BAKTAGenome Explorer: Arachnia propionica (GCA_937974765.1)
Select a Genome:
|
BAKTA Annotations for GCA_937974765.1
|
Search & Sort all 6192 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 4501 | CALJVF010000091.1 | GCA937974765_02237 | gene | open | 7662-8303 | |||
| 4502 | CALJVF010000091.1 | GCA937974765_02238 | gene | open | 8595-9362 | |||
| 4503 | CALJVF010000091.1 | GCA937974765_02239 | gene | open | 9659-9865 | |||
| 4504 | CALJVF010000091.1 | GCA937974765_02240 | gene | open | 10310-11578 | ilvA | ||
| 4505 | CALJVF010000091.1 | GCA937974765_02241 | gene | open | 11816-12799 | ispH | ||
| 4506 | CALJVF010000091.1 | GCA937974765_02242 | gene | open | 12834-13565 | |||
| 4507 | CALJVF010000091.1 | GCA937974765_02243 | gene | open | 13738-14160 | |||
| 4508 | CALJVF010000091.1 | GCA937974765_02244 | gene | open | 14177-15394 | xseA | ||
| 4509 | CALJVF010000091.1 | GCA937974765_02245 | gene | open | 15391-15594 | xseB | ||
| 4510 | CALJVF010000091.1 | GCA937974765_02246 | gene | open | 16052-16702 | |||
| 4511 | CALJVF010000091.1 | GCA937974765_02247 | gene | open | 16699-17610 | |||
| 4512 | CALJVF010000091.1 | GCA937974765_02248 | gene | open | 17622-18422 | uppS | ||
| 4513 | CALJVF010000091.1 | GCA937974765_02249 | gene | open | 18481-20124 | |||
| 4514 | CALJVF010000091.1 | GCA937974765_02250 | gene | open | 20124-20951 | yaaT | ||
| 4515 | CALJVF010000091.1 | GCA937974765_02251 | gene | open | 21204-21827 | |||
| 4516 | CALJVF010000092.1 | regulatory_region | open | 5277-5454 | Cobalamin riboswitch aptamer | |||
| 4517 | CALJVF010000092.1 | GCA937974765_02252 | CDS | open | 781-1263 | _na 160_aa | moaB | Molybdopterin adenylyltransferase |
| 4518 | CALJVF010000092.1 | GCA937974765_02253 | CDS | open | 1306-2064 | _na 252_aa | DUF3039 domain-containing protein | |
| 4519 | CALJVF010000092.1 | GCA937974765_02254 | CDS | open | 2119-2298 | _na 59_aa | hypothetical protein | |
| 4520 | CALJVF010000092.1 | GCA937974765_02255 | CDS | open | 2330-2737 | _na 135_aa | helix-turn-helix domain-containing protein | |
| 4521 | CALJVF010000092.1 | GCA937974765_02256 | CDS | open | 2839-3738 | _na 299_aa | PAC2 family | |
| 4522 | CALJVF010000092.1 | GCA937974765_02257 | CDS | open | 3847-5181 | _na 444_aa | btlA | Vacuole effluxer Atg22 like |
| 4523 | CALJVF010000092.1 | GCA937974765_02258 | CDS | open | 5487-6476 | _na 329_aa | ABC transporter substrate-binding protein | |
| 4524 | CALJVF010000092.1 | GCA937974765_02259 | CDS | open | 6479-7519 | _na 346_aa | iron chelate uptake ABC transporter family permease subunit | |
| 4525 | CALJVF010000092.1 | GCA937974765_02260 | CDS | open | 7516-8268 | _na 250_aa | ABC transporter ATP-binding protein | |
| 4526 | CALJVF010000092.1 | GCA937974765_02261 | CDS | open | 8265-8897 | _na 210_aa | 2FeCpFd | |
| 4527 | CALJVF010000092.1 | GCA937974765_02262 | CDS | open | 8914-9366 | _na 150_aa | TY-Chap N-terminal domain-containing protein | |
| 4528 | CALJVF010000092.1 | GCA937974765_02263 | CDS | open | 9717-10160 | _na 147_aa | Activator of Hsp90 ATPase-like -like protein | |
| 4529 | CALJVF010000092.1 | GCA937974765_02264 | CDS | open | 10366-12888 | _na 840_aa | sodium-translocating pyrophosphatase | |
| 4530 | CALJVF010000092.1 | GCA937974765_02265 | CDS | open | 13005-13499 | _na 164_aa | DUF4282 domain-containing protein | |
| 4531 | CALJVF010000092.1 | GCA937974765_02266 | CDS | open | 13615-14742 | _na 375_aa | fmhB | Lipid II:glycine glycyltransferase |
| 4532 | CALJVF010000092.1 | GCA937974765_02267 | CDS | open | 14744-15769 | _na 341_aa | alr | Alanine racemase |
| 4533 | CALJVF010000092.1 | GCA937974765_02268 | CDS | open | 15899-16177 | _na 92_aa | helix-turn-helix domain-containing protein | |
| 4534 | CALJVF010000092.1 | GCA937974765_02269 | CDS | open | 16167-16982 | _na 271_aa | hipA | HipA domain-containing protein |
| 4535 | CALJVF010000092.1 | GCA937974765_02270 | CDS | open | 16930-18312 | _na 460_aa | putative integral membrane protein | |
| 4536 | CALJVF010000092.1 | GCA937974765_02271 | CDS | open | 18400-20688 | _na 762_aa | mrcB | peptidoglycan glycosyltransferase |
| 4537 | CALJVF010000092.1 | GCA937974765_02272 | CDS | open | 20755-21984 | _na 409_aa | CHAT domain-containing protein | |
| 4538 | CALJVF010000092.1 | GCA937974765_02252 | gene | open | 781-1263 | moaB | ||
| 4539 | CALJVF010000092.1 | GCA937974765_02253 | gene | open | 1306-2064 | |||
| 4540 | CALJVF010000092.1 | GCA937974765_02254 | gene | open | 2119-2298 | |||
| 4541 | CALJVF010000092.1 | GCA937974765_02255 | gene | open | 2330-2737 | |||
| 4542 | CALJVF010000092.1 | GCA937974765_02256 | gene | open | 2839-3738 | |||
| 4543 | CALJVF010000092.1 | GCA937974765_02257 | gene | open | 3847-5181 | btlA | ||
| 4544 | CALJVF010000092.1 | GCA937974765_02258 | gene | open | 5487-6476 | |||
| 4545 | CALJVF010000092.1 | GCA937974765_02259 | gene | open | 6479-7519 | |||
| 4546 | CALJVF010000092.1 | GCA937974765_02260 | gene | open | 7516-8268 | |||
| 4547 | CALJVF010000092.1 | GCA937974765_02261 | gene | open | 8265-8897 | |||
| 4548 | CALJVF010000092.1 | GCA937974765_02262 | gene | open | 8914-9366 | |||
| 4549 | CALJVF010000092.1 | GCA937974765_02263 | gene | open | 9717-10160 | |||
| 4550 | CALJVF010000092.1 | GCA937974765_02264 | gene | open | 10366-12888 | |||
| 4551 | CALJVF010000092.1 | GCA937974765_02265 | gene | open | 13005-13499 | |||
| 4552 | CALJVF010000092.1 | GCA937974765_02266 | gene | open | 13615-14742 | fmhB | ||
| 4553 | CALJVF010000092.1 | GCA937974765_02267 | gene | open | 14744-15769 | alr | ||
| 4554 | CALJVF010000092.1 | GCA937974765_02268 | gene | open | 15899-16177 | |||
| 4555 | CALJVF010000092.1 | GCA937974765_02269 | gene | open | 16167-16982 | hipA | ||
| 4556 | CALJVF010000092.1 | GCA937974765_02270 | gene | open | 16930-18312 | |||
| 4557 | CALJVF010000092.1 | GCA937974765_02271 | gene | open | 18400-20688 | mrcB | ||
| 4558 | CALJVF010000092.1 | GCA937974765_02272 | gene | open | 20755-21984 | |||
| 4559 | CALJVF010000093.1 | GCA937974765_02273 | CDS | open | 13-852 | _na 279_aa | FAD-dependent oxidoreductase | |
| 4560 | CALJVF010000093.1 | GCA937974765_02274 | CDS | open | 849-1700 | _na 283_aa | rpoE | putative RNA polymerase sigma factor fecI |
| 4561 | CALJVF010000093.1 | GCA937974765_02275 | CDS | open | 1691-2251 | _na 186_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 4562 | CALJVF010000093.1 | GCA937974765_02276 | CDS | open | 2353-2940 | _na 195_aa | phoE | Alpha-ribazole phosphatase |
| 4563 | CALJVF010000093.1 | GCA937974765_02277 | CDS | open | 2985-3362 | _na 125_aa | DUF2218 domain-containing protein | |
| 4564 | CALJVF010000093.1 | GCA937974765_02278 | CDS | open | 3637-5505 | _na 622_aa | mutA | methylmalonyl-CoA mutase small subunit |
| 4565 | CALJVF010000093.1 | GCA937974765_02279 | CDS | open | 5509-7701 | _na 730_aa | scpA | methylmalonyl-CoA mutase |
| 4566 | CALJVF010000093.1 | GCA937974765_02280 | CDS | open | 7834-7995 | _na 53_aa | hypothetical protein | |
| 4567 | CALJVF010000093.1 | GCA937974765_02281 | CDS | open | 8029-8439 | _na 136_aa | higA | Antitoxin HigA |
| 4568 | CALJVF010000093.1 | GCA937974765_02282 | CDS | open | 8457-8918 | _na 153_aa | hypothetical protein | |
| 4569 | CALJVF010000093.1 | GCA937974765_02283 | CDS | open | 9414-10988 | _na 524_aa | yfeS | Ankyrin repeats (3 copies) |
| 4570 | CALJVF010000093.1 | GCA937974765_02284 | CDS | open | 11025-11588 | _na 187_aa | Knr4/Smi1-like domain-containing protein | |
| 4571 | CALJVF010000093.1 | GCA937974765_02285 | CDS | open | 11854-12807 | _na 317_aa | hypothetical protein | |
| 4572 | CALJVF010000093.1 | GCA937974765_02286 | CDS | open | 12807-13124 | _na 105_aa | Immunity protein 53 | |
| 4573 | CALJVF010000093.1 | GCA937974765_02287 | CDS | open | 13349-14695 | _na 448_aa | Leucine-rich repeat protein | |
| 4574 | CALJVF010000093.1 | GCA937974765_02288 | CDS | open | 15013-16476 | _na 487_aa | hemK | Release factor glutamine methyltransferase |
| 4575 | CALJVF010000093.1 | GCA937974765_02289 | CDS | open | 16685-17092 | _na 135_aa | Carboxypeptidase regulatory-like domain-containing protein | |
| 4576 | CALJVF010000093.1 | GCA937974765_02290 | CDS | open | 17171-18886 | _na 571_aa | ABC transporter ATP-binding protein | |
| 4577 | CALJVF010000093.1 | GCA937974765_02291 | CDS | open | 18886-21393 | _na 835_aa | ABC transporter ATP-binding protein/permease | |
| 4578 | CALJVF010000093.1 | GCA937974765_02292 | CDS | open | 21540-22367 | _na 275_aa | cobalt-precorrin-5B (C(1))-methyltransferase | |
| 4579 | CALJVF010000093.1 | GCA937974765_02273 | gene | open | 13-852 | |||
| 4580 | CALJVF010000093.1 | GCA937974765_02274 | gene | open | 849-1700 | rpoE | ||
| 4581 | CALJVF010000093.1 | GCA937974765_02275 | gene | open | 1691-2251 | hpt | ||
| 4582 | CALJVF010000093.1 | GCA937974765_02276 | gene | open | 2353-2940 | phoE | ||
| 4583 | CALJVF010000093.1 | GCA937974765_02277 | gene | open | 2985-3362 | |||
| 4584 | CALJVF010000093.1 | GCA937974765_02278 | gene | open | 3637-5505 | mutA | ||
| 4585 | CALJVF010000093.1 | GCA937974765_02279 | gene | open | 5509-7701 | scpA | ||
| 4586 | CALJVF010000093.1 | GCA937974765_02280 | gene | open | 7834-7995 | |||
| 4587 | CALJVF010000093.1 | GCA937974765_02281 | gene | open | 8029-8439 | higA | ||
| 4588 | CALJVF010000093.1 | GCA937974765_02282 | gene | open | 8457-8918 | |||
| 4589 | CALJVF010000093.1 | GCA937974765_02283 | gene | open | 9414-10988 | yfeS | ||
| 4590 | CALJVF010000093.1 | GCA937974765_02284 | gene | open | 11025-11588 | |||
| 4591 | CALJVF010000093.1 | GCA937974765_02285 | gene | open | 11854-12807 | |||
| 4592 | CALJVF010000093.1 | GCA937974765_02286 | gene | open | 12807-13124 | |||
| 4593 | CALJVF010000093.1 | GCA937974765_02287 | gene | open | 13349-14695 | |||
| 4594 | CALJVF010000093.1 | GCA937974765_02288 | gene | open | 15013-16476 | hemK | ||
| 4595 | CALJVF010000093.1 | GCA937974765_02289 | gene | open | 16685-17092 | |||
| 4596 | CALJVF010000093.1 | GCA937974765_02290 | gene | open | 17171-18886 | |||
| 4597 | CALJVF010000093.1 | GCA937974765_02291 | gene | open | 18886-21393 | |||
| 4598 | CALJVF010000093.1 | GCA937974765_02292 | gene | open | 21540-22367 | |||
| 4599 | CALJVF010000094.1 | GCA937974765_02293 | CDS | open | 15-542 | _na 175_aa | hypothetical protein | |
| 4600 | CALJVF010000094.1 | GCA937974765_02294 | CDS | open | 854-1465 | _na 203_aa | rplJ | 50S ribosomal protein L10 |
| 4601 | CALJVF010000094.1 | GCA937974765_02295 | CDS | open | 1540-1935 | _na 131_aa | rplL | 50S ribosomal protein L7/L12 |
| 4602 | CALJVF010000094.1 | GCA937974765_02296 | CDS | open | 2058-2684 | _na 208_aa | ydcF | YdcF family protein |
| 4603 | CALJVF010000094.1 | GCA937974765_02297 | CDS | open | 3048-3896 | _na 282_aa | endonuclease domain-containing protein | |
| 4604 | CALJVF010000094.1 | GCA937974765_02298 | CDS | open | 4459-7932 | _na 1157_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 4605 | CALJVF010000094.1 | GCA937974765_02299 | CDS | open | 8024-11974 | _na 1316_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 4606 | CALJVF010000094.1 | GCA937974765_02300 | CDS | open | 12574-12885 | _na 103_aa | Transposase | |
| 4607 | CALJVF010000094.1 | GCA937974765_02301 | CDS | open | 13564-16122 | _na 852_aa | Protein kinase domain-containing protein | |
| 4608 | CALJVF010000094.1 | GCA937974765_02302 | CDS | open | 16201-16326 | _na 41_aa | hypothetical protein | |
| 4609 | CALJVF010000094.1 | GCA937974765_02293 | gene | open | 15-542 | |||
| 4610 | CALJVF010000094.1 | GCA937974765_02294 | gene | open | 854-1465 | rplJ | ||
| 4611 | CALJVF010000094.1 | GCA937974765_02295 | gene | open | 1540-1935 | rplL | ||
| 4612 | CALJVF010000094.1 | GCA937974765_02296 | gene | open | 2058-2684 | ydcF | ||
| 4613 | CALJVF010000094.1 | GCA937974765_02297 | gene | open | 3048-3896 | |||
| 4614 | CALJVF010000094.1 | GCA937974765_02298 | gene | open | 4459-7932 | rpoB | ||
| 4615 | CALJVF010000094.1 | GCA937974765_02299 | gene | open | 8024-11974 | rpoC | ||
| 4616 | CALJVF010000094.1 | GCA937974765_02300 | gene | open | 12574-12885 | |||
| 4617 | CALJVF010000094.1 | GCA937974765_02301 | gene | open | 13564-16122 | |||
| 4618 | CALJVF010000094.1 | GCA937974765_02302 | gene | open | 16201-16326 | |||
| 4619 | CALJVF010000095.1 | GCA937974765_02303 | CDS | open | 700-1344 | _na 214_aa | hypothetical protein | |
| 4620 | CALJVF010000095.1 | GCA937974765_02304 | CDS | open | 1578-1898 | _na 106_aa | hypothetical protein | |
| 4621 | CALJVF010000095.1 | GCA937974765_02305 | CDS | open | 1917-3728 | _na 603_aa | DUF1023 domain-containing protein | |
| 4622 | CALJVF010000095.1 | GCA937974765_02306 | CDS | open | 3889-5094 | _na 401_aa | hypothetical protein | |
| 4623 | CALJVF010000095.1 | GCA937974765_02307 | CDS | open | 5098-5547 | _na 149_aa | hypothetical protein | |
| 4624 | CALJVF010000095.1 | GCA937974765_02308 | CDS | open | 5579-5788 | _na 69_aa | hypothetical protein | |
| 4625 | CALJVF010000095.1 | GCA937974765_02309 | CDS | open | 6133-6897 | _na 254_aa | rbbA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 4626 | CALJVF010000095.1 | GCA937974765_02310 | CDS | open | 7083-7790 | _na 235_aa | rbbA | ABC transporter ATP-binding protein |
| 4627 | CALJVF010000095.1 | GCA937974765_02311 | CDS | open | 7787-8440 | _na 217_aa | ABC-2 family transporter protein | |
| 4628 | CALJVF010000095.1 | GCA937974765_02312 | CDS | open | 8592-9239 | _na 215_aa | hypothetical protein | |
| 4629 | CALJVF010000095.1 | GCA937974765_02303 | gene | open | 700-1344 | |||
| 4630 | CALJVF010000095.1 | GCA937974765_02304 | gene | open | 1578-1898 | |||
| 4631 | CALJVF010000095.1 | GCA937974765_02305 | gene | open | 1917-3728 | |||
| 4632 | CALJVF010000095.1 | GCA937974765_02306 | gene | open | 3889-5094 | |||
| 4633 | CALJVF010000095.1 | GCA937974765_02307 | gene | open | 5098-5547 | |||
| 4634 | CALJVF010000095.1 | GCA937974765_02308 | gene | open | 5579-5788 | |||
| 4635 | CALJVF010000095.1 | GCA937974765_02309 | gene | open | 6133-6897 | rbbA | ||
| 4636 | CALJVF010000095.1 | GCA937974765_02310 | gene | open | 7083-7790 | rbbA | ||
| 4637 | CALJVF010000095.1 | GCA937974765_02311 | gene | open | 7787-8440 | |||
| 4638 | CALJVF010000095.1 | GCA937974765_02312 | gene | open | 8592-9239 | |||
| 4639 | CALJVF010000096.1 | GCA937974765_02313 | CDS | open | 345-1040 | _na 231_aa | fieF | putative Co/Zn/Cd cation transporters |
| 4640 | CALJVF010000096.1 | GCA937974765_02314 | CDS | open | 1339-1728 | _na 129_aa | vapC | type II toxin-antitoxin system VapC family toxin |
| 4641 | CALJVF010000096.1 | GCA937974765_02315 | CDS | open | 1725-1970 | _na 81_aa | vapB | type II toxin-antitoxin system VapB family antitoxin |
| 4642 | CALJVF010000096.1 | GCA937974765_02316 | CDS | open | 2131-3351 | _na 406_aa | sacC | Glycoside hydrolase family 32 protein |
| 4643 | CALJVF010000096.1 | GCA937974765_02313 | gene | open | 345-1040 | fieF | ||
| 4644 | CALJVF010000096.1 | GCA937974765_02314 | gene | open | 1339-1728 | vapC | ||
| 4645 | CALJVF010000096.1 | GCA937974765_02315 | gene | open | 1725-1970 | vapB | ||
| 4646 | CALJVF010000096.1 | GCA937974765_02316 | gene | open | 2131-3351 | sacC | ||
| 4647 | CALJVF010000097.1 | GCA937974765_02317 | gene | open | 320-3440 | rrl | ||
| 4648 | CALJVF010000097.1 | GCA937974765_02318 | gene | open | 3573-3689 | rrf | ||
| 4649 | CALJVF010000097.1 | GCA937974765_02317 | rRNA | open | 320-3440 | rrl | 23S ribosomal RNA | |
| 4650 | CALJVF010000097.1 | GCA937974765_02318 | rRNA | open | 3573-3689 | rrf | 5S ribosomal RNA | |
| 4651 | CALJVF010000097.1 | GCA937974765_02319 | CDS | open | 3990-5273 | _na 427_aa | hypothetical protein | |
| 4652 | CALJVF010000097.1 | GCA937974765_02320 | CDS | open | 5270-6259 | _na 329_aa | nagD | UMP phosphatase |
| 4653 | CALJVF010000097.1 | GCA937974765_02321 | CDS | open | 6256-6465 | _na 69_aa | hypothetical protein | |
| 4654 | CALJVF010000097.1 | GCA937974765_02322 | CDS | open | 6462-7199 | _na 245_aa | yqxC | 16S/23S rRNA (Cytidine-2'-O)-methyltransferase TlyA |
| 4655 | CALJVF010000097.1 | GCA937974765_02323 | CDS | open | 7199-8092 | _na 297_aa | nadK | NAD kinase |
| 4656 | CALJVF010000097.1 | GCA937974765_02324 | CDS | open | 8095-9771 | _na 558_aa | recN | DNA repair protein RecN |
| 4657 | CALJVF010000097.1 | GCA937974765_02325 | CDS | open | 9846-10352 | _na 168_aa | pncA | nicotinamidase |
| 4658 | CALJVF010000097.1 | GCA937974765_02326 | CDS | open | 10453-11301 | _na 282_aa | hypothetical protein | |
| 4659 | CALJVF010000097.1 | GCA937974765_02327 | CDS | open | 11560-12282 | _na 240_aa | hypothetical protein | |
| 4660 | CALJVF010000097.1 | GCA937974765_02328 | CDS | open | 12269-13234 | _na 321_aa | cps2a | Transcriptional regulator ywtF |
| 4661 | CALJVF010000097.1 | GCA937974765_02329 | CDS | open | 13286-13912 | _na 208_aa | ADP-ribose pyrophosphatase | |
| 4662 | CALJVF010000097.1 | GCA937974765_02330 | CDS | open | 13913-14824 | _na 303_aa | xerC | Tyrosine recombinase XerC |
| 4663 | CALJVF010000097.1 | GCA937974765_02331 | CDS | open | 14928-15824 | _na 298_aa | Sporulation initiation inhibitor protein soj | |
| 4664 | CALJVF010000097.1 | GCA937974765_02332 | CDS | open | 15815-16195 | _na 126_aa | Cobyrinic acid a%2Cc-diamide synthase | |
| 4665 | CALJVF010000097.1 | GCA937974765_02333 | CDS | open | 16192-17016 | _na 274_aa | scpA | Segregation and condensation protein A |
| 4666 | CALJVF010000097.1 | GCA937974765_02334 | CDS | open | 17013-17576 | _na 187_aa | scpB | SMC-Scp complex subunit ScpB |
| 4667 | CALJVF010000097.1 | GCA937974765_02335 | CDS | open | 17569-18303 | _na 244_aa | rsuA | Pseudouridine synthase |
| 4668 | CALJVF010000097.1 | GCA937974765_02336 | CDS | open | 18373-19371 | _na 332_aa | fkpA | FKBP-type peptidyl-prolyl cis-trans isomerase |
| 4669 | CALJVF010000097.1 | GCA937974765_02337 | CDS | open | 19355-20284 | _na 309_aa | gluQRS | tRNA glutamyl-Q(34) synthetase GluQRS |
| 4670 | CALJVF010000097.1 | GCA937974765_02338 | CDS | open | 20350-21279 | _na 309_aa | yobV | Proteasome accessory factor B |
| 4671 | CALJVF010000097.1 | GCA937974765_02339 | CDS | open | 21276-22205 | _na 309_aa | yobV | Proteasome accessory factor C |
| 4672 | CALJVF010000097.1 | GCA937974765_02340 | CDS | open | 22472-22801 | _na 109_aa | hypothetical protein | |
| 4673 | CALJVF010000097.1 | GCA937974765_02341 | CDS | open | 22894-23682 | _na 262_aa | tatC | twin-arginine translocase subunit TatC |
| 4674 | CALJVF010000097.1 | GCA937974765_02342 | CDS | open | 23679-24593 | _na 304_aa | lCB5 | Diacylglycerol kinase |
| 4675 | CALJVF010000097.1 | GCA937974765_02343 | CDS | open | 24616-27360 | _na 914_aa | dob10 | Ski2-like helicase |
| 4676 | CALJVF010000097.1 | GCA937974765_02344 | CDS | open | 27360-28127 | _na 255_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 4677 | CALJVF010000097.1 | GCA937974765_02345 | CDS | open | 28133-28534 | _na 133_aa | hinT | HIT domain-containing protein |
| 4678 | CALJVF010000097.1 | GCA937974765_02346 | CDS | open | 28649-29452 | _na 267_aa | lexA | transcriptional repressor LexA |
| 4679 | CALJVF010000097.1 | GCA937974765_02347 | CDS | open | 29653-29982 | _na 109_aa | hypothetical protein | |
| 4680 | CALJVF010000097.1 | GCA937974765_02348 | CDS | open | 30181-30717 | _na 178_aa | nrdR | transcriptional regulator NrdR |
| 4681 | CALJVF010000097.1 | GCA937974765_02349 | CDS | open | 30755-33607 | _na 950_aa | nrdA | vitamin B12-dependent ribonucleotide reductase |
| 4682 | CALJVF010000097.1 | GCA937974765_02350 | CDS | open | 33745-33972 | _na 75_aa | mazE9 | Antitoxin MazE9 |
| 4683 | CALJVF010000097.1 | GCA937974765_02351 | CDS | open | 33972-34319 | _na 115_aa | mazF | mRNA interferase |
| 4684 | CALJVF010000097.1 | GCA937974765_02352 | CDS | open | 34458-35813 | _na 451_aa | yjjP | Inner membrane protein YjjP |
| 4685 | CALJVF010000097.1 | GCA937974765_02353 | CDS | open | 36108-36911 | _na 267_aa | ubiE | Demethylmenaquinone methyltransferase |
| 4686 | CALJVF010000097.1 | GCA937974765_02354 | CDS | open | 36913-37167 | _na 84_aa | thrE | Threonine/Serine exporter ThrE domain-containing protein |
| 4687 | CALJVF010000097.1 | GCA937974765_02355 | CDS | open | 37234-38823 | _na 529_aa | Shikimate kinase | |
| 4688 | CALJVF010000097.1 | GCA937974765_02356 | CDS | open | 38888-39694 | _na 268_aa | ycjR | Xylose isomerase-like TIM barrel |
| 4689 | CALJVF010000097.1 | GCA937974765_02357 | CDS | open | 39696-41417 | _na 573_aa | sdhA | 3-oxosteroid 1-dehydrogenase |
| 4690 | CALJVF010000097.1 | GCA937974765_02358 | CDS | open | 41449-42816 | _na 455_aa | melB | Proline porter II |
| 4691 | CALJVF010000097.1 | GCA937974765_02359 | CDS | open | 43271-44740 | _na 489_aa | adhE | Succinate-semialdehyde dehydrogenase (Acetylating) |
| 4692 | CALJVF010000097.1 | GCA937974765_02360 | CDS | open | 44750-45619 | _na 289_aa | gltA | citryl-CoA lyase |
| 4693 | CALJVF010000097.1 | GCA937974765_02361 | CDS | open | 45616-47376 | _na 586_aa | ilvB | Acetolactate synthase isozyme 3 large subunit |
| 4694 | CALJVF010000097.1 | GCA937974765_02362 | CDS | open | 47401-48210 | _na 269_aa | ycjR | Hydroxypyruvate isomerase |
| 4695 | CALJVF010000097.1 | GCA937974765_02363 | CDS | open | 48272-49159 | _na 295_aa | aroE | Shikimate dehydrogenase (NADP(+)) |
| 4696 | CALJVF010000097.1 | GCA937974765_02364 | CDS | open | 49159-49803 | _na 214_aa | acrR | Rut operon repressor |
| 4697 | CALJVF010000097.1 | GCA937974765_02365 | CDS | open | 49816-50580 | _na 254_aa | aroD | 3-dehydroquinate dehydratase |
| 4698 | CALJVF010000097.1 | GCA937974765_02366 | CDS | open | 50944-51441 | _na 165_aa | nrfH | cytochrome c nitrite reductase small subunit |
| 4699 | CALJVF010000097.1 | GCA937974765_02367 | CDS | open | 51448-52971 | _na 507_aa | nrfA | nitrite reductase (cytochrome%3B ammonia-forming) |
| 4700 | CALJVF010000097.1 | GCA937974765_02368 | CDS | open | 53005-53856 | _na 283_aa | ycf37 | putative O-linked N-acetylglucosamine transferase%2C SPINDLY family |
| 4701 | CALJVF010000097.1 | GCA937974765_02369 | CDS | open | 53860-54555 | _na 231_aa | ccdA | Thiol:disulfide interchange protein |
| 4702 | CALJVF010000097.1 | GCA937974765_02370 | CDS | open | 54565-56022 | _na 485_aa | ccsB | Cytochrome c biogenesis protein CcsB |
| 4703 | CALJVF010000097.1 | GCA937974765_02371 | CDS | open | 56019-56924 | _na 301_aa | ccsB | c-type cytochrome biogenesis protein CcsB |
| 4704 | CALJVF010000097.1 | GCA937974765_02372 | CDS | open | 56911-57594 | _na 227_aa | Thioredoxin domain-containing protein | |
| 4705 | CALJVF010000097.1 | GCA937974765_02373 | CDS | open | 57802-59646 | _na 614_aa | ilvD | dihydroxy-acid dehydratase |
| 4706 | CALJVF010000097.1 | GCA937974765_02374 | CDS | open | 59589-60110 | _na 173_aa | dedA | SNARE associated Golgi protein |
| 4707 | CALJVF010000097.1 | GCA937974765_02375 | CDS | open | 60332-61192 | _na 286_aa | ybjN | YbjN domain-containing protein |
| 4708 | CALJVF010000097.1 | GCA937974765_02376 | CDS | open | 61219-61614 | _na 131_aa | nimA | Pyridoxamine 5'-phosphate oxidase |
| 4709 | CALJVF010000097.1 | GCA937974765_02377 | CDS | open | 61625-62497 | _na 290_aa | uspA | Universal stress protein |
| 4710 | CALJVF010000097.1 | GCA937974765_02378 | CDS | open | 63288-63392 | _na 34_aa | hypothetical protein | |
| 4711 | CALJVF010000097.1 | GCA937974765_02319 | gene | open | 3990-5273 | |||
| 4712 | CALJVF010000097.1 | GCA937974765_02320 | gene | open | 5270-6259 | nagD | ||
| 4713 | CALJVF010000097.1 | GCA937974765_02321 | gene | open | 6256-6465 | |||
| 4714 | CALJVF010000097.1 | GCA937974765_02322 | gene | open | 6462-7199 | yqxC | ||
| 4715 | CALJVF010000097.1 | GCA937974765_02323 | gene | open | 7199-8092 | nadK | ||
| 4716 | CALJVF010000097.1 | GCA937974765_02324 | gene | open | 8095-9771 | recN | ||
| 4717 | CALJVF010000097.1 | GCA937974765_02325 | gene | open | 9846-10352 | pncA | ||
| 4718 | CALJVF010000097.1 | GCA937974765_02326 | gene | open | 10453-11301 | |||
| 4719 | CALJVF010000097.1 | GCA937974765_02327 | gene | open | 11560-12282 | |||
| 4720 | CALJVF010000097.1 | GCA937974765_02328 | gene | open | 12269-13234 | cps2a | ||
| 4721 | CALJVF010000097.1 | GCA937974765_02329 | gene | open | 13286-13912 | |||
| 4722 | CALJVF010000097.1 | GCA937974765_02330 | gene | open | 13913-14824 | xerC | ||
| 4723 | CALJVF010000097.1 | GCA937974765_02331 | gene | open | 14928-15824 | |||
| 4724 | CALJVF010000097.1 | GCA937974765_02332 | gene | open | 15815-16195 | |||
| 4725 | CALJVF010000097.1 | GCA937974765_02333 | gene | open | 16192-17016 | scpA | ||
| 4726 | CALJVF010000097.1 | GCA937974765_02334 | gene | open | 17013-17576 | scpB | ||
| 4727 | CALJVF010000097.1 | GCA937974765_02335 | gene | open | 17569-18303 | rsuA | ||
| 4728 | CALJVF010000097.1 | GCA937974765_02336 | gene | open | 18373-19371 | fkpA | ||
| 4729 | CALJVF010000097.1 | GCA937974765_02337 | gene | open | 19355-20284 | gluQRS | ||
| 4730 | CALJVF010000097.1 | GCA937974765_02338 | gene | open | 20350-21279 | yobV | ||
| 4731 | CALJVF010000097.1 | GCA937974765_02339 | gene | open | 21276-22205 | yobV | ||
| 4732 | CALJVF010000097.1 | GCA937974765_02340 | gene | open | 22472-22801 | |||
| 4733 | CALJVF010000097.1 | GCA937974765_02341 | gene | open | 22894-23682 | tatC | ||
| 4734 | CALJVF010000097.1 | GCA937974765_02342 | gene | open | 23679-24593 | lCB5 | ||
| 4735 | CALJVF010000097.1 | GCA937974765_02343 | gene | open | 24616-27360 | dob10 | ||
| 4736 | CALJVF010000097.1 | GCA937974765_02344 | gene | open | 27360-28127 | hisF | ||
| 4737 | CALJVF010000097.1 | GCA937974765_02345 | gene | open | 28133-28534 | hinT | ||
| 4738 | CALJVF010000097.1 | GCA937974765_02346 | gene | open | 28649-29452 | lexA | ||
| 4739 | CALJVF010000097.1 | GCA937974765_02347 | gene | open | 29653-29982 | |||
| 4740 | CALJVF010000097.1 | GCA937974765_02348 | gene | open | 30181-30717 | nrdR | ||
| 4741 | CALJVF010000097.1 | GCA937974765_02349 | gene | open | 30755-33607 | nrdA | ||
| 4742 | CALJVF010000097.1 | GCA937974765_02350 | gene | open | 33745-33972 | mazE9 | ||
| 4743 | CALJVF010000097.1 | GCA937974765_02351 | gene | open | 33972-34319 | mazF | ||
| 4744 | CALJVF010000097.1 | GCA937974765_02352 | gene | open | 34458-35813 | yjjP | ||
| 4745 | CALJVF010000097.1 | GCA937974765_02353 | gene | open | 36108-36911 | ubiE | ||
| 4746 | CALJVF010000097.1 | GCA937974765_02354 | gene | open | 36913-37167 | thrE | ||
| 4747 | CALJVF010000097.1 | GCA937974765_02355 | gene | open | 37234-38823 | |||
| 4748 | CALJVF010000097.1 | GCA937974765_02356 | gene | open | 38888-39694 | ycjR | ||
| 4749 | CALJVF010000097.1 | GCA937974765_02357 | gene | open | 39696-41417 | sdhA | ||
| 4750 | CALJVF010000097.1 | GCA937974765_02358 | gene | open | 41449-42816 | melB | ||
| 4751 | CALJVF010000097.1 | GCA937974765_02359 | gene | open | 43271-44740 | adhE | ||
| 4752 | CALJVF010000097.1 | GCA937974765_02360 | gene | open | 44750-45619 | gltA | ||
| 4753 | CALJVF010000097.1 | GCA937974765_02361 | gene | open | 45616-47376 | ilvB | ||
| 4754 | CALJVF010000097.1 | GCA937974765_02362 | gene | open | 47401-48210 | ycjR | ||
| 4755 | CALJVF010000097.1 | GCA937974765_02363 | gene | open | 48272-49159 | aroE | ||
| 4756 | CALJVF010000097.1 | GCA937974765_02364 | gene | open | 49159-49803 | acrR | ||
| 4757 | CALJVF010000097.1 | GCA937974765_02365 | gene | open | 49816-50580 | aroD | ||
| 4758 | CALJVF010000097.1 | GCA937974765_02366 | gene | open | 50944-51441 | nrfH | ||
| 4759 | CALJVF010000097.1 | GCA937974765_02367 | gene | open | 51448-52971 | nrfA | ||
| 4760 | CALJVF010000097.1 | GCA937974765_02368 | gene | open | 53005-53856 | ycf37 | ||
| 4761 | CALJVF010000097.1 | GCA937974765_02369 | gene | open | 53860-54555 | ccdA | ||
| 4762 | CALJVF010000097.1 | GCA937974765_02370 | gene | open | 54565-56022 | ccsB | ||
| 4763 | CALJVF010000097.1 | GCA937974765_02371 | gene | open | 56019-56924 | ccsB | ||
| 4764 | CALJVF010000097.1 | GCA937974765_02372 | gene | open | 56911-57594 | |||
| 4765 | CALJVF010000097.1 | GCA937974765_02373 | gene | open | 57802-59646 | ilvD | ||
| 4766 | CALJVF010000097.1 | GCA937974765_02374 | gene | open | 59589-60110 | dedA | ||
| 4767 | CALJVF010000097.1 | GCA937974765_02375 | gene | open | 60332-61192 | ybjN | ||
| 4768 | CALJVF010000097.1 | GCA937974765_02376 | gene | open | 61219-61614 | nimA | ||
| 4769 | CALJVF010000097.1 | GCA937974765_02377 | gene | open | 61625-62497 | uspA | ||
| 4770 | CALJVF010000097.1 | GCA937974765_02378 | gene | open | 63288-63392 | |||
| 4771 | CALJVF010000098.1 | GCA937974765_02379 | CDS | open | 23-604 | _na 193_aa | hypothetical protein | |
| 4772 | CALJVF010000098.1 | GCA937974765_02380 | CDS | open | 601-840 | _na 79_aa | Molybdopterin synthase sulfur carrier subunit | |
| 4773 | CALJVF010000098.1 | GCA937974765_02381 | CDS | open | 1073-1393 | _na 106_aa | hypothetical protein | |
| 4774 | CALJVF010000098.1 | GCA937974765_02382 | CDS | open | 1277-2314 | _na 345_aa | purR | LacI family DNA-binding transcriptional regulator |
| 4775 | CALJVF010000098.1 | GCA937974765_02383 | CDS | open | 2445-3605 | _na 386_aa | rbsB | Substrate-binding domain-containing protein |
| 4776 | CALJVF010000098.1 | GCA937974765_02384 | CDS | open | 3602-5152 | _na 516_aa | mglA | Sugar ABC transporter ATP-binding protein |
| 4777 | CALJVF010000098.1 | GCA937974765_02385 | CDS | open | 5149-6123 | _na 324_aa | araH | ABC transporter permease |
| 4778 | CALJVF010000098.1 | GCA937974765_02386 | CDS | open | 6148-8193 | _na 681_aa | ganA | Beta-galactosidase |
| 4779 | CALJVF010000098.1 | GCA937974765_02387 | CDS | open | 8206-8979 | _na 257_aa | hypothetical protein | |
| 4780 | CALJVF010000098.1 | GCA937974765_02388 | CDS | open | 9480-10367 | _na 295_aa | alpha/beta fold hydrolase | |
| 4781 | CALJVF010000098.1 | GCA937974765_02389 | CDS | open | 10438-11577 | _na 379_aa | Agarase | |
| 4782 | CALJVF010000098.1 | GCA937974765_02390 | CDS | open | 11596-12453 | _na 285_aa | Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein | |
| 4783 | CALJVF010000098.1 | GCA937974765_02391 | CDS | open | 12509-12883 | _na 124_aa | MmcQ/YjbR family DNA-binding protein | |
| 4784 | CALJVF010000098.1 | GCA937974765_02392 | CDS | open | 13207-13887 | _na 226_aa | hypothetical protein | |
| 4785 | CALJVF010000098.1 | GCA937974765_02393 | CDS | open | 13874-14008 | _na 44_aa | hypothetical protein | |
| 4786 | CALJVF010000098.1 | GCA937974765_02379 | gene | open | 23-604 | |||
| 4787 | CALJVF010000098.1 | GCA937974765_02380 | gene | open | 601-840 | |||
| 4788 | CALJVF010000098.1 | GCA937974765_02381 | gene | open | 1073-1393 | |||
| 4789 | CALJVF010000098.1 | GCA937974765_02382 | gene | open | 1277-2314 | purR | ||
| 4790 | CALJVF010000098.1 | GCA937974765_02383 | gene | open | 2445-3605 | rbsB | ||
| 4791 | CALJVF010000098.1 | GCA937974765_02384 | gene | open | 3602-5152 | mglA | ||
| 4792 | CALJVF010000098.1 | GCA937974765_02385 | gene | open | 5149-6123 | araH | ||
| 4793 | CALJVF010000098.1 | GCA937974765_02386 | gene | open | 6148-8193 | ganA | ||
| 4794 | CALJVF010000098.1 | GCA937974765_02387 | gene | open | 8206-8979 | |||
| 4795 | CALJVF010000098.1 | GCA937974765_02388 | gene | open | 9480-10367 | |||
| 4796 | CALJVF010000098.1 | GCA937974765_02389 | gene | open | 10438-11577 | |||
| 4797 | CALJVF010000098.1 | GCA937974765_02390 | gene | open | 11596-12453 | |||
| 4798 | CALJVF010000098.1 | GCA937974765_02391 | gene | open | 12509-12883 | |||
| 4799 | CALJVF010000098.1 | GCA937974765_02392 | gene | open | 13207-13887 | |||
| 4800 | CALJVF010000098.1 | GCA937974765_02393 | gene | open | 13874-14008 | |||
| 4801 | CALJVF010000099.1 | repeat_region | open | 35051-37515 | CRISPR array with 34 repeats of length 37%2C consensus sequence GTCTGAAACCACCGCGAACCTCAAAGCGGATTGAAAC and spacer length 35 | |||
| 4802 | CALJVF010000099.1 | GCA937974765_02394 | CDS | open | 350-2686 | _na 778_aa | hypothetical protein | |
| 4803 | CALJVF010000099.1 | GCA937974765_02395 | CDS | open | 2690-3061 | _na 123_aa | DUF6507 domain-containing protein | |
| 4804 | CALJVF010000099.1 | GCA937974765_02396 | CDS | open | 3480-4559 | _na 359_aa | pdhA | pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha |
| 4805 | CALJVF010000099.1 | GCA937974765_02397 | CDS | open | 4556-5530 | _na 324_aa | acoB | 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring) |
| 4806 | CALJVF010000099.1 | GCA937974765_02398 | CDS | open | 5553-7034 | _na 493_aa | aceF | Dihydrolipoamide acetyltransferase component of pyruvate dehydrogenase complex |
| 4807 | CALJVF010000099.1 | GCA937974765_02399 | CDS | open | 7099-7830 | _na 243_aa | DUF4282 domain-containing protein | |
| 4808 | CALJVF010000099.1 | GCA937974765_02400 | CDS | open | 7892-9004 | _na 370_aa | alr | alanine racemase |
| 4809 | CALJVF010000099.1 | GCA937974765_02401 | CDS | open | 9337-10032 | _na 231_aa | ecsC | EcsC family protein |
| 4810 | CALJVF010000099.1 | GCA937974765_02402 | CDS | open | 10181-10876 | _na 231_aa | aat | leucyl/phenylalanyl-tRNA--protein transferase |
| 4811 | CALJVF010000099.1 | GCA937974765_02403 | CDS | open | 10910-11743 | _na 277_aa | CPBP family intramembrane metalloprotease | |
| 4812 | CALJVF010000099.1 | GCA937974765_02404 | CDS | open | 11740-12360 | _na 206_aa | putative protein conserved in bacteria | |
| 4813 | CALJVF010000099.1 | GCA937974765_02405 | CDS | open | 12460-13371 | _na 303_aa | pheA | prephenate dehydratase |
| 4814 | CALJVF010000099.1 | GCA937974765_02406 | CDS | open | 13783-15054 | _na 423_aa | serS | serine--tRNA ligase |
| 4815 | CALJVF010000099.1 | GCA937974765_02407 | CDS | open | 15152-15952 | _na 266_aa | cof | Stress response protein yhaX |
| 4816 | CALJVF010000099.1 | GCA937974765_02408 | CDS | open | 15992-16540 | _na 182_aa | lrp | 4Fe-4S Wbl-type domain-containing protein |
| 4817 | CALJVF010000099.1 | GCA937974765_02409 | CDS | open | 16865-17815 | _na 316_aa | irrE | IrrE N-terminal-like domain-containing protein |
| 4818 | CALJVF010000099.1 | GCA937974765_02410 | CDS | open | 17939-19336 | _na 465_aa | hypothetical protein | |
| 4819 | CALJVF010000099.1 | GCA937974765_02411 | CDS | open | 19333-20697 | _na 454_aa | hypothetical protein | |
| 4820 | CALJVF010000099.1 | GCA937974765_02412 | CDS | open | 21134-22948 | _na 604_aa | hypothetical protein | |
| 4821 | CALJVF010000099.1 | GCA937974765_02413 | CDS | open | 22951-23904 | _na 317_aa | DUF2276 domain-containing protein | |
| 4822 | CALJVF010000099.1 | GCA937974765_02414 | CDS | open | 23897-26371 | _na 824_aa | CRISPR-associated protein | |
| 4823 | CALJVF010000099.1 | GCA937974765_02415 | CDS | open | 26383-27900 | _na 505_aa | GGDEF domain-containing protein | |
| 4824 | CALJVF010000099.1 | GCA937974765_02416 | CDS | open | 27897-28523 | _na 208_aa | RAMP superfamily | |
| 4825 | CALJVF010000099.1 | GCA937974765_02417 | CDS | open | 28520-29716 | _na 398_aa | CRISPR-associated RAMP protein%2C Csx10 family | |
| 4826 | CALJVF010000099.1 | GCA937974765_02418 | CDS | open | 29718-31025 | _na 435_aa | CRISPR-associated RAMP protein%2C SSO1426 family | |
| 4827 | CALJVF010000099.1 | GCA937974765_02419 | CDS | open | 31018-31458 | _na 146_aa | hypothetical protein | |
| 4828 | CALJVF010000099.1 | GCA937974765_02420 | CDS | open | 32630-33529 | _na 299_aa | hypothetical protein | |
| 4829 | CALJVF010000099.1 | GCA937974765_02421 | CDS | open | 33499-34485 | _na 328_aa | CRISPR-associated endonuclease Cas1 | |
| 4830 | CALJVF010000099.1 | GCA937974765_02422 | CDS | open | 34476-34760 | _na 94_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 4831 | CALJVF010000099.1 | GCA937974765_02423 | CDS | open | 38167-38451 | _na 94_aa | whiB | Transcriptional regulator WhiB |
| 4832 | CALJVF010000099.1 | GCA937974765_02424 | CDS | open | 38851-39015 | _na 54_aa | DUF4177 domain-containing protein | |
| 4833 | CALJVF010000099.1 | GCA937974765_02425 | CDS | open | 39012-39473 | _na 153_aa | ridA | Putative endoribonuclease L-PSP |
| 4834 | CALJVF010000099.1 | GCA937974765_02394 | gene | open | 350-2686 | |||
| 4835 | CALJVF010000099.1 | GCA937974765_02395 | gene | open | 2690-3061 | |||
| 4836 | CALJVF010000099.1 | GCA937974765_02396 | gene | open | 3480-4559 | pdhA | ||
| 4837 | CALJVF010000099.1 | GCA937974765_02397 | gene | open | 4556-5530 | acoB | ||
| 4838 | CALJVF010000099.1 | GCA937974765_02398 | gene | open | 5553-7034 | aceF | ||
| 4839 | CALJVF010000099.1 | GCA937974765_02399 | gene | open | 7099-7830 | |||
| 4840 | CALJVF010000099.1 | GCA937974765_02400 | gene | open | 7892-9004 | alr | ||
| 4841 | CALJVF010000099.1 | GCA937974765_02401 | gene | open | 9337-10032 | ecsC | ||
| 4842 | CALJVF010000099.1 | GCA937974765_02402 | gene | open | 10181-10876 | aat | ||
| 4843 | CALJVF010000099.1 | GCA937974765_02403 | gene | open | 10910-11743 | |||
| 4844 | CALJVF010000099.1 | GCA937974765_02404 | gene | open | 11740-12360 | |||
| 4845 | CALJVF010000099.1 | GCA937974765_02405 | gene | open | 12460-13371 | pheA | ||
| 4846 | CALJVF010000099.1 | GCA937974765_02406 | gene | open | 13783-15054 | serS | ||
| 4847 | CALJVF010000099.1 | GCA937974765_02407 | gene | open | 15152-15952 | cof | ||
| 4848 | CALJVF010000099.1 | GCA937974765_02408 | gene | open | 15992-16540 | lrp | ||
| 4849 | CALJVF010000099.1 | GCA937974765_02409 | gene | open | 16865-17815 | irrE | ||
| 4850 | CALJVF010000099.1 | GCA937974765_02410 | gene | open | 17939-19336 | |||
| 4851 | CALJVF010000099.1 | GCA937974765_02411 | gene | open | 19333-20697 | |||
| 4852 | CALJVF010000099.1 | GCA937974765_02412 | gene | open | 21134-22948 | |||
| 4853 | CALJVF010000099.1 | GCA937974765_02413 | gene | open | 22951-23904 | |||
| 4854 | CALJVF010000099.1 | GCA937974765_02414 | gene | open | 23897-26371 | |||
| 4855 | CALJVF010000099.1 | GCA937974765_02415 | gene | open | 26383-27900 | |||
| 4856 | CALJVF010000099.1 | GCA937974765_02416 | gene | open | 27897-28523 | |||
| 4857 | CALJVF010000099.1 | GCA937974765_02417 | gene | open | 28520-29716 | |||
| 4858 | CALJVF010000099.1 | GCA937974765_02418 | gene | open | 29718-31025 | |||
| 4859 | CALJVF010000099.1 | GCA937974765_02419 | gene | open | 31018-31458 | |||
| 4860 | CALJVF010000099.1 | GCA937974765_02420 | gene | open | 32630-33529 | |||
| 4861 | CALJVF010000099.1 | GCA937974765_02421 | gene | open | 33499-34485 | |||
| 4862 | CALJVF010000099.1 | GCA937974765_02422 | gene | open | 34476-34760 | cas2 | ||
| 4863 | CALJVF010000099.1 | GCA937974765_02423 | gene | open | 38167-38451 | whiB | ||
| 4864 | CALJVF010000099.1 | GCA937974765_02424 | gene | open | 38851-39015 | |||
| 4865 | CALJVF010000099.1 | GCA937974765_02425 | gene | open | 39012-39473 | ridA | ||
| 4866 | CALJVF010000100.1 | repeat_region | open | 3212-5964 | CRISPR array with 38 repeats of length 36%2C consensus sequence GTCGCAATGGAGCCTGACCTTTGAGGTCAGGAAAAG and spacer length 37 | |||
| 4867 | CALJVF010000100.1 | GCA937974765_02426 | CDS | open | 83-853 | _na 256_aa | glnQ | Arginine transport ATP-binding protein ArtM |
| 4868 | CALJVF010000100.1 | GCA937974765_02427 | CDS | open | 853-1716 | _na 287_aa | hisM | Amino acid ABC transporter permease |
| 4869 | CALJVF010000100.1 | GCA937974765_02428 | CDS | open | 1720-2577 | _na 285_aa | hisJ | Sulfate starvation-induced protein 7 |
| 4870 | CALJVF010000100.1 | GCA937974765_02426 | gene | open | 83-853 | glnQ | ||
| 4871 | CALJVF010000100.1 | GCA937974765_02427 | gene | open | 853-1716 | hisM | ||
| 4872 | CALJVF010000100.1 | GCA937974765_02428 | gene | open | 1720-2577 | hisJ | ||
| 4873 | CALJVF010000101.1 | GCA937974765_02429 | CDS | open | 382-747 | _na 121_aa | hypothetical protein | |
| 4874 | CALJVF010000101.1 | GCA937974765_02430 | CDS | open | 854-1282 | _na 142_aa | DNA-binding protein | |
| 4875 | CALJVF010000101.1 | GCA937974765_02431 | CDS | open | 1275-2468 | _na 397_aa | non-specific serine/threonine protein kinase | |
| 4876 | CALJVF010000101.1 | GCA937974765_02432 | CDS | open | 2533-4440 | _na 635_aa | chlD | Mg-chelatase subunit ChlD |
| 4877 | CALJVF010000101.1 | GCA937974765_02433 | CDS | open | 4848-5216 | _na 122_aa | Roadblock/LC7 domain | |
| 4878 | CALJVF010000101.1 | GCA937974765_02434 | CDS | open | 5213-5695 | _na 160_aa | pAS | Aerotaxis receptor |
| 4879 | CALJVF010000101.1 | GCA937974765_02435 | CDS | open | 5697-6464 | _na 255_aa | ABC transporter%2C phosphonate%2C periplasmic substrate-binding protein | |
| 4880 | CALJVF010000101.1 | GCA937974765_02436 | CDS | open | 6541-7404 | _na 287_aa | hypothetical protein | |
| 4881 | CALJVF010000101.1 | GCA937974765_02437 | CDS | open | 7816-9204 | _na 462_aa | araJ | D-xylose transporter |
| 4882 | CALJVF010000101.1 | GCA937974765_02438 | CDS | open | 9226-10182 | _na 318_aa | rbsK | 5-dehydro-2-deoxygluconokinase |
| 4883 | CALJVF010000101.1 | GCA937974765_02439 | CDS | open | 10122-10388 | _na 88_aa | hypothetical protein | |
| 4884 | CALJVF010000101.1 | GCA937974765_02440 | CDS | open | 10489-11070 | _na 193_aa | DUF4276 domain-containing protein | |
| 4885 | CALJVF010000101.1 | GCA937974765_02441 | CDS | open | 11073-12224 | _na 383_aa | AAA family ATPase | |
| 4886 | CALJVF010000101.1 | GCA937974765_02442 | CDS | open | 12228-12365 | _na 45_aa | hypothetical protein | |
| 4887 | CALJVF010000101.1 | GCA937974765_02429 | gene | open | 382-747 | |||
| 4888 | CALJVF010000101.1 | GCA937974765_02430 | gene | open | 854-1282 | |||
| 4889 | CALJVF010000101.1 | GCA937974765_02431 | gene | open | 1275-2468 | |||
| 4890 | CALJVF010000101.1 | GCA937974765_02432 | gene | open | 2533-4440 | chlD | ||
| 4891 | CALJVF010000101.1 | GCA937974765_02433 | gene | open | 4848-5216 | |||
| 4892 | CALJVF010000101.1 | GCA937974765_02434 | gene | open | 5213-5695 | pAS | ||
| 4893 | CALJVF010000101.1 | GCA937974765_02435 | gene | open | 5697-6464 | |||
| 4894 | CALJVF010000101.1 | GCA937974765_02436 | gene | open | 6541-7404 | |||
| 4895 | CALJVF010000101.1 | GCA937974765_02437 | gene | open | 7816-9204 | araJ | ||
| 4896 | CALJVF010000101.1 | GCA937974765_02438 | gene | open | 9226-10182 | rbsK | ||
| 4897 | CALJVF010000101.1 | GCA937974765_02439 | gene | open | 10122-10388 | |||
| 4898 | CALJVF010000101.1 | GCA937974765_02440 | gene | open | 10489-11070 | |||
| 4899 | CALJVF010000101.1 | GCA937974765_02441 | gene | open | 11073-12224 | |||
| 4900 | CALJVF010000101.1 | GCA937974765_02442 | gene | open | 12228-12365 | |||
| 4901 | CALJVF010000102.1 | GCA937974765_02443 | CDS | open | 207-1130 | _na 307_aa | DUF4862 domain-containing protein | |
| 4902 | CALJVF010000102.1 | GCA937974765_02444 | CDS | open | 1343-1786 | _na 147_aa | DUF4190 domain-containing protein | |
| 4903 | CALJVF010000102.1 | GCA937974765_02445 | CDS | open | 1915-3195 | _na 426_aa | fucP | L-fucose:H+ symporter permease |
| 4904 | CALJVF010000102.1 | GCA937974765_02446 | CDS | open | 3192-4187 | _na 331_aa | rbsB | D-allose-binding periplasmic protein |
| 4905 | CALJVF010000102.1 | GCA937974765_02447 | CDS | open | 4547-4729 | _na 60_aa | hypothetical protein | |
| 4906 | CALJVF010000102.1 | GCA937974765_02448 | CDS | open | 4806-5738 | _na 310_aa | lysR | HTH-type transcriptional regulator gltC |
| 4907 | CALJVF010000102.1 | GCA937974765_02449 | CDS | open | 5735-6367 | _na 210_aa | RNA polymerase subunit sigma-70 | |
| 4908 | CALJVF010000102.1 | GCA937974765_02450 | CDS | open | 6420-7046 | _na 208_aa | putative protein conserved in bacteria | |
| 4909 | CALJVF010000102.1 | GCA937974765_02451 | CDS | open | 7152-8087 | _na 311_aa | ppk2 | polyphosphate kinase 2 |
| 4910 | CALJVF010000102.1 | GCA937974765_02452 | CDS | open | 8164-8670 | _na 168_aa | tpx | thiol peroxidase |
| 4911 | CALJVF010000102.1 | GCA937974765_02453 | CDS | open | 8844-9704 | _na 286_aa | rbsK | Ribokinase |
| 4912 | CALJVF010000102.1 | GCA937974765_02454 | CDS | open | 9845-10804 | _na 319_aa | Aminomethyltransferase | |
| 4913 | CALJVF010000102.1 | GCA937974765_02455 | CDS | open | 10954-11844 | _na 296_aa | aminodeoxychorismate lyase | |
| 4914 | CALJVF010000102.1 | GCA937974765_02456 | CDS | open | 11827-12318 | _na 163_aa | hypothetical protein | |
| 4915 | CALJVF010000102.1 | GCA937974765_02443 | gene | open | 207-1130 | |||
| 4916 | CALJVF010000102.1 | GCA937974765_02444 | gene | open | 1343-1786 | |||
| 4917 | CALJVF010000102.1 | GCA937974765_02445 | gene | open | 1915-3195 | fucP | ||
| 4918 | CALJVF010000102.1 | GCA937974765_02446 | gene | open | 3192-4187 | rbsB | ||
| 4919 | CALJVF010000102.1 | GCA937974765_02447 | gene | open | 4547-4729 | |||
| 4920 | CALJVF010000102.1 | GCA937974765_02448 | gene | open | 4806-5738 | lysR | ||
| 4921 | CALJVF010000102.1 | GCA937974765_02449 | gene | open | 5735-6367 | |||
| 4922 | CALJVF010000102.1 | GCA937974765_02450 | gene | open | 6420-7046 | |||
| 4923 | CALJVF010000102.1 | GCA937974765_02451 | gene | open | 7152-8087 | ppk2 | ||
| 4924 | CALJVF010000102.1 | GCA937974765_02452 | gene | open | 8164-8670 | tpx | ||
| 4925 | CALJVF010000102.1 | GCA937974765_02453 | gene | open | 8844-9704 | rbsK | ||
| 4926 | CALJVF010000102.1 | GCA937974765_02454 | gene | open | 9845-10804 | |||
| 4927 | CALJVF010000102.1 | GCA937974765_02455 | gene | open | 10954-11844 | |||
| 4928 | CALJVF010000102.1 | GCA937974765_02456 | gene | open | 11827-12318 | |||
| 4929 | CALJVF010000103.1 | GCA937974765_02457 | CDS | open | 183-1988 | _na 601_aa | hypothetical protein | |
| 4930 | CALJVF010000103.1 | GCA937974765_02458 | CDS | open | 2024-3391 | _na 455_aa | lpdA | dihydrolipoyl dehydrogenase |
| 4931 | CALJVF010000103.1 | GCA937974765_02459 | CDS | open | 3403-4044 | _na 213_aa | 2-oxoacid dehydrogenase acyltransferase catalytic domain-containing protein | |
| 4932 | CALJVF010000103.1 | GCA937974765_02457 | gene | open | 183-1988 | |||
| 4933 | CALJVF010000103.1 | GCA937974765_02458 | gene | open | 2024-3391 | lpdA | ||
| 4934 | CALJVF010000103.1 | GCA937974765_02459 | gene | open | 3403-4044 | |||
| 4935 | CALJVF010000104.1 | GCA937974765_02460 | CDS | open | 549-1106 | _na 185_aa | putative RNA 2'-phosphotransferase | |
| 4936 | CALJVF010000104.1 | GCA937974765_02461 | CDS | open | 1192-1707 | _na 171_aa | rimI | GNAT family N-acetyltransferase |
| 4937 | CALJVF010000104.1 | GCA937974765_02462 | CDS | open | 2040-3014 | _na 324_aa | rsmC | Ribosomal RNA large subunit methyltransferase G |
| 4938 | CALJVF010000104.1 | GCA937974765_02463 | CDS | open | 3111-4640 | _na 509_aa | degP | Periplasmic serine endoprotease DegP |
| 4939 | CALJVF010000104.1 | GCA937974765_02464 | CDS | open | 5116-5934 | _na 272_aa | phosphoserine phosphatase | |
| 4940 | CALJVF010000104.1 | GCA937974765_02465 | CDS | open | 5918-6589 | _na 223_aa | hypothetical protein | |
| 4941 | CALJVF010000104.1 | GCA937974765_02466 | CDS | open | 6983-7399 | _na 138_aa | hypothetical protein | |
| 4942 | CALJVF010000104.1 | GCA937974765_02467 | CDS | open | 7623-9134 | _na 503_aa | aCH1 | Acetyl-CoA hydrolase/transferase family protein |
| 4943 | CALJVF010000104.1 | GCA937974765_02468 | CDS | open | 9250-10905 | _na 551_aa | hypothetical protein | |
| 4944 | CALJVF010000104.1 | GCA937974765_02469 | CDS | open | 11033-11791 | _na 252_aa | hypothetical protein | |
| 4945 | CALJVF010000104.1 | GCA937974765_02470 | CDS | open | 11853-12350 | _na 165_aa | thpR | 2'-5' RNA ligase family protein |
| 4946 | CALJVF010000104.1 | GCA937974765_02471 | CDS | open | 12397-13713 | _na 438_aa | abgB | putative hydrolase YxeP |
| 4947 | CALJVF010000104.1 | GCA937974765_02472 | CDS | open | 13725-14429 | _na 234_aa | Runt domain-containing protein | |
| 4948 | CALJVF010000104.1 | GCA937974765_02460 | gene | open | 549-1106 | |||
| 4949 | CALJVF010000104.1 | GCA937974765_02461 | gene | open | 1192-1707 | rimI | ||
| 4950 | CALJVF010000104.1 | GCA937974765_02462 | gene | open | 2040-3014 | rsmC | ||
| 4951 | CALJVF010000104.1 | GCA937974765_02463 | gene | open | 3111-4640 | degP | ||
| 4952 | CALJVF010000104.1 | GCA937974765_02464 | gene | open | 5116-5934 | |||
| 4953 | CALJVF010000104.1 | GCA937974765_02465 | gene | open | 5918-6589 | |||
| 4954 | CALJVF010000104.1 | GCA937974765_02466 | gene | open | 6983-7399 | |||
| 4955 | CALJVF010000104.1 | GCA937974765_02467 | gene | open | 7623-9134 | aCH1 | ||
| 4956 | CALJVF010000104.1 | GCA937974765_02468 | gene | open | 9250-10905 | |||
| 4957 | CALJVF010000104.1 | GCA937974765_02469 | gene | open | 11033-11791 | |||
| 4958 | CALJVF010000104.1 | GCA937974765_02470 | gene | open | 11853-12350 | thpR | ||
| 4959 | CALJVF010000104.1 | GCA937974765_02471 | gene | open | 12397-13713 | abgB | ||
| 4960 | CALJVF010000104.1 | GCA937974765_02472 | gene | open | 13725-14429 | |||
| 4961 | CALJVF010000105.1 | GCA937974765_02473 | CDS | open | 126-848 | _na 240_aa | cobH | precorrin-8X methylmutase |
| 4962 | CALJVF010000105.1 | GCA937974765_02474 | CDS | open | 1043-1789 | _na 248_aa | cobI | precorrin-2 C(20)-methyltransferase |
| 4963 | CALJVF010000105.1 | GCA937974765_02475 | CDS | open | 1786-2646 | _na 286_aa | cobM | precorrin-4 C(11)-methyltransferase |
| 4964 | CALJVF010000105.1 | GCA937974765_02476 | CDS | open | 2643-5063 | _na 806_aa | cobL | Cobalt-precorrin-3B C(17)-methyltransferase |
| 4965 | CALJVF010000105.1 | GCA937974765_02477 | CDS | open | 5063-6289 | _na 408_aa | sirB | precorrin-2 dehydrogenase |
| 4966 | CALJVF010000105.1 | GCA937974765_02478 | CDS | open | 6480-6701 | _na 73_aa | DUF4244 domain-containing protein | |
| 4967 | CALJVF010000105.1 | GCA937974765_02479 | CDS | open | 6881-7201 | _na 106_aa | hypothetical protein | |
| 4968 | CALJVF010000105.1 | GCA937974765_02480 | CDS | open | 7267-7593 | _na 108_aa | Flp pilus-assembly TadE/G-like family protein | |
| 4969 | CALJVF010000105.1 | GCA937974765_02481 | CDS | open | 7697-9688 | _na 663_aa | yprA | ATP-dependent RNA helicase SrmB |
| 4970 | CALJVF010000105.1 | GCA937974765_02473 | gene | open | 126-848 | cobH | ||
| 4971 | CALJVF010000105.1 | GCA937974765_02474 | gene | open | 1043-1789 | cobI | ||
| 4972 | CALJVF010000105.1 | GCA937974765_02475 | gene | open | 1786-2646 | cobM | ||
| 4973 | CALJVF010000105.1 | GCA937974765_02476 | gene | open | 2643-5063 | cobL | ||
| 4974 | CALJVF010000105.1 | GCA937974765_02477 | gene | open | 5063-6289 | sirB | ||
| 4975 | CALJVF010000105.1 | GCA937974765_02478 | gene | open | 6480-6701 | |||
| 4976 | CALJVF010000105.1 | GCA937974765_02479 | gene | open | 6881-7201 | |||
| 4977 | CALJVF010000105.1 | GCA937974765_02480 | gene | open | 7267-7593 | |||
| 4978 | CALJVF010000105.1 | GCA937974765_02481 | gene | open | 7697-9688 | yprA | ||
| 4979 | CALJVF010000106.1 | GCA937974765_02482 | CDS | open | 229-1236 | _na 335_aa | hypothetical protein | |
| 4980 | CALJVF010000106.1 | GCA937974765_02483 | CDS | open | 1488-2093 | _na 201_aa | sodA | Superoxide dismutase |
| 4981 | CALJVF010000106.1 | GCA937974765_02484 | CDS | open | 2176-2769 | _na 197_aa | rsmC | Ribosomal RNA small subunit methyltransferase C |
| 4982 | CALJVF010000106.1 | GCA937974765_02485 | CDS | open | 2766-3578 | _na 270_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 4983 | CALJVF010000106.1 | GCA937974765_02486 | CDS | open | 3575-4231 | _na 218_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 4984 | CALJVF010000106.1 | GCA937974765_02487 | CDS | open | 4490-5710 | _na 406_aa | fepB | Periplasmic binding protein |
| 4985 | CALJVF010000106.1 | GCA937974765_02488 | CDS | open | 5710-6732 | _na 340_aa | fepD | Vitamin B12 import system permease protein BtuC |
| 4986 | CALJVF010000106.1 | GCA937974765_02489 | CDS | open | 6729-7541 | _na 270_aa | fepC | ABC transporter ATP-binding protein |
| 4987 | CALJVF010000106.1 | GCA937974765_02490 | CDS | open | 7577-7987 | _na 136_aa | yccF | YccF domain-containing protein |
| 4988 | CALJVF010000106.1 | GCA937974765_02491 | CDS | open | 8058-10139 | _na 693_aa | elongation factor G-like protein EF-G2 | |
| 4989 | CALJVF010000106.1 | GCA937974765_02492 | CDS | open | 10253-11704 | _na 483_aa | adaA | DNA-3-methyladenine glycosylase II |
| 4990 | CALJVF010000106.1 | GCA937974765_02493 | CDS | open | 11701-12159 | _na 152_aa | adaB | Regulatory protein of adaptative response |
| 4991 | CALJVF010000106.1 | GCA937974765_02494 | CDS | open | 12150-12869 | _na 239_aa | Fic/DOC family | |
| 4992 | CALJVF010000106.1 | GCA937974765_02495 | CDS | open | 13173-13628 | _na 151_aa | rplM | 50S ribosomal protein L13 |
| 4993 | CALJVF010000106.1 | GCA937974765_02496 | CDS | open | 13643-14170 | _na 175_aa | rpsI | 30S ribosomal protein S9 |
| 4994 | CALJVF010000106.1 | GCA937974765_02497 | CDS | open | 14221-14967 | _na 248_aa | ECF transporter S component | |
| 4995 | CALJVF010000106.1 | GCA937974765_02498 | CDS | open | 14964-16565 | _na 533_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 4996 | CALJVF010000106.1 | GCA937974765_02499 | CDS | open | 16562-17635 | _na 357_aa | ecfT | energy-coupling factor transporter transmembrane protein EcfT |
| 4997 | CALJVF010000106.1 | GCA937974765_02500 | CDS | open | 17635-18342 | _na 235_aa | LPXTG cell wall anchor domain-containing protein | |
| 4998 | CALJVF010000106.1 | GCA937974765_02501 | CDS | open | 18473-19459 | _na 328_aa | hypothetical protein | |
| 4999 | CALJVF010000106.1 | GCA937974765_02502 | CDS | open | 19558-19653 | _na 31_aa | hypothetical protein | |
| 5000 | CALJVF010000106.1 | GCA937974765_02503 | CDS | open | 20064-22901 | _na 945_aa | hypothetical protein |

