BAKTAGenome Explorer: Dialister invisus (GCA_934831285.1)
Select a Genome:
|
BAKTA Annotations for GCA_934831285.1
|
Search & Sort all 3231 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CAKVSM010000118.1 | GCA934831285_01244 | gene | open | 4556-4960 | |||
| 2502 | CAKVSM010000119.1 | GCA934831285_01245 | CDS | open | 110-367 | _na 85_aa | hypothetical protein | |
| 2503 | CAKVSM010000119.1 | GCA934831285_01246 | CDS | open | 620-949 | _na 109_aa | csoR | Copper-sensing transcriptional repressor CsoR |
| 2504 | CAKVSM010000119.1 | GCA934831285_01247 | CDS | open | 1214-1675 | _na 153_aa | bcp | thioredoxin-dependent thiol peroxidase |
| 2505 | CAKVSM010000119.1 | GCA934831285_01248 | CDS | open | 1799-2857 | _na 352_aa | ABC transporter%2C ATP-binding protein | |
| 2506 | CAKVSM010000119.1 | GCA934831285_01249 | CDS | open | 2888-4549 | _na 553_aa | ABC transporter%2C permease protein | |
| 2507 | CAKVSM010000119.1 | GCA934831285_01250 | CDS | open | 4726-4932 | _na 68_aa | hypothetical protein | |
| 2508 | CAKVSM010000119.1 | GCA934831285_01245 | gene | open | 110-367 | |||
| 2509 | CAKVSM010000119.1 | GCA934831285_01246 | gene | open | 620-949 | csoR | ||
| 2510 | CAKVSM010000119.1 | GCA934831285_01247 | gene | open | 1214-1675 | bcp | ||
| 2511 | CAKVSM010000119.1 | GCA934831285_01248 | gene | open | 1799-2857 | |||
| 2512 | CAKVSM010000119.1 | GCA934831285_01249 | gene | open | 2888-4549 | |||
| 2513 | CAKVSM010000119.1 | GCA934831285_01250 | gene | open | 4726-4932 | |||
| 2514 | CAKVSM010000120.1 | GCA934831285_01251 | CDS | open | 634-1884 | _na 416_aa | Tat pathway signal sequence domain protein | |
| 2515 | CAKVSM010000120.1 | GCA934831285_01252 | CDS | open | 1991-3349 | _na 452_aa | Transporter | |
| 2516 | CAKVSM010000120.1 | GCA934831285_01253 | CDS | open | 3400-4755 | _na 451_aa | Transporter | |
| 2517 | CAKVSM010000120.1 | GCA934831285_01251 | gene | open | 634-1884 | |||
| 2518 | CAKVSM010000120.1 | GCA934831285_01252 | gene | open | 1991-3349 | |||
| 2519 | CAKVSM010000120.1 | GCA934831285_01253 | gene | open | 3400-4755 | |||
| 2520 | CAKVSM010000121.1 | GCA934831285_01254 | CDS | open | 848-1393 | _na 181_aa | hypothetical protein | |
| 2521 | CAKVSM010000121.1 | GCA934831285_01255 | CDS | open | 1406-1849 | _na 147_aa | ImmA/IrrE family metallo-endopeptidase | |
| 2522 | CAKVSM010000121.1 | GCA934831285_01256 | CDS | open | 2010-2768 | _na 252_aa | hypothetical protein | |
| 2523 | CAKVSM010000121.1 | GCA934831285_01257 | CDS | open | 2793-3272 | _na 159_aa | helix-turn-helix transcriptional regulator | |
| 2524 | CAKVSM010000121.1 | GCA934831285_01258 | CDS | open | 3418-3606 | _na 62_aa | helix-turn-helix transcriptional regulator | |
| 2525 | CAKVSM010000121.1 | GCA934831285_01259 | CDS | open | 3651-3788 | _na 45_aa | hypothetical protein | |
| 2526 | CAKVSM010000121.1 | GCA934831285_01260 | CDS | open | 3760-3981 | _na 73_aa | hypothetical protein | |
| 2527 | CAKVSM010000121.1 | GCA934831285_01261 | CDS | open | 4070-4381 | _na 103_aa | helix-turn-helix domain-containing protein | |
| 2528 | CAKVSM010000121.1 | GCA934831285_01262 | CDS | open | 4366-4650 | _na 94_aa | lysM | LysM peptidoglycan-binding domain-containing protein |
| 2529 | CAKVSM010000121.1 | GCA934831285_01263 | CDS | open | 4622-4864 | _na 80_aa | hypothetical protein | |
| 2530 | CAKVSM010000121.1 | GCA934831285_01254 | gene | open | 848-1393 | |||
| 2531 | CAKVSM010000121.1 | GCA934831285_01255 | gene | open | 1406-1849 | |||
| 2532 | CAKVSM010000121.1 | GCA934831285_01256 | gene | open | 2010-2768 | |||
| 2533 | CAKVSM010000121.1 | GCA934831285_01257 | gene | open | 2793-3272 | |||
| 2534 | CAKVSM010000121.1 | GCA934831285_01258 | gene | open | 3418-3606 | |||
| 2535 | CAKVSM010000121.1 | GCA934831285_01259 | gene | open | 3651-3788 | |||
| 2536 | CAKVSM010000121.1 | GCA934831285_01260 | gene | open | 3760-3981 | |||
| 2537 | CAKVSM010000121.1 | GCA934831285_01261 | gene | open | 4070-4381 | |||
| 2538 | CAKVSM010000121.1 | GCA934831285_01262 | gene | open | 4366-4650 | lysM | ||
| 2539 | CAKVSM010000121.1 | GCA934831285_01263 | gene | open | 4622-4864 | |||
| 2540 | CAKVSM010000122.1 | GCA934831285_01264 | CDS | open | 161-3361 | _na 1066_aa | cas3f | type I-F CRISPR-associated helicase Cas3f |
| 2541 | CAKVSM010000122.1 | GCA934831285_01265 | CDS | open | 3364-4527 | _na 387_aa | Type I-F CRISPR-associated protein Csy1 | |
| 2542 | CAKVSM010000122.1 | GCA934831285_01264 | gene | open | 161-3361 | cas3f | ||
| 2543 | CAKVSM010000122.1 | GCA934831285_01265 | gene | open | 3364-4527 | |||
| 2544 | CAKVSM010000123.1 | GCA934831285_01269 | gene | open | 2181-2525 | ssrA | ||
| 2545 | CAKVSM010000123.1 | GCA934831285_01269 | tmRNA | open | 2181-2525 | ssrA | transfer-messenger RNA%2C SsrA | |
| 2546 | CAKVSM010000123.1 | GCA934831285_01266 | CDS | open | 160-813 | _na 217_aa | Thiamine-phosphate synthase | |
| 2547 | CAKVSM010000123.1 | GCA934831285_01267 | CDS | open | 803-1615 | _na 270_aa | thiM | hydroxyethylthiazole kinase |
| 2548 | CAKVSM010000123.1 | GCA934831285_01268 | CDS | open | 1726-2046 | _na 106_aa | Thioredoxin | |
| 2549 | CAKVSM010000123.1 | GCA934831285_01270 | CDS | open | 2571-3527 | _na 318_aa | Peptidase family T4 | |
| 2550 | CAKVSM010000123.1 | GCA934831285_01271 | CDS | open | 3527-4453 | _na 308_aa | Pseudouridine synthase | |
| 2551 | CAKVSM010000123.1 | GCA934831285_01272 | CDS | open | 4454-4873 | _na 139_aa | lspA | signal peptidase II |
| 2552 | CAKVSM010000123.1 | GCA934831285_01266 | gene | open | 160-813 | |||
| 2553 | CAKVSM010000123.1 | GCA934831285_01267 | gene | open | 803-1615 | thiM | ||
| 2554 | CAKVSM010000123.1 | GCA934831285_01268 | gene | open | 1726-2046 | |||
| 2555 | CAKVSM010000123.1 | GCA934831285_01270 | gene | open | 2571-3527 | |||
| 2556 | CAKVSM010000123.1 | GCA934831285_01271 | gene | open | 3527-4453 | |||
| 2557 | CAKVSM010000123.1 | GCA934831285_01272 | gene | open | 4454-4873 | lspA | ||
| 2558 | CAKVSM010000124.1 | GCA934831285_01273 | CDS | open | 86-3277 | _na 1063_aa | DNA-directed RNA polymerase subunit beta' | |
| 2559 | CAKVSM010000124.1 | GCA934831285_01274 | CDS | open | 3411-4190 | _na 259_aa | pdaC | Deacetylase PdaC domain-containing protein |
| 2560 | CAKVSM010000124.1 | GCA934831285_01275 | CDS | open | 4601-4765 | _na 54_aa | hypothetical protein | |
| 2561 | CAKVSM010000124.1 | GCA934831285_01273 | gene | open | 86-3277 | |||
| 2562 | CAKVSM010000124.1 | GCA934831285_01274 | gene | open | 3411-4190 | pdaC | ||
| 2563 | CAKVSM010000124.1 | GCA934831285_01275 | gene | open | 4601-4765 | |||
| 2564 | CAKVSM010000125.1 | GCA934831285_01276 | CDS | open | 4-420 | _na 138_aa | hypothetical protein | |
| 2565 | CAKVSM010000125.1 | GCA934831285_01277 | CDS | open | 417-1367 | _na 316_aa | ABC transporter%2C permease protein | |
| 2566 | CAKVSM010000125.1 | GCA934831285_01278 | CDS | open | 1364-2203 | _na 279_aa | ABC transporter%2C permease protein | |
| 2567 | CAKVSM010000125.1 | GCA934831285_01279 | CDS | open | 2206-3144 | _na 312_aa | nikD | Nickel import system ATP-binding protein NikD |
| 2568 | CAKVSM010000125.1 | GCA934831285_01280 | CDS | open | 3141-3905 | _na 254_aa | ABC transporter%2C ATP-binding protein | |
| 2569 | CAKVSM010000125.1 | GCA934831285_01276 | gene | open | 4-420 | |||
| 2570 | CAKVSM010000125.1 | GCA934831285_01277 | gene | open | 417-1367 | |||
| 2571 | CAKVSM010000125.1 | GCA934831285_01278 | gene | open | 1364-2203 | |||
| 2572 | CAKVSM010000125.1 | GCA934831285_01279 | gene | open | 2206-3144 | nikD | ||
| 2573 | CAKVSM010000125.1 | GCA934831285_01280 | gene | open | 3141-3905 | |||
| 2574 | CAKVSM010000126.1 | GCA934831285_01281 | CDS | open | 13-423 | _na 136_aa | VOC family protein | |
| 2575 | CAKVSM010000126.1 | GCA934831285_01282 | CDS | open | 451-1197 | _na 248_aa | Type-4 uracil-DNA glycosylase | |
| 2576 | CAKVSM010000126.1 | GCA934831285_01283 | CDS | open | 1229-2656 | _na 475_aa | dnaB | replicative DNA helicase |
| 2577 | CAKVSM010000126.1 | GCA934831285_01284 | CDS | open | 2669-4585 | _na 638_aa | lonC | Lon family ATP-dependent protease |
| 2578 | CAKVSM010000126.1 | GCA934831285_01281 | gene | open | 13-423 | |||
| 2579 | CAKVSM010000126.1 | GCA934831285_01282 | gene | open | 451-1197 | |||
| 2580 | CAKVSM010000126.1 | GCA934831285_01283 | gene | open | 1229-2656 | dnaB | ||
| 2581 | CAKVSM010000126.1 | GCA934831285_01284 | gene | open | 2669-4585 | lonC | ||
| 2582 | CAKVSM010000127.1 | regulatory_region | open | 3101-3300 | T-box leader | |||
| 2583 | CAKVSM010000127.1 | GCA934831285_01285 | CDS | open | 60-302 | _na 80_aa | hypothetical protein | |
| 2584 | CAKVSM010000127.1 | GCA934831285_01286 | CDS | open | 278-1030 | _na 250_aa | ABC transporter%2C ATP-binding protein | |
| 2585 | CAKVSM010000127.1 | GCA934831285_01287 | CDS | open | 1042-2004 | _na 320_aa | Branched-chain amino acid ABC transporter%2C permease protein | |
| 2586 | CAKVSM010000127.1 | GCA934831285_01288 | CDS | open | 2004-2885 | _na 293_aa | livH | Branched-chain amino acid ABC transporter permease |
| 2587 | CAKVSM010000127.1 | GCA934831285_01289 | CDS | open | 3235-3522 | _na 95_aa | hypothetical protein | |
| 2588 | CAKVSM010000127.1 | GCA934831285_01290 | CDS | open | 3590-4759 | _na 389_aa | IMP dehydrogenase | |
| 2589 | CAKVSM010000127.1 | GCA934831285_01285 | gene | open | 60-302 | |||
| 2590 | CAKVSM010000127.1 | GCA934831285_01286 | gene | open | 278-1030 | |||
| 2591 | CAKVSM010000127.1 | GCA934831285_01287 | gene | open | 1042-2004 | |||
| 2592 | CAKVSM010000127.1 | GCA934831285_01288 | gene | open | 2004-2885 | livH | ||
| 2593 | CAKVSM010000127.1 | GCA934831285_01289 | gene | open | 3235-3522 | |||
| 2594 | CAKVSM010000127.1 | GCA934831285_01290 | gene | open | 3590-4759 | |||
| 2595 | CAKVSM010000128.1 | GCA934831285_01291 | CDS | open | 102-962 | _na 286_aa | S-layer protein | |
| 2596 | CAKVSM010000128.1 | GCA934831285_01292 | CDS | open | 1685-2872 | _na 395_aa | Ribulose bisphosphate carboxylase large chain%2C catalytic domain protein | |
| 2597 | CAKVSM010000128.1 | GCA934831285_01293 | CDS | open | 2891-3862 | _na 323_aa | Glycosyltransferase%2C group 2 family protein | |
| 2598 | CAKVSM010000128.1 | GCA934831285_01294 | CDS | open | 4153-4419 | _na 88_aa | hypothetical protein | |
| 2599 | CAKVSM010000128.1 | GCA934831285_01291 | gene | open | 102-962 | |||
| 2600 | CAKVSM010000128.1 | GCA934831285_01292 | gene | open | 1685-2872 | |||
| 2601 | CAKVSM010000128.1 | GCA934831285_01293 | gene | open | 2891-3862 | |||
| 2602 | CAKVSM010000128.1 | GCA934831285_01294 | gene | open | 4153-4419 | |||
| 2603 | CAKVSM010000129.1 | GCA934831285_01295 | CDS | open | 7-612 | _na 201_aa | aldehyde dehydrogenase family protein | |
| 2604 | CAKVSM010000129.1 | GCA934831285_01296 | CDS | open | 693-1205 | _na 170_aa | Flavin reductase like domain-containing protein | |
| 2605 | CAKVSM010000129.1 | GCA934831285_01297 | CDS | open | 1389-2603 | _na 404_aa | Transporter%2C major facilitator family protein | |
| 2606 | CAKVSM010000129.1 | GCA934831285_01298 | CDS | open | 2713-3567 | _na 284_aa | AB hydrolase-1 domain-containing protein | |
| 2607 | CAKVSM010000129.1 | GCA934831285_01299 | CDS | open | 3612-4604 | _na 330_aa | deoxyguanosinetriphosphate triphosphohydrolase | |
| 2608 | CAKVSM010000129.1 | GCA934831285_01295 | gene | open | 7-612 | |||
| 2609 | CAKVSM010000129.1 | GCA934831285_01296 | gene | open | 693-1205 | |||
| 2610 | CAKVSM010000129.1 | GCA934831285_01297 | gene | open | 1389-2603 | |||
| 2611 | CAKVSM010000129.1 | GCA934831285_01298 | gene | open | 2713-3567 | |||
| 2612 | CAKVSM010000129.1 | GCA934831285_01299 | gene | open | 3612-4604 | |||
| 2613 | CAKVSM010000130.1 | GCA934831285_01300 | CDS | open | 947-1171 | _na 74_aa | hypothetical protein | |
| 2614 | CAKVSM010000130.1 | GCA934831285_01301 | CDS | open | 1257-2048 | _na 263_aa | HEAT repeat protein | |
| 2615 | CAKVSM010000130.1 | GCA934831285_01302 | CDS | open | 2237-2569 | _na 110_aa | azlD | Branched-chain amino acid transport protein AzlD |
| 2616 | CAKVSM010000130.1 | GCA934831285_01303 | CDS | open | 2566-3282 | _na 238_aa | azlC | Putative azaleucine resistance protein AzlC |
| 2617 | CAKVSM010000130.1 | GCA934831285_01304 | CDS | open | 3439-3699 | _na 86_aa | hypothetical protein | |
| 2618 | CAKVSM010000130.1 | GCA934831285_01305 | CDS | open | 3798-4592 | _na 264_aa | FAD-dependent oxidoreductase | |
| 2619 | CAKVSM010000130.1 | GCA934831285_01300 | gene | open | 947-1171 | |||
| 2620 | CAKVSM010000130.1 | GCA934831285_01301 | gene | open | 1257-2048 | |||
| 2621 | CAKVSM010000130.1 | GCA934831285_01302 | gene | open | 2237-2569 | azlD | ||
| 2622 | CAKVSM010000130.1 | GCA934831285_01303 | gene | open | 2566-3282 | azlC | ||
| 2623 | CAKVSM010000130.1 | GCA934831285_01304 | gene | open | 3439-3699 | |||
| 2624 | CAKVSM010000130.1 | GCA934831285_01305 | gene | open | 3798-4592 | |||
| 2625 | CAKVSM010000131.1 | GCA934831285_01306 | CDS | open | 38-1408 | _na 456_aa | Polyribonucleotide nucleotidyltransferase | |
| 2626 | CAKVSM010000131.1 | GCA934831285_01307 | CDS | open | 1431-2129 | _na 232_aa | Polyribonucleotide nucleotidyltransferase | |
| 2627 | CAKVSM010000131.1 | GCA934831285_01308 | CDS | open | 2130-2555 | _na 141_aa | dUTP diphosphatase | |
| 2628 | CAKVSM010000131.1 | GCA934831285_01309 | CDS | open | 2552-3079 | _na 175_aa | Hydrolase%2C NUDIX family | |
| 2629 | CAKVSM010000131.1 | GCA934831285_01310 | CDS | open | 3180-4523 | _na 447_aa | mtaB | tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB |
| 2630 | CAKVSM010000131.1 | GCA934831285_01306 | gene | open | 38-1408 | |||
| 2631 | CAKVSM010000131.1 | GCA934831285_01307 | gene | open | 1431-2129 | |||
| 2632 | CAKVSM010000131.1 | GCA934831285_01308 | gene | open | 2130-2555 | |||
| 2633 | CAKVSM010000131.1 | GCA934831285_01309 | gene | open | 2552-3079 | |||
| 2634 | CAKVSM010000131.1 | GCA934831285_01310 | gene | open | 3180-4523 | mtaB | ||
| 2635 | CAKVSM010000132.1 | GCA934831285_01311 | CDS | open | 143-1108 | _na 321_aa | glpX | class II fructose-bisphosphatase |
| 2636 | CAKVSM010000132.1 | GCA934831285_01312 | CDS | open | 1302-1886 | _na 194_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 2637 | CAKVSM010000132.1 | GCA934831285_01313 | CDS | open | 1964-2737 | _na 257_aa | tatD | Hydrolase%2C TatD family |
| 2638 | CAKVSM010000132.1 | GCA934831285_01314 | CDS | open | 2737-4563 | _na 608_aa | metG | methionine--tRNA ligase |
| 2639 | CAKVSM010000132.1 | GCA934831285_01311 | gene | open | 143-1108 | glpX | ||
| 2640 | CAKVSM010000132.1 | GCA934831285_01312 | gene | open | 1302-1886 | |||
| 2641 | CAKVSM010000132.1 | GCA934831285_01313 | gene | open | 1964-2737 | tatD | ||
| 2642 | CAKVSM010000132.1 | GCA934831285_01314 | gene | open | 2737-4563 | metG | ||
| 2643 | CAKVSM010000133.1 | GCA934831285_01315 | CDS | open | 90-1205 | _na 371_aa | rodA | rod shape-determining protein RodA |
| 2644 | CAKVSM010000133.1 | GCA934831285_01316 | CDS | open | 1209-2063 | _na 284_aa | CobQ/CobB/MinD/ParA nucleotide binding domain protein | |
| 2645 | CAKVSM010000133.1 | GCA934831285_01317 | CDS | open | 2066-3937 | _na 623_aa | mrdA | penicillin-binding protein 2 |
| 2646 | CAKVSM010000133.1 | GCA934831285_01318 | CDS | open | 3931-4422 | _na 163_aa | mreD | rod shape-determining protein MreD |
| 2647 | CAKVSM010000133.1 | GCA934831285_01315 | gene | open | 90-1205 | rodA | ||
| 2648 | CAKVSM010000133.1 | GCA934831285_01316 | gene | open | 1209-2063 | |||
| 2649 | CAKVSM010000133.1 | GCA934831285_01317 | gene | open | 2066-3937 | mrdA | ||
| 2650 | CAKVSM010000133.1 | GCA934831285_01318 | gene | open | 3931-4422 | mreD | ||
| 2651 | CAKVSM010000134.1 | GCA934831285_01319 | CDS | open | 113-313 | _na 66_aa | hypothetical protein | |
| 2652 | CAKVSM010000134.1 | GCA934831285_01320 | CDS | open | 386-1075 | _na 229_aa | hypothetical protein | |
| 2653 | CAKVSM010000134.1 | GCA934831285_01321 | CDS | open | 1835-2524 | _na 229_aa | hypothetical protein | |
| 2654 | CAKVSM010000134.1 | GCA934831285_01322 | CDS | open | 3284-3715 | _na 143_aa | hypothetical protein | |
| 2655 | CAKVSM010000134.1 | GCA934831285_01323 | CDS | open | 3875-4024 | _na 49_aa | hypothetical protein | |
| 2656 | CAKVSM010000134.1 | GCA934831285_01319 | gene | open | 113-313 | |||
| 2657 | CAKVSM010000134.1 | GCA934831285_01320 | gene | open | 386-1075 | |||
| 2658 | CAKVSM010000134.1 | GCA934831285_01321 | gene | open | 1835-2524 | |||
| 2659 | CAKVSM010000134.1 | GCA934831285_01322 | gene | open | 3284-3715 | |||
| 2660 | CAKVSM010000134.1 | GCA934831285_01323 | gene | open | 3875-4024 | |||
| 2661 | CAKVSM010000135.1 | GCA934831285_01324 | CDS | open | 38-772 | _na 244_aa | FAD-binding protein | |
| 2662 | CAKVSM010000135.1 | GCA934831285_01325 | CDS | open | 762-1472 | _na 236_aa | succinate dehydrogenase | |
| 2663 | CAKVSM010000135.1 | GCA934831285_01326 | CDS | open | 1469-2473 | _na 334_aa | FAD:protein FMN transferase | |
| 2664 | CAKVSM010000135.1 | GCA934831285_01327 | CDS | open | 2480-2842 | _na 120_aa | nusG | NusG domain-containing protein |
| 2665 | CAKVSM010000135.1 | GCA934831285_01328 | CDS | open | 2855-3346 | _na 163_aa | Heptaprenyl diphosphate synthase component I | |
| 2666 | CAKVSM010000135.1 | GCA934831285_01329 | CDS | open | 3601-4179 | _na 192_aa | hypothetical protein | |
| 2667 | CAKVSM010000135.1 | GCA934831285_01324 | gene | open | 38-772 | |||
| 2668 | CAKVSM010000135.1 | GCA934831285_01325 | gene | open | 762-1472 | |||
| 2669 | CAKVSM010000135.1 | GCA934831285_01326 | gene | open | 1469-2473 | |||
| 2670 | CAKVSM010000135.1 | GCA934831285_01327 | gene | open | 2480-2842 | nusG | ||
| 2671 | CAKVSM010000135.1 | GCA934831285_01328 | gene | open | 2855-3346 | |||
| 2672 | CAKVSM010000135.1 | GCA934831285_01329 | gene | open | 3601-4179 | |||
| 2673 | CAKVSM010000136.1 | GCA934831285_01330 | CDS | open | 59-1747 | _na 562_aa | glutamine--tRNA ligase/YqeY domain fusion protein | |
| 2674 | CAKVSM010000136.1 | GCA934831285_01331 | CDS | open | 1756-2415 | _na 219_aa | Secreted protein | |
| 2675 | CAKVSM010000136.1 | GCA934831285_01332 | CDS | open | 2529-2957 | _na 142_aa | flavodoxin | |
| 2676 | CAKVSM010000136.1 | GCA934831285_01333 | CDS | open | 3017-3451 | _na 144_aa | Flavodoxin domain-containing protein | |
| 2677 | CAKVSM010000136.1 | GCA934831285_01330 | gene | open | 59-1747 | |||
| 2678 | CAKVSM010000136.1 | GCA934831285_01331 | gene | open | 1756-2415 | |||
| 2679 | CAKVSM010000136.1 | GCA934831285_01332 | gene | open | 2529-2957 | |||
| 2680 | CAKVSM010000136.1 | GCA934831285_01333 | gene | open | 3017-3451 | |||
| 2681 | CAKVSM010000137.1 | repeat_region | open | 28-449 | CRISPR array with 7 repeats of length 28%2C consensus sequence GTTATCTGCCGTATAGGCAGCTTAGAAA and spacer length 32 | |||
| 2682 | CAKVSM010000137.1 | GCA934831285_01334 | CDS | open | 641-1261 | _na 206_aa | RelA/SpoT domain protein | |
| 2683 | CAKVSM010000137.1 | GCA934831285_01335 | CDS | open | 1258-1932 | _na 224_aa | Response regulator receiver domain protein | |
| 2684 | CAKVSM010000137.1 | GCA934831285_01336 | CDS | open | 1961-3223 | _na 420_aa | histidine kinase | |
| 2685 | CAKVSM010000137.1 | GCA934831285_01334 | gene | open | 641-1261 | |||
| 2686 | CAKVSM010000137.1 | GCA934831285_01335 | gene | open | 1258-1932 | |||
| 2687 | CAKVSM010000137.1 | GCA934831285_01336 | gene | open | 1961-3223 | |||
| 2688 | CAKVSM010000138.1 | GCA934831285_01337 | CDS | open | 1005-2015 | _na 336_aa | TRAP transporter solute receptor%2C TAXI family | |
| 2689 | CAKVSM010000138.1 | GCA934831285_01338 | CDS | open | 2082-3653 | _na 523_aa | TRAP transporter%2C 4TM/12TM fusion protein | |
| 2690 | CAKVSM010000138.1 | GCA934831285_01339 | CDS | open | 3632-4123 | _na 163_aa | hypothetical protein | |
| 2691 | CAKVSM010000138.1 | GCA934831285_01337 | gene | open | 1005-2015 | |||
| 2692 | CAKVSM010000138.1 | GCA934831285_01338 | gene | open | 2082-3653 | |||
| 2693 | CAKVSM010000138.1 | GCA934831285_01339 | gene | open | 3632-4123 | |||
| 2694 | CAKVSM010000139.1 | GCA934831285_01340 | CDS | open | 426-977 | _na 183_aa | hypothetical protein | |
| 2695 | CAKVSM010000139.1 | GCA934831285_01341 | CDS | open | 1426-2073 | _na 215_aa | Peptidase family S51 | |
| 2696 | CAKVSM010000139.1 | GCA934831285_01342 | CDS | open | 2073-2672 | _na 199_aa | Alpha/beta hydrolase | |
| 2697 | CAKVSM010000139.1 | GCA934831285_01343 | CDS | open | 2763-3536 | _na 257_aa | tatD | Hydrolase%2C TatD family |
| 2698 | CAKVSM010000139.1 | GCA934831285_01344 | CDS | open | 3908-4207 | _na 99_aa | hypothetical protein | |
| 2699 | CAKVSM010000139.1 | GCA934831285_01340 | gene | open | 426-977 | |||
| 2700 | CAKVSM010000139.1 | GCA934831285_01341 | gene | open | 1426-2073 | |||
| 2701 | CAKVSM010000139.1 | GCA934831285_01342 | gene | open | 2073-2672 | |||
| 2702 | CAKVSM010000139.1 | GCA934831285_01343 | gene | open | 2763-3536 | tatD | ||
| 2703 | CAKVSM010000139.1 | GCA934831285_01344 | gene | open | 3908-4207 | |||
| 2704 | CAKVSM010000140.1 | GCA934831285_01345 | CDS | open | 89-802 | _na 237_aa | ABC transporter%2C ATP-binding protein | |
| 2705 | CAKVSM010000140.1 | GCA934831285_01346 | CDS | open | 803-2005 | _na 400_aa | hrtB | Putative hemin transport system permease protein HrtB |
| 2706 | CAKVSM010000140.1 | GCA934831285_01347 | CDS | open | 1995-2414 | _na 139_aa | DUF4418 domain-containing protein | |
| 2707 | CAKVSM010000140.1 | GCA934831285_01348 | CDS | open | 2590-3984 | _na 464_aa | mnmE | tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE |
| 2708 | CAKVSM010000140.1 | GCA934831285_01345 | gene | open | 89-802 | |||
| 2709 | CAKVSM010000140.1 | GCA934831285_01346 | gene | open | 803-2005 | hrtB | ||
| 2710 | CAKVSM010000140.1 | GCA934831285_01347 | gene | open | 1995-2414 | |||
| 2711 | CAKVSM010000140.1 | GCA934831285_01348 | gene | open | 2590-3984 | mnmE | ||
| 2712 | CAKVSM010000141.1 | GCA934831285_01349 | CDS | open | 74-232 | _na 52_aa | hypothetical protein | |
| 2713 | CAKVSM010000141.1 | GCA934831285_01350 | CDS | open | 429-1406 | _na 325_aa | C4-dicarboxylate ABC transporter substrate-binding protein | |
| 2714 | CAKVSM010000141.1 | GCA934831285_01351 | CDS | open | 1547-2074 | _na 175_aa | DUF1850 domain-containing protein | |
| 2715 | CAKVSM010000141.1 | GCA934831285_01352 | CDS | open | 2080-4038 | _na 652_aa | TRAP transporter%2C 4TM/12TM fusion protein | |
| 2716 | CAKVSM010000141.1 | GCA934831285_01349 | gene | open | 74-232 | |||
| 2717 | CAKVSM010000141.1 | GCA934831285_01350 | gene | open | 429-1406 | |||
| 2718 | CAKVSM010000141.1 | GCA934831285_01351 | gene | open | 1547-2074 | |||
| 2719 | CAKVSM010000141.1 | GCA934831285_01352 | gene | open | 2080-4038 | |||
| 2720 | CAKVSM010000142.1 | GCA934831285_01353 | CDS | open | 439-1227 | _na 262_aa | hypothetical protein | |
| 2721 | CAKVSM010000142.1 | GCA934831285_01354 | CDS | open | 2025-2204 | _na 59_aa | hypothetical protein | |
| 2722 | CAKVSM010000142.1 | GCA934831285_01355 | CDS | open | 2285-2983 | _na 232_aa | hypothetical protein | |
| 2723 | CAKVSM010000142.1 | GCA934831285_01356 | CDS | open | 3006-3977 | _na 323_aa | S-layer-like y domain-containing protein | |
| 2724 | CAKVSM010000142.1 | GCA934831285_01353 | gene | open | 439-1227 | |||
| 2725 | CAKVSM010000142.1 | GCA934831285_01354 | gene | open | 2025-2204 | |||
| 2726 | CAKVSM010000142.1 | GCA934831285_01355 | gene | open | 2285-2983 | |||
| 2727 | CAKVSM010000142.1 | GCA934831285_01356 | gene | open | 3006-3977 | |||
| 2728 | CAKVSM010000143.1 | GCA934831285_01357 | CDS | open | 43-600 | _na 185_aa | radical SAM protein | |
| 2729 | CAKVSM010000143.1 | GCA934831285_01358 | CDS | open | 603-1016 | _na 137_aa | Surface-adhesin protein E-like domain-containing protein | |
| 2730 | CAKVSM010000143.1 | GCA934831285_01359 | CDS | open | 1194-1940 | _na 248_aa | nikM | Nickel transport complex%2C NikM subunit%2C transmembrane |
| 2731 | CAKVSM010000143.1 | GCA934831285_01360 | CDS | open | 2654-3289 | _na 211_aa | hypothetical protein | |
| 2732 | CAKVSM010000143.1 | GCA934831285_01361 | CDS | open | 3335-3562 | _na 75_aa | hypothetical protein | |
| 2733 | CAKVSM010000143.1 | GCA934831285_01357 | gene | open | 43-600 | |||
| 2734 | CAKVSM010000143.1 | GCA934831285_01358 | gene | open | 603-1016 | |||
| 2735 | CAKVSM010000143.1 | GCA934831285_01359 | gene | open | 1194-1940 | nikM | ||
| 2736 | CAKVSM010000143.1 | GCA934831285_01360 | gene | open | 2654-3289 | |||
| 2737 | CAKVSM010000143.1 | GCA934831285_01361 | gene | open | 3335-3562 | |||
| 2738 | CAKVSM010000144.1 | GCA934831285_01362 | CDS | open | 880-1008 | _na 42_aa | hypothetical protein | |
| 2739 | CAKVSM010000144.1 | GCA934831285_01363 | CDS | open | 1702-3957 | _na 751_aa | autotransporter outer membrane beta-barrel domain-containing protein | |
| 2740 | CAKVSM010000144.1 | GCA934831285_01362 | gene | open | 880-1008 | |||
| 2741 | CAKVSM010000144.1 | GCA934831285_01363 | gene | open | 1702-3957 | |||
| 2742 | CAKVSM010000145.1 | GCA934831285_01364 | CDS | open | 254-1138 | _na 294_aa | GHMP kinase%2C N-terminal domain protein | |
| 2743 | CAKVSM010000145.1 | GCA934831285_01365 | CDS | open | 1126-1875 | _na 249_aa | cobS | adenosylcobinamide-GDP ribazoletransferase |
| 2744 | CAKVSM010000145.1 | GCA934831285_01366 | CDS | open | 1880-2851 | _na 323_aa | cbiB | adenosylcobinamide-phosphate synthase CbiB |
| 2745 | CAKVSM010000145.1 | GCA934831285_01367 | CDS | open | 2848-3963 | _na 371_aa | cobQ | CobQ |
| 2746 | CAKVSM010000145.1 | GCA934831285_01364 | gene | open | 254-1138 | |||
| 2747 | CAKVSM010000145.1 | GCA934831285_01365 | gene | open | 1126-1875 | cobS | ||
| 2748 | CAKVSM010000145.1 | GCA934831285_01366 | gene | open | 1880-2851 | cbiB | ||
| 2749 | CAKVSM010000145.1 | GCA934831285_01367 | gene | open | 2848-3963 | cobQ | ||
| 2750 | CAKVSM010000146.1 | GCA934831285_01368 | CDS | open | 200-1411 | _na 403_aa | Malic enzyme%2C NAD binding domain protein | |
| 2751 | CAKVSM010000146.1 | GCA934831285_01369 | CDS | open | 1562-2155 | _na 197_aa | XTP/dITP diphosphatase | |
| 2752 | CAKVSM010000146.1 | GCA934831285_01370 | CDS | open | 2181-3659 | _na 492_aa | Type I restriction modification DNA specificity domain-containing protein | |
| 2753 | CAKVSM010000146.1 | GCA934831285_01368 | gene | open | 200-1411 | |||
| 2754 | CAKVSM010000146.1 | GCA934831285_01369 | gene | open | 1562-2155 | |||
| 2755 | CAKVSM010000146.1 | GCA934831285_01370 | gene | open | 2181-3659 | |||
| 2756 | CAKVSM010000147.1 | GCA934831285_01371 | CDS | open | 90-254 | _na 54_aa | hypothetical protein | |
| 2757 | CAKVSM010000147.1 | GCA934831285_01372 | CDS | open | 1017-1328 | _na 103_aa | hypothetical protein | |
| 2758 | CAKVSM010000147.1 | GCA934831285_01373 | CDS | open | 1644-2141 | _na 165_aa | Prepilin-type cleavage/methylation domain-containing protein | |
| 2759 | CAKVSM010000147.1 | GCA934831285_01374 | CDS | open | 2086-2715 | _na 209_aa | Prepilin type IV endopeptidase peptidase domain-containing protein | |
| 2760 | CAKVSM010000147.1 | GCA934831285_01375 | CDS | open | 2850-3569 | _na 239_aa | Protein kinase domain-containing protein | |
| 2761 | CAKVSM010000147.1 | GCA934831285_01371 | gene | open | 90-254 | |||
| 2762 | CAKVSM010000147.1 | GCA934831285_01372 | gene | open | 1017-1328 | |||
| 2763 | CAKVSM010000147.1 | GCA934831285_01373 | gene | open | 1644-2141 | |||
| 2764 | CAKVSM010000147.1 | GCA934831285_01374 | gene | open | 2086-2715 | |||
| 2765 | CAKVSM010000147.1 | GCA934831285_01375 | gene | open | 2850-3569 | |||
| 2766 | CAKVSM010000148.1 | GCA934831285_01376 | CDS | open | 348-1610 | _na 420_aa | SGNH hydrolase-type esterase domain-containing protein | |
| 2767 | CAKVSM010000148.1 | GCA934831285_01377 | CDS | open | 1786-3054 | _na 422_aa | ADP-ribosylglycohydrolase | |
| 2768 | CAKVSM010000148.1 | GCA934831285_01378 | CDS | open | 3055-3261 | _na 68_aa | hypothetical protein | |
| 2769 | CAKVSM010000148.1 | GCA934831285_01379 | CDS | open | 3412-3879 | _na 155_aa | hypothetical protein | |
| 2770 | CAKVSM010000148.1 | GCA934831285_01376 | gene | open | 348-1610 | |||
| 2771 | CAKVSM010000148.1 | GCA934831285_01377 | gene | open | 1786-3054 | |||
| 2772 | CAKVSM010000148.1 | GCA934831285_01378 | gene | open | 3055-3261 | |||
| 2773 | CAKVSM010000148.1 | GCA934831285_01379 | gene | open | 3412-3879 | |||
| 2774 | CAKVSM010000149.1 | GCA934831285_01380 | CDS | open | 241-759 | _na 172_aa | infC | translation initiation factor IF-3 |
| 2775 | CAKVSM010000149.1 | GCA934831285_01381 | CDS | open | 776-973 | _na 65_aa | rpmI | 50S ribosomal protein L35 |
| 2776 | CAKVSM010000149.1 | GCA934831285_01382 | CDS | open | 991-1341 | _na 116_aa | rplT | 50S ribosomal protein L20 |
| 2777 | CAKVSM010000149.1 | GCA934831285_01383 | CDS | open | 1472-2404 | _na 310_aa | fba | class II fructose-1%2C6-bisphosphate aldolase |
| 2778 | CAKVSM010000149.1 | GCA934831285_01384 | CDS | open | 2670-3161 | _na 163_aa | yajQ | YajQ family cyclic di-GMP-binding protein |
| 2779 | CAKVSM010000149.1 | GCA934831285_01380 | gene | open | 241-759 | infC | ||
| 2780 | CAKVSM010000149.1 | GCA934831285_01381 | gene | open | 776-973 | rpmI | ||
| 2781 | CAKVSM010000149.1 | GCA934831285_01382 | gene | open | 991-1341 | rplT | ||
| 2782 | CAKVSM010000149.1 | GCA934831285_01383 | gene | open | 1472-2404 | fba | ||
| 2783 | CAKVSM010000149.1 | GCA934831285_01384 | gene | open | 2670-3161 | yajQ | ||
| 2784 | CAKVSM010000150.1 | GCA934831285_01385 | CDS | open | 26-577 | _na 183_aa | HD domain-containing protein | |
| 2785 | CAKVSM010000150.1 | GCA934831285_01386 | CDS | open | 564-2552 | _na 662_aa | Penicillin-binding protein%2C transpeptidase domain protein | |
| 2786 | CAKVSM010000150.1 | GCA934831285_01387 | CDS | open | 2852-3517 | _na 221_aa | hypothetical protein | |
| 2787 | CAKVSM010000150.1 | GCA934831285_01385 | gene | open | 26-577 | |||
| 2788 | CAKVSM010000150.1 | GCA934831285_01386 | gene | open | 564-2552 | |||
| 2789 | CAKVSM010000150.1 | GCA934831285_01387 | gene | open | 2852-3517 | |||
| 2790 | CAKVSM010000151.1 | GCA934831285_01388 | CDS | open | 296-838 | _na 180_aa | hypothetical protein | |
| 2791 | CAKVSM010000151.1 | GCA934831285_01389 | CDS | open | 1193-3367 | _na 724_aa | TonB-dependent siderophore receptor | |
| 2792 | CAKVSM010000151.1 | GCA934831285_01388 | gene | open | 296-838 | |||
| 2793 | CAKVSM010000151.1 | GCA934831285_01389 | gene | open | 1193-3367 | |||
| 2794 | CAKVSM010000152.1 | GCA934831285_01390 | CDS | open | 3-1190 | _na 395_aa | ABC transporter ATP-binding protein | |
| 2795 | CAKVSM010000152.1 | GCA934831285_01391 | CDS | open | 1187-2311 | _na 374_aa | ABC transmembrane type-2 domain-containing protein | |
| 2796 | CAKVSM010000152.1 | GCA934831285_01392 | CDS | open | 2311-3426 | _na 371_aa | Transport permease protein | |
| 2797 | CAKVSM010000152.1 | GCA934831285_01393 | CDS | open | 3407-3712 | _na 101_aa | hypothetical protein | |
| 2798 | CAKVSM010000152.1 | GCA934831285_01390 | gene | open | 3-1190 | |||
| 2799 | CAKVSM010000152.1 | GCA934831285_01391 | gene | open | 1187-2311 | |||
| 2800 | CAKVSM010000152.1 | GCA934831285_01392 | gene | open | 2311-3426 | |||
| 2801 | CAKVSM010000152.1 | GCA934831285_01393 | gene | open | 3407-3712 | |||
| 2802 | CAKVSM010000153.1 | GCA934831285_01394 | CDS | open | 378-2282 | _na 634_aa | NADH-ubiquinone/plastoquinone (Complex I) family protein | |
| 2803 | CAKVSM010000153.1 | GCA934831285_01395 | CDS | open | 2818-3738 | _na 306_aa | ABC transporter%2C ATP-binding protein | |
| 2804 | CAKVSM010000153.1 | GCA934831285_01394 | gene | open | 378-2282 | |||
| 2805 | CAKVSM010000153.1 | GCA934831285_01395 | gene | open | 2818-3738 | |||
| 2806 | CAKVSM010000154.1 | GCA934831285_01396 | CDS | open | 125-703 | _na 192_aa | hypothetical protein | |
| 2807 | CAKVSM010000154.1 | GCA934831285_01397 | CDS | open | 1138-1878 | _na 246_aa | hypothetical protein | |
| 2808 | CAKVSM010000154.1 | GCA934831285_01398 | CDS | open | 1963-2709 | _na 248_aa | hypothetical protein | |
| 2809 | CAKVSM010000154.1 | GCA934831285_01399 | CDS | open | 2874-3461 | _na 195_aa | hypothetical protein | |
| 2810 | CAKVSM010000154.1 | GCA934831285_01396 | gene | open | 125-703 | |||
| 2811 | CAKVSM010000154.1 | GCA934831285_01397 | gene | open | 1138-1878 | |||
| 2812 | CAKVSM010000154.1 | GCA934831285_01398 | gene | open | 1963-2709 | |||
| 2813 | CAKVSM010000154.1 | GCA934831285_01399 | gene | open | 2874-3461 | |||
| 2814 | CAKVSM010000155.1 | GCA934831285_01400 | CDS | open | 5-550 | _na 181_aa | hypothetical protein | |
| 2815 | CAKVSM010000155.1 | GCA934831285_01401 | CDS | open | 706-1437 | _na 243_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 2816 | CAKVSM010000155.1 | GCA934831285_01402 | CDS | open | 1434-2021 | _na 195_aa | pyrE | orotate phosphoribosyltransferase |
| 2817 | CAKVSM010000155.1 | GCA934831285_01403 | CDS | open | 2174-3229 | _na 351_aa | Oxidoreductase%2C 2-nitropropane dioxygenase family protein | |
| 2818 | CAKVSM010000155.1 | GCA934831285_01400 | gene | open | 5-550 | |||
| 2819 | CAKVSM010000155.1 | GCA934831285_01401 | gene | open | 706-1437 | pyrF | ||
| 2820 | CAKVSM010000155.1 | GCA934831285_01402 | gene | open | 1434-2021 | pyrE | ||
| 2821 | CAKVSM010000155.1 | GCA934831285_01403 | gene | open | 2174-3229 | |||
| 2822 | CAKVSM010000156.1 | GCA934831285_01404 | CDS | open | 32-820 | _na 262_aa | biotin synthase | |
| 2823 | CAKVSM010000156.1 | GCA934831285_01405 | CDS | open | 822-1565 | _na 247_aa | DUF4130 domain-containing protein | |
| 2824 | CAKVSM010000156.1 | GCA934831285_01406 | CDS | open | 1774-2265 | _na 163_aa | Flavodoxin-like domain-containing protein | |
| 2825 | CAKVSM010000156.1 | GCA934831285_01407 | CDS | open | 2285-2770 | _na 161_aa | Flavodoxin-like domain-containing protein | |
| 2826 | CAKVSM010000156.1 | GCA934831285_01408 | CDS | open | 2784-3332 | _na 182_aa | fibronectin type III domain-containing protein | |
| 2827 | CAKVSM010000156.1 | GCA934831285_01404 | gene | open | 32-820 | |||
| 2828 | CAKVSM010000156.1 | GCA934831285_01405 | gene | open | 822-1565 | |||
| 2829 | CAKVSM010000156.1 | GCA934831285_01406 | gene | open | 1774-2265 | |||
| 2830 | CAKVSM010000156.1 | GCA934831285_01407 | gene | open | 2285-2770 | |||
| 2831 | CAKVSM010000156.1 | GCA934831285_01408 | gene | open | 2784-3332 | |||
| 2832 | CAKVSM010000157.1 | GCA934831285_01409 | CDS | open | 32-2353 | _na 773_aa | uvrA | excinuclease ABC subunit UvrA |
| 2833 | CAKVSM010000157.1 | GCA934831285_01409 | gene | open | 32-2353 | uvrA | ||
| 2834 | CAKVSM010000158.1 | GCA934831285_01410 | CDS | open | 147-1181 | _na 344_aa | Cell shape determining protein%2C MreB/Mrl family | |
| 2835 | CAKVSM010000158.1 | GCA934831285_01411 | CDS | open | 1522-2511 | _na 329_aa | Cobalt chelatase (CbiK) | |
| 2836 | CAKVSM010000158.1 | GCA934831285_01412 | CDS | open | 2614-3543 | _na 309_aa | Periplasmic binding protein | |
| 2837 | CAKVSM010000158.1 | GCA934831285_01410 | gene | open | 147-1181 | |||
| 2838 | CAKVSM010000158.1 | GCA934831285_01411 | gene | open | 1522-2511 | |||
| 2839 | CAKVSM010000158.1 | GCA934831285_01412 | gene | open | 2614-3543 | |||
| 2840 | CAKVSM010000159.1 | GCA934831285_01413 | CDS | open | 21-488 | _na 155_aa | cbiT | Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit |
| 2841 | CAKVSM010000159.1 | GCA934831285_01414 | CDS | open | 490-1266 | _na 258_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 2842 | CAKVSM010000159.1 | GCA934831285_01415 | CDS | open | 1263-2324 | _na 353_aa | Cobalt-precorrin 5A hydrolase | |
| 2843 | CAKVSM010000159.1 | GCA934831285_01416 | CDS | open | 2354-3043 | _na 229_aa | Precorrin-3B C(17)-methyltransferase | |
| 2844 | CAKVSM010000159.1 | GCA934831285_01413 | gene | open | 21-488 | cbiT | ||
| 2845 | CAKVSM010000159.1 | GCA934831285_01414 | gene | open | 490-1266 | cobM | ||
| 2846 | CAKVSM010000159.1 | GCA934831285_01415 | gene | open | 1263-2324 | |||
| 2847 | CAKVSM010000159.1 | GCA934831285_01416 | gene | open | 2354-3043 | |||
| 2848 | CAKVSM010000160.1 | GCA934831285_01417 | CDS | open | 206-826 | _na 206_aa | DivIVA domain protein | |
| 2849 | CAKVSM010000160.1 | GCA934831285_01418 | CDS | open | 864-1655 | _na 263_aa | S4 domain protein | |
| 2850 | CAKVSM010000160.1 | GCA934831285_01419 | CDS | open | 1655-2449 | _na 264_aa | proC | pyrroline-5-carboxylate reductase |
| 2851 | CAKVSM010000160.1 | GCA934831285_01420 | CDS | open | 2446-2880 | _na 144_aa | sepF | Cell division protein SepF |
| 2852 | CAKVSM010000160.1 | GCA934831285_01421 | CDS | open | 2880-3335 | _na 151_aa | sepF | Cell division protein SepF |
| 2853 | CAKVSM010000160.1 | GCA934831285_01417 | gene | open | 206-826 | |||
| 2854 | CAKVSM010000160.1 | GCA934831285_01418 | gene | open | 864-1655 | |||
| 2855 | CAKVSM010000160.1 | GCA934831285_01419 | gene | open | 1655-2449 | proC | ||
| 2856 | CAKVSM010000160.1 | GCA934831285_01420 | gene | open | 2446-2880 | sepF | ||
| 2857 | CAKVSM010000160.1 | GCA934831285_01421 | gene | open | 2880-3335 | sepF | ||
| 2858 | CAKVSM010000161.1 | GCA934831285_01422 | CDS | open | 205-1023 | _na 272_aa | ABC transporter%2C permease protein | |
| 2859 | CAKVSM010000161.1 | GCA934831285_01423 | CDS | open | 1004-1861 | _na 285_aa | ABC transporter%2C permease protein | |
| 2860 | CAKVSM010000161.1 | GCA934831285_01424 | CDS | open | 1858-2709 | _na 283_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 2861 | CAKVSM010000161.1 | GCA934831285_01425 | CDS | open | 2803-3138 | _na 111_aa | hypothetical protein | |
| 2862 | CAKVSM010000161.1 | GCA934831285_01426 | CDS | open | 3164-3298 | _na 44_aa | hypothetical protein | |
| 2863 | CAKVSM010000161.1 | GCA934831285_01422 | gene | open | 205-1023 | |||
| 2864 | CAKVSM010000161.1 | GCA934831285_01423 | gene | open | 1004-1861 | |||
| 2865 | CAKVSM010000161.1 | GCA934831285_01424 | gene | open | 1858-2709 | potA | ||
| 2866 | CAKVSM010000161.1 | GCA934831285_01425 | gene | open | 2803-3138 | |||
| 2867 | CAKVSM010000161.1 | GCA934831285_01426 | gene | open | 3164-3298 | |||
| 2868 | CAKVSM010000162.1 | GCA934831285_01427 | CDS | open | 394-762 | _na 122_aa | Aldoketomutase | |
| 2869 | CAKVSM010000162.1 | GCA934831285_01428 | CDS | open | 764-1471 | _na 235_aa | thiF | ThiF family protein |
| 2870 | CAKVSM010000162.1 | GCA934831285_01429 | CDS | open | 1570-2178 | _na 202_aa | Peptidase C39-like domain-containing protein | |
| 2871 | CAKVSM010000162.1 | GCA934831285_01430 | CDS | open | 2132-2683 | _na 183_aa | hypothetical protein | |
| 2872 | CAKVSM010000162.1 | GCA934831285_01431 | CDS | open | 2747-3304 | _na 185_aa | Zinc ribbon domain-containing protein | |
| 2873 | CAKVSM010000162.1 | GCA934831285_01427 | gene | open | 394-762 | |||
| 2874 | CAKVSM010000162.1 | GCA934831285_01428 | gene | open | 764-1471 | thiF | ||
| 2875 | CAKVSM010000162.1 | GCA934831285_01429 | gene | open | 1570-2178 | |||
| 2876 | CAKVSM010000162.1 | GCA934831285_01430 | gene | open | 2132-2683 | |||
| 2877 | CAKVSM010000162.1 | GCA934831285_01431 | gene | open | 2747-3304 | |||
| 2878 | CAKVSM010000163.1 | GCA934831285_01432 | CDS | open | 49-858 | _na 269_aa | Chitin deacetylase | |
| 2879 | CAKVSM010000163.1 | GCA934831285_01433 | CDS | open | 859-1935 | _na 358_aa | Glycosyltransferase family 4 protein | |
| 2880 | CAKVSM010000163.1 | GCA934831285_01434 | CDS | open | 2367-3260 | _na 297_aa | Oxidoreductase%2C aldo/keto reductase family protein | |
| 2881 | CAKVSM010000163.1 | GCA934831285_01432 | gene | open | 49-858 | |||
| 2882 | CAKVSM010000163.1 | GCA934831285_01433 | gene | open | 859-1935 | |||
| 2883 | CAKVSM010000163.1 | GCA934831285_01434 | gene | open | 2367-3260 | |||
| 2884 | CAKVSM010000164.1 | regulatory_region | open | 1977-2062 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 2885 | CAKVSM010000164.1 | GCA934831285_01435 | CDS | open | 67-1818 | _na 583_aa | TonB-dependent receptor plug domain protein | |
| 2886 | CAKVSM010000164.1 | GCA934831285_01436 | CDS | open | 1837-1956 | _na 39_aa | hypothetical protein | |
| 2887 | CAKVSM010000164.1 | GCA934831285_01437 | CDS | open | 2126-3388 | _na 420_aa | Transporter%2C major facilitator family protein | |
| 2888 | CAKVSM010000164.1 | GCA934831285_01435 | gene | open | 67-1818 | |||
| 2889 | CAKVSM010000164.1 | GCA934831285_01436 | gene | open | 1837-1956 | |||
| 2890 | CAKVSM010000164.1 | GCA934831285_01437 | gene | open | 2126-3388 | |||
| 2891 | CAKVSM010000165.1 | GCA934831285_01438 | CDS | open | 46-318 | _na 90_aa | hypothetical protein | |
| 2892 | CAKVSM010000165.1 | GCA934831285_01439 | CDS | open | 341-1861 | _na 506_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 2893 | CAKVSM010000165.1 | GCA934831285_01440 | CDS | open | 1886-2710 | _na 274_aa | nikC | Nickel ABC transporter permease subunit NikC |
| 2894 | CAKVSM010000165.1 | GCA934831285_01441 | CDS | open | 2719-3411 | _na 230_aa | nikB | Nickel import system permease protein NikB |
| 2895 | CAKVSM010000165.1 | GCA934831285_01438 | gene | open | 46-318 | |||
| 2896 | CAKVSM010000165.1 | GCA934831285_01439 | gene | open | 341-1861 | |||
| 2897 | CAKVSM010000165.1 | GCA934831285_01440 | gene | open | 1886-2710 | nikC | ||
| 2898 | CAKVSM010000165.1 | GCA934831285_01441 | gene | open | 2719-3411 | nikB | ||
| 2899 | CAKVSM010000166.1 | GCA934831285_01442 | CDS | open | 157-1764 | _na 535_aa | peptide chain release factor 3 | |
| 2900 | CAKVSM010000166.1 | GCA934831285_01443 | CDS | open | 1876-3078 | _na 400_aa | Spermidine synthase | |
| 2901 | CAKVSM010000166.1 | GCA934831285_01442 | gene | open | 157-1764 | |||
| 2902 | CAKVSM010000166.1 | GCA934831285_01443 | gene | open | 1876-3078 | |||
| 2903 | CAKVSM010000167.1 | GCA934831285_01444 | CDS | open | 531-1823 | _na 430_aa | purB | adenylosuccinate lyase |
| 2904 | CAKVSM010000167.1 | GCA934831285_01445 | CDS | open | 1824-3224 | _na 466_aa | FAD-dependent monooxygenase | |
| 2905 | CAKVSM010000167.1 | GCA934831285_01444 | gene | open | 531-1823 | purB | ||
| 2906 | CAKVSM010000167.1 | GCA934831285_01445 | gene | open | 1824-3224 | |||
| 2907 | CAKVSM010000168.1 | GCA934831285_01446 | CDS | open | 7-1350 | _na 447_aa | glmM | phosphoglucosamine mutase |
| 2908 | CAKVSM010000168.1 | GCA934831285_01447 | CDS | open | 1435-2355 | _na 306_aa | YbbR-like domain-containing protein | |
| 2909 | CAKVSM010000168.1 | GCA934831285_01448 | CDS | open | 2352-3194 | _na 280_aa | cdaA | diadenylate cyclase CdaA |
| 2910 | CAKVSM010000168.1 | GCA934831285_01446 | gene | open | 7-1350 | glmM | ||
| 2911 | CAKVSM010000168.1 | GCA934831285_01447 | gene | open | 1435-2355 | |||
| 2912 | CAKVSM010000168.1 | GCA934831285_01448 | gene | open | 2352-3194 | cdaA | ||
| 2913 | CAKVSM010000169.1 | GCA934831285_01449 | CDS | open | 60-1424 | _na 454_aa | hypothetical protein | |
| 2914 | CAKVSM010000169.1 | GCA934831285_01450 | CDS | open | 1511-2146 | _na 211_aa | CBS domain protein | |
| 2915 | CAKVSM010000169.1 | GCA934831285_01451 | CDS | open | 2150-2977 | _na 275_aa | Putative pyruvate%2C phosphate dikinase regulatory protein | |
| 2916 | CAKVSM010000169.1 | GCA934831285_01449 | gene | open | 60-1424 | |||
| 2917 | CAKVSM010000169.1 | GCA934831285_01450 | gene | open | 1511-2146 | |||
| 2918 | CAKVSM010000169.1 | GCA934831285_01451 | gene | open | 2150-2977 | |||
| 2919 | CAKVSM010000170.1 | regulatory_region | open | 1417-1584 | Cobalamin riboswitch aptamer | |||
| 2920 | CAKVSM010000170.1 | GCA934831285_01452 | CDS | open | 250-435 | _na 61_aa | hypothetical protein | |
| 2921 | CAKVSM010000170.1 | GCA934831285_01453 | CDS | open | 634-918 | _na 94_aa | hypothetical protein | |
| 2922 | CAKVSM010000170.1 | GCA934831285_01454 | CDS | open | 1796-2296 | _na 166_aa | Methylmalonyl-CoA mutase | |
| 2923 | CAKVSM010000170.1 | GCA934831285_01455 | CDS | open | 2424-2654 | _na 76_aa | hypothetical protein | |
| 2924 | CAKVSM010000170.1 | GCA934831285_01456 | CDS | open | 2925-3116 | _na 63_aa | Lipoyl-binding domain-containing protein | |
| 2925 | CAKVSM010000170.1 | GCA934831285_01452 | gene | open | 250-435 | |||
| 2926 | CAKVSM010000170.1 | GCA934831285_01453 | gene | open | 634-918 | |||
| 2927 | CAKVSM010000170.1 | GCA934831285_01454 | gene | open | 1796-2296 | |||
| 2928 | CAKVSM010000170.1 | GCA934831285_01455 | gene | open | 2424-2654 | |||
| 2929 | CAKVSM010000170.1 | GCA934831285_01456 | gene | open | 2925-3116 | |||
| 2930 | CAKVSM010000171.1 | regulatory_region | open | 2320-2523 | T-box leader | |||
| 2931 | CAKVSM010000171.1 | GCA934831285_01457 | CDS | open | 61-816 | _na 251_aa | putative membrane transporter protein | |
| 2932 | CAKVSM010000171.1 | GCA934831285_01458 | CDS | open | 963-1943 | _na 326_aa | Receptor family ligand-binding protein | |
| 2933 | CAKVSM010000171.1 | GCA934831285_01459 | CDS | open | 1906-2142 | _na 78_aa | hypothetical protein | |
| 2934 | CAKVSM010000171.1 | GCA934831285_01460 | CDS | open | 2715-3221 | _na 168_aa | hypothetical protein | |
| 2935 | CAKVSM010000171.1 | GCA934831285_01457 | gene | open | 61-816 | |||
| 2936 | CAKVSM010000171.1 | GCA934831285_01458 | gene | open | 963-1943 | |||
| 2937 | CAKVSM010000171.1 | GCA934831285_01459 | gene | open | 1906-2142 | |||
| 2938 | CAKVSM010000171.1 | GCA934831285_01460 | gene | open | 2715-3221 | |||
| 2939 | CAKVSM010000172.1 | GCA934831285_01461 | CDS | open | 16-504 | _na 162_aa | hypothetical protein | |
| 2940 | CAKVSM010000172.1 | GCA934831285_01462 | CDS | open | 504-1439 | _na 311_aa | whiA | DNA-binding protein WhiA |
| 2941 | CAKVSM010000172.1 | GCA934831285_01463 | CDS | open | 1439-2482 | _na 347_aa | Tat pathway signal sequence domain protein | |
| 2942 | CAKVSM010000172.1 | GCA934831285_01464 | CDS | open | 2489-2728 | _na 79_aa | DUF951 domain-containing protein | |
| 2943 | CAKVSM010000172.1 | GCA934831285_01461 | gene | open | 16-504 | |||
| 2944 | CAKVSM010000172.1 | GCA934831285_01462 | gene | open | 504-1439 | whiA | ||
| 2945 | CAKVSM010000172.1 | GCA934831285_01463 | gene | open | 1439-2482 | |||
| 2946 | CAKVSM010000172.1 | GCA934831285_01464 | gene | open | 2489-2728 | |||
| 2947 | CAKVSM010000172.1 | GCA934831285_01465 | gene | open | 2896-2971 | trnT | ||
| 2948 | CAKVSM010000172.1 | GCA934831285_01466 | gene | open | 2975-3059 | trnY | ||
| 2949 | CAKVSM010000172.1 | GCA934831285_01467 | gene | open | 3064-3139 | trnfM | ||
| 2950 | CAKVSM010000172.1 | GCA934831285_01465 | tRNA | open | 2896-2971 | trnT | tRNA-Thr(tgt) | |
| 2951 | CAKVSM010000172.1 | GCA934831285_01466 | tRNA | open | 2975-3059 | trnY | tRNA-Tyr(gta) | |
| 2952 | CAKVSM010000172.1 | GCA934831285_01467 | tRNA | open | 3064-3139 | trnfM | tRNA-fMet(cat) | |
| 2953 | CAKVSM010000173.1 | GCA934831285_01468 | CDS | open | 20-250 | _na 76_aa | hypothetical protein | |
| 2954 | CAKVSM010000173.1 | GCA934831285_01469 | CDS | open | 329-1414 | _na 361_aa | PLP-dependent aminotransferase family protein | |
| 2955 | CAKVSM010000173.1 | GCA934831285_01470 | CDS | open | 1519-2067 | _na 182_aa | ECF transporter S component | |
| 2956 | CAKVSM010000173.1 | GCA934831285_01471 | CDS | open | 2182-3015 | _na 277_aa | ADP-ribosylglycohydrolase | |
| 2957 | CAKVSM010000173.1 | GCA934831285_01468 | gene | open | 20-250 | |||
| 2958 | CAKVSM010000173.1 | GCA934831285_01469 | gene | open | 329-1414 | |||
| 2959 | CAKVSM010000173.1 | GCA934831285_01470 | gene | open | 1519-2067 | |||
| 2960 | CAKVSM010000173.1 | GCA934831285_01471 | gene | open | 2182-3015 | |||
| 2961 | CAKVSM010000174.1 | GCA934831285_01472 | CDS | open | 40-1200 | _na 386_aa | hypothetical protein | |
| 2962 | CAKVSM010000174.1 | GCA934831285_01473 | CDS | open | 1280-1447 | _na 55_aa | hypothetical protein | |
| 2963 | CAKVSM010000174.1 | GCA934831285_01474 | CDS | open | 1583-2158 | _na 191_aa | hypothetical protein | |
| 2964 | CAKVSM010000174.1 | GCA934831285_01472 | gene | open | 40-1200 | |||
| 2965 | CAKVSM010000174.1 | GCA934831285_01473 | gene | open | 1280-1447 | |||
| 2966 | CAKVSM010000174.1 | GCA934831285_01474 | gene | open | 1583-2158 | |||
| 2967 | CAKVSM010000175.1 | GCA934831285_01475 | CDS | open | 186-530 | _na 114_aa | hypothetical protein | |
| 2968 | CAKVSM010000175.1 | GCA934831285_01476 | CDS | open | 1446-2099 | _na 217_aa | hypothetical protein | |
| 2969 | CAKVSM010000175.1 | GCA934831285_01475 | gene | open | 186-530 | |||
| 2970 | CAKVSM010000175.1 | GCA934831285_01476 | gene | open | 1446-2099 | |||
| 2971 | CAKVSM010000176.1 | GCA934831285_01477 | CDS | open | 227-697 | _na 156_aa | Pyridoxamine 5'-phosphate oxidase family protein | |
| 2972 | CAKVSM010000176.1 | GCA934831285_01478 | CDS | open | 780-2174 | _na 464_aa | Putative permease | |
| 2973 | CAKVSM010000176.1 | GCA934831285_01477 | gene | open | 227-697 | |||
| 2974 | CAKVSM010000176.1 | GCA934831285_01478 | gene | open | 780-2174 | |||
| 2975 | CAKVSM010000177.1 | GCA934831285_01479 | CDS | open | 162-977 | _na 271_aa | hypothetical protein | |
| 2976 | CAKVSM010000177.1 | GCA934831285_01480 | CDS | open | 1053-2726 | _na 557_aa | mdcA | malonate decarboxylase subunit alpha |
| 2977 | CAKVSM010000177.1 | GCA934831285_01479 | gene | open | 162-977 | |||
| 2978 | CAKVSM010000177.1 | GCA934831285_01480 | gene | open | 1053-2726 | mdcA | ||
| 2979 | CAKVSM010000178.1 | GCA934831285_01481 | CDS | open | 129-398 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 2980 | CAKVSM010000178.1 | GCA934831285_01482 | CDS | open | 515-1303 | _na 262_aa | ABC transporter%2C ATP-binding protein | |
| 2981 | CAKVSM010000178.1 | GCA934831285_01483 | CDS | open | 1306-2148 | _na 280_aa | Branched-chain amino acid ABC transporter%2C permease protein | |
| 2982 | CAKVSM010000178.1 | GCA934831285_01484 | CDS | open | 2210-2908 | _na 232_aa | ABC transporter substrate-binding protein | |
| 2983 | CAKVSM010000178.1 | GCA934831285_01481 | gene | open | 129-398 | rpsO | ||
| 2984 | CAKVSM010000178.1 | GCA934831285_01482 | gene | open | 515-1303 | |||
| 2985 | CAKVSM010000178.1 | GCA934831285_01483 | gene | open | 1306-2148 | |||
| 2986 | CAKVSM010000178.1 | GCA934831285_01484 | gene | open | 2210-2908 | |||
| 2987 | CAKVSM010000179.1 | GCA934831285_01485 | CDS | open | 275-1570 | _na 431_aa | Citrate transporter | |
| 2988 | CAKVSM010000179.1 | GCA934831285_01486 | CDS | open | 1858-2811 | _na 317_aa | hypothetical protein | |
| 2989 | CAKVSM010000179.1 | GCA934831285_01485 | gene | open | 275-1570 | |||
| 2990 | CAKVSM010000179.1 | GCA934831285_01486 | gene | open | 1858-2811 | |||
| 2991 | CAKVSM010000180.1 | GCA934831285_01487 | CDS | open | 117-1427 | _na 436_aa | Peptidase M20 domain-containing protein 2 | |
| 2992 | CAKVSM010000180.1 | GCA934831285_01488 | CDS | open | 1465-2298 | _na 277_aa | DUF3100 domain-containing protein | |
| 2993 | CAKVSM010000180.1 | GCA934831285_01489 | CDS | open | 2295-2741 | _na 148_aa | DUF340 domain-containing protein | |
| 2994 | CAKVSM010000180.1 | GCA934831285_01487 | gene | open | 117-1427 | |||
| 2995 | CAKVSM010000180.1 | GCA934831285_01488 | gene | open | 1465-2298 | |||
| 2996 | CAKVSM010000180.1 | GCA934831285_01489 | gene | open | 2295-2741 | |||
| 2997 | CAKVSM010000181.1 | GCA934831285_01490 | CDS | open | 57-1067 | _na 336_aa | hypothetical protein | |
| 2998 | CAKVSM010000181.1 | GCA934831285_01491 | CDS | open | 1885-2307 | _na 140_aa | Acyl-CoA thioester hydrolase%2C YbgC/YbaW family | |
| 2999 | CAKVSM010000181.1 | GCA934831285_01490 | gene | open | 57-1067 | |||
| 3000 | CAKVSM010000181.1 | GCA934831285_01491 | gene | open | 1885-2307 |

