BAKTAGenome Explorer: Rothia mucilaginosa clade-681 (GCA_937936265.1)
Select a Genome:
|
BAKTA Annotations for GCA_937936265.1
|
Search & Sort all 3706 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | CALGWP010000057.1 | GCA937936265_01515 | CDS | open | 34143-34649 | _na 168_aa | Thioesterase domain-containing protein | |
| 3002 | CALGWP010000057.1 | GCA937936265_01516 | CDS | open | 34783-36060 | _na 425_aa | Sodium:proton antiporter | |
| 3003 | CALGWP010000057.1 | GCA937936265_01517 | CDS | open | 36506-39514 | _na 1002_aa | polA | DNA polymerase I |
| 3004 | CALGWP010000057.1 | GCA937936265_01518 | CDS | open | 40218-41672 | _na 484_aa | rpsA | 30S ribosomal protein S1 |
| 3005 | CALGWP010000057.1 | GCA937936265_01519 | CDS | open | 41897-42532 | _na 211_aa | coaE | dephospho-CoA kinase |
| 3006 | CALGWP010000057.1 | GCA937936265_01520 | CDS | open | 42591-43277 | _na 228_aa | putative conserved protein | |
| 3007 | CALGWP010000057.1 | GCA937936265_01521 | CDS | open | 43487-44803 | _na 438_aa | 2-oxoglutarate dehydrogenase | |
| 3008 | CALGWP010000057.1 | GCA937936265_01522 | CDS | open | 44986-46131 | _na 381_aa | Iron(III) ABC transporter | |
| 3009 | CALGWP010000057.1 | GCA937936265_01523 | CDS | open | 46272-47231 | _na 319_aa | ABC transporter domain-containing protein | |
| 3010 | CALGWP010000057.1 | GCA937936265_01524 | CDS | open | 47231-48373 | _na 380_aa | ABC-type Fe3+-siderophore transport system%2C permease component | |
| 3011 | CALGWP010000057.1 | GCA937936265_01525 | CDS | open | 48798-50966 | _na 722_aa | uvrB | excinuclease ABC subunit UvrB |
| 3012 | CALGWP010000057.1 | GCA937936265_01526 | CDS | open | 51060-51911 | _na 283_aa | Ornithinee aminotransferase | |
| 3013 | CALGWP010000057.1 | GCA937936265_01527 | CDS | open | 52346-53551 | _na 401_aa | Transporter | |
| 3014 | CALGWP010000057.1 | GCA937936265_01528 | CDS | open | 53667-55118 | _na 483_aa | AB hydrolase-1 domain-containing protein | |
| 3015 | CALGWP010000057.1 | GCA937936265_01529 | CDS | open | 55211-57811 | _na 866_aa | DEAD/DEAH box helicase | |
| 3016 | CALGWP010000057.1 | GCA937936265_01530 | CDS | open | 58257-60167 | _na 636_aa | ABC transmembrane type-1 domain-containing protein | |
| 3017 | CALGWP010000057.1 | GCA937936265_01531 | CDS | open | 60169-61917 | _na 582_aa | ABC transporter ATP-binding protein | |
| 3018 | CALGWP010000057.1 | GCA937936265_01532 | CDS | open | 62323-64068 | _na 581_aa | bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase | |
| 3019 | CALGWP010000057.1 | GCA937936265_01533 | CDS | open | 64601-65374 | _na 257_aa | Band 7 domain-containing protein | |
| 3020 | CALGWP010000057.1 | GCA937936265_01534 | CDS | open | 65662-66504 | _na 280_aa | Transposase DDE domain-containing protein | |
| 3021 | CALGWP010000057.1 | GCA937936265_01535 | CDS | open | 66507-68924 | _na 805_aa | Nitric oxide reductase large subunit | |
| 3022 | CALGWP010000057.1 | GCA937936265_01536 | CDS | open | 69548-70228 | _na 226_aa | Phospholipid/glycerol acyltransferase domain-containing protein | |
| 3023 | CALGWP010000057.1 | GCA937936265_01537 | CDS | open | 70391-72022 | _na 543_aa | uvrC | excinuclease ABC subunit UvrC |
| 3024 | CALGWP010000057.1 | GCA937936265_01538 | CDS | open | 72056-72331 | _na 91_aa | helix-hairpin-helix domain-containing protein | |
| 3025 | CALGWP010000057.1 | GCA937936265_01485 | gene | open | 226-870 | orn | ||
| 3026 | CALGWP010000057.1 | GCA937936265_01486 | gene | open | 1142-2815 | mptB | ||
| 3027 | CALGWP010000057.1 | GCA937936265_01488 | gene | open | 3108-4004 | |||
| 3028 | CALGWP010000057.1 | GCA937936265_01489 | gene | open | 4366-4983 | |||
| 3029 | CALGWP010000057.1 | GCA937936265_01490 | gene | open | 5201-5548 | rplS | ||
| 3030 | CALGWP010000057.1 | GCA937936265_01491 | gene | open | 5773-6759 | lepB | ||
| 3031 | CALGWP010000057.1 | GCA937936265_01492 | gene | open | 6772-7596 | |||
| 3032 | CALGWP010000057.1 | GCA937936265_01493 | gene | open | 7689-8015 | |||
| 3033 | CALGWP010000057.1 | GCA937936265_01494 | gene | open | 8307-8762 | |||
| 3034 | CALGWP010000057.1 | GCA937936265_01495 | gene | open | 8762-10300 | |||
| 3035 | CALGWP010000057.1 | GCA937936265_01496 | gene | open | 10379-12172 | dprA | ||
| 3036 | CALGWP010000057.1 | GCA937936265_01497 | gene | open | 12412-13515 | xerC | ||
| 3037 | CALGWP010000057.1 | GCA937936265_01498 | gene | open | 13767-14666 | |||
| 3038 | CALGWP010000057.1 | GCA937936265_01499 | gene | open | 14783-15808 | |||
| 3039 | CALGWP010000057.1 | GCA937936265_01500 | gene | open | 16011-16253 | acpP | ||
| 3040 | CALGWP010000057.1 | GCA937936265_01501 | gene | open | 16470-17741 | fabF | ||
| 3041 | CALGWP010000057.1 | GCA937936265_01502 | gene | open | 19368-20099 | pnuC | ||
| 3042 | CALGWP010000057.1 | GCA937936265_01503 | gene | open | 20100-21410 | ribD | ||
| 3043 | CALGWP010000057.1 | GCA937936265_01504 | gene | open | 21676-22968 | |||
| 3044 | CALGWP010000057.1 | GCA937936265_01505 | gene | open | 22977-23798 | |||
| 3045 | CALGWP010000057.1 | GCA937936265_01506 | gene | open | 23855-24331 | ribH | ||
| 3046 | CALGWP010000057.1 | GCA937936265_01507 | gene | open | 24601-26211 | |||
| 3047 | CALGWP010000057.1 | GCA937936265_01508 | gene | open | 26226-27041 | trpC | ||
| 3048 | CALGWP010000057.1 | GCA937936265_01509 | gene | open | 27478-28869 | |||
| 3049 | CALGWP010000057.1 | GCA937936265_01510 | gene | open | 29050-30159 | ftsY | ||
| 3050 | CALGWP010000057.1 | GCA937936265_01511 | gene | open | 30380-31426 | |||
| 3051 | CALGWP010000057.1 | GCA937936265_01512 | gene | open | 31575-32477 | |||
| 3052 | CALGWP010000057.1 | GCA937936265_01513 | gene | open | 32916-33527 | |||
| 3053 | CALGWP010000057.1 | GCA937936265_01514 | gene | open | 33796-34044 | |||
| 3054 | CALGWP010000057.1 | GCA937936265_01515 | gene | open | 34143-34649 | |||
| 3055 | CALGWP010000057.1 | GCA937936265_01516 | gene | open | 34783-36060 | |||
| 3056 | CALGWP010000057.1 | GCA937936265_01517 | gene | open | 36506-39514 | polA | ||
| 3057 | CALGWP010000057.1 | GCA937936265_01518 | gene | open | 40218-41672 | rpsA | ||
| 3058 | CALGWP010000057.1 | GCA937936265_01519 | gene | open | 41897-42532 | coaE | ||
| 3059 | CALGWP010000057.1 | GCA937936265_01520 | gene | open | 42591-43277 | |||
| 3060 | CALGWP010000057.1 | GCA937936265_01521 | gene | open | 43487-44803 | |||
| 3061 | CALGWP010000057.1 | GCA937936265_01522 | gene | open | 44986-46131 | |||
| 3062 | CALGWP010000057.1 | GCA937936265_01523 | gene | open | 46272-47231 | |||
| 3063 | CALGWP010000057.1 | GCA937936265_01524 | gene | open | 47231-48373 | |||
| 3064 | CALGWP010000057.1 | GCA937936265_01525 | gene | open | 48798-50966 | uvrB | ||
| 3065 | CALGWP010000057.1 | GCA937936265_01526 | gene | open | 51060-51911 | |||
| 3066 | CALGWP010000057.1 | GCA937936265_01527 | gene | open | 52346-53551 | |||
| 3067 | CALGWP010000057.1 | GCA937936265_01528 | gene | open | 53667-55118 | |||
| 3068 | CALGWP010000057.1 | GCA937936265_01529 | gene | open | 55211-57811 | |||
| 3069 | CALGWP010000057.1 | GCA937936265_01530 | gene | open | 58257-60167 | |||
| 3070 | CALGWP010000057.1 | GCA937936265_01531 | gene | open | 60169-61917 | |||
| 3071 | CALGWP010000057.1 | GCA937936265_01532 | gene | open | 62323-64068 | |||
| 3072 | CALGWP010000057.1 | GCA937936265_01533 | gene | open | 64601-65374 | |||
| 3073 | CALGWP010000057.1 | GCA937936265_01534 | gene | open | 65662-66504 | |||
| 3074 | CALGWP010000057.1 | GCA937936265_01535 | gene | open | 66507-68924 | |||
| 3075 | CALGWP010000057.1 | GCA937936265_01536 | gene | open | 69548-70228 | |||
| 3076 | CALGWP010000057.1 | GCA937936265_01537 | gene | open | 70391-72022 | uvrC | ||
| 3077 | CALGWP010000057.1 | GCA937936265_01538 | gene | open | 72056-72331 | |||
| 3078 | CALGWP010000057.1 | GCA937936265_01484 | gene | open | 47-119 | trnH | ||
| 3079 | CALGWP010000057.1 | GCA937936265_01487 | gene | open | 2908-2983 | trnR | ||
| 3080 | CALGWP010000057.1 | GCA937936265_01484 | tRNA | open | 47-119 | trnH | tRNA-His(gtg) | |
| 3081 | CALGWP010000057.1 | GCA937936265_01487 | tRNA | open | 2908-2983 | trnR | tRNA-Arg(tct) | |
| 3082 | CALGWP010000058.1 | GCA937936265_01539 | CDS | open | 54-329 | _na 91_aa | hypothetical protein | |
| 3083 | CALGWP010000058.1 | GCA937936265_01540 | CDS | open | 1098-1262 | _na 54_aa | hypothetical protein | |
| 3084 | CALGWP010000058.1 | GCA937936265_01539 | gene | open | 54-329 | |||
| 3085 | CALGWP010000058.1 | GCA937936265_01540 | gene | open | 1098-1262 | |||
| 3086 | CALGWP010000059.1 | GCA937936265_01541 | CDS | open | 680-1552 | _na 290_aa | Phage holin family protein | |
| 3087 | CALGWP010000059.1 | GCA937936265_01542 | CDS | open | 1862-3067 | _na 401_aa | D-inositol 3-phosphate glycosyltransferase | |
| 3088 | CALGWP010000059.1 | GCA937936265_01544 | CDS | open | 3528-4610 | _na 360_aa | tolA | TolA protein |
| 3089 | CALGWP010000059.1 | GCA937936265_01545 | CDS | open | 4612-6828 | _na 738_aa | Flagellar motor component | |
| 3090 | CALGWP010000059.1 | GCA937936265_01546 | CDS | open | 6954-7655 | _na 233_aa | M23 family metallopeptidase | |
| 3091 | CALGWP010000059.1 | GCA937936265_01547 | CDS | open | 8101-8898 | _na 265_aa | rpsB | 30S ribosomal protein S2 |
| 3092 | CALGWP010000059.1 | GCA937936265_01548 | CDS | open | 9052-9882 | _na 276_aa | tsf | translation elongation factor Ts |
| 3093 | CALGWP010000059.1 | GCA937936265_01549 | CDS | open | 10077-10820 | _na 247_aa | pyrH | UMP kinase |
| 3094 | CALGWP010000059.1 | GCA937936265_01550 | CDS | open | 11116-11673 | _na 185_aa | frr | ribosome recycling factor |
| 3095 | CALGWP010000059.1 | GCA937936265_01551 | CDS | open | 11680-12588 | _na 302_aa | Phosphatidate cytidylyltransferase | |
| 3096 | CALGWP010000059.1 | GCA937936265_01552 | CDS | open | 12792-13379 | _na 195_aa | DivIVA domain repeat protein | |
| 3097 | CALGWP010000059.1 | GCA937936265_01553 | CDS | open | 13568-14893 | _na 441_aa | dxr | 1-deoxy-D-xylulose-5-phosphate reductoisomerase |
| 3098 | CALGWP010000059.1 | GCA937936265_01554 | CDS | open | 14736-15275 | _na 179_aa | hypothetical protein | |
| 3099 | CALGWP010000059.1 | GCA937936265_01555 | CDS | open | 15378-16232 | _na 284_aa | parA | Chromosome partitioning protein ParA |
| 3100 | CALGWP010000059.1 | GCA937936265_01556 | CDS | open | 16441-17631 | _na 396_aa | hlyD | Secretion protein HlyD |
| 3101 | CALGWP010000059.1 | GCA937936265_01557 | CDS | open | 17641-19689 | _na 682_aa | ABC transporter domain-containing protein | |
| 3102 | CALGWP010000059.1 | GCA937936265_01541 | gene | open | 680-1552 | |||
| 3103 | CALGWP010000059.1 | GCA937936265_01542 | gene | open | 1862-3067 | |||
| 3104 | CALGWP010000059.1 | GCA937936265_01544 | gene | open | 3528-4610 | tolA | ||
| 3105 | CALGWP010000059.1 | GCA937936265_01545 | gene | open | 4612-6828 | |||
| 3106 | CALGWP010000059.1 | GCA937936265_01546 | gene | open | 6954-7655 | |||
| 3107 | CALGWP010000059.1 | GCA937936265_01547 | gene | open | 8101-8898 | rpsB | ||
| 3108 | CALGWP010000059.1 | GCA937936265_01548 | gene | open | 9052-9882 | tsf | ||
| 3109 | CALGWP010000059.1 | GCA937936265_01549 | gene | open | 10077-10820 | pyrH | ||
| 3110 | CALGWP010000059.1 | GCA937936265_01550 | gene | open | 11116-11673 | frr | ||
| 3111 | CALGWP010000059.1 | GCA937936265_01551 | gene | open | 11680-12588 | |||
| 3112 | CALGWP010000059.1 | GCA937936265_01552 | gene | open | 12792-13379 | |||
| 3113 | CALGWP010000059.1 | GCA937936265_01553 | gene | open | 13568-14893 | dxr | ||
| 3114 | CALGWP010000059.1 | GCA937936265_01554 | gene | open | 14736-15275 | |||
| 3115 | CALGWP010000059.1 | GCA937936265_01555 | gene | open | 15378-16232 | parA | ||
| 3116 | CALGWP010000059.1 | GCA937936265_01556 | gene | open | 16441-17631 | hlyD | ||
| 3117 | CALGWP010000059.1 | GCA937936265_01557 | gene | open | 17641-19689 | |||
| 3118 | CALGWP010000059.1 | GCA937936265_01543 | gene | open | 3183-3256 | trnI | ||
| 3119 | CALGWP010000059.1 | GCA937936265_01543 | tRNA | open | 3183-3256 | trnI | tRNA-Ile2(cat) | |
| 3120 | CALGWP010000060.1 | regulatory_region | open | 6764-6876 | SAM (S-adenosyl methionine) riboswitch aptamer | |||
| 3121 | CALGWP010000060.1 | GCA937936265_01558 | CDS | open | 64-2241 | _na 725_aa | Protease 2 | |
| 3122 | CALGWP010000060.1 | GCA937936265_01559 | CDS | open | 2471-3673 | _na 400_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 3123 | CALGWP010000060.1 | GCA937936265_01560 | CDS | open | 3749-4546 | _na 265_aa | ABC-2 type transporter domain-containing protein | |
| 3124 | CALGWP010000060.1 | GCA937936265_01561 | CDS | open | 4581-5441 | _na 286_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 3125 | CALGWP010000060.1 | GCA937936265_01562 | CDS | open | 5438-6424 | _na 328_aa | ABC transporter domain-containing protein | |
| 3126 | CALGWP010000060.1 | GCA937936265_01563 | CDS | open | 6980-8326 | _na 448_aa | mET17 | bifunctional o-acetylhomoserine/o-acetylserine sulfhydrylase |
| 3127 | CALGWP010000060.1 | GCA937936265_01564 | CDS | open | 8516-9844 | _na 442_aa | homoserine O-acetyltransferase | |
| 3128 | CALGWP010000060.1 | GCA937936265_01565 | CDS | open | 10237-10551 | _na 104_aa | HTH merR-type domain-containing protein | |
| 3129 | CALGWP010000060.1 | GCA937936265_01566 | CDS | open | 10689-11504 | _na 271_aa | HTH merR-type domain-containing protein | |
| 3130 | CALGWP010000060.1 | GCA937936265_01567 | CDS | open | 11599-12351 | _na 250_aa | Phospholipase/carboxylesterase/thioesterase domain-containing protein | |
| 3131 | CALGWP010000060.1 | GCA937936265_01568 | CDS | open | 12755-12970 | _na 71_aa | RNA-binding protein | |
| 3132 | CALGWP010000060.1 | GCA937936265_01569 | CDS | open | 13203-14582 | _na 459_aa | gRS1 | glycine--tRNA ligase |
| 3133 | CALGWP010000060.1 | GCA937936265_01570 | CDS | open | 14711-15688 | _na 325_aa | N-acetyltransferase domain-containing protein | |
| 3134 | CALGWP010000060.1 | GCA937936265_01571 | CDS | open | 15889-17055 | _na 388_aa | dusB | tRNA dihydrouridine synthase DusB |
| 3135 | CALGWP010000060.1 | GCA937936265_01572 | CDS | open | 17131-19320 | _na 729_aa | DNA primase | |
| 3136 | CALGWP010000060.1 | GCA937936265_01573 | CDS | open | 19213-19428 | _na 71_aa | hypothetical protein | |
| 3137 | CALGWP010000060.1 | GCA937936265_01558 | gene | open | 64-2241 | |||
| 3138 | CALGWP010000060.1 | GCA937936265_01559 | gene | open | 2471-3673 | rsgA | ||
| 3139 | CALGWP010000060.1 | GCA937936265_01560 | gene | open | 3749-4546 | |||
| 3140 | CALGWP010000060.1 | GCA937936265_01561 | gene | open | 4581-5441 | |||
| 3141 | CALGWP010000060.1 | GCA937936265_01562 | gene | open | 5438-6424 | |||
| 3142 | CALGWP010000060.1 | GCA937936265_01563 | gene | open | 6980-8326 | mET17 | ||
| 3143 | CALGWP010000060.1 | GCA937936265_01564 | gene | open | 8516-9844 | |||
| 3144 | CALGWP010000060.1 | GCA937936265_01565 | gene | open | 10237-10551 | |||
| 3145 | CALGWP010000060.1 | GCA937936265_01566 | gene | open | 10689-11504 | |||
| 3146 | CALGWP010000060.1 | GCA937936265_01567 | gene | open | 11599-12351 | |||
| 3147 | CALGWP010000060.1 | GCA937936265_01568 | gene | open | 12755-12970 | |||
| 3148 | CALGWP010000060.1 | GCA937936265_01569 | gene | open | 13203-14582 | gRS1 | ||
| 3149 | CALGWP010000060.1 | GCA937936265_01570 | gene | open | 14711-15688 | |||
| 3150 | CALGWP010000060.1 | GCA937936265_01571 | gene | open | 15889-17055 | dusB | ||
| 3151 | CALGWP010000060.1 | GCA937936265_01572 | gene | open | 17131-19320 | |||
| 3152 | CALGWP010000060.1 | GCA937936265_01573 | gene | open | 19213-19428 | |||
| 3153 | CALGWP010000060.1 | GCA937936265_01574 | gene | open | 19548-19620 | trnN | ||
| 3154 | CALGWP010000060.1 | GCA937936265_01574 | tRNA | open | 19548-19620 | trnN | tRNA-Asn(gtt) | |
| 3155 | CALGWP010000061.1 | repeat_region | open | 4164-5715 | CRISPR array with 22 repeats of length 24%2C consensus sequence TTCGGGCGGGGACTTTCATTGAGG and spacer length 48 | |||
| 3156 | CALGWP010000061.1 | GCA937936265_01575 | CDS | open | 37-510 | _na 157_aa | hypothetical protein | |
| 3157 | CALGWP010000061.1 | GCA937936265_01576 | CDS | open | 877-1227 | _na 116_aa | hypothetical protein | |
| 3158 | CALGWP010000061.1 | GCA937936265_01577 | CDS | open | 1374-1589 | _na 71_aa | hypothetical protein | |
| 3159 | CALGWP010000061.1 | GCA937936265_01578 | CDS | open | 2046-3656 | _na 536_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 3160 | CALGWP010000061.1 | GCA937936265_01579 | CDS | open | 3656-3955 | _na 99_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3161 | CALGWP010000061.1 | GCA937936265_01580 | CDS | open | 7131-8351 | _na 406_aa | Type I-U CRISPR-associated protein Cas7 | |
| 3162 | CALGWP010000061.1 | GCA937936265_01581 | CDS | open | 8353-9942 | _na 529_aa | csb2 | type I-U CRISPR-associated protein Csb2 |
| 3163 | CALGWP010000061.1 | GCA937936265_01582 | CDS | open | 9935-12784 | _na 949_aa | cas3u | type I-U CRISPR-associated helicase/endonuclease Cas3 |
| 3164 | CALGWP010000061.1 | GCA937936265_01583 | CDS | open | 12784-13848 | _na 354_aa | Aldehyde dehydrogenase | |
| 3165 | CALGWP010000061.1 | GCA937936265_01584 | CDS | open | 14001-14753 | _na 250_aa | pnuC | Nicotinamide mononucleotide transporter PnuC |
| 3166 | CALGWP010000061.1 | GCA937936265_01585 | CDS | open | 15241-16320 | _na 359_aa | SLH domain-containing protein | |
| 3167 | CALGWP010000061.1 | GCA937936265_01586 | CDS | open | 16816-19896 | _na 1026_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 3168 | CALGWP010000061.1 | GCA937936265_01587 | CDS | open | 20475-22667 | _na 730_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 3169 | CALGWP010000061.1 | GCA937936265_01575 | gene | open | 37-510 | |||
| 3170 | CALGWP010000061.1 | GCA937936265_01576 | gene | open | 877-1227 | |||
| 3171 | CALGWP010000061.1 | GCA937936265_01577 | gene | open | 1374-1589 | |||
| 3172 | CALGWP010000061.1 | GCA937936265_01578 | gene | open | 2046-3656 | cas1 | ||
| 3173 | CALGWP010000061.1 | GCA937936265_01579 | gene | open | 3656-3955 | cas2 | ||
| 3174 | CALGWP010000061.1 | GCA937936265_01580 | gene | open | 7131-8351 | |||
| 3175 | CALGWP010000061.1 | GCA937936265_01581 | gene | open | 8353-9942 | csb2 | ||
| 3176 | CALGWP010000061.1 | GCA937936265_01582 | gene | open | 9935-12784 | cas3u | ||
| 3177 | CALGWP010000061.1 | GCA937936265_01583 | gene | open | 12784-13848 | |||
| 3178 | CALGWP010000061.1 | GCA937936265_01584 | gene | open | 14001-14753 | pnuC | ||
| 3179 | CALGWP010000061.1 | GCA937936265_01585 | gene | open | 15241-16320 | |||
| 3180 | CALGWP010000061.1 | GCA937936265_01586 | gene | open | 16816-19896 | |||
| 3181 | CALGWP010000061.1 | GCA937936265_01587 | gene | open | 20475-22667 | |||
| 3182 | CALGWP010000062.1 | GCA937936265_01588 | CDS | open | 25-1212 | _na 395_aa | gluconolactonase | |
| 3183 | CALGWP010000062.1 | GCA937936265_01589 | CDS | open | 2153-2617 | _na 154_aa | hypothetical protein | |
| 3184 | CALGWP010000062.1 | GCA937936265_01588 | gene | open | 25-1212 | |||
| 3185 | CALGWP010000062.1 | GCA937936265_01589 | gene | open | 2153-2617 | |||
| 3186 | CALGWP010000063.1 | GCA937936265_01590 | CDS | open | 172-429 | _na 85_aa | hypothetical protein | |
| 3187 | CALGWP010000063.1 | GCA937936265_01591 | CDS | open | 463-768 | _na 101_aa | hypothetical protein | |
| 3188 | CALGWP010000063.1 | GCA937936265_01592 | CDS | open | 817-1032 | _na 71_aa | hypothetical protein | |
| 3189 | CALGWP010000063.1 | GCA937936265_01590 | gene | open | 172-429 | |||
| 3190 | CALGWP010000063.1 | GCA937936265_01591 | gene | open | 463-768 | |||
| 3191 | CALGWP010000063.1 | GCA937936265_01592 | gene | open | 817-1032 | |||
| 3192 | CALGWP010000064.1 | regulatory_region | open | 4586-4799 | lysM-Actino RNA | |||
| 3193 | CALGWP010000064.1 | GCA937936265_01593 | CDS | open | 184-1689 | _na 501_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 3194 | CALGWP010000064.1 | GCA937936265_01594 | CDS | open | 1689-3293 | _na 534_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 3195 | CALGWP010000064.1 | GCA937936265_01595 | CDS | open | 3309-3605 | _na 98_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 3196 | CALGWP010000064.1 | GCA937936265_01596 | CDS | open | 3821-4585 | _na 254_aa | lysM | LysM domain-containing protein |
| 3197 | CALGWP010000064.1 | GCA937936265_01597 | CDS | open | 4880-5032 | _na 50_aa | hypothetical protein | |
| 3198 | CALGWP010000064.1 | GCA937936265_01598 | CDS | open | 5282-7513 | _na 743_aa | ligA | NAD-dependent DNA ligase LigA |
| 3199 | CALGWP010000064.1 | GCA937936265_01599 | CDS | open | 7737-8630 | _na 297_aa | Serine/threonine protein phosphatase | |
| 3200 | CALGWP010000064.1 | GCA937936265_01600 | CDS | open | 8627-9778 | _na 383_aa | Adenylate cyclase | |
| 3201 | CALGWP010000064.1 | GCA937936265_01601 | CDS | open | 10070-10558 | _na 162_aa | DUF304 domain-containing protein | |
| 3202 | CALGWP010000064.1 | GCA937936265_01602 | CDS | open | 10683-11648 | _na 321_aa | biotin--[biotin carboxyl-carrier protein] ligase | |
| 3203 | CALGWP010000064.1 | GCA937936265_01603 | CDS | open | 11870-12151 | _na 93_aa | YCII-related domain-containing protein | |
| 3204 | CALGWP010000064.1 | GCA937936265_01604 | CDS | open | 12477-14078 | _na 533_aa | Acetyl-CoA carboxylase%2C carboxyltransferase component | |
| 3205 | CALGWP010000064.1 | GCA937936265_01605 | CDS | open | 14151-14543 | _na 130_aa | Acyl-CoA carboxylase subunit epsilon | |
| 3206 | CALGWP010000064.1 | GCA937936265_01606 | CDS | open | 14773-15930 | _na 385_aa | Restriction endonuclease | |
| 3207 | CALGWP010000064.1 | GCA937936265_01607 | CDS | open | 16406-18868 | _na 820_aa | Restriction endonuclease type IV Mrr domain-containing protein | |
| 3208 | CALGWP010000064.1 | GCA937936265_01608 | CDS | open | 19101-20858 | _na 585_aa | DUF885 domain-containing protein | |
| 3209 | CALGWP010000064.1 | GCA937936265_01609 | CDS | open | 20993-22285 | _na 430_aa | Glutathionylspermidine synthase pre-ATP-grasp-like domain-containing protein | |
| 3210 | CALGWP010000064.1 | GCA937936265_01610 | CDS | open | 22420-23370 | _na 316_aa | Lysozyme | |
| 3211 | CALGWP010000064.1 | GCA937936265_01593 | gene | open | 184-1689 | gatB | ||
| 3212 | CALGWP010000064.1 | GCA937936265_01594 | gene | open | 1689-3293 | gatA | ||
| 3213 | CALGWP010000064.1 | GCA937936265_01595 | gene | open | 3309-3605 | gatC | ||
| 3214 | CALGWP010000064.1 | GCA937936265_01596 | gene | open | 3821-4585 | lysM | ||
| 3215 | CALGWP010000064.1 | GCA937936265_01597 | gene | open | 4880-5032 | |||
| 3216 | CALGWP010000064.1 | GCA937936265_01598 | gene | open | 5282-7513 | ligA | ||
| 3217 | CALGWP010000064.1 | GCA937936265_01599 | gene | open | 7737-8630 | |||
| 3218 | CALGWP010000064.1 | GCA937936265_01600 | gene | open | 8627-9778 | |||
| 3219 | CALGWP010000064.1 | GCA937936265_01601 | gene | open | 10070-10558 | |||
| 3220 | CALGWP010000064.1 | GCA937936265_01602 | gene | open | 10683-11648 | |||
| 3221 | CALGWP010000064.1 | GCA937936265_01603 | gene | open | 11870-12151 | |||
| 3222 | CALGWP010000064.1 | GCA937936265_01604 | gene | open | 12477-14078 | |||
| 3223 | CALGWP010000064.1 | GCA937936265_01605 | gene | open | 14151-14543 | |||
| 3224 | CALGWP010000064.1 | GCA937936265_01606 | gene | open | 14773-15930 | |||
| 3225 | CALGWP010000064.1 | GCA937936265_01607 | gene | open | 16406-18868 | |||
| 3226 | CALGWP010000064.1 | GCA937936265_01608 | gene | open | 19101-20858 | |||
| 3227 | CALGWP010000064.1 | GCA937936265_01609 | gene | open | 20993-22285 | |||
| 3228 | CALGWP010000064.1 | GCA937936265_01610 | gene | open | 22420-23370 | |||
| 3229 | CALGWP010000065.1 | GCA937936265_01611 | CDS | open | 337-2643 | _na 768_aa | hypothetical protein | |
| 3230 | CALGWP010000065.1 | GCA937936265_01612 | CDS | open | 3104-4345 | _na 413_aa | Permease of the major facilitator superfamily | |
| 3231 | CALGWP010000065.1 | GCA937936265_01613 | CDS | open | 4524-5207 | _na 227_aa | Single-stranded DNA-specific exonuclease | |
| 3232 | CALGWP010000065.1 | GCA937936265_01614 | CDS | open | 5420-6151 | _na 243_aa | Manganese transport regulator | |
| 3233 | CALGWP010000065.1 | GCA937936265_01615 | CDS | open | 6246-7130 | _na 294_aa | Metal ABC transporter permease | |
| 3234 | CALGWP010000065.1 | GCA937936265_01616 | CDS | open | 7131-7964 | _na 277_aa | ABC transporter domain-containing protein | |
| 3235 | CALGWP010000065.1 | GCA937936265_01617 | CDS | open | 8201-9163 | _na 320_aa | Iron-binding protein | |
| 3236 | CALGWP010000065.1 | GCA937936265_01618 | CDS | open | 9500-10339 | _na 279_aa | exodeoxyribonuclease III | |
| 3237 | CALGWP010000065.1 | GCA937936265_01619 | CDS | open | 10530-11339 | _na 269_aa | Metal ABC transporter substrate-binding protein | |
| 3238 | CALGWP010000065.1 | GCA937936265_01620 | CDS | open | 11830-13158 | _na 442_aa | Rhamnogalacturonase A/B/Epimerase-like pectate lyase domain-containing protein | |
| 3239 | CALGWP010000065.1 | GCA937936265_01611 | gene | open | 337-2643 | |||
| 3240 | CALGWP010000065.1 | GCA937936265_01612 | gene | open | 3104-4345 | |||
| 3241 | CALGWP010000065.1 | GCA937936265_01613 | gene | open | 4524-5207 | |||
| 3242 | CALGWP010000065.1 | GCA937936265_01614 | gene | open | 5420-6151 | |||
| 3243 | CALGWP010000065.1 | GCA937936265_01615 | gene | open | 6246-7130 | |||
| 3244 | CALGWP010000065.1 | GCA937936265_01616 | gene | open | 7131-7964 | |||
| 3245 | CALGWP010000065.1 | GCA937936265_01617 | gene | open | 8201-9163 | |||
| 3246 | CALGWP010000065.1 | GCA937936265_01618 | gene | open | 9500-10339 | |||
| 3247 | CALGWP010000065.1 | GCA937936265_01619 | gene | open | 10530-11339 | |||
| 3248 | CALGWP010000065.1 | GCA937936265_01620 | gene | open | 11830-13158 | |||
| 3249 | CALGWP010000066.1 | GCA937936265_01621 | CDS | open | 17-463 | _na 148_aa | Luciferase-like domain-containing protein | |
| 3250 | CALGWP010000066.1 | GCA937936265_01621 | gene | open | 17-463 | |||
| 3251 | CALGWP010000067.1 | GCA937936265_01622 | CDS | open | 277-747 | _na 156_aa | Excisionase | |
| 3252 | CALGWP010000067.1 | GCA937936265_01623 | CDS | open | 741-1385 | _na 214_aa | Toxin PIN | |
| 3253 | CALGWP010000067.1 | GCA937936265_01622 | gene | open | 277-747 | |||
| 3254 | CALGWP010000067.1 | GCA937936265_01623 | gene | open | 741-1385 | |||
| 3255 | CALGWP010000068.1 | GCA937936265_01624 | CDS | open | 77-1255 | _na 392_aa | TIGR03773 family transporter-associated surface protein | |
| 3256 | CALGWP010000068.1 | GCA937936265_01625 | CDS | open | 1242-2993 | _na 583_aa | anchored repeat ABC transporter%2C substrate-binding protein | |
| 3257 | CALGWP010000068.1 | GCA937936265_01626 | CDS | open | 3087-4163 | _na 358_aa | Peptidase | |
| 3258 | CALGWP010000068.1 | GCA937936265_01627 | CDS | open | 4160-5038 | _na 292_aa | ABC transporter domain-containing protein | |
| 3259 | CALGWP010000068.1 | GCA937936265_01628 | CDS | open | 5035-5889 | _na 284_aa | anchored repeat-type ABC transporter permease subunit | |
| 3260 | CALGWP010000068.1 | GCA937936265_01629 | CDS | open | 6186-7256 | _na 356_aa | tdh | Enoyl reductase (ER) domain-containing protein |
| 3261 | CALGWP010000068.1 | GCA937936265_01630 | CDS | open | 7600-7695 | _na 31_aa | hypothetical protein | |
| 3262 | CALGWP010000068.1 | GCA937936265_01631 | CDS | open | 7747-9078 | _na 443_aa | NADH dehydrogenase | |
| 3263 | CALGWP010000068.1 | GCA937936265_01632 | CDS | open | 9276-10841 | _na 521_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3264 | CALGWP010000068.1 | GCA937936265_01633 | CDS | open | 11039-11617 | _na 192_aa | HTH tetR-type domain-containing protein | |
| 3265 | CALGWP010000068.1 | GCA937936265_01634 | CDS | open | 11754-12074 | _na 106_aa | putative conserved protein | |
| 3266 | CALGWP010000068.1 | GCA937936265_01635 | CDS | open | 12336-13148 | _na 270_aa | Nudix hydrolase domain-containing protein | |
| 3267 | CALGWP010000068.1 | GCA937936265_01636 | CDS | open | 13741-15576 | _na 611_aa | ABC transporter domain-containing protein | |
| 3268 | CALGWP010000068.1 | GCA937936265_01637 | CDS | open | 15570-15827 | _na 85_aa | hypothetical protein | |
| 3269 | CALGWP010000068.1 | GCA937936265_01638 | CDS | open | 15824-16234 | _na 136_aa | ABC transporter ATP-binding protein | |
| 3270 | CALGWP010000068.1 | GCA937936265_01639 | CDS | open | 16379-19225 | _na 948_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3271 | CALGWP010000068.1 | GCA937936265_01640 | CDS | open | 19419-20264 | _na 281_aa | araC | Methylated-DNA--[protein]-cysteine S-methyltransferase |
| 3272 | CALGWP010000068.1 | GCA937936265_01641 | CDS | open | 20670-21293 | _na 207_aa | sodA | Superoxide dismutase |
| 3273 | CALGWP010000068.1 | GCA937936265_01642 | CDS | open | 22504-22671 | _na 55_aa | hypothetical protein | |
| 3274 | CALGWP010000068.1 | GCA937936265_01643 | CDS | open | 22784-23335 | _na 183_aa | marR | MarR family transcriptional regulator |
| 3275 | CALGWP010000068.1 | GCA937936265_01644 | CDS | open | 23850-24374 | _na 174_aa | Ferritin | |
| 3276 | CALGWP010000068.1 | GCA937936265_01645 | CDS | open | 24618-25970 | _na 450_aa | nhaA | Na+/H+ antiporter NhaA |
| 3277 | CALGWP010000068.1 | GCA937936265_01646 | CDS | open | 26022-29372 | _na 1116_aa | lysX | bifunctional lysylphosphatidylglycerol synthetase/lysine--tRNA ligase LysX |
| 3278 | CALGWP010000068.1 | GCA937936265_01647 | CDS | open | 29710-31263 | _na 517_aa | Amino acid carrier protein | |
| 3279 | CALGWP010000068.1 | GCA937936265_01648 | CDS | open | 31458-31745 | _na 95_aa | Cardiolipin synthase N-terminal domain-containing protein | |
| 3280 | CALGWP010000068.1 | GCA937936265_01650 | CDS | open | 32203-33066 | _na 287_aa | FHA domain-containing protein | |
| 3281 | CALGWP010000068.1 | GCA937936265_01651 | CDS | open | 33066-33530 | _na 154_aa | Protein containing forkhead-associated domain | |
| 3282 | CALGWP010000068.1 | GCA937936265_01652 | CDS | open | 33534-35297 | _na 587_aa | PPM-type phosphatase domain-containing protein | |
| 3283 | CALGWP010000068.1 | GCA937936265_01653 | CDS | open | 35290-36750 | _na 486_aa | peptidoglycan glycosyltransferase | |
| 3284 | CALGWP010000068.1 | GCA937936265_01654 | CDS | open | 36743-38182 | _na 479_aa | Cell division protein FtsI/penicillin-binding protein 2 | |
| 3285 | CALGWP010000068.1 | GCA937936265_01655 | CDS | open | 38179-39936 | _na 585_aa | non-specific serine/threonine protein kinase | |
| 3286 | CALGWP010000068.1 | GCA937936265_01656 | CDS | open | 39984-42122 | _na 712_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 3287 | CALGWP010000068.1 | GCA937936265_01657 | CDS | open | 42336-42968 | _na 210_aa | aminodeoxychorismate/anthranilate synthase component II | |
| 3288 | CALGWP010000068.1 | GCA937936265_01658 | CDS | open | 42984-43145 | _na 53_aa | DUF4175 domain-containing protein | |
| 3289 | CALGWP010000068.1 | GCA937936265_01659 | CDS | open | 43164-43913 | _na 249_aa | Sortase | |
| 3290 | CALGWP010000068.1 | GCA937936265_01660 | CDS | open | 44073-44387 | _na 104_aa | crgA | Cell division protein CrgA |
| 3291 | CALGWP010000068.1 | GCA937936265_01661 | CDS | open | 44587-45504 | _na 305_aa | HTH lysR-type domain-containing protein | |
| 3292 | CALGWP010000068.1 | GCA937936265_01662 | CDS | open | 45713-46345 | _na 210_aa | Lysine efflux permease | |
| 3293 | CALGWP010000068.1 | GCA937936265_01663 | CDS | open | 46368-47801 | _na 477_aa | D-mannonate dehydratase | |
| 3294 | CALGWP010000068.1 | GCA937936265_01664 | CDS | open | 47849-48397 | _na 182_aa | GTPase | |
| 3295 | CALGWP010000068.1 | GCA937936265_01624 | gene | open | 77-1255 | |||
| 3296 | CALGWP010000068.1 | GCA937936265_01625 | gene | open | 1242-2993 | |||
| 3297 | CALGWP010000068.1 | GCA937936265_01626 | gene | open | 3087-4163 | |||
| 3298 | CALGWP010000068.1 | GCA937936265_01627 | gene | open | 4160-5038 | |||
| 3299 | CALGWP010000068.1 | GCA937936265_01628 | gene | open | 5035-5889 | |||
| 3300 | CALGWP010000068.1 | GCA937936265_01629 | gene | open | 6186-7256 | tdh | ||
| 3301 | CALGWP010000068.1 | GCA937936265_01630 | gene | open | 7600-7695 | |||
| 3302 | CALGWP010000068.1 | GCA937936265_01631 | gene | open | 7747-9078 | |||
| 3303 | CALGWP010000068.1 | GCA937936265_01632 | gene | open | 9276-10841 | |||
| 3304 | CALGWP010000068.1 | GCA937936265_01633 | gene | open | 11039-11617 | |||
| 3305 | CALGWP010000068.1 | GCA937936265_01634 | gene | open | 11754-12074 | |||
| 3306 | CALGWP010000068.1 | GCA937936265_01635 | gene | open | 12336-13148 | |||
| 3307 | CALGWP010000068.1 | GCA937936265_01636 | gene | open | 13741-15576 | |||
| 3308 | CALGWP010000068.1 | GCA937936265_01637 | gene | open | 15570-15827 | |||
| 3309 | CALGWP010000068.1 | GCA937936265_01638 | gene | open | 15824-16234 | |||
| 3310 | CALGWP010000068.1 | GCA937936265_01639 | gene | open | 16379-19225 | |||
| 3311 | CALGWP010000068.1 | GCA937936265_01640 | gene | open | 19419-20264 | araC | ||
| 3312 | CALGWP010000068.1 | GCA937936265_01641 | gene | open | 20670-21293 | sodA | ||
| 3313 | CALGWP010000068.1 | GCA937936265_01642 | gene | open | 22504-22671 | |||
| 3314 | CALGWP010000068.1 | GCA937936265_01643 | gene | open | 22784-23335 | marR | ||
| 3315 | CALGWP010000068.1 | GCA937936265_01644 | gene | open | 23850-24374 | |||
| 3316 | CALGWP010000068.1 | GCA937936265_01645 | gene | open | 24618-25970 | nhaA | ||
| 3317 | CALGWP010000068.1 | GCA937936265_01646 | gene | open | 26022-29372 | lysX | ||
| 3318 | CALGWP010000068.1 | GCA937936265_01647 | gene | open | 29710-31263 | |||
| 3319 | CALGWP010000068.1 | GCA937936265_01648 | gene | open | 31458-31745 | |||
| 3320 | CALGWP010000068.1 | GCA937936265_01650 | gene | open | 32203-33066 | |||
| 3321 | CALGWP010000068.1 | GCA937936265_01651 | gene | open | 33066-33530 | |||
| 3322 | CALGWP010000068.1 | GCA937936265_01652 | gene | open | 33534-35297 | |||
| 3323 | CALGWP010000068.1 | GCA937936265_01653 | gene | open | 35290-36750 | |||
| 3324 | CALGWP010000068.1 | GCA937936265_01654 | gene | open | 36743-38182 | |||
| 3325 | CALGWP010000068.1 | GCA937936265_01655 | gene | open | 38179-39936 | |||
| 3326 | CALGWP010000068.1 | GCA937936265_01656 | gene | open | 39984-42122 | pknB | ||
| 3327 | CALGWP010000068.1 | GCA937936265_01657 | gene | open | 42336-42968 | |||
| 3328 | CALGWP010000068.1 | GCA937936265_01658 | gene | open | 42984-43145 | |||
| 3329 | CALGWP010000068.1 | GCA937936265_01659 | gene | open | 43164-43913 | |||
| 3330 | CALGWP010000068.1 | GCA937936265_01660 | gene | open | 44073-44387 | crgA | ||
| 3331 | CALGWP010000068.1 | GCA937936265_01661 | gene | open | 44587-45504 | |||
| 3332 | CALGWP010000068.1 | GCA937936265_01662 | gene | open | 45713-46345 | |||
| 3333 | CALGWP010000068.1 | GCA937936265_01663 | gene | open | 46368-47801 | |||
| 3334 | CALGWP010000068.1 | GCA937936265_01664 | gene | open | 47849-48397 | |||
| 3335 | CALGWP010000068.1 | GCA937936265_01649 | gene | open | 31888-31974 | trnL | ||
| 3336 | CALGWP010000068.1 | GCA937936265_01649 | tRNA | open | 31888-31974 | trnL | tRNA-Leu(cag) | |
| 3337 | CALGWP010000069.1 | regulatory_region | open | 107954-108113 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 3338 | CALGWP010000069.1 | regulatory_region | open | 113821-113879 | Rothia-sucC RNA | |||
| 3339 | CALGWP010000069.1 | GCA937936265_01665 | CDS | open | 8-943 | _na 311_aa | PH domain-containing protein | |
| 3340 | CALGWP010000069.1 | GCA937936265_01666 | CDS | open | 1072-2034 | _na 320_aa | DUF2520 domain-containing protein | |
| 3341 | CALGWP010000069.1 | GCA937936265_01667 | CDS | open | 2031-2978 | _na 315_aa | panC | pantoate--beta-alanine ligase |
| 3342 | CALGWP010000069.1 | GCA937936265_01668 | CDS | open | 3036-4619 | _na 527_aa | lysS | lysine--tRNA ligase |
| 3343 | CALGWP010000069.1 | GCA937936265_01669 | CDS | open | 4646-4849 | _na 67_aa | hypothetical protein | |
| 3344 | CALGWP010000069.1 | GCA937936265_01670 | CDS | open | 5297-5650 | _na 117_aa | Lsr2 family protein | |
| 3345 | CALGWP010000069.1 | GCA937936265_01671 | CDS | open | 6689-9271 | _na 860_aa | clpC | ATP-dependent Clp protease ClpC |
| 3346 | CALGWP010000069.1 | GCA937936265_01672 | CDS | open | 9406-10428 | _na 340_aa | Adenine DNA glycosylase | |
| 3347 | CALGWP010000069.1 | GCA937936265_01673 | CDS | open | 10521-11300 | _na 259_aa | DUF4232 domain-containing protein | |
| 3348 | CALGWP010000069.1 | GCA937936265_01674 | CDS | open | 11399-11638 | _na 79_aa | Phosphoglycerol transferase | |
| 3349 | CALGWP010000069.1 | GCA937936265_01675 | CDS | open | 11772-12857 | _na 361_aa | disA | DNA integrity scanning diadenylate cyclase DisA |
| 3350 | CALGWP010000069.1 | GCA937936265_01676 | CDS | open | 13057-14490 | _na 477_aa | radA | DNA repair protein RadA |
| 3351 | CALGWP010000069.1 | GCA937936265_01677 | CDS | open | 14623-15951 | _na 442_aa | Integral membrane bound transporter domain-containing protein | |
| 3352 | CALGWP010000069.1 | GCA937936265_01678 | CDS | open | 16097-17812 | _na 571_aa | polysaccharide pyruvyl transferase family protein | |
| 3353 | CALGWP010000069.1 | GCA937936265_01679 | CDS | open | 17816-18868 | _na 350_aa | Glycosyltransferase 2-like domain-containing protein | |
| 3354 | CALGWP010000069.1 | GCA937936265_01680 | CDS | open | 19011-20045 | _na 344_aa | Phosphate transporter | |
| 3355 | CALGWP010000069.1 | GCA937936265_01681 | CDS | open | 20045-20662 | _na 205_aa | Phosphate transport regulator | |
| 3356 | CALGWP010000069.1 | GCA937936265_01682 | CDS | open | 21081-21854 | _na 257_aa | Histone acetyltransferase | |
| 3357 | CALGWP010000069.1 | GCA937936265_01684 | CDS | open | 22183-22692 | _na 169_aa | L-asparaginase N-terminal domain-containing protein | |
| 3358 | CALGWP010000069.1 | GCA937936265_01685 | CDS | open | 22694-23359 | _na 221_aa | Amino acid transporter | |
| 3359 | CALGWP010000069.1 | GCA937936265_01686 | CDS | open | 23559-24362 | _na 267_aa | ostA | Organic solvent tolerance protein OstA |
| 3360 | CALGWP010000069.1 | GCA937936265_01687 | CDS | open | 24473-25066 | _na 197_aa | Multidrug DMT transporter permease | |
| 3361 | CALGWP010000069.1 | GCA937936265_01688 | CDS | open | 25146-26825 | _na 559_aa | ABC transporter permease | |
| 3362 | CALGWP010000069.1 | GCA937936265_01689 | CDS | open | 26918-27772 | _na 284_aa | Multidrug ABC transporter permease | |
| 3363 | CALGWP010000069.1 | GCA937936265_01690 | CDS | open | 27785-28312 | _na 175_aa | DUF2127 domain-containing protein | |
| 3364 | CALGWP010000069.1 | GCA937936265_01691 | CDS | open | 28698-29348 | _na 216_aa | Nitrate ABC transporter permease | |
| 3365 | CALGWP010000069.1 | GCA937936265_01692 | CDS | open | 29481-30083 | _na 200_aa | ABC transporter permease | |
| 3366 | CALGWP010000069.1 | GCA937936265_01693 | CDS | open | 30216-30872 | _na 218_aa | putative membrane-associated protein | |
| 3367 | CALGWP010000069.1 | GCA937936265_01694 | CDS | open | 31210-33396 | _na 728_aa | recQ | ATP-dependent DNA helicase RecQ |
| 3368 | CALGWP010000069.1 | GCA937936265_01695 | CDS | open | 33438-33965 | _na 175_aa | tRNA-specific adenosine deaminase | |
| 3369 | CALGWP010000069.1 | GCA937936265_01696 | CDS | open | 34264-35175 | _na 303_aa | ABC-type multidrug transport system%2C ATPase component | |
| 3370 | CALGWP010000069.1 | GCA937936265_01697 | CDS | open | 35178-37784 | _na 868_aa | ABC-2 type transporter transmembrane domain-containing protein | |
| 3371 | CALGWP010000069.1 | GCA937936265_01698 | CDS | open | 37863-38483 | _na 206_aa | Transcriptional regulator | |
| 3372 | CALGWP010000069.1 | GCA937936265_01700 | CDS | open | 38912-39550 | _na 212_aa | upp | uracil phosphoribosyltransferase |
| 3373 | CALGWP010000069.1 | GCA937936265_01701 | CDS | open | 39899-39994 | _na 31_aa | hypothetical protein | |
| 3374 | CALGWP010000069.1 | GCA937936265_01702 | CDS | open | 40126-40878 | _na 250_aa | Transcriptional regulator | |
| 3375 | CALGWP010000069.1 | GCA937936265_01703 | CDS | open | 41011-41556 | _na 181_aa | sixA | Phosphohistidine phosphatase SixA |
| 3376 | CALGWP010000069.1 | GCA937936265_01705 | CDS | open | 41995-42342 | _na 115_aa | DUF4190 domain-containing protein | |
| 3377 | CALGWP010000069.1 | GCA937936265_01706 | CDS | open | 42552-43040 | _na 162_aa | Polyprenyltransferase | |
| 3378 | CALGWP010000069.1 | GCA937936265_01707 | CDS | open | 43242-43886 | _na 214_aa | Polyprenyltransferase | |
| 3379 | CALGWP010000069.1 | GCA937936265_01708 | CDS | open | 44059-44493 | _na 144_aa | DUF4190 domain-containing protein | |
| 3380 | CALGWP010000069.1 | GCA937936265_01709 | CDS | open | 44580-45014 | _na 144_aa | DUF4190 domain-containing protein | |
| 3381 | CALGWP010000069.1 | GCA937936265_01710 | CDS | open | 45123-45566 | _na 147_aa | Polyprenyltransferase | |
| 3382 | CALGWP010000069.1 | GCA937936265_01712 | CDS | open | 45883-46893 | _na 336_aa | Enoyl reductase (ER) domain-containing protein | |
| 3383 | CALGWP010000069.1 | GCA937936265_01713 | CDS | open | 47142-47681 | _na 179_aa | Dehydrogenase | |
| 3384 | CALGWP010000069.1 | GCA937936265_01714 | CDS | open | 47900-48775 | _na 291_aa | Aldolase | |
| 3385 | CALGWP010000069.1 | GCA937936265_01715 | CDS | open | 48902-49168 | _na 88_aa | hypothetical protein | |
| 3386 | CALGWP010000069.1 | GCA937936265_01717 | CDS | open | 49669-50433 | _na 254_aa | Thioredoxin domain-containing protein | |
| 3387 | CALGWP010000069.1 | GCA937936265_01718 | CDS | open | 50433-51221 | _na 262_aa | SAM-dependent methyltransferase | |
| 3388 | CALGWP010000069.1 | GCA937936265_01719 | CDS | open | 51380-52354 | _na 324_aa | eamA | EamA domain-containing protein |
| 3389 | CALGWP010000069.1 | GCA937936265_01720 | CDS | open | 52540-53601 | _na 353_aa | eamA | EamA domain-containing protein |
| 3390 | CALGWP010000069.1 | GCA937936265_01721 | CDS | open | 53873-54754 | _na 293_aa | Di-and tripeptidase | |
| 3391 | CALGWP010000069.1 | GCA937936265_01722 | CDS | open | 54861-56294 | _na 477_aa | purB | adenylosuccinate lyase |
| 3392 | CALGWP010000069.1 | GCA937936265_01723 | CDS | open | 56546-57139 | _na 197_aa | ABC transporter substrate-binding protein | |
| 3393 | CALGWP010000069.1 | GCA937936265_01724 | CDS | open | 57159-59567 | _na 802_aa | Topoisomerase IA | |
| 3394 | CALGWP010000069.1 | GCA937936265_01725 | CDS | open | 59820-60947 | _na 375_aa | Histidinol-phosphate aminotransferase | |
| 3395 | CALGWP010000069.1 | GCA937936265_01726 | CDS | open | 61361-62527 | _na 388_aa | 2-oxoisovalerate dehydrogenase subunit alpha | |
| 3396 | CALGWP010000069.1 | GCA937936265_01727 | CDS | open | 62530-63516 | _na 328_aa | 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) | |
| 3397 | CALGWP010000069.1 | GCA937936265_01728 | CDS | open | 63616-65091 | _na 491_aa | Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex | |
| 3398 | CALGWP010000069.1 | GCA937936265_01729 | CDS | open | 65267-66367 | _na 366_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3399 | CALGWP010000069.1 | GCA937936265_01730 | CDS | open | 66413-67075 | _na 220_aa | Acetyltransferase | |
| 3400 | CALGWP010000069.1 | GCA937936265_01731 | CDS | open | 67078-69138 | _na 686_aa | long-chain-fatty-acid--CoA ligase | |
| 3401 | CALGWP010000069.1 | GCA937936265_01732 | CDS | open | 69451-70335 | _na 294_aa | Methionine-binding protein | |
| 3402 | CALGWP010000069.1 | GCA937936265_01733 | CDS | open | 70477-71532 | _na 351_aa | ABC-type metal ion transport system%2C ATPase component | |
| 3403 | CALGWP010000069.1 | GCA937936265_01734 | CDS | open | 71533-72228 | _na 231_aa | Methionine ABC transporter ATP-binding protein | |
| 3404 | CALGWP010000069.1 | GCA937936265_01735 | CDS | open | 72376-72534 | _na 52_aa | hypothetical protein | |
| 3405 | CALGWP010000069.1 | GCA937936265_01736 | CDS | open | 73448-73678 | _na 76_aa | hypothetical protein | |
| 3406 | CALGWP010000069.1 | GCA937936265_01737 | CDS | open | 73955-74719 | _na 254_aa | Haloacid dehalogenase | |
| 3407 | CALGWP010000069.1 | GCA937936265_01738 | CDS | open | 74896-76314 | _na 472_aa | ABC3 transporter permease protein domain-containing protein | |
| 3408 | CALGWP010000069.1 | GCA937936265_01739 | CDS | open | 76314-77312 | _na 332_aa | ABC transporter domain-containing protein | |
| 3409 | CALGWP010000069.1 | GCA937936265_01740 | CDS | open | 77541-78830 | _na 429_aa | Phosphoglycerate mutase | |
| 3410 | CALGWP010000069.1 | GCA937936265_01741 | CDS | open | 78820-79299 | _na 159_aa | VanZ-like domain-containing protein | |
| 3411 | CALGWP010000069.1 | GCA937936265_01742 | CDS | open | 79718-80509 | _na 263_aa | D-beta-D-heptose 1-phosphate adenosyltransferase | |
| 3412 | CALGWP010000069.1 | GCA937936265_01743 | CDS | open | 80509-81459 | _na 316_aa | Fructose-1-phosphate kinase | |
| 3413 | CALGWP010000069.1 | GCA937936265_01744 | CDS | open | 81642-83645 | _na 667_aa | PTS lactose transporter subunit IIC | |
| 3414 | CALGWP010000069.1 | GCA937936265_01745 | CDS | open | 83745-85439 | _na 564_aa | Phosphoenolpyruvate-protein phosphotransferase | |
| 3415 | CALGWP010000069.1 | GCA937936265_01746 | CDS | open | 85674-85952 | _na 92_aa | ptsH | Phosphocarrier protein |
| 3416 | CALGWP010000069.1 | GCA937936265_01747 | CDS | open | 86375-88519 | _na 714_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 3417 | CALGWP010000069.1 | GCA937936265_01748 | CDS | open | 88659-89330 | _na 223_aa | uracil-DNA glycosylase | |
| 3418 | CALGWP010000069.1 | GCA937936265_01749 | CDS | open | 89519-89788 | _na 89_aa | DNA-directed RNA polymerase subunit beta | |
| 3419 | CALGWP010000069.1 | GCA937936265_01750 | CDS | open | 90050-90640 | _na 196_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 3420 | CALGWP010000069.1 | GCA937936265_01751 | CDS | open | 91038-92660 | _na 540_aa | groL | chaperonin GroEL |
| 3421 | CALGWP010000069.1 | GCA937936265_01752 | CDS | open | 92906-94039 | _na 377_aa | rlmC | 23S rRNA (uracil(747)-C(5))-methyltransferase RlmC |
| 3422 | CALGWP010000069.1 | GCA937936265_01753 | CDS | open | 94136-94657 | _na 173_aa | mycothiol transferase | |
| 3423 | CALGWP010000069.1 | GCA937936265_01754 | CDS | open | 94848-96257 | _na 469_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 3424 | CALGWP010000069.1 | GCA937936265_01755 | CDS | open | 96564-97265 | _na 233_aa | Isochorismate hydrolase | |
| 3425 | CALGWP010000069.1 | GCA937936265_01756 | CDS | open | 97262-98029 | _na 255_aa | 2%2C3-dihydro-2%2C3-dihydroxybenzoate dehydrogenase | |
| 3426 | CALGWP010000069.1 | GCA937936265_01757 | CDS | open | 98116-99219 | _na 367_aa | isochorismate synthase | |
| 3427 | CALGWP010000069.1 | GCA937936265_01758 | CDS | open | 99340-100344 | _na 334_aa | 4'-phosphopantetheinyl transferase domain-containing protein | |
| 3428 | CALGWP010000069.1 | GCA937936265_01759 | CDS | open | 100495-101955 | _na 486_aa | Ribonuclease H | |
| 3429 | CALGWP010000069.1 | GCA937936265_01760 | CDS | open | 102187-102477 | _na 96_aa | ESAT-6-like protein | |
| 3430 | CALGWP010000069.1 | GCA937936265_01761 | CDS | open | 102893-104392 | _na 499_aa | histidine kinase | |
| 3431 | CALGWP010000069.1 | GCA937936265_01762 | CDS | open | 104394-105098 | _na 234_aa | ompR | Response regulator consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain |
| 3432 | CALGWP010000069.1 | GCA937936265_01763 | CDS | open | 105173-105445 | _na 90_aa | Multidrug ABC transporter ATPase | |
| 3433 | CALGWP010000069.1 | GCA937936265_01764 | CDS | open | 105554-106348 | _na 264_aa | DUF3027 domain-containing protein | |
| 3434 | CALGWP010000069.1 | GCA937936265_01765 | CDS | open | 106559-107263 | _na 234_aa | Mn-dependent transcriptional regulator | |
| 3435 | CALGWP010000069.1 | GCA937936265_01766 | CDS | open | 108114-108827 | _na 237_aa | sagA | SagA protein |
| 3436 | CALGWP010000069.1 | GCA937936265_01767 | CDS | open | 109010-110026 | _na 338_aa | DUF4031 domain-containing protein | |
| 3437 | CALGWP010000069.1 | GCA937936265_01769 | CDS | open | 110456-113425 | _na 989_aa | pcrA | DNA helicase PcrA |
| 3438 | CALGWP010000069.1 | GCA937936265_01770 | CDS | open | 113885-115051 | _na 388_aa | sucC | ADP-forming succinate--CoA ligase subunit beta |
| 3439 | CALGWP010000069.1 | GCA937936265_01771 | CDS | open | 115081-115998 | _na 305_aa | sucD | succinate--CoA ligase subunit alpha |
| 3440 | CALGWP010000069.1 | GCA937936265_01772 | CDS | open | 116358-117284 | _na 308_aa | Amino acid oxidase | |
| 3441 | CALGWP010000069.1 | GCA937936265_01773 | CDS | open | 117455-118714 | _na 419_aa | Rubrerythrin diiron-binding domain-containing protein | |
| 3442 | CALGWP010000069.1 | GCA937936265_01774 | CDS | open | 118984-119481 | _na 165_aa | dps | DNA starvation/stationary phase protection protein Dps |
| 3443 | CALGWP010000069.1 | GCA937936265_01775 | CDS | open | 119854-120510 | _na 218_aa | Phosphoglycolate phosphatase | |
| 3444 | CALGWP010000069.1 | GCA937936265_01776 | CDS | open | 120529-121212 | _na 227_aa | NAD(P)-dependent oxidoreductase | |
| 3445 | CALGWP010000069.1 | GCA937936265_01777 | CDS | open | 121474-124083 | _na 869_aa | clpB | ATP-dependent chaperone ClpB |
| 3446 | CALGWP010000069.1 | GCA937936265_01778 | CDS | open | 124244-125212 | _na 322_aa | NAD-dependent protein deacetylase | |
| 3447 | CALGWP010000069.1 | GCA937936265_01779 | CDS | open | 125412-126635 | _na 407_aa | Protein containing Glucan-binding domain | |
| 3448 | CALGWP010000069.1 | GCA937936265_01780 | CDS | open | 126954-128012 | _na 352_aa | Calcium-binding protein | |
| 3449 | CALGWP010000069.1 | GCA937936265_01781 | CDS | open | 128327-129049 | _na 240_aa | SAM-dependent methyltransferase | |
| 3450 | CALGWP010000069.1 | GCA937936265_01782 | CDS | open | 129173-130093 | _na 306_aa | VTC domain-containing protein | |
| 3451 | CALGWP010000069.1 | GCA937936265_01783 | CDS | open | 130335-132038 | _na 567_aa | Carbohydrate-binding domain-containing protein | |
| 3452 | CALGWP010000069.1 | GCA937936265_01784 | CDS | open | 132452-132661 | _na 69_aa | DUF3073 domain-containing protein | |
| 3453 | CALGWP010000069.1 | GCA937936265_01785 | CDS | open | 133077-133700 | _na 207_aa | hypothetical protein | |
| 3454 | CALGWP010000069.1 | GCA937936265_01786 | CDS | open | 133745-134050 | _na 101_aa | Phosphodiester glycosidase domain-containing protein | |
| 3455 | CALGWP010000069.1 | GCA937936265_01787 | CDS | open | 134047-135168 | _na 373_aa | Dolichyl-phosphate beta-D-mannosyltransferase | |
| 3456 | CALGWP010000069.1 | GCA937936265_01788 | CDS | open | 135459-137177 | _na 572_aa | Peptidase S8/S53 domain-containing protein | |
| 3457 | CALGWP010000069.1 | GCA937936265_01789 | CDS | open | 137784-139718 | _na 644_aa | Peptidase S8/S53 domain-containing protein | |
| 3458 | CALGWP010000069.1 | GCA937936265_01790 | CDS | open | 139823-141784 | _na 653_aa | Peptidase S8/S53 domain-containing protein | |
| 3459 | CALGWP010000069.1 | GCA937936265_01791 | CDS | open | 142424-143569 | _na 381_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 3460 | CALGWP010000069.1 | GCA937936265_01792 | CDS | open | 143566-145320 | _na 584_aa | purF | amidophosphoribosyltransferase |
| 3461 | CALGWP010000069.1 | GCA937936265_01793 | CDS | open | 145561-146013 | _na 150_aa | Ni%2CFe-hydrogenase III large subunit | |
| 3462 | CALGWP010000069.1 | GCA937936265_01794 | CDS | open | 146016-147143 | _na 375_aa | L-asparaginase II | |
| 3463 | CALGWP010000069.1 | GCA937936265_01795 | CDS | open | 147582-147920 | _na 112_aa | MtN3/saliva family protein | |
| 3464 | CALGWP010000069.1 | GCA937936265_01796 | CDS | open | 148006-149358 | _na 450_aa | Phosphoribosylamine--glycine ligase | |
| 3465 | CALGWP010000069.1 | GCA937936265_01797 | CDS | open | 149626-150552 | _na 308_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 3466 | CALGWP010000069.1 | GCA937936265_01798 | CDS | open | 150672-151520 | _na 282_aa | HTH gntR-type domain-containing protein | |
| 3467 | CALGWP010000069.1 | GCA937936265_01799 | CDS | open | 151743-153416 | _na 557_aa | L-lactate permease | |
| 3468 | CALGWP010000069.1 | GCA937936265_01800 | CDS | open | 154260-155054 | _na 264_aa | Fe-S oxidoreductase | |
| 3469 | CALGWP010000069.1 | GCA937936265_01801 | CDS | open | 155071-156708 | _na 545_aa | putative conserved protein containing a ferredoxin-like domain | |
| 3470 | CALGWP010000069.1 | GCA937936265_01802 | CDS | open | 156708-157352 | _na 214_aa | putative conserved protein | |
| 3471 | CALGWP010000069.1 | GCA937936265_01803 | CDS | open | 157566-159125 | _na 519_aa | Oxidoreductase | |
| 3472 | CALGWP010000069.1 | GCA937936265_01804 | CDS | open | 159723-161225 | _na 500_aa | Cation/H+ exchanger transmembrane domain-containing protein | |
| 3473 | CALGWP010000069.1 | GCA937936265_01805 | CDS | open | 161590-162723 | _na 377_aa | DUF418 domain-containing protein | |
| 3474 | CALGWP010000069.1 | GCA937936265_01807 | CDS | open | 163172-164962 | _na 596_aa | ABC transporter | |
| 3475 | CALGWP010000069.1 | GCA937936265_01808 | CDS | open | 164962-167001 | _na 679_aa | ABC transporter permease | |
| 3476 | CALGWP010000069.1 | GCA937936265_01809 | CDS | open | 167001-168014 | _na 337_aa | Calcineurin-like phosphoesterase domain-containing protein | |
| 3477 | CALGWP010000069.1 | GCA937936265_01810 | CDS | open | 168055-170199 | _na 714_aa | peptidoglycan glycosyltransferase | |
| 3478 | CALGWP010000069.1 | GCA937936265_01811 | CDS | open | 170366-170569 | _na 67_aa | DUF4177 domain-containing protein | |
| 3479 | CALGWP010000069.1 | GCA937936265_01812 | CDS | open | 170755-171237 | _na 160_aa | Endoribonuclease L-PSP/chorismate mutase-like domain-containing protein | |
| 3480 | CALGWP010000069.1 | GCA937936265_01813 | CDS | open | 171230-172399 | _na 389_aa | NTP pyrophosphohydrolase including oxidative damage repair enzyme | |
| 3481 | CALGWP010000069.1 | GCA937936265_01814 | CDS | open | 172559-173236 | _na 225_aa | crp | Crp/Fnr family transcriptional regulator |
| 3482 | CALGWP010000069.1 | GCA937936265_01815 | CDS | open | 173722-174900 | _na 392_aa | marP | MarP family serine protease |
| 3483 | CALGWP010000069.1 | GCA937936265_01816 | CDS | open | 175017-175457 | _na 146_aa | aroQ | type II 3-dehydroquinate dehydratase |
| 3484 | CALGWP010000069.1 | GCA937936265_01817 | CDS | open | 175535-176533 | _na 332_aa | nth | endonuclease III |
| 3485 | CALGWP010000069.1 | GCA937936265_01818 | CDS | open | 176584-177363 | _na 259_aa | Nudix hydrolase domain-containing protein | |
| 3486 | CALGWP010000069.1 | GCA937936265_01819 | CDS | open | 177527-179524 | _na 665_aa | bifunctional 3'-5' exonuclease/DNA polymerase | |
| 3487 | CALGWP010000069.1 | GCA937936265_01820 | CDS | open | 179744-181315 | _na 523_aa | tadA | Flp pilus assembly complex ATPase component TadA |
| 3488 | CALGWP010000069.1 | GCA937936265_01821 | CDS | open | 181356-182609 | _na 417_aa | Type II secretion protein F | |
| 3489 | CALGWP010000069.1 | GCA937936265_01822 | CDS | open | 182739-183368 | _na 209_aa | DUF4244 domain-containing protein | |
| 3490 | CALGWP010000069.1 | GCA937936265_01823 | CDS | open | 183465-183983 | _na 172_aa | tadE | TadE family type IV pilus minor pilin |
| 3491 | CALGWP010000069.1 | GCA937936265_01824 | CDS | open | 183946-184575 | _na 209_aa | Acetyl-CoA acetyltransferase | |
| 3492 | CALGWP010000069.1 | GCA937936265_01825 | CDS | open | 184687-187464 | _na 925_aa | ATP-dependent helicase | |
| 3493 | CALGWP010000069.1 | GCA937936265_01826 | CDS | open | 187650-188561 | _na 303_aa | trhO | rhodanese-related sulfurtransferase |
| 3494 | CALGWP010000069.1 | GCA937936265_01827 | CDS | open | 188561-189058 | _na 165_aa | putative protein conserved in archaea | |
| 3495 | CALGWP010000069.1 | GCA937936265_01828 | CDS | open | 189330-190421 | _na 363_aa | LLM class flavin-dependent oxidoreductase | |
| 3496 | CALGWP010000069.1 | GCA937936265_01829 | CDS | open | 190617-190976 | _na 119_aa | arsR | HTH-type transcriptional regulator CmtR |
| 3497 | CALGWP010000069.1 | GCA937936265_01830 | CDS | open | 190919-191617 | _na 232_aa | putative Co/Zn/Cd cation transporter | |
| 3498 | CALGWP010000069.1 | GCA937936265_01831 | CDS | open | 191632-191808 | _na 58_aa | Luciferase-like domain-containing protein | |
| 3499 | CALGWP010000069.1 | GCA937936265_01832 | CDS | open | 192020-192553 | _na 177_aa | Pyrimidine dimer DNA glycosylase | |
| 3500 | CALGWP010000069.1 | GCA937936265_01833 | CDS | open | 192556-194985 | _na 809_aa | hypothetical protein |

