BAKTAGenome Explorer: Arachnia propionica (GCA_937974765.1)
Select a Genome:
|
BAKTA Annotations for GCA_937974765.1
|
Search & Sort all 6192 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 5001 | CALJVF010000106.1 | GCA937974765_02504 | CDS | open | 23019-23675 | _na 218_aa | hypothetical protein | |
| 5002 | CALJVF010000106.1 | GCA937974765_02505 | CDS | open | 23672-24616 | _na 314_aa | vWA domain-containing protein | |
| 5003 | CALJVF010000106.1 | GCA937974765_02506 | CDS | open | 24613-25581 | _na 322_aa | VWA domain-containing protein | |
| 5004 | CALJVF010000106.1 | GCA937974765_02507 | CDS | open | 25572-26030 | _na 152_aa | DUF4129 domain-containing protein | |
| 5005 | CALJVF010000106.1 | GCA937974765_02508 | CDS | open | 26020-26901 | _na 293_aa | DUF58 domain-containing protein | |
| 5006 | CALJVF010000106.1 | GCA937974765_02509 | CDS | open | 26901-27890 | _na 329_aa | moxR | MoxR family ATPase |
| 5007 | CALJVF010000106.1 | GCA937974765_02510 | CDS | open | 27887-28777 | _na 296_aa | hypothetical protein | |
| 5008 | CALJVF010000106.1 | GCA937974765_02511 | CDS | open | 28774-29166 | _na 130_aa | hypothetical protein | |
| 5009 | CALJVF010000106.1 | GCA937974765_02482 | gene | open | 229-1236 | |||
| 5010 | CALJVF010000106.1 | GCA937974765_02483 | gene | open | 1488-2093 | sodA | ||
| 5011 | CALJVF010000106.1 | GCA937974765_02484 | gene | open | 2176-2769 | rsmC | ||
| 5012 | CALJVF010000106.1 | GCA937974765_02485 | gene | open | 2766-3578 | truA | ||
| 5013 | CALJVF010000106.1 | GCA937974765_02486 | gene | open | 3575-4231 | trmB | ||
| 5014 | CALJVF010000106.1 | GCA937974765_02487 | gene | open | 4490-5710 | fepB | ||
| 5015 | CALJVF010000106.1 | GCA937974765_02488 | gene | open | 5710-6732 | fepD | ||
| 5016 | CALJVF010000106.1 | GCA937974765_02489 | gene | open | 6729-7541 | fepC | ||
| 5017 | CALJVF010000106.1 | GCA937974765_02490 | gene | open | 7577-7987 | yccF | ||
| 5018 | CALJVF010000106.1 | GCA937974765_02491 | gene | open | 8058-10139 | |||
| 5019 | CALJVF010000106.1 | GCA937974765_02492 | gene | open | 10253-11704 | adaA | ||
| 5020 | CALJVF010000106.1 | GCA937974765_02493 | gene | open | 11701-12159 | adaB | ||
| 5021 | CALJVF010000106.1 | GCA937974765_02494 | gene | open | 12150-12869 | |||
| 5022 | CALJVF010000106.1 | GCA937974765_02495 | gene | open | 13173-13628 | rplM | ||
| 5023 | CALJVF010000106.1 | GCA937974765_02496 | gene | open | 13643-14170 | rpsI | ||
| 5024 | CALJVF010000106.1 | GCA937974765_02497 | gene | open | 14221-14967 | |||
| 5025 | CALJVF010000106.1 | GCA937974765_02498 | gene | open | 14964-16565 | ccmA | ||
| 5026 | CALJVF010000106.1 | GCA937974765_02499 | gene | open | 16562-17635 | ecfT | ||
| 5027 | CALJVF010000106.1 | GCA937974765_02500 | gene | open | 17635-18342 | |||
| 5028 | CALJVF010000106.1 | GCA937974765_02501 | gene | open | 18473-19459 | |||
| 5029 | CALJVF010000106.1 | GCA937974765_02502 | gene | open | 19558-19653 | |||
| 5030 | CALJVF010000106.1 | GCA937974765_02503 | gene | open | 20064-22901 | |||
| 5031 | CALJVF010000106.1 | GCA937974765_02504 | gene | open | 23019-23675 | |||
| 5032 | CALJVF010000106.1 | GCA937974765_02505 | gene | open | 23672-24616 | |||
| 5033 | CALJVF010000106.1 | GCA937974765_02506 | gene | open | 24613-25581 | |||
| 5034 | CALJVF010000106.1 | GCA937974765_02507 | gene | open | 25572-26030 | |||
| 5035 | CALJVF010000106.1 | GCA937974765_02508 | gene | open | 26020-26901 | |||
| 5036 | CALJVF010000106.1 | GCA937974765_02509 | gene | open | 26901-27890 | moxR | ||
| 5037 | CALJVF010000106.1 | GCA937974765_02510 | gene | open | 27887-28777 | |||
| 5038 | CALJVF010000106.1 | GCA937974765_02511 | gene | open | 28774-29166 | |||
| 5039 | CALJVF010000107.1 | GCA937974765_02512 | CDS | open | 148-801 | _na 217_aa | Lipoprotein | |
| 5040 | CALJVF010000107.1 | GCA937974765_02513 | CDS | open | 1025-4426 | _na 1133_aa | putA2 | L-glutamate gamma-semialdehyde dehydrogenase |
| 5041 | CALJVF010000107.1 | GCA937974765_02514 | CDS | open | 4568-4777 | _na 69_aa | hypothetical protein | |
| 5042 | CALJVF010000107.1 | GCA937974765_02515 | CDS | open | 5038-5358 | _na 106_aa | ygiN | Antibiotic biosynthesis monooxygenase |
| 5043 | CALJVF010000107.1 | GCA937974765_02516 | CDS | open | 5370-6311 | _na 313_aa | ykwD | putative protein%2C YkwD family |
| 5044 | CALJVF010000107.1 | GCA937974765_02517 | CDS | open | 6551-7117 | _na 188_aa | acrR | Rut operon repressor |
| 5045 | CALJVF010000107.1 | GCA937974765_02518 | CDS | open | 7114-8631 | _na 505_aa | araJ | Antiseptic resistance protein |
| 5046 | CALJVF010000107.1 | GCA937974765_02519 | CDS | open | 8886-9431 | _na 181_aa | rimI | Protease synthase and sporulation negative regulatory protein PAI 1 |
| 5047 | CALJVF010000107.1 | GCA937974765_02520 | CDS | open | 9475-9906 | _na 143_aa | putative acetyltransferase | |
| 5048 | CALJVF010000107.1 | GCA937974765_02521 | CDS | open | 10043-10432 | _na 129_aa | nuclear transport factor 2 family protein | |
| 5049 | CALJVF010000107.1 | GCA937974765_02522 | CDS | open | 10541-10669 | _na 42_aa | hypothetical protein | |
| 5050 | CALJVF010000107.1 | GCA937974765_02523 | CDS | open | 10799-12043 | _na 414_aa | DUF4143 domain-containing protein | |
| 5051 | CALJVF010000107.1 | GCA937974765_02524 | CDS | open | 12162-12722 | _na 186_aa | ykwD | putative protein%2C YkwD family |
| 5052 | CALJVF010000107.1 | GCA937974765_02512 | gene | open | 148-801 | |||
| 5053 | CALJVF010000107.1 | GCA937974765_02513 | gene | open | 1025-4426 | putA2 | ||
| 5054 | CALJVF010000107.1 | GCA937974765_02514 | gene | open | 4568-4777 | |||
| 5055 | CALJVF010000107.1 | GCA937974765_02515 | gene | open | 5038-5358 | ygiN | ||
| 5056 | CALJVF010000107.1 | GCA937974765_02516 | gene | open | 5370-6311 | ykwD | ||
| 5057 | CALJVF010000107.1 | GCA937974765_02517 | gene | open | 6551-7117 | acrR | ||
| 5058 | CALJVF010000107.1 | GCA937974765_02518 | gene | open | 7114-8631 | araJ | ||
| 5059 | CALJVF010000107.1 | GCA937974765_02519 | gene | open | 8886-9431 | rimI | ||
| 5060 | CALJVF010000107.1 | GCA937974765_02520 | gene | open | 9475-9906 | |||
| 5061 | CALJVF010000107.1 | GCA937974765_02521 | gene | open | 10043-10432 | |||
| 5062 | CALJVF010000107.1 | GCA937974765_02522 | gene | open | 10541-10669 | |||
| 5063 | CALJVF010000107.1 | GCA937974765_02523 | gene | open | 10799-12043 | |||
| 5064 | CALJVF010000107.1 | GCA937974765_02524 | gene | open | 12162-12722 | ykwD | ||
| 5065 | CALJVF010000108.1 | GCA937974765_02525 | CDS | open | 183-347 | _na 54_aa | hypothetical protein | |
| 5066 | CALJVF010000108.1 | GCA937974765_02526 | CDS | open | 618-1121 | _na 167_aa | hypothetical protein | |
| 5067 | CALJVF010000108.1 | GCA937974765_02527 | CDS | open | 1162-1452 | _na 96_aa | hypothetical protein | |
| 5068 | CALJVF010000108.1 | GCA937974765_02528 | CDS | open | 1447-1755 | _na 102_aa | hypothetical protein | |
| 5069 | CALJVF010000108.1 | GCA937974765_02529 | CDS | open | 2082-3383 | _na 433_aa | hypothetical protein | |
| 5070 | CALJVF010000108.1 | GCA937974765_02530 | CDS | open | 3807-4154 | _na 115_aa | hypothetical protein | |
| 5071 | CALJVF010000108.1 | GCA937974765_02525 | gene | open | 183-347 | |||
| 5072 | CALJVF010000108.1 | GCA937974765_02526 | gene | open | 618-1121 | |||
| 5073 | CALJVF010000108.1 | GCA937974765_02527 | gene | open | 1162-1452 | |||
| 5074 | CALJVF010000108.1 | GCA937974765_02528 | gene | open | 1447-1755 | |||
| 5075 | CALJVF010000108.1 | GCA937974765_02529 | gene | open | 2082-3383 | |||
| 5076 | CALJVF010000108.1 | GCA937974765_02530 | gene | open | 3807-4154 | |||
| 5077 | CALJVF010000109.1 | GCA937974765_02531 | CDS | open | 656-856 | _na 66_aa | hypothetical protein | |
| 5078 | CALJVF010000109.1 | GCA937974765_02532 | CDS | open | 1107-1388 | _na 93_aa | hypothetical protein | |
| 5079 | CALJVF010000109.1 | GCA937974765_02533 | CDS | open | 1277-2254 | _na 325_aa | nusA | Transcription termination/antitermination protein NusA |
| 5080 | CALJVF010000109.1 | GCA937974765_02534 | CDS | open | 2256-2762 | _na 168_aa | rimP | ribosome maturation factor RimP |
| 5081 | CALJVF010000109.1 | GCA937974765_02535 | CDS | open | 2835-3728 | _na 297_aa | DUF4439 domain-containing protein | |
| 5082 | CALJVF010000109.1 | GCA937974765_02536 | CDS | open | 3740-5497 | _na 585_aa | proS | proline--tRNA ligase |
| 5083 | CALJVF010000109.1 | GCA937974765_02537 | CDS | open | 5587-6420 | _na 277_aa | GNAT family N-acetyltransferase | |
| 5084 | CALJVF010000109.1 | GCA937974765_02538 | CDS | open | 6422-7564 | _na 380_aa | ispG | flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase |
| 5085 | CALJVF010000109.1 | GCA937974765_02539 | CDS | open | 7591-8337 | _na 248_aa | cobK | cobalt-precorrin-6A reductase |
| 5086 | CALJVF010000109.1 | GCA937974765_02540 | CDS | open | 8321-8905 | _na 194_aa | rloB | RloB family protein |
| 5087 | CALJVF010000109.1 | GCA937974765_02541 | CDS | open | 8905-10257 | _na 450_aa | ATP/GTP-binding protein | |
| 5088 | CALJVF010000109.1 | GCA937974765_02542 | CDS | open | 10611-11132 | _na 173_aa | EXLDI protein | |
| 5089 | CALJVF010000109.1 | GCA937974765_02543 | CDS | open | 11170-11895 | _na 241_aa | cysG | uroporphyrinogen-III C-methyltransferase |
| 5090 | CALJVF010000109.1 | GCA937974765_02544 | CDS | open | 11892-14303 | _na 803_aa | cobB | cobyrinate a%2Cc-diamide synthase |
| 5091 | CALJVF010000109.1 | GCA937974765_02545 | CDS | open | 14297-14908 | _na 203_aa | cobO | cob(I)yrinic acid a%2Cc-diamide adenosyltransferase |
| 5092 | CALJVF010000109.1 | GCA937974765_02546 | CDS | open | 14966-16423 | _na 485_aa | cobL | Precorrin-6Y C(5%2C15)-methyltransferase [decarboxylating] |
| 5093 | CALJVF010000109.1 | GCA937974765_02547 | CDS | open | 16420-16863 | _na 147_aa | tadG | Flp pilus assembly protein TadG |
| 5094 | CALJVF010000109.1 | GCA937974765_02531 | gene | open | 656-856 | |||
| 5095 | CALJVF010000109.1 | GCA937974765_02532 | gene | open | 1107-1388 | |||
| 5096 | CALJVF010000109.1 | GCA937974765_02533 | gene | open | 1277-2254 | nusA | ||
| 5097 | CALJVF010000109.1 | GCA937974765_02534 | gene | open | 2256-2762 | rimP | ||
| 5098 | CALJVF010000109.1 | GCA937974765_02535 | gene | open | 2835-3728 | |||
| 5099 | CALJVF010000109.1 | GCA937974765_02536 | gene | open | 3740-5497 | proS | ||
| 5100 | CALJVF010000109.1 | GCA937974765_02537 | gene | open | 5587-6420 | |||
| 5101 | CALJVF010000109.1 | GCA937974765_02538 | gene | open | 6422-7564 | ispG | ||
| 5102 | CALJVF010000109.1 | GCA937974765_02539 | gene | open | 7591-8337 | cobK | ||
| 5103 | CALJVF010000109.1 | GCA937974765_02540 | gene | open | 8321-8905 | rloB | ||
| 5104 | CALJVF010000109.1 | GCA937974765_02541 | gene | open | 8905-10257 | |||
| 5105 | CALJVF010000109.1 | GCA937974765_02542 | gene | open | 10611-11132 | |||
| 5106 | CALJVF010000109.1 | GCA937974765_02543 | gene | open | 11170-11895 | cysG | ||
| 5107 | CALJVF010000109.1 | GCA937974765_02544 | gene | open | 11892-14303 | cobB | ||
| 5108 | CALJVF010000109.1 | GCA937974765_02545 | gene | open | 14297-14908 | cobO | ||
| 5109 | CALJVF010000109.1 | GCA937974765_02546 | gene | open | 14966-16423 | cobL | ||
| 5110 | CALJVF010000109.1 | GCA937974765_02547 | gene | open | 16420-16863 | tadG | ||
| 5111 | CALJVF010000110.1 | GCA937974765_02548 | CDS | open | 289-1218 | _na 309_aa | 2-keto-myo-inositol dehydratase | |
| 5112 | CALJVF010000110.1 | GCA937974765_02549 | CDS | open | 1613-3184 | _na 523_aa | TIR domain-containing protein | |
| 5113 | CALJVF010000110.1 | GCA937974765_02550 | CDS | open | 3177-5132 | _na 651_aa | CRISPR-associated protein | |
| 5114 | CALJVF010000110.1 | GCA937974765_02551 | CDS | open | 5129-6538 | _na 469_aa | cas10 | CRISPR-associated protein Cas10/Cmr2%2C subtype III-B |
| 5115 | CALJVF010000110.1 | GCA937974765_02552 | CDS | open | 6535-7095 | _na 186_aa | RAMP superfamily | |
| 5116 | CALJVF010000110.1 | GCA937974765_02553 | CDS | open | 7092-8363 | _na 423_aa | hypothetical protein | |
| 5117 | CALJVF010000110.1 | GCA937974765_02554 | CDS | open | 8363-9625 | _na 420_aa | csm3 | CRISPR-associated RAMP protein%2C SSO1426 family |
| 5118 | CALJVF010000110.1 | GCA937974765_02555 | CDS | open | 9618-10040 | _na 140_aa | hypothetical protein | |
| 5119 | CALJVF010000110.1 | GCA937974765_02556 | CDS | open | 10153-11355 | _na 400_aa | hipA | HipA domain-containing protein |
| 5120 | CALJVF010000110.1 | GCA937974765_02557 | CDS | open | 11348-11968 | _na 206_aa | hypothetical protein | |
| 5121 | CALJVF010000110.1 | GCA937974765_02558 | CDS | open | 12127-13314 | _na 395_aa | mviM | 1%2C5-anhydro-D-fructose reductase |
| 5122 | CALJVF010000110.1 | GCA937974765_02559 | CDS | open | 13676-14809 | _na 377_aa | frmA | S-(Hydroxymethyl)mycothiol dehydrogenase |
| 5123 | CALJVF010000110.1 | GCA937974765_02560 | CDS | open | 14853-15587 | _na 244_aa | putative membrane transporter protein | |
| 5124 | CALJVF010000110.1 | GCA937974765_02561 | CDS | open | 15755-16543 | _na 262_aa | glpR | Lactose phosphotransferase system repressor |
| 5125 | CALJVF010000110.1 | GCA937974765_02548 | gene | open | 289-1218 | |||
| 5126 | CALJVF010000110.1 | GCA937974765_02549 | gene | open | 1613-3184 | |||
| 5127 | CALJVF010000110.1 | GCA937974765_02550 | gene | open | 3177-5132 | |||
| 5128 | CALJVF010000110.1 | GCA937974765_02551 | gene | open | 5129-6538 | cas10 | ||
| 5129 | CALJVF010000110.1 | GCA937974765_02552 | gene | open | 6535-7095 | |||
| 5130 | CALJVF010000110.1 | GCA937974765_02553 | gene | open | 7092-8363 | |||
| 5131 | CALJVF010000110.1 | GCA937974765_02554 | gene | open | 8363-9625 | csm3 | ||
| 5132 | CALJVF010000110.1 | GCA937974765_02555 | gene | open | 9618-10040 | |||
| 5133 | CALJVF010000110.1 | GCA937974765_02556 | gene | open | 10153-11355 | hipA | ||
| 5134 | CALJVF010000110.1 | GCA937974765_02557 | gene | open | 11348-11968 | |||
| 5135 | CALJVF010000110.1 | GCA937974765_02558 | gene | open | 12127-13314 | mviM | ||
| 5136 | CALJVF010000110.1 | GCA937974765_02559 | gene | open | 13676-14809 | frmA | ||
| 5137 | CALJVF010000110.1 | GCA937974765_02560 | gene | open | 14853-15587 | |||
| 5138 | CALJVF010000110.1 | GCA937974765_02561 | gene | open | 15755-16543 | glpR | ||
| 5139 | CALJVF010000111.1 | GCA937974765_02562 | CDS | open | 232-1647 | _na 471_aa | hypothetical protein | |
| 5140 | CALJVF010000111.1 | GCA937974765_02563 | CDS | open | 1690-2352 | _na 220_aa | Lipoprotein | |
| 5141 | CALJVF010000111.1 | GCA937974765_02564 | CDS | open | 2364-5192 | _na 942_aa | hypothetical protein | |
| 5142 | CALJVF010000111.1 | GCA937974765_02565 | CDS | open | 5216-5557 | _na 113_aa | hypothetical protein | |
| 5143 | CALJVF010000111.1 | GCA937974765_02566 | CDS | open | 5752-6816 | _na 354_aa | cydB | cytochrome d ubiquinol oxidase subunit II |
| 5144 | CALJVF010000111.1 | GCA937974765_02567 | CDS | open | 6831-8303 | _na 490_aa | appC | Cytochrome d ubiquinol oxidase subunit 1 |
| 5145 | CALJVF010000111.1 | GCA937974765_02568 | CDS | open | 8440-8772 | _na 110_aa | copY | Transcriptional regulator BlaI |
| 5146 | CALJVF010000111.1 | GCA937974765_02569 | CDS | open | 9247-10953 | _na 568_aa | glcD | putative FAD-linked oxidoreductase Rv2280 |
| 5147 | CALJVF010000111.1 | GCA937974765_02570 | CDS | open | 10950-11768 | _na 272_aa | plsC | 1-acyl-sn-glycerol-3-phosphate acyltransferase |
| 5148 | CALJVF010000111.1 | GCA937974765_02571 | CDS | open | 11772-12548 | _na 258_aa | yqjQ | putative oxidoreductase SAV2478 |
| 5149 | CALJVF010000111.1 | GCA937974765_02572 | CDS | open | 12682-13662 | _na 326_aa | 5'-nucleotidase | |
| 5150 | CALJVF010000111.1 | GCA937974765_02573 | CDS | open | 14015-15199 | _na 394_aa | ackA | Acetate kinase |
| 5151 | CALJVF010000111.1 | GCA937974765_02574 | CDS | open | 15271-17331 | _na 686_aa | pta | phosphate acetyltransferase |
| 5152 | CALJVF010000111.1 | GCA937974765_02575 | CDS | open | 17538-18953 | _na 471_aa | aspA | aspartate ammonia-lyase |
| 5153 | CALJVF010000111.1 | GCA937974765_02576 | CDS | open | 19059-19841 | _na 260_aa | nfo | deoxyribonuclease IV |
| 5154 | CALJVF010000111.1 | GCA937974765_02577 | CDS | open | 19852-20967 | _na 371_aa | nagC | Glucokinase |
| 5155 | CALJVF010000111.1 | GCA937974765_02578 | CDS | open | 21465-22736 | _na 423_aa | ugpB | ABC transporter substrate-binding protein yesO |
| 5156 | CALJVF010000111.1 | GCA937974765_02579 | CDS | open | 22754-23653 | _na 299_aa | ugpA | sn-glycerol-3-phosphate transport system permease protein ugpA |
| 5157 | CALJVF010000111.1 | GCA937974765_02580 | CDS | open | 23643-24491 | _na 282_aa | ugpE | Inner membrane ABC transporter permease protein ycjP |
| 5158 | CALJVF010000111.1 | GCA937974765_02581 | CDS | open | 24491-25432 | _na 313_aa | nagC | Glucokinase |
| 5159 | CALJVF010000111.1 | GCA937974765_02582 | CDS | open | 25429-26985 | _na 518_aa | putative conserved protein | |
| 5160 | CALJVF010000111.1 | GCA937974765_02583 | CDS | open | 26979-28295 | _na 438_aa | afuC | Alpha-L-fucosidase |
| 5161 | CALJVF010000111.1 | GCA937974765_02584 | CDS | open | 28626-29780 | _na 384_aa | TQXA domain | |
| 5162 | CALJVF010000111.1 | GCA937974765_02585 | CDS | open | 29990-31105 | _na 371_aa | TQXA domain | |
| 5163 | CALJVF010000111.1 | GCA937974765_02586 | CDS | open | 31476-32732 | _na 418_aa | TQXA domain | |
| 5164 | CALJVF010000111.1 | GCA937974765_02587 | CDS | open | 33055-34977 | _na 640_aa | amyA | Oligo-1%2C6-glucosidase |
| 5165 | CALJVF010000111.1 | GCA937974765_02588 | CDS | open | 35096-35875 | _na 259_aa | lppM | LppM domain-containing protein |
| 5166 | CALJVF010000111.1 | GCA937974765_02589 | CDS | open | 35872-36639 | _na 255_aa | DUF6891 domain-containing protein | |
| 5167 | CALJVF010000111.1 | GCA937974765_02590 | CDS | open | 36652-37245 | _na 197_aa | hypothetical protein | |
| 5168 | CALJVF010000111.1 | GCA937974765_02591 | CDS | open | 37388-39193 | _na 601_aa | hypothetical protein | |
| 5169 | CALJVF010000111.1 | GCA937974765_02592 | CDS | open | 39245-39664 | _na 139_aa | hypothetical protein | |
| 5170 | CALJVF010000111.1 | GCA937974765_02593 | CDS | open | 39967-41409 | _na 480_aa | hAMP | histidine kinase |
| 5171 | CALJVF010000111.1 | GCA937974765_02594 | CDS | open | 41406-42092 | _na 228_aa | ompR | Mycobacterial persistence regulator A |
| 5172 | CALJVF010000111.1 | GCA937974765_02595 | CDS | open | 42225-42674 | _na 149_aa | wzb | protein-tyrosine-phosphatase |
| 5173 | CALJVF010000111.1 | GCA937974765_02596 | CDS | open | 42776-43768 | _na 330_aa | argF | ornithine carbamoyltransferase |
| 5174 | CALJVF010000111.1 | GCA937974765_02597 | CDS | open | 43892-44365 | _na 157_aa | DUF1877 domain-containing protein | |
| 5175 | CALJVF010000111.1 | GCA937974765_02598 | CDS | open | 44421-44756 | _na 111_aa | hypothetical protein | |
| 5176 | CALJVF010000111.1 | GCA937974765_02599 | CDS | open | 44756-45835 | _na 359_aa | DUF6177 domain-containing protein | |
| 5177 | CALJVF010000111.1 | GCA937974765_02600 | CDS | open | 45929-46495 | _na 188_aa | Ankyrin repeat domain-containing protein | |
| 5178 | CALJVF010000111.1 | GCA937974765_02601 | CDS | open | 46512-46664 | _na 50_aa | yqcG | Toxin YqcG C-terminal domain-containing protein |
| 5179 | CALJVF010000111.1 | GCA937974765_02562 | gene | open | 232-1647 | |||
| 5180 | CALJVF010000111.1 | GCA937974765_02563 | gene | open | 1690-2352 | |||
| 5181 | CALJVF010000111.1 | GCA937974765_02564 | gene | open | 2364-5192 | |||
| 5182 | CALJVF010000111.1 | GCA937974765_02565 | gene | open | 5216-5557 | |||
| 5183 | CALJVF010000111.1 | GCA937974765_02566 | gene | open | 5752-6816 | cydB | ||
| 5184 | CALJVF010000111.1 | GCA937974765_02567 | gene | open | 6831-8303 | appC | ||
| 5185 | CALJVF010000111.1 | GCA937974765_02568 | gene | open | 8440-8772 | copY | ||
| 5186 | CALJVF010000111.1 | GCA937974765_02569 | gene | open | 9247-10953 | glcD | ||
| 5187 | CALJVF010000111.1 | GCA937974765_02570 | gene | open | 10950-11768 | plsC | ||
| 5188 | CALJVF010000111.1 | GCA937974765_02571 | gene | open | 11772-12548 | yqjQ | ||
| 5189 | CALJVF010000111.1 | GCA937974765_02572 | gene | open | 12682-13662 | |||
| 5190 | CALJVF010000111.1 | GCA937974765_02573 | gene | open | 14015-15199 | ackA | ||
| 5191 | CALJVF010000111.1 | GCA937974765_02574 | gene | open | 15271-17331 | pta | ||
| 5192 | CALJVF010000111.1 | GCA937974765_02575 | gene | open | 17538-18953 | aspA | ||
| 5193 | CALJVF010000111.1 | GCA937974765_02576 | gene | open | 19059-19841 | nfo | ||
| 5194 | CALJVF010000111.1 | GCA937974765_02577 | gene | open | 19852-20967 | nagC | ||
| 5195 | CALJVF010000111.1 | GCA937974765_02578 | gene | open | 21465-22736 | ugpB | ||
| 5196 | CALJVF010000111.1 | GCA937974765_02579 | gene | open | 22754-23653 | ugpA | ||
| 5197 | CALJVF010000111.1 | GCA937974765_02580 | gene | open | 23643-24491 | ugpE | ||
| 5198 | CALJVF010000111.1 | GCA937974765_02581 | gene | open | 24491-25432 | nagC | ||
| 5199 | CALJVF010000111.1 | GCA937974765_02582 | gene | open | 25429-26985 | |||
| 5200 | CALJVF010000111.1 | GCA937974765_02583 | gene | open | 26979-28295 | afuC | ||
| 5201 | CALJVF010000111.1 | GCA937974765_02584 | gene | open | 28626-29780 | |||
| 5202 | CALJVF010000111.1 | GCA937974765_02585 | gene | open | 29990-31105 | |||
| 5203 | CALJVF010000111.1 | GCA937974765_02586 | gene | open | 31476-32732 | |||
| 5204 | CALJVF010000111.1 | GCA937974765_02587 | gene | open | 33055-34977 | amyA | ||
| 5205 | CALJVF010000111.1 | GCA937974765_02588 | gene | open | 35096-35875 | lppM | ||
| 5206 | CALJVF010000111.1 | GCA937974765_02589 | gene | open | 35872-36639 | |||
| 5207 | CALJVF010000111.1 | GCA937974765_02590 | gene | open | 36652-37245 | |||
| 5208 | CALJVF010000111.1 | GCA937974765_02591 | gene | open | 37388-39193 | |||
| 5209 | CALJVF010000111.1 | GCA937974765_02592 | gene | open | 39245-39664 | |||
| 5210 | CALJVF010000111.1 | GCA937974765_02593 | gene | open | 39967-41409 | hAMP | ||
| 5211 | CALJVF010000111.1 | GCA937974765_02594 | gene | open | 41406-42092 | ompR | ||
| 5212 | CALJVF010000111.1 | GCA937974765_02595 | gene | open | 42225-42674 | wzb | ||
| 5213 | CALJVF010000111.1 | GCA937974765_02596 | gene | open | 42776-43768 | argF | ||
| 5214 | CALJVF010000111.1 | GCA937974765_02597 | gene | open | 43892-44365 | |||
| 5215 | CALJVF010000111.1 | GCA937974765_02598 | gene | open | 44421-44756 | |||
| 5216 | CALJVF010000111.1 | GCA937974765_02599 | gene | open | 44756-45835 | |||
| 5217 | CALJVF010000111.1 | GCA937974765_02600 | gene | open | 45929-46495 | |||
| 5218 | CALJVF010000111.1 | GCA937974765_02601 | gene | open | 46512-46664 | yqcG | ||
| 5219 | CALJVF010000112.1 | repeat_region | open | 4469-4836 | CRISPR array with 5 repeats of length 36%2C consensus sequence GTCTCAATGGAGTCCGGCCTAGAAGACCGGAACAAT and spacer length 37 | |||
| 5220 | CALJVF010000112.1 | repeat_region | open | 6038-18896 | CRISPR array with 176 repeats of length 36%2C consensus sequence GTCTCAATGGAGTCCGGCCTAGAAGACCGGAACAAT and spacer length 37 | |||
| 5221 | CALJVF010000112.1 | GCA937974765_02602 | CDS | open | 62-526 | _na 154_aa | hypothetical protein | |
| 5222 | CALJVF010000112.1 | GCA937974765_02603 | CDS | open | 593-1057 | _na 154_aa | hypothetical protein | |
| 5223 | CALJVF010000112.1 | GCA937974765_02604 | CDS | open | 1127-1543 | _na 138_aa | cupin domain-containing protein | |
| 5224 | CALJVF010000112.1 | GCA937974765_02605 | CDS | open | 1560-2324 | _na 254_aa | DUF364 domain-containing protein | |
| 5225 | CALJVF010000112.1 | GCA937974765_02606 | CDS | open | 2360-2776 | _na 138_aa | arsR | HTH-type transcriptional regulator CmtR |
| 5226 | CALJVF010000112.1 | GCA937974765_02607 | CDS | open | 2773-3777 | _na 334_aa | czcD | Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter |
| 5227 | CALJVF010000112.1 | GCA937974765_02608 | CDS | open | 4855-5664 | _na 269_aa | IS630 family transposase | |
| 5228 | CALJVF010000112.1 | GCA937974765_02609 | CDS | open | 19060-19344 | _na 94_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 5229 | CALJVF010000112.1 | GCA937974765_02610 | CDS | open | 19348-20703 | _na 451_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 5230 | CALJVF010000112.1 | GCA937974765_02611 | CDS | open | 21016-22512 | _na 498_aa | csb2 | type I-U CRISPR-associated protein Csb2 |
| 5231 | CALJVF010000112.1 | GCA937974765_02612 | CDS | open | 22491-23429 | _na 312_aa | csb1gr7 | Type I-U CRISPR-associated protein Cas7 |
| 5232 | CALJVF010000112.1 | GCA937974765_02613 | CDS | open | 23426-25621 | _na 731_aa | CRISPR-associated protein Csx17%2C subtype Dpsyc | |
| 5233 | CALJVF010000112.1 | GCA937974765_02614 | CDS | open | 25618-28122 | _na 834_aa | cas3 | Helicase Cas3 |
| 5234 | CALJVF010000112.1 | GCA937974765_02615 | CDS | open | 28602-29279 | _na 225_aa | hypothetical protein | |
| 5235 | CALJVF010000112.1 | GCA937974765_02616 | CDS | open | 29699-30241 | _na 180_aa | acrR | Bacterial regulatory proteins%2C tetR family |
| 5236 | CALJVF010000112.1 | GCA937974765_02617 | CDS | open | 30238-31983 | _na 581_aa | mdlB | Multidrug export ATP-binding/permease protein SAV1866 |
| 5237 | CALJVF010000112.1 | GCA937974765_02618 | CDS | open | 31980-33974 | _na 664_aa | mdlB | putative multidrug resistance ABC transporter ATP-binding/permease protein YheH |
| 5238 | CALJVF010000112.1 | GCA937974765_02619 | CDS | open | 34122-34760 | _na 212_aa | hypothetical protein | |
| 5239 | CALJVF010000112.1 | GCA937974765_02620 | CDS | open | 35215-36732 | _na 505_aa | nhaP2 | potassium/proton antiporter |
| 5240 | CALJVF010000112.1 | GCA937974765_02622 | CDS | open | 37664-38476 | _na 270_aa | fliL | flagellar basal body-associated protein FliL |
| 5241 | CALJVF010000112.1 | GCA937974765_02623 | CDS | open | 38814-39584 | _na 256_aa | fliL | flagellar basal body-associated protein FliL |
| 5242 | CALJVF010000112.1 | GCA937974765_02624 | CDS | open | 39759-40499 | _na 246_aa | hypothetical protein | |
| 5243 | CALJVF010000112.1 | GCA937974765_02625 | CDS | open | 40621-41409 | _na 262_aa | fliL | flagellar basal body-associated protein FliL |
| 5244 | CALJVF010000112.1 | GCA937974765_02626 | CDS | open | 41520-42731 | _na 403_aa | rfaB | D-inositol-3-phosphate glycosyltransferase |
| 5245 | CALJVF010000112.1 | GCA937974765_02627 | CDS | open | 42728-43480 | _na 250_aa | lmbE | 1D-myo-inositol 2-acetamido-2-deoxy-alpha-D-glucopyranoside deacetylase |
| 5246 | CALJVF010000112.1 | GCA937974765_02628 | CDS | open | 43931-44536 | _na 201_aa | Lipoprotein | |
| 5247 | CALJVF010000112.1 | GCA937974765_02629 | CDS | open | 44533-45450 | _na 305_aa | ATP/GTP-binding protein | |
| 5248 | CALJVF010000112.1 | GCA937974765_02630 | CDS | open | 45915-46223 | _na 102_aa | hypothetical protein | |
| 5249 | CALJVF010000112.1 | GCA937974765_02602 | gene | open | 62-526 | |||
| 5250 | CALJVF010000112.1 | GCA937974765_02603 | gene | open | 593-1057 | |||
| 5251 | CALJVF010000112.1 | GCA937974765_02604 | gene | open | 1127-1543 | |||
| 5252 | CALJVF010000112.1 | GCA937974765_02605 | gene | open | 1560-2324 | |||
| 5253 | CALJVF010000112.1 | GCA937974765_02606 | gene | open | 2360-2776 | arsR | ||
| 5254 | CALJVF010000112.1 | GCA937974765_02607 | gene | open | 2773-3777 | czcD | ||
| 5255 | CALJVF010000112.1 | GCA937974765_02608 | gene | open | 4855-5664 | |||
| 5256 | CALJVF010000112.1 | GCA937974765_02609 | gene | open | 19060-19344 | cas2 | ||
| 5257 | CALJVF010000112.1 | GCA937974765_02610 | gene | open | 19348-20703 | cas1 | ||
| 5258 | CALJVF010000112.1 | GCA937974765_02611 | gene | open | 21016-22512 | csb2 | ||
| 5259 | CALJVF010000112.1 | GCA937974765_02612 | gene | open | 22491-23429 | csb1gr7 | ||
| 5260 | CALJVF010000112.1 | GCA937974765_02613 | gene | open | 23426-25621 | |||
| 5261 | CALJVF010000112.1 | GCA937974765_02614 | gene | open | 25618-28122 | cas3 | ||
| 5262 | CALJVF010000112.1 | GCA937974765_02615 | gene | open | 28602-29279 | |||
| 5263 | CALJVF010000112.1 | GCA937974765_02616 | gene | open | 29699-30241 | acrR | ||
| 5264 | CALJVF010000112.1 | GCA937974765_02617 | gene | open | 30238-31983 | mdlB | ||
| 5265 | CALJVF010000112.1 | GCA937974765_02618 | gene | open | 31980-33974 | mdlB | ||
| 5266 | CALJVF010000112.1 | GCA937974765_02619 | gene | open | 34122-34760 | |||
| 5267 | CALJVF010000112.1 | GCA937974765_02620 | gene | open | 35215-36732 | nhaP2 | ||
| 5268 | CALJVF010000112.1 | GCA937974765_02622 | gene | open | 37664-38476 | fliL | ||
| 5269 | CALJVF010000112.1 | GCA937974765_02623 | gene | open | 38814-39584 | fliL | ||
| 5270 | CALJVF010000112.1 | GCA937974765_02624 | gene | open | 39759-40499 | |||
| 5271 | CALJVF010000112.1 | GCA937974765_02625 | gene | open | 40621-41409 | fliL | ||
| 5272 | CALJVF010000112.1 | GCA937974765_02626 | gene | open | 41520-42731 | rfaB | ||
| 5273 | CALJVF010000112.1 | GCA937974765_02627 | gene | open | 42728-43480 | lmbE | ||
| 5274 | CALJVF010000112.1 | GCA937974765_02628 | gene | open | 43931-44536 | |||
| 5275 | CALJVF010000112.1 | GCA937974765_02629 | gene | open | 44533-45450 | |||
| 5276 | CALJVF010000112.1 | GCA937974765_02630 | gene | open | 45915-46223 | |||
| 5277 | CALJVF010000112.1 | GCA937974765_02621 | gene | open | 37094-37176 | trnL | ||
| 5278 | CALJVF010000112.1 | GCA937974765_02621 | tRNA | open | 37094-37176 | trnL | tRNA-Leu(cag) | |
| 5279 | CALJVF010000113.1 | GCA937974765_02631 | CDS | open | 132-1619 | _na 495_aa | hypothetical protein | |
| 5280 | CALJVF010000113.1 | GCA937974765_02632 | CDS | open | 2113-3351 | _na 412_aa | hypothetical protein | |
| 5281 | CALJVF010000113.1 | GCA937974765_02633 | CDS | open | 3348-5348 | _na 666_aa | hypothetical protein | |
| 5282 | CALJVF010000113.1 | GCA937974765_02634 | CDS | open | 5674-6852 | _na 392_aa | comP | histidine kinase |
| 5283 | CALJVF010000113.1 | GCA937974765_02635 | CDS | open | 7019-7669 | _na 216_aa | citB | Response regulator protein vraR |
| 5284 | CALJVF010000113.1 | GCA937974765_02631 | gene | open | 132-1619 | |||
| 5285 | CALJVF010000113.1 | GCA937974765_02632 | gene | open | 2113-3351 | |||
| 5286 | CALJVF010000113.1 | GCA937974765_02633 | gene | open | 3348-5348 | |||
| 5287 | CALJVF010000113.1 | GCA937974765_02634 | gene | open | 5674-6852 | comP | ||
| 5288 | CALJVF010000113.1 | GCA937974765_02635 | gene | open | 7019-7669 | citB | ||
| 5289 | CALJVF010000114.1 | GCA937974765_02636 | CDS | open | 57-947 | _na 296_aa | hypothetical protein | |
| 5290 | CALJVF010000114.1 | GCA937974765_02637 | CDS | open | 1174-2247 | _na 357_aa | N-ethylmaleimide reductase | |
| 5291 | CALJVF010000114.1 | GCA937974765_02638 | CDS | open | 2387-3016 | _na 209_aa | rloB | RloB family protein |
| 5292 | CALJVF010000114.1 | GCA937974765_02639 | CDS | open | 3023-4342 | _na 439_aa | ATP-binding protein | |
| 5293 | CALJVF010000114.1 | GCA937974765_02640 | CDS | open | 4501-4989 | _na 162_aa | rimI | Putative acetyltransferase |
| 5294 | CALJVF010000114.1 | GCA937974765_02641 | CDS | open | 5599-5916 | _na 105_aa | hypothetical protein | |
| 5295 | CALJVF010000114.1 | GCA937974765_02642 | CDS | open | 6238-7551 | _na 437_aa | cotH | CotH protein |
| 5296 | CALJVF010000114.1 | GCA937974765_02643 | CDS | open | 7582-9423 | _na 613_aa | DUF262 domain-containing protein | |
| 5297 | CALJVF010000114.1 | GCA937974765_02644 | CDS | open | 9417-10628 | _na 403_aa | hipA | HipA domain-containing protein |
| 5298 | CALJVF010000114.1 | GCA937974765_02645 | CDS | open | 10686-11987 | _na 433_aa | afuC | Alpha-L-fucosidase |
| 5299 | CALJVF010000114.1 | GCA937974765_02646 | CDS | open | 11977-12819 | _na 280_aa | ugpE | Inner membrane ABC transporter permease protein ycjP |
| 5300 | CALJVF010000114.1 | GCA937974765_02647 | CDS | open | 12809-13738 | _na 309_aa | ugpA | Inner membrane ABC transporter permease protein ycjO |
| 5301 | CALJVF010000114.1 | GCA937974765_02648 | CDS | open | 13743-14969 | _na 408_aa | ugpB | Maltodextrin-binding protein mdxE |
| 5302 | CALJVF010000114.1 | GCA937974765_02649 | CDS | open | 15274-17868 | _na 864_aa | putative membrane protein | |
| 5303 | CALJVF010000114.1 | GCA937974765_02650 | CDS | open | 17976-18335 | _na 119_aa | hypothetical protein | |
| 5304 | CALJVF010000114.1 | GCA937974765_02651 | CDS | open | 18547-18771 | _na 74_aa | hypothetical protein | |
| 5305 | CALJVF010000114.1 | GCA937974765_02652 | CDS | open | 19395-21071 | _na 558_aa | helix-turn-helix transcriptional regulator | |
| 5306 | CALJVF010000114.1 | GCA937974765_02653 | CDS | open | 21255-21764 | _na 169_aa | ABC transporter permease | |
| 5307 | CALJVF010000114.1 | GCA937974765_02654 | CDS | open | 21828-22112 | _na 94_aa | hypothetical protein | |
| 5308 | CALJVF010000114.1 | GCA937974765_02655 | CDS | open | 22109-23020 | _na 303_aa | ABC transporter ATP-binding protein | |
| 5309 | CALJVF010000114.1 | GCA937974765_02636 | gene | open | 57-947 | |||
| 5310 | CALJVF010000114.1 | GCA937974765_02637 | gene | open | 1174-2247 | |||
| 5311 | CALJVF010000114.1 | GCA937974765_02638 | gene | open | 2387-3016 | rloB | ||
| 5312 | CALJVF010000114.1 | GCA937974765_02639 | gene | open | 3023-4342 | |||
| 5313 | CALJVF010000114.1 | GCA937974765_02640 | gene | open | 4501-4989 | rimI | ||
| 5314 | CALJVF010000114.1 | GCA937974765_02641 | gene | open | 5599-5916 | |||
| 5315 | CALJVF010000114.1 | GCA937974765_02642 | gene | open | 6238-7551 | cotH | ||
| 5316 | CALJVF010000114.1 | GCA937974765_02643 | gene | open | 7582-9423 | |||
| 5317 | CALJVF010000114.1 | GCA937974765_02644 | gene | open | 9417-10628 | hipA | ||
| 5318 | CALJVF010000114.1 | GCA937974765_02645 | gene | open | 10686-11987 | afuC | ||
| 5319 | CALJVF010000114.1 | GCA937974765_02646 | gene | open | 11977-12819 | ugpE | ||
| 5320 | CALJVF010000114.1 | GCA937974765_02647 | gene | open | 12809-13738 | ugpA | ||
| 5321 | CALJVF010000114.1 | GCA937974765_02648 | gene | open | 13743-14969 | ugpB | ||
| 5322 | CALJVF010000114.1 | GCA937974765_02649 | gene | open | 15274-17868 | |||
| 5323 | CALJVF010000114.1 | GCA937974765_02650 | gene | open | 17976-18335 | |||
| 5324 | CALJVF010000114.1 | GCA937974765_02651 | gene | open | 18547-18771 | |||
| 5325 | CALJVF010000114.1 | GCA937974765_02652 | gene | open | 19395-21071 | |||
| 5326 | CALJVF010000114.1 | GCA937974765_02653 | gene | open | 21255-21764 | |||
| 5327 | CALJVF010000114.1 | GCA937974765_02654 | gene | open | 21828-22112 | |||
| 5328 | CALJVF010000114.1 | GCA937974765_02655 | gene | open | 22109-23020 | |||
| 5329 | CALJVF010000115.1 | GCA937974765_02656 | CDS | open | 2632-5043 | _na 803_aa | ppsA | Phosphoenolpyruvate synthase |
| 5330 | CALJVF010000115.1 | GCA937974765_02657 | CDS | open | 5040-6209 | _na 389_aa | araJ | Multidrug-efflux transporter 3 |
| 5331 | CALJVF010000115.1 | GCA937974765_02658 | CDS | open | 6206-6781 | _na 191_aa | acrR | HTH-type transcriptional repressor Bm3R1 |
| 5332 | CALJVF010000115.1 | GCA937974765_02659 | CDS | open | 7079-8413 | _na 444_aa | hypothetical protein | |
| 5333 | CALJVF010000115.1 | GCA937974765_02660 | CDS | open | 8608-9897 | _na 429_aa | hypothetical protein | |
| 5334 | CALJVF010000115.1 | GCA937974765_02661 | CDS | open | 10077-10964 | _na 295_aa | fba1 | fructose bisphosphate aldolase |
| 5335 | CALJVF010000115.1 | GCA937974765_02662 | CDS | open | 11100-11480 | _na 126_aa | hypothetical protein | |
| 5336 | CALJVF010000115.1 | GCA937974765_02663 | CDS | open | 12339-12944 | _na 201_aa | ubiG | 3-demethylubiquinone-9 3-methyltransferase |
| 5337 | CALJVF010000115.1 | GCA937974765_02664 | CDS | open | 13063-13962 | _na 299_aa | hypothetical protein | |
| 5338 | CALJVF010000115.1 | GCA937974765_02665 | CDS | open | 14216-14926 | _na 236_aa | putative protein conserved in bacteria | |
| 5339 | CALJVF010000115.1 | GCA937974765_02666 | CDS | open | 15115-16290 | _na 391_aa | glycosyltransferase | |
| 5340 | CALJVF010000115.1 | GCA937974765_02667 | CDS | open | 16287-17432 | _na 381_aa | O-antigen ligase family protein | |
| 5341 | CALJVF010000115.1 | GCA937974765_02668 | CDS | open | 17535-18149 | _na 204_aa | hypothetical protein | |
| 5342 | CALJVF010000115.1 | GCA937974765_02656 | gene | open | 2632-5043 | ppsA | ||
| 5343 | CALJVF010000115.1 | GCA937974765_02657 | gene | open | 5040-6209 | araJ | ||
| 5344 | CALJVF010000115.1 | GCA937974765_02658 | gene | open | 6206-6781 | acrR | ||
| 5345 | CALJVF010000115.1 | GCA937974765_02659 | gene | open | 7079-8413 | |||
| 5346 | CALJVF010000115.1 | GCA937974765_02660 | gene | open | 8608-9897 | |||
| 5347 | CALJVF010000115.1 | GCA937974765_02661 | gene | open | 10077-10964 | fba1 | ||
| 5348 | CALJVF010000115.1 | GCA937974765_02662 | gene | open | 11100-11480 | |||
| 5349 | CALJVF010000115.1 | GCA937974765_02663 | gene | open | 12339-12944 | ubiG | ||
| 5350 | CALJVF010000115.1 | GCA937974765_02664 | gene | open | 13063-13962 | |||
| 5351 | CALJVF010000115.1 | GCA937974765_02665 | gene | open | 14216-14926 | |||
| 5352 | CALJVF010000115.1 | GCA937974765_02666 | gene | open | 15115-16290 | |||
| 5353 | CALJVF010000115.1 | GCA937974765_02667 | gene | open | 16287-17432 | |||
| 5354 | CALJVF010000115.1 | GCA937974765_02668 | gene | open | 17535-18149 | |||
| 5355 | CALJVF010000116.1 | GCA937974765_02669 | CDS | open | 276-1529 | _na 417_aa | mshC | cysteine--1-D-myo-inosityl 2-amino-2-deoxy-alpha-D-glucopyranoside ligase |
| 5356 | CALJVF010000116.1 | GCA937974765_02670 | CDS | open | 1590-2006 | _na 138_aa | DUF3090 domain-containing protein | |
| 5357 | CALJVF010000116.1 | GCA937974765_02671 | CDS | open | 2319-3227 | _na 302_aa | pdxI | Aldo/keto reductase |
| 5358 | CALJVF010000116.1 | GCA937974765_02673 | CDS | open | 3664-5199 | _na 511_aa | proP | Antiseptic resistance protein |
| 5359 | CALJVF010000116.1 | GCA937974765_02674 | CDS | open | 5272-5856 | _na 194_aa | TetR/AcrR family transcriptional regulator | |
| 5360 | CALJVF010000116.1 | GCA937974765_02675 | CDS | open | 5866-6159 | _na 97_aa | hypothetical protein | |
| 5361 | CALJVF010000116.1 | GCA937974765_02676 | CDS | open | 6169-6684 | _na 171_aa | Protein-disulfide isomerase | |
| 5362 | CALJVF010000116.1 | GCA937974765_02677 | CDS | open | 6727-6963 | _na 78_aa | hypothetical protein | |
| 5363 | CALJVF010000116.1 | GCA937974765_02678 | CDS | open | 7099-9279 | _na 726_aa | helD | Helicase IV |
| 5364 | CALJVF010000116.1 | GCA937974765_02679 | CDS | open | 9272-10159 | _na 295_aa | metF | Methylenetetrahydrofolate reductase |
| 5365 | CALJVF010000116.1 | GCA937974765_02680 | CDS | open | 10651-11733 | _na 360_aa | ispA | Octaprenyl-diphosphate synthase |
| 5366 | CALJVF010000116.1 | GCA937974765_02681 | CDS | open | 12280-12813 | _na 177_aa | hypothetical protein | |
| 5367 | CALJVF010000116.1 | GCA937974765_02669 | gene | open | 276-1529 | mshC | ||
| 5368 | CALJVF010000116.1 | GCA937974765_02670 | gene | open | 1590-2006 | |||
| 5369 | CALJVF010000116.1 | GCA937974765_02671 | gene | open | 2319-3227 | pdxI | ||
| 5370 | CALJVF010000116.1 | GCA937974765_02673 | gene | open | 3664-5199 | proP | ||
| 5371 | CALJVF010000116.1 | GCA937974765_02674 | gene | open | 5272-5856 | |||
| 5372 | CALJVF010000116.1 | GCA937974765_02675 | gene | open | 5866-6159 | |||
| 5373 | CALJVF010000116.1 | GCA937974765_02676 | gene | open | 6169-6684 | |||
| 5374 | CALJVF010000116.1 | GCA937974765_02677 | gene | open | 6727-6963 | |||
| 5375 | CALJVF010000116.1 | GCA937974765_02678 | gene | open | 7099-9279 | helD | ||
| 5376 | CALJVF010000116.1 | GCA937974765_02679 | gene | open | 9272-10159 | metF | ||
| 5377 | CALJVF010000116.1 | GCA937974765_02680 | gene | open | 10651-11733 | ispA | ||
| 5378 | CALJVF010000116.1 | GCA937974765_02681 | gene | open | 12280-12813 | |||
| 5379 | CALJVF010000116.1 | GCA937974765_02672 | gene | open | 3299-3385 | trnL | ||
| 5380 | CALJVF010000116.1 | GCA937974765_02672 | tRNA | open | 3299-3385 | trnL | tRNA-Leu(gag) | |
| 5381 | CALJVF010000117.1 | regulatory_region | open | 5031-5212 | Cobalamin riboswitch aptamer | |||
| 5382 | CALJVF010000117.1 | GCA937974765_02682 | CDS | open | 779-1591 | _na 270_aa | dppD | Glutathione import ATP-binding protein GsiA |
| 5383 | CALJVF010000117.1 | GCA937974765_02683 | CDS | open | 1578-2405 | _na 275_aa | nikC | nickel transporter permease |
| 5384 | CALJVF010000117.1 | GCA937974765_02684 | CDS | open | 2402-3337 | _na 311_aa | dppB | Glutathione transport system permease protein gsiC |
| 5385 | CALJVF010000117.1 | GCA937974765_02685 | CDS | open | 3341-5002 | _na 553_aa | ddpA | Hemin-binding lipoprotein |
| 5386 | CALJVF010000117.1 | GCA937974765_02686 | CDS | open | 5299-5655 | _na 118_aa | DUF4190 domain-containing protein | |
| 5387 | CALJVF010000117.1 | GCA937974765_02688 | CDS | open | 6027-6353 | _na 108_aa | arsR | Helix-turn-helix domain |
| 5388 | CALJVF010000117.1 | GCA937974765_02689 | CDS | open | 6350-7495 | _na 381_aa | araJ | Purine efflux pump PbuE |
| 5389 | CALJVF010000117.1 | GCA937974765_02690 | CDS | open | 7476-8420 | _na 314_aa | DUF3566 domain-containing protein | |
| 5390 | CALJVF010000117.1 | GCA937974765_02691 | CDS | open | 8413-11046 | _na 877_aa | gyrA | DNA gyrase subunit A |
| 5391 | CALJVF010000117.1 | GCA937974765_02692 | CDS | open | 11079-13121 | _na 680_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 5392 | CALJVF010000117.1 | GCA937974765_02693 | CDS | open | 13617-14375 | _na 252_aa | ydiL | CAAX amino terminal protease self- immunity |
| 5393 | CALJVF010000117.1 | GCA937974765_02694 | CDS | open | 14431-15318 | _na 295_aa | hypothetical protein | |
| 5394 | CALJVF010000117.1 | GCA937974765_02695 | CDS | open | 15353-15463 | _na 36_aa | hypothetical protein | |
| 5395 | CALJVF010000117.1 | GCA937974765_02682 | gene | open | 779-1591 | dppD | ||
| 5396 | CALJVF010000117.1 | GCA937974765_02683 | gene | open | 1578-2405 | nikC | ||
| 5397 | CALJVF010000117.1 | GCA937974765_02684 | gene | open | 2402-3337 | dppB | ||
| 5398 | CALJVF010000117.1 | GCA937974765_02685 | gene | open | 3341-5002 | ddpA | ||
| 5399 | CALJVF010000117.1 | GCA937974765_02686 | gene | open | 5299-5655 | |||
| 5400 | CALJVF010000117.1 | GCA937974765_02688 | gene | open | 6027-6353 | arsR | ||
| 5401 | CALJVF010000117.1 | GCA937974765_02689 | gene | open | 6350-7495 | araJ | ||
| 5402 | CALJVF010000117.1 | GCA937974765_02690 | gene | open | 7476-8420 | |||
| 5403 | CALJVF010000117.1 | GCA937974765_02691 | gene | open | 8413-11046 | gyrA | ||
| 5404 | CALJVF010000117.1 | GCA937974765_02692 | gene | open | 11079-13121 | gyrB | ||
| 5405 | CALJVF010000117.1 | GCA937974765_02693 | gene | open | 13617-14375 | ydiL | ||
| 5406 | CALJVF010000117.1 | GCA937974765_02694 | gene | open | 14431-15318 | |||
| 5407 | CALJVF010000117.1 | GCA937974765_02695 | gene | open | 15353-15463 | |||
| 5408 | CALJVF010000117.1 | GCA937974765_02687 | gene | open | 5783-5856 | trnI | ||
| 5409 | CALJVF010000117.1 | GCA937974765_02687 | tRNA | open | 5783-5856 | trnI | tRNA-Ile(gat) | |
| 5410 | CALJVF010000118.1 | GCA937974765_02696 | CDS | open | 192-677 | _na 161_aa | hypothetical protein | |
| 5411 | CALJVF010000118.1 | GCA937974765_02697 | CDS | open | 734-2137 | _na 467_aa | lpd | Dihydrolipoyl dehydrogenase |
| 5412 | CALJVF010000118.1 | GCA937974765_02698 | CDS | open | 2232-2501 | _na 89_aa | Oxidoreductase | |
| 5413 | CALJVF010000118.1 | GCA937974765_02699 | CDS | open | 2694-3407 | _na 237_aa | hypothetical protein | |
| 5414 | CALJVF010000118.1 | GCA937974765_02700 | CDS | open | 3569-4831 | _na 420_aa | yjiC | PGL/p-HBAD biosynthesis rhamnosyltransferase |
| 5415 | CALJVF010000118.1 | GCA937974765_02701 | CDS | open | 4828-5724 | _na 298_aa | ybjT | NAD(P)H-binding protein |
| 5416 | CALJVF010000118.1 | GCA937974765_02702 | CDS | open | 5721-6323 | _na 200_aa | acrR | Pyrimidine utilization regulatory protein R |
| 5417 | CALJVF010000118.1 | GCA937974765_02703 | CDS | open | 6523-6966 | _na 147_aa | Cytosol aminopeptidase domain-containing protein | |
| 5418 | CALJVF010000118.1 | GCA937974765_02704 | CDS | open | 7070-7900 | _na 276_aa | hypothetical protein | |
| 5419 | CALJVF010000118.1 | GCA937974765_02705 | CDS | open | 7906-8646 | _na 246_aa | ABC transporter ATP-binding protein | |
| 5420 | CALJVF010000118.1 | GCA937974765_02706 | CDS | open | 9155-9799 | _na 214_aa | Pyrimidine utilization regulatory protein R | |
| 5421 | CALJVF010000118.1 | GCA937974765_02707 | CDS | open | 10480-11973 | _na 497_aa | pepB | leucyl aminopeptidase |
| 5422 | CALJVF010000118.1 | GCA937974765_02708 | CDS | open | 12011-13018 | _na 335_aa | rocF | arginase |
| 5423 | CALJVF010000118.1 | GCA937974765_02709 | CDS | open | 13125-13331 | _na 68_aa | hypothetical protein | |
| 5424 | CALJVF010000118.1 | GCA937974765_02710 | CDS | open | 13328-14107 | _na 259_aa | DUF3043 domain-containing protein | |
| 5425 | CALJVF010000118.1 | GCA937974765_02711 | CDS | open | 14214-15017 | _na 267_aa | Phage shock A-like protein | |
| 5426 | CALJVF010000118.1 | GCA937974765_02712 | CDS | open | 15014-15337 | _na 107_aa | PspA-associated domain-containing protein | |
| 5427 | CALJVF010000118.1 | GCA937974765_02696 | gene | open | 192-677 | |||
| 5428 | CALJVF010000118.1 | GCA937974765_02697 | gene | open | 734-2137 | lpd | ||
| 5429 | CALJVF010000118.1 | GCA937974765_02698 | gene | open | 2232-2501 | |||
| 5430 | CALJVF010000118.1 | GCA937974765_02699 | gene | open | 2694-3407 | |||
| 5431 | CALJVF010000118.1 | GCA937974765_02700 | gene | open | 3569-4831 | yjiC | ||
| 5432 | CALJVF010000118.1 | GCA937974765_02701 | gene | open | 4828-5724 | ybjT | ||
| 5433 | CALJVF010000118.1 | GCA937974765_02702 | gene | open | 5721-6323 | acrR | ||
| 5434 | CALJVF010000118.1 | GCA937974765_02703 | gene | open | 6523-6966 | |||
| 5435 | CALJVF010000118.1 | GCA937974765_02704 | gene | open | 7070-7900 | |||
| 5436 | CALJVF010000118.1 | GCA937974765_02705 | gene | open | 7906-8646 | |||
| 5437 | CALJVF010000118.1 | GCA937974765_02706 | gene | open | 9155-9799 | |||
| 5438 | CALJVF010000118.1 | GCA937974765_02707 | gene | open | 10480-11973 | pepB | ||
| 5439 | CALJVF010000118.1 | GCA937974765_02708 | gene | open | 12011-13018 | rocF | ||
| 5440 | CALJVF010000118.1 | GCA937974765_02709 | gene | open | 13125-13331 | |||
| 5441 | CALJVF010000118.1 | GCA937974765_02710 | gene | open | 13328-14107 | |||
| 5442 | CALJVF010000118.1 | GCA937974765_02711 | gene | open | 14214-15017 | |||
| 5443 | CALJVF010000118.1 | GCA937974765_02712 | gene | open | 15014-15337 | |||
| 5444 | CALJVF010000119.1 | GCA937974765_02713 | CDS | open | 312-1196 | _na 294_aa | ispE | 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase |
| 5445 | CALJVF010000119.1 | GCA937974765_02714 | CDS | open | 1216-2073 | _na 285_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 5446 | CALJVF010000119.1 | GCA937974765_02715 | CDS | open | 2066-2929 | _na 287_aa | tatD | putative deoxyribonuclease YcfH |
| 5447 | CALJVF010000119.1 | GCA937974765_02716 | CDS | open | 2926-3774 | _na 282_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 5448 | CALJVF010000119.1 | GCA937974765_02717 | CDS | open | 3857-5569 | _na 570_aa | pMT1 | dolichyl-phosphate-mannose--protein mannosyltransferase |
| 5449 | CALJVF010000119.1 | GCA937974765_02718 | CDS | open | 5600-7015 | _na 471_aa | araJ | Multidrug resistance protein B |
| 5450 | CALJVF010000119.1 | GCA937974765_02719 | CDS | open | 7129-8232 | _na 367_aa | dadA | FAD-binding oxidoreductase |
| 5451 | CALJVF010000119.1 | GCA937974765_02720 | CDS | open | 8568-10034 | _na 488_aa | uraA | Pyrimidine permease RutG |
| 5452 | CALJVF010000119.1 | GCA937974765_02721 | CDS | open | 10045-11241 | _na 398_aa | trpB | tryptophan synthase subunit beta |
| 5453 | CALJVF010000119.1 | GCA937974765_02722 | CDS | open | 11214-12254 | _na 346_aa | baeS | histidine kinase |
| 5454 | CALJVF010000119.1 | GCA937974765_02723 | CDS | open | 12251-12961 | _na 236_aa | ompR | Sensory transduction protein regX3 |
| 5455 | CALJVF010000119.1 | GCA937974765_02724 | CDS | open | 12942-14606 | _na 554_aa | ccdA | Cytochrome c biogenesis protein DipZ |
| 5456 | CALJVF010000119.1 | GCA937974765_02725 | CDS | open | 14611-15060 | _na 149_aa | dsbD | Thiol:disulfide interchange protein |
| 5457 | CALJVF010000119.1 | GCA937974765_02726 | CDS | open | 15449-15571 | _na 40_aa | hypothetical protein | |
| 5458 | CALJVF010000119.1 | GCA937974765_02727 | CDS | open | 15608-15901 | _na 97_aa | hmoA | Antibiotic biosynthesis monooxygenase |
| 5459 | CALJVF010000119.1 | GCA937974765_02728 | CDS | open | 15919-18609 | _na 896_aa | hypothetical protein | |
| 5460 | CALJVF010000119.1 | GCA937974765_02729 | CDS | open | 18665-19252 | _na 195_aa | acrR | Rut operon repressor |
| 5461 | CALJVF010000119.1 | GCA937974765_02730 | CDS | open | 19355-20590 | _na 411_aa | araJ | Inner membrane transport protein ynfM |
| 5462 | CALJVF010000119.1 | GCA937974765_02731 | CDS | open | 20587-21234 | _na 215_aa | ywnB | NADH-flavin reductase |
| 5463 | CALJVF010000119.1 | GCA937974765_02732 | CDS | open | 21333-21809 | _na 158_aa | ybhB | Putative kinase inhibitor protein |
| 5464 | CALJVF010000119.1 | GCA937974765_02733 | CDS | open | 21933-22508 | _na 191_aa | DUF1707 domain-containing protein | |
| 5465 | CALJVF010000119.1 | GCA937974765_02735 | CDS | open | 22883-23701 | _na 272_aa | Adhesin domain-containing protein | |
| 5466 | CALJVF010000119.1 | GCA937974765_02736 | CDS | open | 23698-24129 | _na 143_aa | DUF2089 domain-containing protein | |
| 5467 | CALJVF010000119.1 | GCA937974765_02737 | CDS | open | 24139-24636 | _na 165_aa | greA | transcription elongation factor GreA |
| 5468 | CALJVF010000119.1 | GCA937974765_02738 | CDS | open | 24720-25622 | _na 300_aa | mca | mycothiol conjugate amidase Mca |
| 5469 | CALJVF010000119.1 | GCA937974765_02739 | CDS | open | 25800-26399 | _na 199_aa | glpG | Rhombosortase |
| 5470 | CALJVF010000119.1 | GCA937974765_02740 | CDS | open | 26836-27621 | _na 261_aa | hypothetical protein | |
| 5471 | CALJVF010000119.1 | GCA937974765_02713 | gene | open | 312-1196 | ispE | ||
| 5472 | CALJVF010000119.1 | GCA937974765_02714 | gene | open | 1216-2073 | rsmA | ||
| 5473 | CALJVF010000119.1 | GCA937974765_02715 | gene | open | 2066-2929 | tatD | ||
| 5474 | CALJVF010000119.1 | GCA937974765_02716 | gene | open | 2926-3774 | rsmI | ||
| 5475 | CALJVF010000119.1 | GCA937974765_02717 | gene | open | 3857-5569 | pMT1 | ||
| 5476 | CALJVF010000119.1 | GCA937974765_02718 | gene | open | 5600-7015 | araJ | ||
| 5477 | CALJVF010000119.1 | GCA937974765_02719 | gene | open | 7129-8232 | dadA | ||
| 5478 | CALJVF010000119.1 | GCA937974765_02720 | gene | open | 8568-10034 | uraA | ||
| 5479 | CALJVF010000119.1 | GCA937974765_02721 | gene | open | 10045-11241 | trpB | ||
| 5480 | CALJVF010000119.1 | GCA937974765_02722 | gene | open | 11214-12254 | baeS | ||
| 5481 | CALJVF010000119.1 | GCA937974765_02723 | gene | open | 12251-12961 | ompR | ||
| 5482 | CALJVF010000119.1 | GCA937974765_02724 | gene | open | 12942-14606 | ccdA | ||
| 5483 | CALJVF010000119.1 | GCA937974765_02725 | gene | open | 14611-15060 | dsbD | ||
| 5484 | CALJVF010000119.1 | GCA937974765_02726 | gene | open | 15449-15571 | |||
| 5485 | CALJVF010000119.1 | GCA937974765_02727 | gene | open | 15608-15901 | hmoA | ||
| 5486 | CALJVF010000119.1 | GCA937974765_02728 | gene | open | 15919-18609 | |||
| 5487 | CALJVF010000119.1 | GCA937974765_02729 | gene | open | 18665-19252 | acrR | ||
| 5488 | CALJVF010000119.1 | GCA937974765_02730 | gene | open | 19355-20590 | araJ | ||
| 5489 | CALJVF010000119.1 | GCA937974765_02731 | gene | open | 20587-21234 | ywnB | ||
| 5490 | CALJVF010000119.1 | GCA937974765_02732 | gene | open | 21333-21809 | ybhB | ||
| 5491 | CALJVF010000119.1 | GCA937974765_02733 | gene | open | 21933-22508 | |||
| 5492 | CALJVF010000119.1 | GCA937974765_02735 | gene | open | 22883-23701 | |||
| 5493 | CALJVF010000119.1 | GCA937974765_02736 | gene | open | 23698-24129 | |||
| 5494 | CALJVF010000119.1 | GCA937974765_02737 | gene | open | 24139-24636 | greA | ||
| 5495 | CALJVF010000119.1 | GCA937974765_02738 | gene | open | 24720-25622 | mca | ||
| 5496 | CALJVF010000119.1 | GCA937974765_02739 | gene | open | 25800-26399 | glpG | ||
| 5497 | CALJVF010000119.1 | GCA937974765_02740 | gene | open | 26836-27621 | |||
| 5498 | CALJVF010000119.1 | GCA937974765_02734 | gene | open | 22662-22734 | trnT | ||
| 5499 | CALJVF010000119.1 | GCA937974765_02734 | tRNA | open | 22662-22734 | trnT | tRNA-Thr(cgt) | |
| 5500 | CALJVF010000120.1 | GCA937974765_02741 | CDS | open | 35-451 | _na 138_aa | hypothetical protein |

