BAKTAGenome Explorer: Schaalia lingnae (GCA_937910295.1)
Select a Genome:
|
BAKTA Annotations for GCA_937910295.1
|
Search & Sort all 3656 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2501 | CALENC010000144.1 | GCA937910295_01244 | gene | open | 7765-8829 | corC | ||
| 2502 | CALENC010000144.1 | GCA937910295_01245 | gene | open | 8886-9752 | mepM | ||
| 2503 | CALENC010000144.1 | GCA937910295_01246 | gene | open | 9755-10546 | |||
| 2504 | CALENC010000144.1 | GCA937910295_01247 | gene | open | 10631-12046 | |||
| 2505 | CALENC010000144.1 | GCA937910295_01249 | gene | open | 13112-13549 | |||
| 2506 | CALENC010000144.1 | GCA937910295_01250 | gene | open | 13571-14800 | |||
| 2507 | CALENC010000144.1 | GCA937910295_01251 | gene | open | 14912-16594 | argS | ||
| 2508 | CALENC010000144.1 | GCA937910295_01252 | gene | open | 16704-18086 | |||
| 2509 | CALENC010000144.1 | GCA937910295_01253 | gene | open | 18187-19380 | hrpB | ||
| 2510 | CALENC010000144.1 | GCA937910295_01248 | gene | open | 12931-13003 | trnR | ||
| 2511 | CALENC010000144.1 | GCA937910295_01248 | tRNA | open | 12931-13003 | trnR | tRNA-Arg(ccg) | |
| 2512 | CALENC010000145.1 | GCA937910295_01254 | CDS | open | 220-450 | _na 76_aa | hypothetical protein | |
| 2513 | CALENC010000145.1 | GCA937910295_01255 | CDS | open | 472-1194 | _na 240_aa | hypothetical protein | |
| 2514 | CALENC010000145.1 | GCA937910295_01256 | CDS | open | 1302-1676 | _na 124_aa | hypothetical protein | |
| 2515 | CALENC010000145.1 | GCA937910295_01254 | gene | open | 220-450 | |||
| 2516 | CALENC010000145.1 | GCA937910295_01255 | gene | open | 472-1194 | |||
| 2517 | CALENC010000145.1 | GCA937910295_01256 | gene | open | 1302-1676 | |||
| 2518 | CALENC010000146.1 | GCA937910295_01257 | CDS | open | 107-406 | _na 99_aa | hypothetical protein | |
| 2519 | CALENC010000146.1 | GCA937910295_01258 | CDS | open | 406-1551 | _na 381_aa | hypothetical protein | |
| 2520 | CALENC010000146.1 | GCA937910295_01259 | CDS | open | 1575-1943 | _na 122_aa | hypothetical protein | |
| 2521 | CALENC010000146.1 | GCA937910295_01260 | CDS | open | 1982-2473 | _na 163_aa | DUF1795 domain-containing protein | |
| 2522 | CALENC010000146.1 | GCA937910295_01261 | CDS | open | 2470-3240 | _na 256_aa | XRE family transcriptional regulator | |
| 2523 | CALENC010000146.1 | GCA937910295_01257 | gene | open | 107-406 | |||
| 2524 | CALENC010000146.1 | GCA937910295_01258 | gene | open | 406-1551 | |||
| 2525 | CALENC010000146.1 | GCA937910295_01259 | gene | open | 1575-1943 | |||
| 2526 | CALENC010000146.1 | GCA937910295_01260 | gene | open | 1982-2473 | |||
| 2527 | CALENC010000146.1 | GCA937910295_01261 | gene | open | 2470-3240 | |||
| 2528 | CALENC010000147.1 | GCA937910295_01262 | CDS | open | 152-895 | _na 247_aa | hypothetical protein | |
| 2529 | CALENC010000147.1 | GCA937910295_01263 | CDS | open | 1748-2770 | _na 340_aa | lacI | LacI family transcriptional regulator |
| 2530 | CALENC010000147.1 | GCA937910295_01262 | gene | open | 152-895 | |||
| 2531 | CALENC010000147.1 | GCA937910295_01263 | gene | open | 1748-2770 | lacI | ||
| 2532 | CALENC010000148.1 | GCA937910295_01264 | CDS | open | 62-907 | _na 281_aa | Cytosine-specific methyltransferase | |
| 2533 | CALENC010000148.1 | GCA937910295_01265 | CDS | open | 962-2071 | _na 369_aa | sacI | Restriction endonuclease%2C SacI family |
| 2534 | CALENC010000148.1 | GCA937910295_01266 | CDS | open | 2113-2325 | _na 70_aa | hypothetical protein | |
| 2535 | CALENC010000148.1 | GCA937910295_01264 | gene | open | 62-907 | |||
| 2536 | CALENC010000148.1 | GCA937910295_01265 | gene | open | 962-2071 | sacI | ||
| 2537 | CALENC010000148.1 | GCA937910295_01266 | gene | open | 2113-2325 | |||
| 2538 | CALENC010000149.1 | GCA937910295_01267 | CDS | open | 171-704 | _na 177_aa | hypothetical protein | |
| 2539 | CALENC010000149.1 | GCA937910295_01267 | gene | open | 171-704 | |||
| 2540 | CALENC010000150.1 | GCA937910295_01268 | CDS | open | 8-1471 | _na 487_aa | Allantoin permease | |
| 2541 | CALENC010000150.1 | GCA937910295_01269 | CDS | open | 1690-2019 | _na 109_aa | hypothetical protein | |
| 2542 | CALENC010000150.1 | GCA937910295_01270 | CDS | open | 2019-2234 | _na 71_aa | hypothetical protein | |
| 2543 | CALENC010000150.1 | GCA937910295_01271 | CDS | open | 2282-2824 | _na 180_aa | hypothetical protein | |
| 2544 | CALENC010000150.1 | GCA937910295_01272 | CDS | open | 3166-3690 | _na 174_aa | hypothetical protein | |
| 2545 | CALENC010000150.1 | GCA937910295_01273 | CDS | open | 3687-4124 | _na 145_aa | glycohydrolase toxin TNT-related protein | |
| 2546 | CALENC010000150.1 | GCA937910295_01274 | CDS | open | 4174-4704 | _na 176_aa | RES domain-containing protein | |
| 2547 | CALENC010000150.1 | GCA937910295_01275 | CDS | open | 4918-5685 | _na 255_aa | 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase | |
| 2548 | CALENC010000150.1 | GCA937910295_01276 | CDS | open | 5713-7191 | _na 492_aa | alsT | Amino-acid carrier protein AlsT |
| 2549 | CALENC010000150.1 | GCA937910295_01277 | CDS | open | 8144-8476 | _na 110_aa | hypothetical protein | |
| 2550 | CALENC010000150.1 | GCA937910295_01268 | gene | open | 8-1471 | |||
| 2551 | CALENC010000150.1 | GCA937910295_01269 | gene | open | 1690-2019 | |||
| 2552 | CALENC010000150.1 | GCA937910295_01270 | gene | open | 2019-2234 | |||
| 2553 | CALENC010000150.1 | GCA937910295_01271 | gene | open | 2282-2824 | |||
| 2554 | CALENC010000150.1 | GCA937910295_01272 | gene | open | 3166-3690 | |||
| 2555 | CALENC010000150.1 | GCA937910295_01273 | gene | open | 3687-4124 | |||
| 2556 | CALENC010000150.1 | GCA937910295_01274 | gene | open | 4174-4704 | |||
| 2557 | CALENC010000150.1 | GCA937910295_01275 | gene | open | 4918-5685 | |||
| 2558 | CALENC010000150.1 | GCA937910295_01276 | gene | open | 5713-7191 | alsT | ||
| 2559 | CALENC010000150.1 | GCA937910295_01277 | gene | open | 8144-8476 | |||
| 2560 | CALENC010000151.1 | GCA937910295_01278 | CDS | open | 6-2474 | _na 822_aa | FtsX-like permease family protein | |
| 2561 | CALENC010000151.1 | GCA937910295_01279 | CDS | open | 2285-2728 | _na 147_aa | hypothetical protein | |
| 2562 | CALENC010000151.1 | GCA937910295_01278 | gene | open | 6-2474 | |||
| 2563 | CALENC010000151.1 | GCA937910295_01279 | gene | open | 2285-2728 | |||
| 2564 | CALENC010000152.1 | GCA937910295_01280 | CDS | open | 23-1249 | _na 408_aa | mdxE | Maltodextrin-binding protein MdxE |
| 2565 | CALENC010000152.1 | GCA937910295_01281 | CDS | open | 1361-2437 | _na 358_aa | degA | HTH-type transcriptional regulator DegA |
| 2566 | CALENC010000152.1 | GCA937910295_01282 | CDS | open | 2462-3454 | _na 330_aa | znuA | High-affinity zinc uptake system binding-protein ZnuA |
| 2567 | CALENC010000152.1 | GCA937910295_01280 | gene | open | 23-1249 | mdxE | ||
| 2568 | CALENC010000152.1 | GCA937910295_01281 | gene | open | 1361-2437 | degA | ||
| 2569 | CALENC010000152.1 | GCA937910295_01282 | gene | open | 2462-3454 | znuA | ||
| 2570 | CALENC010000153.1 | GCA937910295_01283 | CDS | open | 687-857 | _na 56_aa | hypothetical protein | |
| 2571 | CALENC010000153.1 | GCA937910295_01283 | gene | open | 687-857 | |||
| 2572 | CALENC010000154.1 | GCA937910295_01284 | CDS | open | 503-2245 | _na 580_aa | Alpha-amylase | |
| 2573 | CALENC010000154.1 | GCA937910295_01285 | CDS | open | 2384-3325 | _na 313_aa | Sugar ABC transporter permease | |
| 2574 | CALENC010000154.1 | GCA937910295_01286 | CDS | open | 3325-4203 | _na 292_aa | lacF | Lactose transport system permease protein LacF |
| 2575 | CALENC010000154.1 | GCA937910295_01287 | CDS | open | 4423-5670 | _na 415_aa | Sugar ABC transporter substrate-binding protein | |
| 2576 | CALENC010000154.1 | GCA937910295_01288 | CDS | open | 5705-6043 | _na 112_aa | hypothetical protein | |
| 2577 | CALENC010000154.1 | GCA937910295_01284 | gene | open | 503-2245 | |||
| 2578 | CALENC010000154.1 | GCA937910295_01285 | gene | open | 2384-3325 | |||
| 2579 | CALENC010000154.1 | GCA937910295_01286 | gene | open | 3325-4203 | lacF | ||
| 2580 | CALENC010000154.1 | GCA937910295_01287 | gene | open | 4423-5670 | |||
| 2581 | CALENC010000154.1 | GCA937910295_01288 | gene | open | 5705-6043 | |||
| 2582 | CALENC010000155.1 | GCA937910295_01289 | CDS | open | 545-1012 | _na 155_aa | hypothetical protein | |
| 2583 | CALENC010000155.1 | GCA937910295_01290 | CDS | open | 1145-1771 | _na 208_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 2584 | CALENC010000155.1 | GCA937910295_01291 | CDS | open | 1843-2241 | _na 132_aa | Peptidyl-prolyl cis-trans isomerase | |
| 2585 | CALENC010000155.1 | GCA937910295_01292 | CDS | open | 2503-3465 | _na 320_aa | Bax inhibitor 1 like protein | |
| 2586 | CALENC010000155.1 | GCA937910295_01294 | CDS | open | 3584-4564 | _na 326_aa | Guanosine-5'-triphosphate%2C3'-diphosphate pyrophosphatase | |
| 2587 | CALENC010000155.1 | GCA937910295_01295 | CDS | open | 4595-5113 | _na 172_aa | Septum formation initiator family protein | |
| 2588 | CALENC010000155.1 | GCA937910295_01296 | CDS | open | 5285-6058 | _na 257_aa | ftsL | Cell division protein FtsL |
| 2589 | CALENC010000155.1 | GCA937910295_01297 | CDS | open | 6209-7489 | _na 426_aa | eno | phosphopyruvate hydratase |
| 2590 | CALENC010000155.1 | GCA937910295_01298 | CDS | open | 7712-8284 | _na 190_aa | Lipoprotein | |
| 2591 | CALENC010000155.1 | GCA937910295_01299 | CDS | open | 8339-11575 | _na 1078_aa | mfd | transcription-repair coupling factor |
| 2592 | CALENC010000155.1 | GCA937910295_01289 | gene | open | 545-1012 | |||
| 2593 | CALENC010000155.1 | GCA937910295_01290 | gene | open | 1145-1771 | msrA | ||
| 2594 | CALENC010000155.1 | GCA937910295_01291 | gene | open | 1843-2241 | |||
| 2595 | CALENC010000155.1 | GCA937910295_01292 | gene | open | 2503-3465 | |||
| 2596 | CALENC010000155.1 | GCA937910295_01294 | gene | open | 3584-4564 | |||
| 2597 | CALENC010000155.1 | GCA937910295_01295 | gene | open | 4595-5113 | |||
| 2598 | CALENC010000155.1 | GCA937910295_01296 | gene | open | 5285-6058 | ftsL | ||
| 2599 | CALENC010000155.1 | GCA937910295_01297 | gene | open | 6209-7489 | eno | ||
| 2600 | CALENC010000155.1 | GCA937910295_01298 | gene | open | 7712-8284 | |||
| 2601 | CALENC010000155.1 | GCA937910295_01299 | gene | open | 8339-11575 | mfd | ||
| 2602 | CALENC010000155.1 | GCA937910295_01293 | gene | open | 3502-3575 | trnL | ||
| 2603 | CALENC010000155.1 | GCA937910295_01293 | tRNA | open | 3502-3575 | trnL | tRNA-Leu(taa) | |
| 2604 | CALENC010000156.1 | GCA937910295_01300 | CDS | open | 149-1045 | _na 298_aa | NH(3)-dependent NAD(+) synthetase | |
| 2605 | CALENC010000156.1 | GCA937910295_01301 | CDS | open | 1195-2211 | _na 338_aa | yclQ | Putative ABC transporter solute-binding protein YclQ |
| 2606 | CALENC010000156.1 | GCA937910295_01302 | CDS | open | 2293-3288 | _na 331_aa | hmuU | Hemin transport system permease protein HmuU |
| 2607 | CALENC010000156.1 | GCA937910295_01303 | CDS | open | 3285-4295 | _na 336_aa | feuC | Iron-uptake system permease protein FeuC |
| 2608 | CALENC010000156.1 | GCA937910295_01304 | CDS | open | 4292-5047 | _na 251_aa | yusV | Putative siderophore transport system ATP-binding protein YusV |
| 2609 | CALENC010000156.1 | GCA937910295_01305 | CDS | open | 5142-5516 | _na 124_aa | Cupin | |
| 2610 | CALENC010000156.1 | GCA937910295_01306 | CDS | open | 5503-6321 | _na 272_aa | Methyltransferase type 11 domain-containing protein | |
| 2611 | CALENC010000156.1 | GCA937910295_01307 | CDS | open | 6333-6569 | _na 78_aa | Dyp-type peroxidase C-terminal domain-containing protein | |
| 2612 | CALENC010000156.1 | GCA937910295_01300 | gene | open | 149-1045 | |||
| 2613 | CALENC010000156.1 | GCA937910295_01301 | gene | open | 1195-2211 | yclQ | ||
| 2614 | CALENC010000156.1 | GCA937910295_01302 | gene | open | 2293-3288 | hmuU | ||
| 2615 | CALENC010000156.1 | GCA937910295_01303 | gene | open | 3285-4295 | feuC | ||
| 2616 | CALENC010000156.1 | GCA937910295_01304 | gene | open | 4292-5047 | yusV | ||
| 2617 | CALENC010000156.1 | GCA937910295_01305 | gene | open | 5142-5516 | |||
| 2618 | CALENC010000156.1 | GCA937910295_01306 | gene | open | 5503-6321 | |||
| 2619 | CALENC010000156.1 | GCA937910295_01307 | gene | open | 6333-6569 | |||
| 2620 | CALENC010000157.1 | GCA937910295_01308 | CDS | open | 51-494 | _na 147_aa | hypothetical protein | |
| 2621 | CALENC010000157.1 | GCA937910295_01309 | CDS | open | 1082-1738 | _na 218_aa | ABC transporter domain-containing protein | |
| 2622 | CALENC010000157.1 | GCA937910295_01310 | CDS | open | 1743-2468 | _na 241_aa | ABC-2 type transporter domain-containing protein | |
| 2623 | CALENC010000157.1 | GCA937910295_01311 | CDS | open | 2465-3088 | _na 207_aa | Cytochrome C oxidase subunit IV | |
| 2624 | CALENC010000157.1 | GCA937910295_01308 | gene | open | 51-494 | |||
| 2625 | CALENC010000157.1 | GCA937910295_01309 | gene | open | 1082-1738 | |||
| 2626 | CALENC010000157.1 | GCA937910295_01310 | gene | open | 1743-2468 | |||
| 2627 | CALENC010000157.1 | GCA937910295_01311 | gene | open | 2465-3088 | |||
| 2628 | CALENC010000158.1 | GCA937910295_01312 | CDS | open | 462-2174 | _na 570_aa | Alpha/beta-hydrolase family protein | |
| 2629 | CALENC010000158.1 | GCA937910295_01313 | CDS | open | 2198-2932 | _na 244_aa | Methyltransferase type 11 domain-containing protein | |
| 2630 | CALENC010000158.1 | GCA937910295_01314 | CDS | open | 2942-3871 | _na 309_aa | cysA | Sulfate/thiosulfate import ATP-binding protein CysA |
| 2631 | CALENC010000158.1 | GCA937910295_01315 | CDS | open | 3868-5322 | _na 484_aa | phnU | 2-aminoethylphosphonate transport system permease protein PhnU |
| 2632 | CALENC010000158.1 | GCA937910295_01312 | gene | open | 462-2174 | |||
| 2633 | CALENC010000158.1 | GCA937910295_01313 | gene | open | 2198-2932 | |||
| 2634 | CALENC010000158.1 | GCA937910295_01314 | gene | open | 2942-3871 | cysA | ||
| 2635 | CALENC010000158.1 | GCA937910295_01315 | gene | open | 3868-5322 | phnU | ||
| 2636 | CALENC010000159.1 | GCA937910295_01316 | CDS | open | 279-1913 | _na 544_aa | RNA helicase | |
| 2637 | CALENC010000159.1 | GCA937910295_01317 | CDS | open | 2100-2723 | _na 207_aa | tRNA-(MS[2]IO[6]A)-hydroxylase (MiaE)-like | |
| 2638 | CALENC010000159.1 | GCA937910295_01318 | CDS | open | 2762-2986 | _na 74_aa | DUF3107 domain-containing protein | |
| 2639 | CALENC010000159.1 | GCA937910295_01319 | CDS | open | 3249-4088 | _na 279_aa | DUF5067 domain-containing protein | |
| 2640 | CALENC010000159.1 | GCA937910295_01316 | gene | open | 279-1913 | |||
| 2641 | CALENC010000159.1 | GCA937910295_01317 | gene | open | 2100-2723 | |||
| 2642 | CALENC010000159.1 | GCA937910295_01318 | gene | open | 2762-2986 | |||
| 2643 | CALENC010000159.1 | GCA937910295_01319 | gene | open | 3249-4088 | |||
| 2644 | CALENC010000160.1 | GCA937910295_01320 | CDS | open | 782-1732 | _na 316_aa | Tat pathway signal sequence domain protein | |
| 2645 | CALENC010000160.1 | GCA937910295_01321 | CDS | open | 1783-2382 | _na 199_aa | hypothetical protein | |
| 2646 | CALENC010000160.1 | GCA937910295_01320 | gene | open | 782-1732 | |||
| 2647 | CALENC010000160.1 | GCA937910295_01321 | gene | open | 1783-2382 | |||
| 2648 | CALENC010000161.1 | regulatory_region | open | 3108-3202 | mraW RNA | |||
| 2649 | CALENC010000161.1 | GCA937910295_01322 | CDS | open | 1004-1846 | _na 280_aa | hypothetical protein | |
| 2650 | CALENC010000161.1 | GCA937910295_01323 | CDS | open | 1720-2115 | _na 131_aa | ftsL | Cell division protein FtsL |
| 2651 | CALENC010000161.1 | GCA937910295_01324 | CDS | open | 2112-3089 | _na 325_aa | rsmH | 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH |
| 2652 | CALENC010000161.1 | GCA937910295_01325 | CDS | open | 3198-3629 | _na 143_aa | mraZ | division/cell wall cluster transcriptional repressor MraZ |
| 2653 | CALENC010000161.1 | GCA937910295_01326 | CDS | open | 3963-4334 | _na 123_aa | DUF3040 domain-containing protein | |
| 2654 | CALENC010000161.1 | GCA937910295_01327 | CDS | open | 4344-5561 | _na 405_aa | dinB | DNA polymerase IV |
| 2655 | CALENC010000161.1 | GCA937910295_01328 | CDS | open | 5592-6389 | _na 265_aa | Spermidine synthase | |
| 2656 | CALENC010000161.1 | GCA937910295_01329 | CDS | open | 6386-7573 | _na 395_aa | PAC2 family protein | |
| 2657 | CALENC010000161.1 | GCA937910295_01330 | CDS | open | 7748-10003 | _na 751_aa | Helicase IV | |
| 2658 | CALENC010000161.1 | GCA937910295_01331 | CDS | open | 10093-10539 | _na 148_aa | nrdR | transcriptional regulator NrdR |
| 2659 | CALENC010000161.1 | GCA937910295_01332 | CDS | open | 10648-11094 | _na 148_aa | lysM | Peptidoglycan-binding protein LysM |
| 2660 | CALENC010000161.1 | GCA937910295_01333 | CDS | open | 11289-11975 | _na 228_aa | lexA | transcriptional repressor LexA |
| 2661 | CALENC010000161.1 | GCA937910295_01322 | gene | open | 1004-1846 | |||
| 2662 | CALENC010000161.1 | GCA937910295_01323 | gene | open | 1720-2115 | ftsL | ||
| 2663 | CALENC010000161.1 | GCA937910295_01324 | gene | open | 2112-3089 | rsmH | ||
| 2664 | CALENC010000161.1 | GCA937910295_01325 | gene | open | 3198-3629 | mraZ | ||
| 2665 | CALENC010000161.1 | GCA937910295_01326 | gene | open | 3963-4334 | |||
| 2666 | CALENC010000161.1 | GCA937910295_01327 | gene | open | 4344-5561 | dinB | ||
| 2667 | CALENC010000161.1 | GCA937910295_01328 | gene | open | 5592-6389 | |||
| 2668 | CALENC010000161.1 | GCA937910295_01329 | gene | open | 6386-7573 | |||
| 2669 | CALENC010000161.1 | GCA937910295_01330 | gene | open | 7748-10003 | |||
| 2670 | CALENC010000161.1 | GCA937910295_01331 | gene | open | 10093-10539 | nrdR | ||
| 2671 | CALENC010000161.1 | GCA937910295_01332 | gene | open | 10648-11094 | lysM | ||
| 2672 | CALENC010000161.1 | GCA937910295_01333 | gene | open | 11289-11975 | lexA | ||
| 2673 | CALENC010000162.1 | GCA937910295_01334 | CDS | open | 45-1523 | _na 492_aa | hypothetical protein | |
| 2674 | CALENC010000162.1 | GCA937910295_01335 | CDS | open | 1527-2123 | _na 198_aa | recR | recombination mediator RecR |
| 2675 | CALENC010000162.1 | GCA937910295_01336 | CDS | open | 2155-2880 | _na 241_aa | tcrX | Putative transcriptional regulatory protein TcrX |
| 2676 | CALENC010000162.1 | GCA937910295_01337 | CDS | open | 2889-4550 | _na 553_aa | walK | cell wall metabolism sensor histidine kinase WalK |
| 2677 | CALENC010000162.1 | GCA937910295_01338 | CDS | open | 4687-5634 | _na 315_aa | Abi family protein | |
| 2678 | CALENC010000162.1 | GCA937910295_01339 | CDS | open | 5703-7433 | _na 576_aa | Phosphoenolpyruvate-protein phosphotransferase | |
| 2679 | CALENC010000162.1 | GCA937910295_01340 | CDS | open | 7618-8934 | _na 438_aa | aspartate kinase | |
| 2680 | CALENC010000162.1 | GCA937910295_01341 | CDS | open | 8967-10016 | _na 349_aa | aspartate-semialdehyde dehydrogenase | |
| 2681 | CALENC010000162.1 | GCA937910295_01342 | CDS | open | 10092-10466 | _na 124_aa | trxA | thioredoxin |
| 2682 | CALENC010000162.1 | GCA937910295_01343 | CDS | open | 10583-11296 | _na 237_aa | betI | Transcriptional regulator BetI |
| 2683 | CALENC010000162.1 | GCA937910295_01344 | CDS | open | 11345-11809 | _na 154_aa | (deoxy)nucleoside triphosphate pyrophosphohydrolase | |
| 2684 | CALENC010000162.1 | GCA937910295_01334 | gene | open | 45-1523 | |||
| 2685 | CALENC010000162.1 | GCA937910295_01335 | gene | open | 1527-2123 | recR | ||
| 2686 | CALENC010000162.1 | GCA937910295_01336 | gene | open | 2155-2880 | tcrX | ||
| 2687 | CALENC010000162.1 | GCA937910295_01337 | gene | open | 2889-4550 | walK | ||
| 2688 | CALENC010000162.1 | GCA937910295_01338 | gene | open | 4687-5634 | |||
| 2689 | CALENC010000162.1 | GCA937910295_01339 | gene | open | 5703-7433 | |||
| 2690 | CALENC010000162.1 | GCA937910295_01340 | gene | open | 7618-8934 | |||
| 2691 | CALENC010000162.1 | GCA937910295_01341 | gene | open | 8967-10016 | |||
| 2692 | CALENC010000162.1 | GCA937910295_01342 | gene | open | 10092-10466 | trxA | ||
| 2693 | CALENC010000162.1 | GCA937910295_01343 | gene | open | 10583-11296 | betI | ||
| 2694 | CALENC010000162.1 | GCA937910295_01344 | gene | open | 11345-11809 | |||
| 2695 | CALENC010000162.1 | GCA937910295_01345 | gene | open | 11893-11945 | trnG | ||
| 2696 | CALENC010000162.1 | GCA937910295_01345 | tRNA | open | 11893-11945 | trnG | tRNA-Gly(ccc) | |
| 2697 | CALENC010000163.1 | GCA937910295_01348 | CDS | open | 319-1362 | _na 347_aa | alcohol dehydrogenase (NADP(+)) | |
| 2698 | CALENC010000163.1 | GCA937910295_01348 | gene | open | 319-1362 | |||
| 2699 | CALENC010000163.1 | GCA937910295_01346 | gene | open | 2-75 | trnP | ||
| 2700 | CALENC010000163.1 | GCA937910295_01347 | gene | open | 163-233 | trnG | ||
| 2701 | CALENC010000163.1 | GCA937910295_01349 | gene | open | 1512-1584 | trnH | ||
| 2702 | CALENC010000163.1 | GCA937910295_01346 | tRNA | open | 2-75 | trnP | tRNA-Pro(tgg) | |
| 2703 | CALENC010000163.1 | GCA937910295_01347 | tRNA | open | 163-233 | trnG | tRNA-Gly(tcc) | |
| 2704 | CALENC010000163.1 | GCA937910295_01349 | tRNA | open | 1512-1584 | trnH | tRNA-His(gtg) | |
| 2705 | CALENC010000164.1 | GCA937910295_01350 | CDS | open | 1293-1805 | _na 170_aa | DUF2505 domain-containing protein | |
| 2706 | CALENC010000164.1 | GCA937910295_01351 | CDS | open | 1866-2330 | _na 154_aa | OsmC-like protein | |
| 2707 | CALENC010000164.1 | GCA937910295_01352 | CDS | open | 2426-3229 | _na 267_aa | thymidylate synthase | |
| 2708 | CALENC010000164.1 | GCA937910295_01353 | CDS | open | 3226-3831 | _na 201_aa | dihydrofolate reductase | |
| 2709 | CALENC010000164.1 | GCA937910295_01354 | CDS | open | 3784-5064 | _na 426_aa | rmuC | DNA recombination protein RmuC |
| 2710 | CALENC010000164.1 | GCA937910295_01356 | CDS | open | 5391-6425 | _na 344_aa | cell wall protein | |
| 2711 | CALENC010000164.1 | GCA937910295_01357 | CDS | open | 6600-7478 | _na 292_aa | DUF11 domain-containing protein | |
| 2712 | CALENC010000164.1 | GCA937910295_01358 | CDS | open | 7861-8565 | _na 234_aa | hypothetical protein | |
| 2713 | CALENC010000164.1 | GCA937910295_01350 | gene | open | 1293-1805 | |||
| 2714 | CALENC010000164.1 | GCA937910295_01351 | gene | open | 1866-2330 | |||
| 2715 | CALENC010000164.1 | GCA937910295_01352 | gene | open | 2426-3229 | |||
| 2716 | CALENC010000164.1 | GCA937910295_01353 | gene | open | 3226-3831 | |||
| 2717 | CALENC010000164.1 | GCA937910295_01354 | gene | open | 3784-5064 | rmuC | ||
| 2718 | CALENC010000164.1 | GCA937910295_01356 | gene | open | 5391-6425 | |||
| 2719 | CALENC010000164.1 | GCA937910295_01357 | gene | open | 6600-7478 | |||
| 2720 | CALENC010000164.1 | GCA937910295_01358 | gene | open | 7861-8565 | |||
| 2721 | CALENC010000164.1 | GCA937910295_01355 | gene | open | 5199-5272 | trnfM | ||
| 2722 | CALENC010000164.1 | GCA937910295_01355 | tRNA | open | 5199-5272 | trnfM | tRNA-fMet(cat) | |
| 2723 | CALENC010000165.1 | GCA937910295_01359 | CDS | open | 35-3571 | _na 1178_aa | smc | chromosome segregation protein SMC |
| 2724 | CALENC010000165.1 | GCA937910295_01360 | CDS | open | 3628-3984 | _na 118_aa | hypothetical protein | |
| 2725 | CALENC010000165.1 | GCA937910295_01359 | gene | open | 35-3571 | smc | ||
| 2726 | CALENC010000165.1 | GCA937910295_01360 | gene | open | 3628-3984 | |||
| 2727 | CALENC010000166.1 | GCA937910295_01361 | CDS | open | 82-261 | _na 59_aa | hypothetical protein | |
| 2728 | CALENC010000166.1 | GCA937910295_01362 | CDS | open | 237-764 | _na 175_aa | smpB | SsrA-binding protein SmpB |
| 2729 | CALENC010000166.1 | GCA937910295_01363 | CDS | open | 805-2076 | _na 423_aa | mepM | Murein DD-endopeptidase MepM |
| 2730 | CALENC010000166.1 | GCA937910295_01364 | CDS | open | 2081-2995 | _na 304_aa | ftsX | permease-like cell division protein FtsX |
| 2731 | CALENC010000166.1 | GCA937910295_01365 | CDS | open | 2995-3684 | _na 229_aa | ftsE | cell division ATP-binding protein FtsE |
| 2732 | CALENC010000166.1 | GCA937910295_01366 | CDS | open | 3790-4917 | _na 375_aa | prfB | peptide chain release factor 2 |
| 2733 | CALENC010000166.1 | GCA937910295_01367 | CDS | open | 5074-6216 | _na 380_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 2734 | CALENC010000166.1 | GCA937910295_01368 | CDS | open | 6238-6396 | _na 52_aa | hypothetical protein | |
| 2735 | CALENC010000166.1 | GCA937910295_01361 | gene | open | 82-261 | |||
| 2736 | CALENC010000166.1 | GCA937910295_01362 | gene | open | 237-764 | smpB | ||
| 2737 | CALENC010000166.1 | GCA937910295_01363 | gene | open | 805-2076 | mepM | ||
| 2738 | CALENC010000166.1 | GCA937910295_01364 | gene | open | 2081-2995 | ftsX | ||
| 2739 | CALENC010000166.1 | GCA937910295_01365 | gene | open | 2995-3684 | ftsE | ||
| 2740 | CALENC010000166.1 | GCA937910295_01366 | gene | open | 3790-4917 | prfB | ||
| 2741 | CALENC010000166.1 | GCA937910295_01367 | gene | open | 5074-6216 | potA | ||
| 2742 | CALENC010000166.1 | GCA937910295_01368 | gene | open | 6238-6396 | |||
| 2743 | CALENC010000167.1 | GCA937910295_01369 | CDS | open | 401-2098 | _na 565_aa | DUF1023 domain-containing protein | |
| 2744 | CALENC010000167.1 | GCA937910295_01370 | CDS | open | 2150-2644 | _na 164_aa | DUF4853 domain-containing protein | |
| 2745 | CALENC010000167.1 | GCA937910295_01369 | gene | open | 401-2098 | |||
| 2746 | CALENC010000167.1 | GCA937910295_01370 | gene | open | 2150-2644 | |||
| 2747 | CALENC010000168.1 | GCA937910295_01371 | CDS | open | 189-527 | _na 112_aa | PE domain-containing protein | |
| 2748 | CALENC010000168.1 | GCA937910295_01372 | CDS | open | 524-3367 | _na 947_aa | hypothetical protein | |
| 2749 | CALENC010000168.1 | GCA937910295_01373 | CDS | open | 3534-3881 | _na 115_aa | hypothetical protein | |
| 2750 | CALENC010000168.1 | GCA937910295_01374 | CDS | open | 3883-6675 | _na 930_aa | Putative T7SS secretion signal domain-containing protein | |
| 2751 | CALENC010000168.1 | GCA937910295_01375 | CDS | open | 6783-7073 | _na 96_aa | YCII-related domain-containing protein | |
| 2752 | CALENC010000168.1 | GCA937910295_01371 | gene | open | 189-527 | |||
| 2753 | CALENC010000168.1 | GCA937910295_01372 | gene | open | 524-3367 | |||
| 2754 | CALENC010000168.1 | GCA937910295_01373 | gene | open | 3534-3881 | |||
| 2755 | CALENC010000168.1 | GCA937910295_01374 | gene | open | 3883-6675 | |||
| 2756 | CALENC010000168.1 | GCA937910295_01375 | gene | open | 6783-7073 | |||
| 2757 | CALENC010000169.1 | regulatory_region | open | 1976-2108 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 2758 | CALENC010000169.1 | GCA937910295_01376 | CDS | open | 165-1094 | _na 309_aa | Universal stress protein | |
| 2759 | CALENC010000169.1 | GCA937910295_01377 | CDS | open | 1253-1972 | _na 239_aa | Putative endopeptidase p60 | |
| 2760 | CALENC010000169.1 | GCA937910295_01378 | CDS | open | 2277-2966 | _na 229_aa | ideR | Iron-dependent repressor IdeR |
| 2761 | CALENC010000169.1 | GCA937910295_01379 | CDS | open | 3098-4450 | _na 450_aa | Putative multidrug-efflux transporter/MT1297 | |
| 2762 | CALENC010000169.1 | GCA937910295_01380 | CDS | open | 4480-5934 | _na 484_aa | pbuG | Guanine/hypoxanthine permease PbuG |
| 2763 | CALENC010000169.1 | GCA937910295_01381 | CDS | open | 6041-6802 | _na 253_aa | DUF3027 domain-containing protein | |
| 2764 | CALENC010000169.1 | GCA937910295_01382 | CDS | open | 6795-7169 | _na 124_aa | Cold shock-like protein | |
| 2765 | CALENC010000169.1 | GCA937910295_01383 | CDS | open | 7846-7980 | _na 44_aa | hypothetical protein | |
| 2766 | CALENC010000169.1 | GCA937910295_01376 | gene | open | 165-1094 | |||
| 2767 | CALENC010000169.1 | GCA937910295_01377 | gene | open | 1253-1972 | |||
| 2768 | CALENC010000169.1 | GCA937910295_01378 | gene | open | 2277-2966 | ideR | ||
| 2769 | CALENC010000169.1 | GCA937910295_01379 | gene | open | 3098-4450 | |||
| 2770 | CALENC010000169.1 | GCA937910295_01380 | gene | open | 4480-5934 | pbuG | ||
| 2771 | CALENC010000169.1 | GCA937910295_01381 | gene | open | 6041-6802 | |||
| 2772 | CALENC010000169.1 | GCA937910295_01382 | gene | open | 6795-7169 | |||
| 2773 | CALENC010000169.1 | GCA937910295_01383 | gene | open | 7846-7980 | |||
| 2774 | CALENC010000170.1 | GCA937910295_01384 | CDS | open | 97-957 | _na 286_aa | hypothetical protein | |
| 2775 | CALENC010000170.1 | GCA937910295_01385 | CDS | open | 810-1178 | _na 122_aa | arsR | HTH arsR-type domain-containing protein |
| 2776 | CALENC010000170.1 | GCA937910295_01386 | CDS | open | 1644-2990 | _na 448_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 2777 | CALENC010000170.1 | GCA937910295_01387 | CDS | open | 2987-3727 | _na 246_aa | lolD | Lipoprotein-releasing system ATP-binding protein LolD |
| 2778 | CALENC010000170.1 | GCA937910295_01388 | CDS | open | 3861-4565 | _na 234_aa | Methyltransferase | |
| 2779 | CALENC010000170.1 | GCA937910295_01389 | CDS | open | 4662-5981 | _na 439_aa | 2-aminoadipate transaminase | |
| 2780 | CALENC010000170.1 | GCA937910295_01390 | CDS | open | 5997-6947 | _na 316_aa | D-alanine--D-alanine ligase | |
| 2781 | CALENC010000170.1 | GCA937910295_01391 | CDS | open | 7041-7676 | _na 211_aa | HAD hydrolase-like protein | |
| 2782 | CALENC010000170.1 | GCA937910295_01392 | CDS | open | 8103-9038 | _na 311_aa | parB | Chromosome partitioning protein ParB |
| 2783 | CALENC010000170.1 | GCA937910295_01384 | gene | open | 97-957 | |||
| 2784 | CALENC010000170.1 | GCA937910295_01385 | gene | open | 810-1178 | arsR | ||
| 2785 | CALENC010000170.1 | GCA937910295_01386 | gene | open | 1644-2990 | |||
| 2786 | CALENC010000170.1 | GCA937910295_01387 | gene | open | 2987-3727 | lolD | ||
| 2787 | CALENC010000170.1 | GCA937910295_01388 | gene | open | 3861-4565 | |||
| 2788 | CALENC010000170.1 | GCA937910295_01389 | gene | open | 4662-5981 | |||
| 2789 | CALENC010000170.1 | GCA937910295_01390 | gene | open | 5997-6947 | |||
| 2790 | CALENC010000170.1 | GCA937910295_01391 | gene | open | 7041-7676 | |||
| 2791 | CALENC010000170.1 | GCA937910295_01392 | gene | open | 8103-9038 | parB | ||
| 2792 | CALENC010000171.1 | GCA937910295_01393 | CDS | open | 27-788 | _na 253_aa | CRISPR-associated protein Cas6 C-terminal domain-containing protein | |
| 2793 | CALENC010000171.1 | GCA937910295_01394 | CDS | open | 804-1475 | _na 223_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 2794 | CALENC010000171.1 | GCA937910295_01395 | CDS | open | 1495-3456 | _na 653_aa | hypothetical protein | |
| 2795 | CALENC010000171.1 | GCA937910295_01396 | CDS | open | 3453-5390 | _na 645_aa | CRISPR-associated protein | |
| 2796 | CALENC010000171.1 | GCA937910295_01397 | CDS | open | 5387-7237 | _na 616_aa | CRISPR-associated protein | |
| 2797 | CALENC010000171.1 | GCA937910295_01398 | CDS | open | 7230-7853 | _na 207_aa | Phage tail protein | |
| 2798 | CALENC010000171.1 | GCA937910295_01399 | CDS | open | 7855-10266 | _na 803_aa | TIGR03986 family CRISPR-associated RAMP protein | |
| 2799 | CALENC010000171.1 | GCA937910295_01393 | gene | open | 27-788 | |||
| 2800 | CALENC010000171.1 | GCA937910295_01394 | gene | open | 804-1475 | |||
| 2801 | CALENC010000171.1 | GCA937910295_01395 | gene | open | 1495-3456 | |||
| 2802 | CALENC010000171.1 | GCA937910295_01396 | gene | open | 3453-5390 | |||
| 2803 | CALENC010000171.1 | GCA937910295_01397 | gene | open | 5387-7237 | |||
| 2804 | CALENC010000171.1 | GCA937910295_01398 | gene | open | 7230-7853 | |||
| 2805 | CALENC010000171.1 | GCA937910295_01399 | gene | open | 7855-10266 | |||
| 2806 | CALENC010000172.1 | GCA937910295_01400 | CDS | open | 739-1095 | _na 118_aa | rplS | 50S ribosomal protein L19 |
| 2807 | CALENC010000172.1 | GCA937910295_01401 | CDS | open | 1294-2619 | _na 441_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 2808 | CALENC010000172.1 | GCA937910295_01402 | CDS | open | 2634-3140 | _na 168_aa | rimM | ribosome maturation factor RimM |
| 2809 | CALENC010000172.1 | GCA937910295_01403 | CDS | open | 3216-3455 | _na 79_aa | RNA-binding protein | |
| 2810 | CALENC010000172.1 | GCA937910295_01404 | CDS | open | 3458-3943 | _na 161_aa | rpsP | 30S ribosomal protein S16 |
| 2811 | CALENC010000172.1 | GCA937910295_01405 | CDS | open | 4145-5251 | _na 368_aa | Amidohydrolase | |
| 2812 | CALENC010000172.1 | GCA937910295_01406 | CDS | open | 5251-6855 | _na 534_aa | ffh | signal recognition particle protein |
| 2813 | CALENC010000172.1 | GCA937910295_01407 | CDS | open | 6914-7459 | _na 181_aa | hypothetical protein | |
| 2814 | CALENC010000172.1 | GCA937910295_01400 | gene | open | 739-1095 | rplS | ||
| 2815 | CALENC010000172.1 | GCA937910295_01401 | gene | open | 1294-2619 | trmD | ||
| 2816 | CALENC010000172.1 | GCA937910295_01402 | gene | open | 2634-3140 | rimM | ||
| 2817 | CALENC010000172.1 | GCA937910295_01403 | gene | open | 3216-3455 | |||
| 2818 | CALENC010000172.1 | GCA937910295_01404 | gene | open | 3458-3943 | rpsP | ||
| 2819 | CALENC010000172.1 | GCA937910295_01405 | gene | open | 4145-5251 | |||
| 2820 | CALENC010000172.1 | GCA937910295_01406 | gene | open | 5251-6855 | ffh | ||
| 2821 | CALENC010000172.1 | GCA937910295_01407 | gene | open | 6914-7459 | |||
| 2822 | CALENC010000173.1 | GCA937910295_01408 | CDS | open | 78-1394 | _na 438_aa | class I tRNA ligase family protein | |
| 2823 | CALENC010000173.1 | GCA937910295_01409 | CDS | open | 1510-1758 | _na 82_aa | 50S ribosomal protein L7/L12 | |
| 2824 | CALENC010000173.1 | GCA937910295_01410 | CDS | open | 1912-2916 | _na 334_aa | HTH lacI-type domain-containing protein | |
| 2825 | CALENC010000173.1 | GCA937910295_01411 | CDS | open | 2944-4269 | _na 441_aa | Cyclodextrin-binding protein | |
| 2826 | CALENC010000173.1 | GCA937910295_01412 | CDS | open | 4273-5166 | _na 297_aa | lacF | Lactose transport system permease protein LacF |
| 2827 | CALENC010000173.1 | GCA937910295_01413 | CDS | open | 5163-6050 | _na 295_aa | araQ | L-arabinose transport system permease protein AraQ |
| 2828 | CALENC010000173.1 | GCA937910295_01414 | CDS | open | 6059-7546 | _na 495_aa | arylsulfatase | |
| 2829 | CALENC010000173.1 | GCA937910295_01415 | CDS | open | 7592-8155 | _na 187_aa | hypothetical protein | |
| 2830 | CALENC010000173.1 | GCA937910295_01408 | gene | open | 78-1394 | |||
| 2831 | CALENC010000173.1 | GCA937910295_01409 | gene | open | 1510-1758 | |||
| 2832 | CALENC010000173.1 | GCA937910295_01410 | gene | open | 1912-2916 | |||
| 2833 | CALENC010000173.1 | GCA937910295_01411 | gene | open | 2944-4269 | |||
| 2834 | CALENC010000173.1 | GCA937910295_01412 | gene | open | 4273-5166 | lacF | ||
| 2835 | CALENC010000173.1 | GCA937910295_01413 | gene | open | 5163-6050 | araQ | ||
| 2836 | CALENC010000173.1 | GCA937910295_01414 | gene | open | 6059-7546 | |||
| 2837 | CALENC010000173.1 | GCA937910295_01415 | gene | open | 7592-8155 | |||
| 2838 | CALENC010000174.1 | GCA937910295_01416 | CDS | open | 403-2145 | _na 580_aa | pyruvate dehydrogenase | |
| 2839 | CALENC010000174.1 | GCA937910295_01417 | CDS | open | 2322-5357 | _na 1011_aa | Tetratricopeptide repeat protein | |
| 2840 | CALENC010000174.1 | GCA937910295_01418 | CDS | open | 5384-7177 | _na 597_aa | HSP90 family protein | |
| 2841 | CALENC010000174.1 | GCA937910295_01419 | CDS | open | 7178-8146 | _na 322_aa | yicL | Putative inner membrane transporter YicL |
| 2842 | CALENC010000174.1 | GCA937910295_01420 | CDS | open | 8249-8686 | _na 145_aa | ohrB | Organic hydroperoxide resistance protein OhrB |
| 2843 | CALENC010000174.1 | GCA937910295_01421 | CDS | open | 8746-11778 | _na 1010_aa | Tetratricopeptide repeat protein | |
| 2844 | CALENC010000174.1 | GCA937910295_01422 | CDS | open | 12021-12197 | _na 58_aa | feoA | FeoA domain protein |
| 2845 | CALENC010000174.1 | GCA937910295_01423 | CDS | open | 12194-14224 | _na 676_aa | feoB | ferrous iron transport protein B |
| 2846 | CALENC010000174.1 | GCA937910295_01424 | CDS | open | 14224-14475 | _na 83_aa | Transcriptional regulator | |
| 2847 | CALENC010000174.1 | GCA937910295_01425 | CDS | open | 14569-16257 | _na 562_aa | formate--tetrahydrofolate ligase | |
| 2848 | CALENC010000174.1 | GCA937910295_01426 | CDS | open | 16373-20449 | _na 1358_aa | Restriction endonuclease type II-like domain-containing protein | |
| 2849 | CALENC010000174.1 | GCA937910295_01427 | CDS | open | 20446-20748 | _na 100_aa | hypothetical protein | |
| 2850 | CALENC010000174.1 | GCA937910295_01428 | CDS | open | 20755-21606 | _na 283_aa | aldo/keto reductase | |
| 2851 | CALENC010000174.1 | GCA937910295_01429 | CDS | open | 21617-22951 | _na 444_aa | amidohydrolase | |
| 2852 | CALENC010000174.1 | GCA937910295_01416 | gene | open | 403-2145 | |||
| 2853 | CALENC010000174.1 | GCA937910295_01417 | gene | open | 2322-5357 | |||
| 2854 | CALENC010000174.1 | GCA937910295_01418 | gene | open | 5384-7177 | |||
| 2855 | CALENC010000174.1 | GCA937910295_01419 | gene | open | 7178-8146 | yicL | ||
| 2856 | CALENC010000174.1 | GCA937910295_01420 | gene | open | 8249-8686 | ohrB | ||
| 2857 | CALENC010000174.1 | GCA937910295_01421 | gene | open | 8746-11778 | |||
| 2858 | CALENC010000174.1 | GCA937910295_01422 | gene | open | 12021-12197 | feoA | ||
| 2859 | CALENC010000174.1 | GCA937910295_01423 | gene | open | 12194-14224 | feoB | ||
| 2860 | CALENC010000174.1 | GCA937910295_01424 | gene | open | 14224-14475 | |||
| 2861 | CALENC010000174.1 | GCA937910295_01425 | gene | open | 14569-16257 | |||
| 2862 | CALENC010000174.1 | GCA937910295_01426 | gene | open | 16373-20449 | |||
| 2863 | CALENC010000174.1 | GCA937910295_01427 | gene | open | 20446-20748 | |||
| 2864 | CALENC010000174.1 | GCA937910295_01428 | gene | open | 20755-21606 | |||
| 2865 | CALENC010000174.1 | GCA937910295_01429 | gene | open | 21617-22951 | |||
| 2866 | CALENC010000175.1 | GCA937910295_01430 | CDS | open | 277-1149 | _na 290_aa | ABC transporter%2C ATP-binding protein | |
| 2867 | CALENC010000175.1 | GCA937910295_01431 | CDS | open | 1153-2355 | _na 400_aa | Lanthionine synthetase C-like protein | |
| 2868 | CALENC010000175.1 | GCA937910295_01432 | CDS | open | 2352-2852 | _na 166_aa | lantibiotic dehydratase C-terminal domain-containing protein | |
| 2869 | CALENC010000175.1 | GCA937910295_01430 | gene | open | 277-1149 | |||
| 2870 | CALENC010000175.1 | GCA937910295_01431 | gene | open | 1153-2355 | |||
| 2871 | CALENC010000175.1 | GCA937910295_01432 | gene | open | 2352-2852 | |||
| 2872 | CALENC010000176.1 | GCA937910295_01433 | CDS | open | 30-1061 | _na 343_aa | Ribonucleoside-diphosphate reductase subunit alpha 2 | |
| 2873 | CALENC010000176.1 | GCA937910295_01434 | CDS | open | 1356-1805 | _na 149_aa | DUF4190 domain-containing protein | |
| 2874 | CALENC010000176.1 | GCA937910295_01435 | CDS | open | 1810-3603 | _na 597_aa | Putative ATPase of the ABC class | |
| 2875 | CALENC010000176.1 | GCA937910295_01436 | CDS | open | 3685-4416 | _na 243_aa | macB | Macrolide export ATP-binding/permease protein MacB |
| 2876 | CALENC010000176.1 | GCA937910295_01437 | CDS | open | 4422-6968 | _na 848_aa | macB | Macrolide export ATP-binding/permease protein MacB |
| 2877 | CALENC010000176.1 | GCA937910295_01438 | CDS | open | 7101-7997 | _na 298_aa | Phospholipase | |
| 2878 | CALENC010000176.1 | GCA937910295_01439 | CDS | open | 8061-8630 | _na 189_aa | GtrA-like protein | |
| 2879 | CALENC010000176.1 | GCA937910295_01440 | CDS | open | 8631-10814 | _na 727_aa | Protease 2 | |
| 2880 | CALENC010000176.1 | GCA937910295_01441 | CDS | open | 10826-11803 | _na 325_aa | Ribonuclease H | |
| 2881 | CALENC010000176.1 | GCA937910295_01433 | gene | open | 30-1061 | |||
| 2882 | CALENC010000176.1 | GCA937910295_01434 | gene | open | 1356-1805 | |||
| 2883 | CALENC010000176.1 | GCA937910295_01435 | gene | open | 1810-3603 | |||
| 2884 | CALENC010000176.1 | GCA937910295_01436 | gene | open | 3685-4416 | macB | ||
| 2885 | CALENC010000176.1 | GCA937910295_01437 | gene | open | 4422-6968 | macB | ||
| 2886 | CALENC010000176.1 | GCA937910295_01438 | gene | open | 7101-7997 | |||
| 2887 | CALENC010000176.1 | GCA937910295_01439 | gene | open | 8061-8630 | |||
| 2888 | CALENC010000176.1 | GCA937910295_01440 | gene | open | 8631-10814 | |||
| 2889 | CALENC010000176.1 | GCA937910295_01441 | gene | open | 10826-11803 | |||
| 2890 | CALENC010000177.1 | GCA937910295_01443 | CDS | open | 292-1425 | _na 377_aa | hypothetical protein | |
| 2891 | CALENC010000177.1 | GCA937910295_01444 | CDS | open | 1576-1968 | _na 130_aa | MmcQ/YjbR family DNA-binding protein | |
| 2892 | CALENC010000177.1 | GCA937910295_01445 | CDS | open | 1999-2976 | _na 325_aa | Abi-like protein | |
| 2893 | CALENC010000177.1 | GCA937910295_01446 | CDS | open | 3130-3360 | _na 76_aa | hypothetical protein | |
| 2894 | CALENC010000177.1 | GCA937910295_01447 | CDS | open | 3474-4286 | _na 270_aa | Alpha/beta hydrolase | |
| 2895 | CALENC010000177.1 | GCA937910295_01448 | CDS | open | 4293-5267 | _na 324_aa | nlhH | Carboxylesterase NlhH |
| 2896 | CALENC010000177.1 | GCA937910295_01449 | CDS | open | 5555-6922 | _na 455_aa | Sugar ABC transporter substrate-binding protein | |
| 2897 | CALENC010000177.1 | GCA937910295_01450 | CDS | open | 6924-7865 | _na 313_aa | sugA | Trehalose transport system permease protein SugA |
| 2898 | CALENC010000177.1 | GCA937910295_01443 | gene | open | 292-1425 | |||
| 2899 | CALENC010000177.1 | GCA937910295_01444 | gene | open | 1576-1968 | |||
| 2900 | CALENC010000177.1 | GCA937910295_01445 | gene | open | 1999-2976 | |||
| 2901 | CALENC010000177.1 | GCA937910295_01446 | gene | open | 3130-3360 | |||
| 2902 | CALENC010000177.1 | GCA937910295_01447 | gene | open | 3474-4286 | |||
| 2903 | CALENC010000177.1 | GCA937910295_01448 | gene | open | 4293-5267 | nlhH | ||
| 2904 | CALENC010000177.1 | GCA937910295_01449 | gene | open | 5555-6922 | |||
| 2905 | CALENC010000177.1 | GCA937910295_01450 | gene | open | 6924-7865 | sugA | ||
| 2906 | CALENC010000177.1 | GCA937910295_01442 | gene | open | 1-68 | trnG | ||
| 2907 | CALENC010000177.1 | GCA937910295_01442 | tRNA | open | 1-68 | trnG | tRNA-Gly(ccc) | |
| 2908 | CALENC010000178.1 | GCA937910295_01451 | CDS | open | 97-1965 | _na 622_aa | hypothetical protein | |
| 2909 | CALENC010000178.1 | GCA937910295_01451 | gene | open | 97-1965 | |||
| 2910 | CALENC010000179.1 | GCA937910295_01452 | CDS | open | 1101-1334 | _na 77_aa | Heavy metal-binding domain-containing protein | |
| 2911 | CALENC010000179.1 | GCA937910295_01452 | gene | open | 1101-1334 | |||
| 2912 | CALENC010000180.1 | GCA937910295_01453 | CDS | open | 217-2934 | _na 905_aa | ppdK | pyruvate%2C phosphate dikinase |
| 2913 | CALENC010000180.1 | GCA937910295_01454 | CDS | open | 3103-3753 | _na 216_aa | hypothetical protein | |
| 2914 | CALENC010000180.1 | GCA937910295_01455 | CDS | open | 4213-4947 | _na 244_aa | Glycerophosphoryl diester phosphodiesterase | |
| 2915 | CALENC010000180.1 | GCA937910295_01456 | CDS | open | 4976-6310 | _na 444_aa | yihN | Inner membrane protein YihN |
| 2916 | CALENC010000180.1 | GCA937910295_01457 | CDS | open | 6588-7835 | _na 415_aa | RAMA domain-containing protein | |
| 2917 | CALENC010000180.1 | GCA937910295_01458 | CDS | open | 7832-8953 | _na 373_aa | Alpha/beta hydrolase family protein | |
| 2918 | CALENC010000180.1 | GCA937910295_01459 | CDS | open | 9167-10462 | _na 431_aa | ripA | Peptidoglycan endopeptidase RipA |
| 2919 | CALENC010000180.1 | GCA937910295_01460 | CDS | open | 10795-11619 | _na 274_aa | Carnitine transport ATP-binding protein OpuCA | |
| 2920 | CALENC010000180.1 | GCA937910295_01461 | CDS | open | 11616-12248 | _na 210_aa | yehY | Osmoprotectant uptake system permease protein YehY |
| 2921 | CALENC010000180.1 | GCA937910295_01462 | CDS | open | 12248-12919 | _na 223_aa | Carnitine transport permease protein OpuCB | |
| 2922 | CALENC010000180.1 | GCA937910295_01463 | CDS | open | 12980-13897 | _na 305_aa | osmF | Osmoprotectant uptake system substrate-binding protein OsmF |
| 2923 | CALENC010000180.1 | GCA937910295_01464 | CDS | open | 14263-15192 | _na 309_aa | DUF559 domain-containing protein | |
| 2924 | CALENC010000180.1 | GCA937910295_01465 | CDS | open | 15747-16244 | _na 165_aa | ppa | Inorganic pyrophosphatase |
| 2925 | CALENC010000180.1 | GCA937910295_01466 | CDS | open | 16362-17741 | _na 459_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 2926 | CALENC010000180.1 | GCA937910295_01467 | CDS | open | 17837-18664 | _na 275_aa | hypothetical protein | |
| 2927 | CALENC010000180.1 | GCA937910295_01468 | CDS | open | 18661-19761 | _na 366_aa | tRNA(Ile)-lysidine synthase | |
| 2928 | CALENC010000180.1 | GCA937910295_01469 | CDS | open | 19828-20382 | _na 184_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 2929 | CALENC010000180.1 | GCA937910295_01470 | CDS | open | 20394-22463 | _na 689_aa | ftsH | ATP-dependent zinc metalloprotease FtsH |
| 2930 | CALENC010000180.1 | GCA937910295_01471 | CDS | open | 22460-23032 | _na 190_aa | folE | GTP cyclohydrolase I FolE |
| 2931 | CALENC010000180.1 | GCA937910295_01472 | CDS | open | 23029-23892 | _na 287_aa | folP | dihydropteroate synthase |
| 2932 | CALENC010000180.1 | GCA937910295_01473 | CDS | open | 23900-26395 | _na 831_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 2933 | CALENC010000180.1 | GCA937910295_01474 | CDS | open | 26392-26934 | _na 180_aa | DUF3180 domain-containing protein | |
| 2934 | CALENC010000180.1 | GCA937910295_01475 | CDS | open | 26939-27814 | _na 291_aa | hypothetical protein | |
| 2935 | CALENC010000180.1 | GCA937910295_01476 | CDS | open | 27896-28825 | _na 309_aa | disA | DNA integrity scanning diadenylate cyclase DisA |
| 2936 | CALENC010000180.1 | GCA937910295_01453 | gene | open | 217-2934 | ppdK | ||
| 2937 | CALENC010000180.1 | GCA937910295_01454 | gene | open | 3103-3753 | |||
| 2938 | CALENC010000180.1 | GCA937910295_01455 | gene | open | 4213-4947 | |||
| 2939 | CALENC010000180.1 | GCA937910295_01456 | gene | open | 4976-6310 | yihN | ||
| 2940 | CALENC010000180.1 | GCA937910295_01457 | gene | open | 6588-7835 | |||
| 2941 | CALENC010000180.1 | GCA937910295_01458 | gene | open | 7832-8953 | |||
| 2942 | CALENC010000180.1 | GCA937910295_01459 | gene | open | 9167-10462 | ripA | ||
| 2943 | CALENC010000180.1 | GCA937910295_01460 | gene | open | 10795-11619 | |||
| 2944 | CALENC010000180.1 | GCA937910295_01461 | gene | open | 11616-12248 | yehY | ||
| 2945 | CALENC010000180.1 | GCA937910295_01462 | gene | open | 12248-12919 | |||
| 2946 | CALENC010000180.1 | GCA937910295_01463 | gene | open | 12980-13897 | osmF | ||
| 2947 | CALENC010000180.1 | GCA937910295_01464 | gene | open | 14263-15192 | |||
| 2948 | CALENC010000180.1 | GCA937910295_01465 | gene | open | 15747-16244 | ppa | ||
| 2949 | CALENC010000180.1 | GCA937910295_01466 | gene | open | 16362-17741 | dacB | ||
| 2950 | CALENC010000180.1 | GCA937910295_01467 | gene | open | 17837-18664 | |||
| 2951 | CALENC010000180.1 | GCA937910295_01468 | gene | open | 18661-19761 | |||
| 2952 | CALENC010000180.1 | GCA937910295_01469 | gene | open | 19828-20382 | hpt | ||
| 2953 | CALENC010000180.1 | GCA937910295_01470 | gene | open | 20394-22463 | ftsH | ||
| 2954 | CALENC010000180.1 | GCA937910295_01471 | gene | open | 22460-23032 | folE | ||
| 2955 | CALENC010000180.1 | GCA937910295_01472 | gene | open | 23029-23892 | folP | ||
| 2956 | CALENC010000180.1 | GCA937910295_01473 | gene | open | 23900-26395 | folK | ||
| 2957 | CALENC010000180.1 | GCA937910295_01474 | gene | open | 26392-26934 | |||
| 2958 | CALENC010000180.1 | GCA937910295_01475 | gene | open | 26939-27814 | |||
| 2959 | CALENC010000180.1 | GCA937910295_01476 | gene | open | 27896-28825 | disA | ||
| 2960 | CALENC010000181.1 | GCA937910295_01477 | CDS | open | 29-184 | _na 51_aa | hypothetical protein | |
| 2961 | CALENC010000181.1 | GCA937910295_01478 | CDS | open | 2174-2437 | _na 87_aa | hypothetical protein | |
| 2962 | CALENC010000181.1 | GCA937910295_01479 | CDS | open | 2767-3090 | _na 107_aa | Nucleotide pyrophosphohydrolase | |
| 2963 | CALENC010000181.1 | GCA937910295_01480 | CDS | open | 3153-4142 | _na 329_aa | Inosine/uridine-preferring nucleoside hydrolase domain-containing protein | |
| 2964 | CALENC010000181.1 | GCA937910295_01481 | CDS | open | 4145-5155 | _na 336_aa | Catabolite control protein A | |
| 2965 | CALENC010000181.1 | GCA937910295_01482 | CDS | open | 5180-6535 | _na 451_aa | Proline/betaine transporter | |
| 2966 | CALENC010000181.1 | GCA937910295_01483 | CDS | open | 6703-7887 | _na 394_aa | endonuclease domain-containing protein | |
| 2967 | CALENC010000181.1 | GCA937910295_01484 | CDS | open | 8051-8647 | _na 198_aa | hypothetical protein | |
| 2968 | CALENC010000181.1 | GCA937910295_01485 | CDS | open | 8690-9280 | _na 196_aa | hypothetical protein | |
| 2969 | CALENC010000181.1 | GCA937910295_01477 | gene | open | 29-184 | |||
| 2970 | CALENC010000181.1 | GCA937910295_01478 | gene | open | 2174-2437 | |||
| 2971 | CALENC010000181.1 | GCA937910295_01479 | gene | open | 2767-3090 | |||
| 2972 | CALENC010000181.1 | GCA937910295_01480 | gene | open | 3153-4142 | |||
| 2973 | CALENC010000181.1 | GCA937910295_01481 | gene | open | 4145-5155 | |||
| 2974 | CALENC010000181.1 | GCA937910295_01482 | gene | open | 5180-6535 | |||
| 2975 | CALENC010000181.1 | GCA937910295_01483 | gene | open | 6703-7887 | |||
| 2976 | CALENC010000181.1 | GCA937910295_01484 | gene | open | 8051-8647 | |||
| 2977 | CALENC010000181.1 | GCA937910295_01485 | gene | open | 8690-9280 | |||
| 2978 | CALENC010000182.1 | repeat_region | open | 6922-8114 | CRISPR array with 20 repeats of length 28%2C consensus sequence GTTTTCCCCGCGTGAGCGGGGATGAGCC and spacer length 32 | |||
| 2979 | CALENC010000182.1 | GCA937910295_01486 | CDS | open | 18-1526 | _na 502_aa | hypothetical protein | |
| 2980 | CALENC010000182.1 | GCA937910295_01487 | CDS | open | 1513-3186 | _na 557_aa | Cse1 family CRISPR-associated protein | |
| 2981 | CALENC010000182.1 | GCA937910295_01488 | CDS | open | 3183-3821 | _na 212_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 2982 | CALENC010000182.1 | GCA937910295_01489 | CDS | open | 3868-5034 | _na 388_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 2983 | CALENC010000182.1 | GCA937910295_01490 | CDS | open | 5031-5759 | _na 242_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 2984 | CALENC010000182.1 | GCA937910295_01491 | CDS | open | 5759-6508 | _na 249_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 2985 | CALENC010000182.1 | GCA937910295_01486 | gene | open | 18-1526 | |||
| 2986 | CALENC010000182.1 | GCA937910295_01487 | gene | open | 1513-3186 | |||
| 2987 | CALENC010000182.1 | GCA937910295_01488 | gene | open | 3183-3821 | casB | ||
| 2988 | CALENC010000182.1 | GCA937910295_01489 | gene | open | 3868-5034 | cas7e | ||
| 2989 | CALENC010000182.1 | GCA937910295_01490 | gene | open | 5031-5759 | cas5e | ||
| 2990 | CALENC010000182.1 | GCA937910295_01491 | gene | open | 5759-6508 | cas6e | ||
| 2991 | CALENC010000183.1 | GCA937910295_01492 | CDS | open | 2008-2775 | _na 255_aa | Ketoacyl reductase | |
| 2992 | CALENC010000183.1 | GCA937910295_01493 | CDS | open | 2796-3593 | _na 265_aa | exodeoxyribonuclease III | |
| 2993 | CALENC010000183.1 | GCA937910295_01494 | CDS | open | 3577-4143 | _na 188_aa | hypothetical protein | |
| 2994 | CALENC010000183.1 | GCA937910295_01492 | gene | open | 2008-2775 | |||
| 2995 | CALENC010000183.1 | GCA937910295_01493 | gene | open | 2796-3593 | |||
| 2996 | CALENC010000183.1 | GCA937910295_01494 | gene | open | 3577-4143 | |||
| 2997 | CALENC010000184.1 | GCA937910295_01495 | CDS | open | 98-313 | _na 71_aa | hypothetical protein | |
| 2998 | CALENC010000184.1 | GCA937910295_01496 | CDS | open | 313-585 | _na 90_aa | helix-turn-helix domain-containing protein | |
| 2999 | CALENC010000184.1 | GCA937910295_01497 | CDS | open | 587-1081 | _na 164_aa | hypothetical protein | |
| 3000 | CALENC010000184.1 | GCA937910295_01498 | CDS | open | 1087-1968 | _na 293_aa | hypothetical protein |

