BAKTAGenome Explorer: Arachnia propionica (GCA_937974765.1)
Select a Genome:
|
BAKTA Annotations for GCA_937974765.1
|
Search & Sort all 6192 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | CALJVF010000050.1 | GCA937974765_01021 | CDS | open | 46086-46517 | _na 143_aa | DUF5709 domain-containing protein | |
| 2002 | CALJVF010000050.1 | GCA937974765_01022 | CDS | open | 46564-47619 | _na 351_aa | purR | Mgl repressor and galactose ultrainduction factor |
| 2003 | CALJVF010000050.1 | GCA937974765_01023 | CDS | open | 47708-47866 | _na 52_aa | hypothetical protein | |
| 2004 | CALJVF010000050.1 | GCA937974765_01024 | CDS | open | 47930-48880 | _na 316_aa | Gfo/Idh/MocA family oxidoreductase | |
| 2005 | CALJVF010000050.1 | GCA937974765_01025 | CDS | open | 48877-49881 | _na 334_aa | Hydroxypyruvate isomerase | |
| 2006 | CALJVF010000050.1 | GCA937974765_01026 | CDS | open | 49954-50973 | _na 339_aa | phoH | PhoH-like protein |
| 2007 | CALJVF010000050.1 | GCA937974765_01027 | CDS | open | 50970-51452 | _na 160_aa | ybeY | rRNA maturation RNase YbeY |
| 2008 | CALJVF010000050.1 | GCA937974765_01028 | CDS | open | 51538-52845 | _na 435_aa | mpfA | Magnesium and cobalt efflux protein CorC |
| 2009 | CALJVF010000050.1 | GCA937974765_01029 | CDS | open | 52838-53764 | _na 308_aa | era | GTPase Era |
| 2010 | CALJVF010000050.1 | GCA937974765_01030 | CDS | open | 53895-55625 | _na 576_aa | leuA | 2-isopropylmalate synthase |
| 2011 | CALJVF010000050.1 | GCA937974765_01031 | CDS | open | 55618-56448 | _na 276_aa | yaeI | putative metallophosphoesterase Cj0846 |
| 2012 | CALJVF010000050.1 | GCA937974765_01032 | CDS | open | 56457-56570 | _na 37_aa | hypothetical protein | |
| 2013 | CALJVF010000050.1 | GCA937974765_01033 | CDS | open | 56607-57362 | _na 251_aa | ceuD | Iron(3+)-hydroxamate import ATP-binding protein FhuC |
| 2014 | CALJVF010000050.1 | GCA937974765_01034 | CDS | open | 57359-58378 | _na 339_aa | ceuC | Iron-uptake system permease protein FeuC |
| 2015 | CALJVF010000050.1 | GCA937974765_01035 | CDS | open | 58371-59384 | _na 337_aa | ceuB | Iron-uptake system permease protein FeuB |
| 2016 | CALJVF010000050.1 | GCA937974765_01036 | CDS | open | 59381-60409 | _na 342_aa | ceuA | putative ABC transporter solute-binding protein yclQ |
| 2017 | CALJVF010000050.1 | GCA937974765_01037 | CDS | open | 60498-61274 | _na 258_aa | yjhB | CTP pyrophosphohydrolase |
| 2018 | CALJVF010000050.1 | GCA937974765_01038 | CDS | open | 61271-63166 | _na 631_aa | glgB | 1%2C4-alpha-glucan branching protein GlgB |
| 2019 | CALJVF010000050.1 | GCA937974765_01039 | CDS | open | 63177-64418 | _na 413_aa | ble | Maltokinase |
| 2020 | CALJVF010000050.1 | GCA937974765_01040 | CDS | open | 64422-66422 | _na 666_aa | amyA | Alpha-1%2C4-glucan:maltose-1-phosphate maltosyltransferase |
| 2021 | CALJVF010000050.1 | GCA937974765_01041 | CDS | open | 66479-69034 | _na 851_aa | glgP | glycogen phosphorylase |
| 2022 | CALJVF010000050.1 | GCA937974765_01042 | CDS | open | 69126-71255 | _na 709_aa | glgX | glycogen debranching protein GlgX |
| 2023 | CALJVF010000050.1 | GCA937974765_01043 | CDS | open | 71422-72489 | _na 355_aa | nifS | cysteine desulfurase |
| 2024 | CALJVF010000050.1 | GCA937974765_01044 | CDS | open | 72526-73599 | _na 357_aa | mnmA | tRNA 2-thiouridine(34) synthase MnmA |
| 2025 | CALJVF010000050.1 | GCA937974765_01045 | CDS | open | 73599-74567 | _na 322_aa | Methionine synthase | |
| 2026 | CALJVF010000050.1 | GCA937974765_01046 | CDS | open | 74578-74802 | _na 74_aa | hypothetical protein | |
| 2027 | CALJVF010000050.1 | GCA937974765_01047 | CDS | open | 74790-76373 | _na 527_aa | ABC transporter permease | |
| 2028 | CALJVF010000050.1 | GCA937974765_01048 | CDS | open | 76349-77149 | _na 266_aa | rbbA | ABC transporter ATP-binding protein |
| 2029 | CALJVF010000050.1 | GCA937974765_01049 | CDS | open | 77159-77833 | _na 224_aa | citB | Response regulator protein vraR |
| 2030 | CALJVF010000050.1 | GCA937974765_01050 | CDS | open | 77830-78996 | _na 388_aa | comP | histidine kinase |
| 2031 | CALJVF010000050.1 | GCA937974765_01051 | CDS | open | 79032-79832 | _na 266_aa | ABC transporter permease | |
| 2032 | CALJVF010000050.1 | GCA937974765_01052 | CDS | open | 79829-80593 | _na 254_aa | ABC transporter permease | |
| 2033 | CALJVF010000050.1 | GCA937974765_01053 | CDS | open | 80593-81579 | _na 328_aa | rbbA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 2034 | CALJVF010000050.1 | GCA937974765_01054 | CDS | open | 81752-82462 | _na 236_aa | fadR | FadR family transcriptional regulator |
| 2035 | CALJVF010000050.1 | GCA937974765_01055 | CDS | open | 82512-82805 | _na 97_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 2036 | CALJVF010000050.1 | GCA937974765_01056 | CDS | open | 82809-84320 | _na 503_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 2037 | CALJVF010000050.1 | GCA937974765_01057 | CDS | open | 84320-85807 | _na 495_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 2038 | CALJVF010000050.1 | GCA937974765_01058 | CDS | open | 85826-86431 | _na 201_aa | Mycothiol-dependent maleylpyruvate isomerase metal-binding domain-containing protein | |
| 2039 | CALJVF010000050.1 | GCA937974765_01059 | CDS | open | 86498-87703 | _na 401_aa | rtcB | 3'-phosphate/5'-hydroxy nucleic acid ligase |
| 2040 | CALJVF010000050.1 | GCA937974765_01060 | CDS | open | 88165-88512 | _na 115_aa | padR | Lineage-specific thermal regulator protein |
| 2041 | CALJVF010000050.1 | GCA937974765_00978 | gene | open | 27-908 | |||
| 2042 | CALJVF010000050.1 | GCA937974765_00979 | gene | open | 939-1688 | fetB | ||
| 2043 | CALJVF010000050.1 | GCA937974765_00980 | gene | open | 1710-2399 | |||
| 2044 | CALJVF010000050.1 | GCA937974765_00981 | gene | open | 2405-3574 | pGRP | ||
| 2045 | CALJVF010000050.1 | GCA937974765_00982 | gene | open | 3673-4602 | |||
| 2046 | CALJVF010000050.1 | GCA937974765_00983 | gene | open | 4592-5206 | |||
| 2047 | CALJVF010000050.1 | GCA937974765_00984 | gene | open | 5300-6235 | |||
| 2048 | CALJVF010000050.1 | GCA937974765_00985 | gene | open | 6245-7183 | rbsK | ||
| 2049 | CALJVF010000050.1 | GCA937974765_00986 | gene | open | 7280-9997 | glcD | ||
| 2050 | CALJVF010000050.1 | GCA937974765_00987 | gene | open | 10019-10615 | citB | ||
| 2051 | CALJVF010000050.1 | GCA937974765_00988 | gene | open | 10612-11820 | |||
| 2052 | CALJVF010000050.1 | GCA937974765_00989 | gene | open | 11871-13037 | |||
| 2053 | CALJVF010000050.1 | GCA937974765_00990 | gene | open | 13089-15152 | ushA | ||
| 2054 | CALJVF010000050.1 | GCA937974765_00991 | gene | open | 15347-16156 | comEA | ||
| 2055 | CALJVF010000050.1 | GCA937974765_00992 | gene | open | 16273-18468 | comEC | ||
| 2056 | CALJVF010000050.1 | GCA937974765_00993 | gene | open | 18497-19450 | holA | ||
| 2057 | CALJVF010000050.1 | GCA937974765_00994 | gene | open | 19463-20953 | |||
| 2058 | CALJVF010000050.1 | GCA937974765_00995 | gene | open | 21050-21313 | rpsT | ||
| 2059 | CALJVF010000050.1 | GCA937974765_00996 | gene | open | 21506-23329 | lepA | ||
| 2060 | CALJVF010000050.1 | GCA937974765_00997 | gene | open | 23605-23775 | |||
| 2061 | CALJVF010000050.1 | GCA937974765_00998 | gene | open | 23802-24626 | ugpE | ||
| 2062 | CALJVF010000050.1 | GCA937974765_00999 | gene | open | 24623-25516 | ugpA | ||
| 2063 | CALJVF010000050.1 | GCA937974765_01000 | gene | open | 25513-26775 | ugpB | ||
| 2064 | CALJVF010000050.1 | GCA937974765_01001 | gene | open | 26877-28055 | hemW | ||
| 2065 | CALJVF010000050.1 | GCA937974765_01002 | gene | open | 29092-29649 | |||
| 2066 | CALJVF010000050.1 | GCA937974765_01003 | gene | open | 29696-31189 | tam | ||
| 2067 | CALJVF010000050.1 | GCA937974765_01004 | gene | open | 31279-31947 | nadQ | ||
| 2068 | CALJVF010000050.1 | GCA937974765_01005 | gene | open | 32024-33061 | |||
| 2069 | CALJVF010000050.1 | GCA937974765_01006 | gene | open | 33058-33933 | nadK | ||
| 2070 | CALJVF010000050.1 | GCA937974765_01007 | gene | open | 34018-34632 | ydfG | ||
| 2071 | CALJVF010000050.1 | GCA937974765_01008 | gene | open | 34752-35111 | yhcF | ||
| 2072 | CALJVF010000050.1 | GCA937974765_01009 | gene | open | 35108-35827 | rbbA | ||
| 2073 | CALJVF010000050.1 | GCA937974765_01010 | gene | open | 35824-36639 | |||
| 2074 | CALJVF010000050.1 | GCA937974765_01011 | gene | open | 36709-37554 | |||
| 2075 | CALJVF010000050.1 | GCA937974765_01012 | gene | open | 37564-38346 | suhB | ||
| 2076 | CALJVF010000050.1 | GCA937974765_01013 | gene | open | 38347-39195 | gloB | ||
| 2077 | CALJVF010000050.1 | GCA937974765_01014 | gene | open | 39282-40289 | hrcA | ||
| 2078 | CALJVF010000050.1 | GCA937974765_01015 | gene | open | 40293-41459 | dnaJ | ||
| 2079 | CALJVF010000050.1 | GCA937974765_01016 | gene | open | 41456-42184 | rsmE | ||
| 2080 | CALJVF010000050.1 | GCA937974765_01017 | gene | open | 42267-43163 | lCB5 | ||
| 2081 | CALJVF010000050.1 | GCA937974765_01018 | gene | open | 43186-44409 | tgt | ||
| 2082 | CALJVF010000050.1 | GCA937974765_01019 | gene | open | 44412-45305 | |||
| 2083 | CALJVF010000050.1 | GCA937974765_01020 | gene | open | 45315-46004 | yhhQ | ||
| 2084 | CALJVF010000050.1 | GCA937974765_01021 | gene | open | 46086-46517 | |||
| 2085 | CALJVF010000050.1 | GCA937974765_01022 | gene | open | 46564-47619 | purR | ||
| 2086 | CALJVF010000050.1 | GCA937974765_01023 | gene | open | 47708-47866 | |||
| 2087 | CALJVF010000050.1 | GCA937974765_01024 | gene | open | 47930-48880 | |||
| 2088 | CALJVF010000050.1 | GCA937974765_01025 | gene | open | 48877-49881 | |||
| 2089 | CALJVF010000050.1 | GCA937974765_01026 | gene | open | 49954-50973 | phoH | ||
| 2090 | CALJVF010000050.1 | GCA937974765_01027 | gene | open | 50970-51452 | ybeY | ||
| 2091 | CALJVF010000050.1 | GCA937974765_01028 | gene | open | 51538-52845 | mpfA | ||
| 2092 | CALJVF010000050.1 | GCA937974765_01029 | gene | open | 52838-53764 | era | ||
| 2093 | CALJVF010000050.1 | GCA937974765_01030 | gene | open | 53895-55625 | leuA | ||
| 2094 | CALJVF010000050.1 | GCA937974765_01031 | gene | open | 55618-56448 | yaeI | ||
| 2095 | CALJVF010000050.1 | GCA937974765_01032 | gene | open | 56457-56570 | |||
| 2096 | CALJVF010000050.1 | GCA937974765_01033 | gene | open | 56607-57362 | ceuD | ||
| 2097 | CALJVF010000050.1 | GCA937974765_01034 | gene | open | 57359-58378 | ceuC | ||
| 2098 | CALJVF010000050.1 | GCA937974765_01035 | gene | open | 58371-59384 | ceuB | ||
| 2099 | CALJVF010000050.1 | GCA937974765_01036 | gene | open | 59381-60409 | ceuA | ||
| 2100 | CALJVF010000050.1 | GCA937974765_01037 | gene | open | 60498-61274 | yjhB | ||
| 2101 | CALJVF010000050.1 | GCA937974765_01038 | gene | open | 61271-63166 | glgB | ||
| 2102 | CALJVF010000050.1 | GCA937974765_01039 | gene | open | 63177-64418 | ble | ||
| 2103 | CALJVF010000050.1 | GCA937974765_01040 | gene | open | 64422-66422 | amyA | ||
| 2104 | CALJVF010000050.1 | GCA937974765_01041 | gene | open | 66479-69034 | glgP | ||
| 2105 | CALJVF010000050.1 | GCA937974765_01042 | gene | open | 69126-71255 | glgX | ||
| 2106 | CALJVF010000050.1 | GCA937974765_01043 | gene | open | 71422-72489 | nifS | ||
| 2107 | CALJVF010000050.1 | GCA937974765_01044 | gene | open | 72526-73599 | mnmA | ||
| 2108 | CALJVF010000050.1 | GCA937974765_01045 | gene | open | 73599-74567 | |||
| 2109 | CALJVF010000050.1 | GCA937974765_01046 | gene | open | 74578-74802 | |||
| 2110 | CALJVF010000050.1 | GCA937974765_01047 | gene | open | 74790-76373 | |||
| 2111 | CALJVF010000050.1 | GCA937974765_01048 | gene | open | 76349-77149 | rbbA | ||
| 2112 | CALJVF010000050.1 | GCA937974765_01049 | gene | open | 77159-77833 | citB | ||
| 2113 | CALJVF010000050.1 | GCA937974765_01050 | gene | open | 77830-78996 | comP | ||
| 2114 | CALJVF010000050.1 | GCA937974765_01051 | gene | open | 79032-79832 | |||
| 2115 | CALJVF010000050.1 | GCA937974765_01052 | gene | open | 79829-80593 | |||
| 2116 | CALJVF010000050.1 | GCA937974765_01053 | gene | open | 80593-81579 | rbbA | ||
| 2117 | CALJVF010000050.1 | GCA937974765_01054 | gene | open | 81752-82462 | fadR | ||
| 2118 | CALJVF010000050.1 | GCA937974765_01055 | gene | open | 82512-82805 | gatC | ||
| 2119 | CALJVF010000050.1 | GCA937974765_01056 | gene | open | 82809-84320 | gatA | ||
| 2120 | CALJVF010000050.1 | GCA937974765_01057 | gene | open | 84320-85807 | gatB | ||
| 2121 | CALJVF010000050.1 | GCA937974765_01058 | gene | open | 85826-86431 | |||
| 2122 | CALJVF010000050.1 | GCA937974765_01059 | gene | open | 86498-87703 | rtcB | ||
| 2123 | CALJVF010000050.1 | GCA937974765_01060 | gene | open | 88165-88512 | padR | ||
| 2124 | CALJVF010000051.1 | repeat_region | open | 71-336 | CRISPR array with 4 repeats of length 36%2C consensus sequence GTCGCAATGGAGCCTGACCTTTGAGGTCAGGAAAAG and spacer length 37 | |||
| 2125 | CALJVF010000051.1 | repeat_region | open | 4831-6625 | CRISPR array with 25 repeats of length 36%2C consensus sequence GTCGCAATGGAGCCTGACCTTTGAGGTCAGGAAAAG and spacer length 36 | |||
| 2126 | CALJVF010000051.1 | GCA937974765_01061 | CDS | open | 2377-2574 | _na 65_aa | hypothetical protein | |
| 2127 | CALJVF010000051.1 | GCA937974765_01062 | CDS | open | 3828-4022 | _na 64_aa | hypothetical protein | |
| 2128 | CALJVF010000051.1 | GCA937974765_01063 | CDS | open | 6790-7053 | _na 87_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2129 | CALJVF010000051.1 | GCA937974765_01064 | CDS | open | 7077-8753 | _na 558_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 2130 | CALJVF010000051.1 | GCA937974765_01065 | CDS | open | 8750-9736 | _na 328_aa | cas8g1 | CRISPR-Cas system type I-G effector complex large subunit Cas8g1 |
| 2131 | CALJVF010000051.1 | GCA937974765_01066 | CDS | open | 9733-12600 | _na 955_aa | cas3u | type I-U CRISPR-associated helicase/endonuclease Cas3 |
| 2132 | CALJVF010000051.1 | GCA937974765_01067 | CDS | open | 12597-14024 | _na 475_aa | csb2 | type I-U CRISPR-associated protein Csb2 |
| 2133 | CALJVF010000051.1 | GCA937974765_01068 | CDS | open | 14026-15171 | _na 381_aa | csb1gr7 | CRISPR-associated protein GSU0053/csb1%2C Dpsyc system |
| 2134 | CALJVF010000051.1 | GCA937974765_01069 | CDS | open | 15344-15799 | _na 151_aa | marR | Homoprotocatechuate degradation operon regulator%2C HpaR |
| 2135 | CALJVF010000051.1 | GCA937974765_01070 | CDS | open | 15885-18677 | _na 930_aa | mgtA | Cation-translocating P-type ATPase |
| 2136 | CALJVF010000051.1 | GCA937974765_01071 | CDS | open | 18694-19623 | _na 309_aa | eMpr | Serine protease |
| 2137 | CALJVF010000051.1 | GCA937974765_01072 | CDS | open | 20018-22471 | _na 817_aa | TIR domain-containing protein | |
| 2138 | CALJVF010000051.1 | GCA937974765_01073 | CDS | open | 22647-23189 | _na 180_aa | Mycothiol maleylpyruvate isomerase N-terminal domain | |
| 2139 | CALJVF010000051.1 | GCA937974765_01074 | CDS | open | 23225-24106 | _na 293_aa | araC | AraC family transcriptional regulator |
| 2140 | CALJVF010000051.1 | GCA937974765_01075 | CDS | open | 24079-24753 | _na 224_aa | talA | fructose-6-phosphate aldolase |
| 2141 | CALJVF010000051.1 | GCA937974765_01076 | CDS | open | 24819-26792 | _na 657_aa | acf2 | glucan endo-1%2C3-beta-D-glucosidase |
| 2142 | CALJVF010000051.1 | GCA937974765_01077 | CDS | open | 26789-27532 | _na 247_aa | emrA | Efflux transporter%2C RND family%2C MFP subunit |
| 2143 | CALJVF010000051.1 | GCA937974765_01078 | CDS | open | 27536-29368 | _na 610_aa | bcsA | Cellulose synthase catalytic subunit [UDP-forming] |
| 2144 | CALJVF010000051.1 | GCA937974765_01079 | CDS | open | 29798-30550 | _na 250_aa | glpR | DeoR/GlpR transcriptional regulator |
| 2145 | CALJVF010000051.1 | GCA937974765_01061 | gene | open | 2377-2574 | |||
| 2146 | CALJVF010000051.1 | GCA937974765_01062 | gene | open | 3828-4022 | |||
| 2147 | CALJVF010000051.1 | GCA937974765_01063 | gene | open | 6790-7053 | cas2 | ||
| 2148 | CALJVF010000051.1 | GCA937974765_01064 | gene | open | 7077-8753 | cas1 | ||
| 2149 | CALJVF010000051.1 | GCA937974765_01065 | gene | open | 8750-9736 | cas8g1 | ||
| 2150 | CALJVF010000051.1 | GCA937974765_01066 | gene | open | 9733-12600 | cas3u | ||
| 2151 | CALJVF010000051.1 | GCA937974765_01067 | gene | open | 12597-14024 | csb2 | ||
| 2152 | CALJVF010000051.1 | GCA937974765_01068 | gene | open | 14026-15171 | csb1gr7 | ||
| 2153 | CALJVF010000051.1 | GCA937974765_01069 | gene | open | 15344-15799 | marR | ||
| 2154 | CALJVF010000051.1 | GCA937974765_01070 | gene | open | 15885-18677 | mgtA | ||
| 2155 | CALJVF010000051.1 | GCA937974765_01071 | gene | open | 18694-19623 | eMpr | ||
| 2156 | CALJVF010000051.1 | GCA937974765_01072 | gene | open | 20018-22471 | |||
| 2157 | CALJVF010000051.1 | GCA937974765_01073 | gene | open | 22647-23189 | |||
| 2158 | CALJVF010000051.1 | GCA937974765_01074 | gene | open | 23225-24106 | araC | ||
| 2159 | CALJVF010000051.1 | GCA937974765_01075 | gene | open | 24079-24753 | talA | ||
| 2160 | CALJVF010000051.1 | GCA937974765_01076 | gene | open | 24819-26792 | acf2 | ||
| 2161 | CALJVF010000051.1 | GCA937974765_01077 | gene | open | 26789-27532 | emrA | ||
| 2162 | CALJVF010000051.1 | GCA937974765_01078 | gene | open | 27536-29368 | bcsA | ||
| 2163 | CALJVF010000051.1 | GCA937974765_01079 | gene | open | 29798-30550 | glpR | ||
| 2164 | CALJVF010000052.1 | regulatory_region | open | 14775-14961 | Cobalamin riboswitch aptamer | |||
| 2165 | CALJVF010000052.1 | regulatory_region | open | 15140-15311 | Cobalamin riboswitch aptamer | |||
| 2166 | CALJVF010000052.1 | GCA937974765_01080 | CDS | open | 246-473 | _na 75_aa | hypothetical protein | |
| 2167 | CALJVF010000052.1 | GCA937974765_01081 | CDS | open | 795-968 | _na 57_aa | hypothetical protein | |
| 2168 | CALJVF010000052.1 | GCA937974765_01082 | CDS | open | 1457-1696 | _na 79_aa | abrB | Transcriptional regulator%2C AbrB family |
| 2169 | CALJVF010000052.1 | GCA937974765_01083 | CDS | open | 1969-2217 | _na 82_aa | Antitoxin VapB43 | |
| 2170 | CALJVF010000052.1 | GCA937974765_01084 | CDS | open | 2204-2629 | _na 141_aa | vapC | type II toxin-antitoxin system VapC family toxin |
| 2171 | CALJVF010000052.1 | GCA937974765_01085 | CDS | open | 3387-4169 | _na 260_aa | ABC transporter permease | |
| 2172 | CALJVF010000052.1 | GCA937974765_01086 | CDS | open | 4166-4888 | _na 240_aa | rbbA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 2173 | CALJVF010000052.1 | GCA937974765_01087 | CDS | open | 5018-6205 | _na 395_aa | comP | histidine kinase |
| 2174 | CALJVF010000052.1 | GCA937974765_01088 | CDS | open | 6199-6855 | _na 218_aa | citB | Response regulator protein vraR |
| 2175 | CALJVF010000052.1 | GCA937974765_01089 | CDS | open | 6980-7492 | _na 170_aa | lytR | LytR C-terminal domain-containing protein |
| 2176 | CALJVF010000052.1 | GCA937974765_01090 | CDS | open | 7504-7797 | _na 97_aa | vapB6 | Transcription regulator of the Arc/MetJ class |
| 2177 | CALJVF010000052.1 | GCA937974765_01091 | CDS | open | 7898-9484 | _na 528_aa | cedB | Ornithine/acetylornithine aminotransferase |
| 2178 | CALJVF010000052.1 | GCA937974765_01092 | CDS | open | 9650-10849 | _na 399_aa | salY | FtsX-like permease family |
| 2179 | CALJVF010000052.1 | GCA937974765_01093 | CDS | open | 10846-11490 | _na 214_aa | lolD | L-cystine import ATP-binding protein TcyC |
| 2180 | CALJVF010000052.1 | GCA937974765_01094 | CDS | open | 11761-12531 | _na 256_aa | fepC | putative siderophore transport system ATP-binding protein YusV |
| 2181 | CALJVF010000052.1 | GCA937974765_01095 | CDS | open | 12531-13610 | _na 359_aa | fepD | putative ABC transporter permease protein HI_1471 |
| 2182 | CALJVF010000052.1 | GCA937974765_01096 | CDS | open | 13630-14733 | _na 367_aa | fepB | Corrinoid ABC transporter substrate-binding protein |
| 2183 | CALJVF010000052.1 | GCA937974765_01097 | CDS | open | 15431-16468 | _na 345_aa | fepB | Vitamin B12-binding protein |
| 2184 | CALJVF010000052.1 | GCA937974765_01098 | CDS | open | 16465-17511 | _na 348_aa | fepD | putative ABC transporter permease protein HI_1471 |
| 2185 | CALJVF010000052.1 | GCA937974765_01099 | CDS | open | 17508-18284 | _na 258_aa | fepC | Hemin import ATP-binding protein HmuV |
| 2186 | CALJVF010000052.1 | GCA937974765_01100 | CDS | open | 18312-19880 | _na 522_aa | ATP-binding protein | |
| 2187 | CALJVF010000052.1 | GCA937974765_01101 | CDS | open | 20446-21138 | _na 230_aa | hypothetical protein | |
| 2188 | CALJVF010000052.1 | GCA937974765_01102 | CDS | open | 21169-21441 | _na 90_aa | hypothetical protein | |
| 2189 | CALJVF010000052.1 | GCA937974765_01103 | CDS | open | 21438-22826 | _na 462_aa | AAA family ATPase | |
| 2190 | CALJVF010000052.1 | GCA937974765_01104 | CDS | open | 22933-24207 | _na 424_aa | metL1 | aspartate kinase |
| 2191 | CALJVF010000052.1 | GCA937974765_01105 | CDS | open | 24515-25174 | _na 219_aa | citB | Response regulator transcription factor |
| 2192 | CALJVF010000052.1 | GCA937974765_01106 | CDS | open | 25171-27273 | _na 700_aa | comP | Nitrate/nitrite sensor protein NarQ |
| 2193 | CALJVF010000052.1 | GCA937974765_01107 | CDS | open | 27436-28428 | _na 330_aa | mviM | 1%2C5-anhydro-D-fructose reductase |
| 2194 | CALJVF010000052.1 | GCA937974765_01108 | CDS | open | 28466-29416 | _na 316_aa | abiEi | Transcriptional regulator%2C AbiEi antitoxin%2C Type IV TA system |
| 2195 | CALJVF010000052.1 | GCA937974765_01109 | CDS | open | 29643-30758 | _na 371_aa | malY | cysteine-S-conjugate beta-lyase |
| 2196 | CALJVF010000052.1 | GCA937974765_01080 | gene | open | 246-473 | |||
| 2197 | CALJVF010000052.1 | GCA937974765_01081 | gene | open | 795-968 | |||
| 2198 | CALJVF010000052.1 | GCA937974765_01082 | gene | open | 1457-1696 | abrB | ||
| 2199 | CALJVF010000052.1 | GCA937974765_01083 | gene | open | 1969-2217 | |||
| 2200 | CALJVF010000052.1 | GCA937974765_01084 | gene | open | 2204-2629 | vapC | ||
| 2201 | CALJVF010000052.1 | GCA937974765_01085 | gene | open | 3387-4169 | |||
| 2202 | CALJVF010000052.1 | GCA937974765_01086 | gene | open | 4166-4888 | rbbA | ||
| 2203 | CALJVF010000052.1 | GCA937974765_01087 | gene | open | 5018-6205 | comP | ||
| 2204 | CALJVF010000052.1 | GCA937974765_01088 | gene | open | 6199-6855 | citB | ||
| 2205 | CALJVF010000052.1 | GCA937974765_01089 | gene | open | 6980-7492 | lytR | ||
| 2206 | CALJVF010000052.1 | GCA937974765_01090 | gene | open | 7504-7797 | vapB6 | ||
| 2207 | CALJVF010000052.1 | GCA937974765_01091 | gene | open | 7898-9484 | cedB | ||
| 2208 | CALJVF010000052.1 | GCA937974765_01092 | gene | open | 9650-10849 | salY | ||
| 2209 | CALJVF010000052.1 | GCA937974765_01093 | gene | open | 10846-11490 | lolD | ||
| 2210 | CALJVF010000052.1 | GCA937974765_01094 | gene | open | 11761-12531 | fepC | ||
| 2211 | CALJVF010000052.1 | GCA937974765_01095 | gene | open | 12531-13610 | fepD | ||
| 2212 | CALJVF010000052.1 | GCA937974765_01096 | gene | open | 13630-14733 | fepB | ||
| 2213 | CALJVF010000052.1 | GCA937974765_01097 | gene | open | 15431-16468 | fepB | ||
| 2214 | CALJVF010000052.1 | GCA937974765_01098 | gene | open | 16465-17511 | fepD | ||
| 2215 | CALJVF010000052.1 | GCA937974765_01099 | gene | open | 17508-18284 | fepC | ||
| 2216 | CALJVF010000052.1 | GCA937974765_01100 | gene | open | 18312-19880 | |||
| 2217 | CALJVF010000052.1 | GCA937974765_01101 | gene | open | 20446-21138 | |||
| 2218 | CALJVF010000052.1 | GCA937974765_01102 | gene | open | 21169-21441 | |||
| 2219 | CALJVF010000052.1 | GCA937974765_01103 | gene | open | 21438-22826 | |||
| 2220 | CALJVF010000052.1 | GCA937974765_01104 | gene | open | 22933-24207 | metL1 | ||
| 2221 | CALJVF010000052.1 | GCA937974765_01105 | gene | open | 24515-25174 | citB | ||
| 2222 | CALJVF010000052.1 | GCA937974765_01106 | gene | open | 25171-27273 | comP | ||
| 2223 | CALJVF010000052.1 | GCA937974765_01107 | gene | open | 27436-28428 | mviM | ||
| 2224 | CALJVF010000052.1 | GCA937974765_01108 | gene | open | 28466-29416 | abiEi | ||
| 2225 | CALJVF010000052.1 | GCA937974765_01109 | gene | open | 29643-30758 | malY | ||
| 2226 | CALJVF010000053.1 | GCA937974765_01110 | CDS | open | 62-223 | _na 53_aa | hypothetical protein | |
| 2227 | CALJVF010000053.1 | GCA937974765_01111 | CDS | open | 821-1036 | _na 71_aa | hypothetical protein | |
| 2228 | CALJVF010000053.1 | GCA937974765_01112 | CDS | open | 1040-1282 | _na 80_aa | hypothetical protein | |
| 2229 | CALJVF010000053.1 | GCA937974765_01113 | CDS | open | 1386-4514 | _na 1042_aa | Beta-galactosidase | |
| 2230 | CALJVF010000053.1 | GCA937974765_01114 | CDS | open | 4765-5754 | _na 329_aa | purR | Lactose operon repressor |
| 2231 | CALJVF010000053.1 | GCA937974765_01115 | CDS | open | 6485-7384 | _na 299_aa | Lipoprotein | |
| 2232 | CALJVF010000053.1 | GCA937974765_01116 | CDS | open | 7647-8555 | _na 302_aa | Lipoprotein | |
| 2233 | CALJVF010000053.1 | GCA937974765_01117 | CDS | open | 8596-9987 | _na 463_aa | Membrane fusion protein cluster 2 protein | |
| 2234 | CALJVF010000053.1 | GCA937974765_01118 | CDS | open | 9984-10658 | _na 224_aa | lolD | ABC transporter ATP-binding protein |
| 2235 | CALJVF010000053.1 | GCA937974765_01119 | CDS | open | 10648-11841 | _na 397_aa | salY | ABC transporter permease |
| 2236 | CALJVF010000053.1 | GCA937974765_01120 | CDS | open | 11919-12539 | _na 206_aa | putative periplasmic/secreted protein | |
| 2237 | CALJVF010000053.1 | GCA937974765_01121 | CDS | open | 12543-13622 | _na 359_aa | Winged helix DNA-binding domain-containing protein | |
| 2238 | CALJVF010000053.1 | GCA937974765_01122 | CDS | open | 13894-15354 | _na 486_aa | efeB | iron uptake transporter deferrochelatase/peroxidase subunit |
| 2239 | CALJVF010000053.1 | GCA937974765_01123 | CDS | open | 15393-16721 | _na 442_aa | efeO | iron uptake system protein EfeO |
| 2240 | CALJVF010000053.1 | GCA937974765_01124 | CDS | open | 16867-17730 | _na 287_aa | efeU | iron uptake transporter permease EfeU |
| 2241 | CALJVF010000053.1 | GCA937974765_01125 | CDS | open | 18090-18578 | _na 162_aa | sixA | Phosphohistidine phosphatase SixA |
| 2242 | CALJVF010000053.1 | GCA937974765_01126 | CDS | open | 18817-19812 | _na 331_aa | trm11 | Site-specific DNA-methyltransferase |
| 2243 | CALJVF010000053.1 | GCA937974765_01127 | CDS | open | 20094-20327 | _na 77_aa | copG | Ribbon-helix-helix protein CopG domain-containing protein |
| 2244 | CALJVF010000053.1 | GCA937974765_01128 | CDS | open | 20362-22065 | _na 567_aa | tagG | Transport permease protein |
| 2245 | CALJVF010000053.1 | GCA937974765_01129 | CDS | open | 22058-23005 | _na 315_aa | rbbA | ABC transporter ATP-binding protein |
| 2246 | CALJVF010000053.1 | GCA937974765_01130 | CDS | open | 23037-23729 | _na 230_aa | hypothetical protein | |
| 2247 | CALJVF010000053.1 | GCA937974765_01131 | CDS | open | 23997-24899 | _na 300_aa | hypothetical protein | |
| 2248 | CALJVF010000053.1 | GCA937974765_01132 | CDS | open | 24883-25446 | _na 187_aa | ppa | Inorganic pyrophosphatase |
| 2249 | CALJVF010000053.1 | GCA937974765_01133 | CDS | open | 25476-26927 | _na 483_aa | dacB | D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase |
| 2250 | CALJVF010000053.1 | GCA937974765_01110 | gene | open | 62-223 | |||
| 2251 | CALJVF010000053.1 | GCA937974765_01111 | gene | open | 821-1036 | |||
| 2252 | CALJVF010000053.1 | GCA937974765_01112 | gene | open | 1040-1282 | |||
| 2253 | CALJVF010000053.1 | GCA937974765_01113 | gene | open | 1386-4514 | |||
| 2254 | CALJVF010000053.1 | GCA937974765_01114 | gene | open | 4765-5754 | purR | ||
| 2255 | CALJVF010000053.1 | GCA937974765_01115 | gene | open | 6485-7384 | |||
| 2256 | CALJVF010000053.1 | GCA937974765_01116 | gene | open | 7647-8555 | |||
| 2257 | CALJVF010000053.1 | GCA937974765_01117 | gene | open | 8596-9987 | |||
| 2258 | CALJVF010000053.1 | GCA937974765_01118 | gene | open | 9984-10658 | lolD | ||
| 2259 | CALJVF010000053.1 | GCA937974765_01119 | gene | open | 10648-11841 | salY | ||
| 2260 | CALJVF010000053.1 | GCA937974765_01120 | gene | open | 11919-12539 | |||
| 2261 | CALJVF010000053.1 | GCA937974765_01121 | gene | open | 12543-13622 | |||
| 2262 | CALJVF010000053.1 | GCA937974765_01122 | gene | open | 13894-15354 | efeB | ||
| 2263 | CALJVF010000053.1 | GCA937974765_01123 | gene | open | 15393-16721 | efeO | ||
| 2264 | CALJVF010000053.1 | GCA937974765_01124 | gene | open | 16867-17730 | efeU | ||
| 2265 | CALJVF010000053.1 | GCA937974765_01125 | gene | open | 18090-18578 | sixA | ||
| 2266 | CALJVF010000053.1 | GCA937974765_01126 | gene | open | 18817-19812 | trm11 | ||
| 2267 | CALJVF010000053.1 | GCA937974765_01127 | gene | open | 20094-20327 | copG | ||
| 2268 | CALJVF010000053.1 | GCA937974765_01128 | gene | open | 20362-22065 | tagG | ||
| 2269 | CALJVF010000053.1 | GCA937974765_01129 | gene | open | 22058-23005 | rbbA | ||
| 2270 | CALJVF010000053.1 | GCA937974765_01130 | gene | open | 23037-23729 | |||
| 2271 | CALJVF010000053.1 | GCA937974765_01131 | gene | open | 23997-24899 | |||
| 2272 | CALJVF010000053.1 | GCA937974765_01132 | gene | open | 24883-25446 | ppa | ||
| 2273 | CALJVF010000053.1 | GCA937974765_01133 | gene | open | 25476-26927 | dacB | ||
| 2274 | CALJVF010000054.1 | GCA937974765_01134 | CDS | open | 405-1355 | _na 316_aa | hypothetical protein | |
| 2275 | CALJVF010000054.1 | GCA937974765_01135 | CDS | open | 1653-2318 | _na 221_aa | hypothetical protein | |
| 2276 | CALJVF010000054.1 | GCA937974765_01136 | CDS | open | 2311-2523 | _na 70_aa | hypothetical protein | |
| 2277 | CALJVF010000054.1 | GCA937974765_01137 | CDS | open | 2613-2855 | _na 80_aa | hypothetical protein | |
| 2278 | CALJVF010000054.1 | GCA937974765_01138 | CDS | open | 2789-3433 | _na 214_aa | hypothetical protein | |
| 2279 | CALJVF010000054.1 | GCA937974765_01139 | CDS | open | 3925-4833 | _na 302_aa | parA | ParA family protein |
| 2280 | CALJVF010000054.1 | GCA937974765_01140 | CDS | open | 4830-5474 | _na 214_aa | hypothetical protein | |
| 2281 | CALJVF010000054.1 | GCA937974765_01141 | CDS | open | 5443-6111 | _na 222_aa | hypothetical protein | |
| 2282 | CALJVF010000054.1 | GCA937974765_01142 | CDS | open | 6115-6948 | _na 277_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 2283 | CALJVF010000054.1 | GCA937974765_01143 | CDS | open | 6945-8471 | _na 508_aa | Type II/IV secretion system ATPase subunit | |
| 2284 | CALJVF010000054.1 | GCA937974765_01144 | CDS | open | 8468-9328 | _na 286_aa | Type II secretion system F family protein | |
| 2285 | CALJVF010000054.1 | GCA937974765_01145 | CDS | open | 9325-10221 | _na 298_aa | Type II secretion system F family protein | |
| 2286 | CALJVF010000054.1 | GCA937974765_01146 | CDS | open | 10050-10445 | _na 131_aa | hypothetical protein | |
| 2287 | CALJVF010000054.1 | GCA937974765_01147 | CDS | open | 10697-11161 | _na 154_aa | hypothetical protein | |
| 2288 | CALJVF010000054.1 | GCA937974765_01148 | CDS | open | 11451-11654 | _na 67_aa | hypothetical protein | |
| 2289 | CALJVF010000054.1 | GCA937974765_01149 | CDS | open | 11651-12025 | _na 124_aa | Pilus assembly protein | |
| 2290 | CALJVF010000054.1 | GCA937974765_01150 | CDS | open | 12028-12459 | _na 143_aa | Pilus assembly protein | |
| 2291 | CALJVF010000054.1 | GCA937974765_01151 | CDS | open | 12456-12878 | _na 140_aa | Pilus assembly protein | |
| 2292 | CALJVF010000054.1 | GCA937974765_01152 | CDS | open | 12875-15781 | _na 968_aa | hypothetical protein | |
| 2293 | CALJVF010000054.1 | GCA937974765_01153 | CDS | open | 15781-16398 | _na 205_aa | hypothetical protein | |
| 2294 | CALJVF010000054.1 | GCA937974765_01154 | CDS | open | 16392-17348 | _na 318_aa | hypothetical protein | |
| 2295 | CALJVF010000054.1 | GCA937974765_01155 | CDS | open | 17416-18129 | _na 237_aa | hypothetical protein | |
| 2296 | CALJVF010000054.1 | GCA937974765_01156 | CDS | open | 18293-18487 | _na 64_aa | hypothetical protein | |
| 2297 | CALJVF010000054.1 | GCA937974765_01157 | CDS | open | 18494-19402 | _na 302_aa | hypothetical protein | |
| 2298 | CALJVF010000054.1 | GCA937974765_01158 | CDS | open | 19417-19686 | _na 89_aa | hypothetical protein | |
| 2299 | CALJVF010000054.1 | GCA937974765_01159 | CDS | open | 19698-20339 | _na 213_aa | hypothetical protein | |
| 2300 | CALJVF010000054.1 | GCA937974765_01160 | CDS | open | 20336-22870 | _na 844_aa | ATP-binding protein | |
| 2301 | CALJVF010000054.1 | GCA937974765_01161 | CDS | open | 22867-24867 | _na 666_aa | hypothetical protein | |
| 2302 | CALJVF010000054.1 | GCA937974765_01162 | CDS | open | 24867-26483 | _na 538_aa | Peptidase M23 domain-containing protein | |
| 2303 | CALJVF010000054.1 | GCA937974765_01163 | CDS | open | 26492-27055 | _na 187_aa | hypothetical protein | |
| 2304 | CALJVF010000054.1 | GCA937974765_01164 | CDS | open | 27192-27875 | _na 227_aa | hypothetical protein | |
| 2305 | CALJVF010000054.1 | GCA937974765_01165 | CDS | open | 28015-28737 | _na 240_aa | hypothetical protein | |
| 2306 | CALJVF010000054.1 | GCA937974765_01166 | CDS | open | 28734-30383 | _na 549_aa | hypothetical protein | |
| 2307 | CALJVF010000054.1 | GCA937974765_01167 | CDS | open | 30376-30939 | _na 187_aa | hypothetical protein | |
| 2308 | CALJVF010000054.1 | GCA937974765_01168 | CDS | open | 30976-31731 | _na 251_aa | hypothetical protein | |
| 2309 | CALJVF010000054.1 | GCA937974765_01169 | CDS | open | 31798-32145 | _na 115_aa | hypothetical protein | |
| 2310 | CALJVF010000054.1 | GCA937974765_01170 | CDS | open | 32232-33746 | _na 504_aa | hypothetical protein | |
| 2311 | CALJVF010000054.1 | GCA937974765_01171 | CDS | open | 33758-34480 | _na 240_aa | hypothetical protein | |
| 2312 | CALJVF010000054.1 | GCA937974765_01172 | CDS | open | 34551-34967 | _na 138_aa | hypothetical protein | |
| 2313 | CALJVF010000054.1 | GCA937974765_01173 | CDS | open | 35149-35340 | _na 63_aa | hypothetical protein | |
| 2314 | CALJVF010000054.1 | GCA937974765_01174 | CDS | open | 35285-36760 | _na 491_aa | ligA | LigA |
| 2315 | CALJVF010000054.1 | GCA937974765_01175 | CDS | open | 36741-37640 | _na 299_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 2316 | CALJVF010000054.1 | GCA937974765_01176 | CDS | open | 38055-39020 | _na 321_aa | hypothetical protein | |
| 2317 | CALJVF010000054.1 | GCA937974765_01177 | CDS | open | 39058-39993 | _na 311_aa | hypothetical protein | |
| 2318 | CALJVF010000054.1 | GCA937974765_01178 | CDS | open | 39990-40124 | _na 44_aa | hypothetical protein | |
| 2319 | CALJVF010000054.1 | GCA937974765_01179 | CDS | open | 40156-42318 | _na 720_aa | hypothetical protein | |
| 2320 | CALJVF010000054.1 | GCA937974765_01180 | CDS | open | 42409-42558 | _na 49_aa | hypothetical protein | |
| 2321 | CALJVF010000054.1 | GCA937974765_01181 | CDS | open | 42600-42791 | _na 63_aa | hypothetical protein | |
| 2322 | CALJVF010000054.1 | GCA937974765_01134 | gene | open | 405-1355 | |||
| 2323 | CALJVF010000054.1 | GCA937974765_01135 | gene | open | 1653-2318 | |||
| 2324 | CALJVF010000054.1 | GCA937974765_01136 | gene | open | 2311-2523 | |||
| 2325 | CALJVF010000054.1 | GCA937974765_01137 | gene | open | 2613-2855 | |||
| 2326 | CALJVF010000054.1 | GCA937974765_01138 | gene | open | 2789-3433 | |||
| 2327 | CALJVF010000054.1 | GCA937974765_01139 | gene | open | 3925-4833 | parA | ||
| 2328 | CALJVF010000054.1 | GCA937974765_01140 | gene | open | 4830-5474 | |||
| 2329 | CALJVF010000054.1 | GCA937974765_01141 | gene | open | 5443-6111 | |||
| 2330 | CALJVF010000054.1 | GCA937974765_01142 | gene | open | 6115-6948 | |||
| 2331 | CALJVF010000054.1 | GCA937974765_01143 | gene | open | 6945-8471 | |||
| 2332 | CALJVF010000054.1 | GCA937974765_01144 | gene | open | 8468-9328 | |||
| 2333 | CALJVF010000054.1 | GCA937974765_01145 | gene | open | 9325-10221 | |||
| 2334 | CALJVF010000054.1 | GCA937974765_01146 | gene | open | 10050-10445 | |||
| 2335 | CALJVF010000054.1 | GCA937974765_01147 | gene | open | 10697-11161 | |||
| 2336 | CALJVF010000054.1 | GCA937974765_01148 | gene | open | 11451-11654 | |||
| 2337 | CALJVF010000054.1 | GCA937974765_01149 | gene | open | 11651-12025 | |||
| 2338 | CALJVF010000054.1 | GCA937974765_01150 | gene | open | 12028-12459 | |||
| 2339 | CALJVF010000054.1 | GCA937974765_01151 | gene | open | 12456-12878 | |||
| 2340 | CALJVF010000054.1 | GCA937974765_01152 | gene | open | 12875-15781 | |||
| 2341 | CALJVF010000054.1 | GCA937974765_01153 | gene | open | 15781-16398 | |||
| 2342 | CALJVF010000054.1 | GCA937974765_01154 | gene | open | 16392-17348 | |||
| 2343 | CALJVF010000054.1 | GCA937974765_01155 | gene | open | 17416-18129 | |||
| 2344 | CALJVF010000054.1 | GCA937974765_01156 | gene | open | 18293-18487 | |||
| 2345 | CALJVF010000054.1 | GCA937974765_01157 | gene | open | 18494-19402 | |||
| 2346 | CALJVF010000054.1 | GCA937974765_01158 | gene | open | 19417-19686 | |||
| 2347 | CALJVF010000054.1 | GCA937974765_01159 | gene | open | 19698-20339 | |||
| 2348 | CALJVF010000054.1 | GCA937974765_01160 | gene | open | 20336-22870 | |||
| 2349 | CALJVF010000054.1 | GCA937974765_01161 | gene | open | 22867-24867 | |||
| 2350 | CALJVF010000054.1 | GCA937974765_01162 | gene | open | 24867-26483 | |||
| 2351 | CALJVF010000054.1 | GCA937974765_01163 | gene | open | 26492-27055 | |||
| 2352 | CALJVF010000054.1 | GCA937974765_01164 | gene | open | 27192-27875 | |||
| 2353 | CALJVF010000054.1 | GCA937974765_01165 | gene | open | 28015-28737 | |||
| 2354 | CALJVF010000054.1 | GCA937974765_01166 | gene | open | 28734-30383 | |||
| 2355 | CALJVF010000054.1 | GCA937974765_01167 | gene | open | 30376-30939 | |||
| 2356 | CALJVF010000054.1 | GCA937974765_01168 | gene | open | 30976-31731 | |||
| 2357 | CALJVF010000054.1 | GCA937974765_01169 | gene | open | 31798-32145 | |||
| 2358 | CALJVF010000054.1 | GCA937974765_01170 | gene | open | 32232-33746 | |||
| 2359 | CALJVF010000054.1 | GCA937974765_01171 | gene | open | 33758-34480 | |||
| 2360 | CALJVF010000054.1 | GCA937974765_01172 | gene | open | 34551-34967 | |||
| 2361 | CALJVF010000054.1 | GCA937974765_01173 | gene | open | 35149-35340 | |||
| 2362 | CALJVF010000054.1 | GCA937974765_01174 | gene | open | 35285-36760 | ligA | ||
| 2363 | CALJVF010000054.1 | GCA937974765_01175 | gene | open | 36741-37640 | |||
| 2364 | CALJVF010000054.1 | GCA937974765_01176 | gene | open | 38055-39020 | |||
| 2365 | CALJVF010000054.1 | GCA937974765_01177 | gene | open | 39058-39993 | |||
| 2366 | CALJVF010000054.1 | GCA937974765_01178 | gene | open | 39990-40124 | |||
| 2367 | CALJVF010000054.1 | GCA937974765_01179 | gene | open | 40156-42318 | |||
| 2368 | CALJVF010000054.1 | GCA937974765_01180 | gene | open | 42409-42558 | |||
| 2369 | CALJVF010000054.1 | GCA937974765_01181 | gene | open | 42600-42791 | |||
| 2370 | CALJVF010000055.1 | GCA937974765_01182 | CDS | open | 10-930 | _na 306_aa | hypothetical protein | |
| 2371 | CALJVF010000055.1 | GCA937974765_01183 | CDS | open | 948-1433 | _na 161_aa | hypothetical protein | |
| 2372 | CALJVF010000055.1 | GCA937974765_01184 | CDS | open | 1651-3177 | _na 508_aa | pntA | Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha |
| 2373 | CALJVF010000055.1 | GCA937974765_01185 | CDS | open | 3181-4575 | _na 464_aa | pntB | Re/Si-specific NAD(P)(+) transhydrogenase subunit beta |
| 2374 | CALJVF010000055.1 | GCA937974765_01186 | CDS | open | 4664-6619 | _na 651_aa | acyltransferase | |
| 2375 | CALJVF010000055.1 | GCA937974765_01187 | CDS | open | 6647-7225 | _na 192_aa | hypothetical protein | |
| 2376 | CALJVF010000055.1 | GCA937974765_01188 | CDS | open | 7275-8729 | _na 484_aa | MFS transporter | |
| 2377 | CALJVF010000055.1 | GCA937974765_01189 | CDS | open | 8843-10540 | _na 565_aa | recB | Putative RecB family nuclease%2C TM0106 family |
| 2378 | CALJVF010000055.1 | GCA937974765_01190 | CDS | open | 10537-11229 | _na 230_aa | ubiE | demethylmenaquinone methyltransferase |
| 2379 | CALJVF010000055.1 | GCA937974765_01191 | CDS | open | 11262-11831 | _na 189_aa | Glycogen branching enzyme | |
| 2380 | CALJVF010000055.1 | GCA937974765_01192 | CDS | open | 11954-12604 | _na 216_aa | rbbA | ABC transporter ATP-binding protein |
| 2381 | CALJVF010000055.1 | GCA937974765_01193 | CDS | open | 12601-14226 | _na 541_aa | ABC transporter permease | |
| 2382 | CALJVF010000055.1 | GCA937974765_01194 | CDS | open | 14314-15150 | _na 278_aa | hypothetical protein | |
| 2383 | CALJVF010000055.1 | GCA937974765_01195 | CDS | open | 15245-15511 | _na 88_aa | DUF1540 domain-containing protein | |
| 2384 | CALJVF010000055.1 | GCA937974765_01196 | CDS | open | 16114-17550 | _na 478_aa | menF | isochorismate synthase |
| 2385 | CALJVF010000055.1 | GCA937974765_01197 | CDS | open | 17622-18884 | _na 420_aa | fixC | Alkyl hydroperoxide reductase%2C large subunit |
| 2386 | CALJVF010000055.1 | GCA937974765_01198 | CDS | open | 18913-19272 | _na 119_aa | nuoA | NADH-quinone oxidoreductase subunit A |
| 2387 | CALJVF010000055.1 | GCA937974765_01199 | CDS | open | 19288-19842 | _na 184_aa | nuoB | NADH-quinone oxidoreductase subunit B |
| 2388 | CALJVF010000055.1 | GCA937974765_01200 | CDS | open | 19839-20525 | _na 228_aa | nuoC | NADH-quinone oxidoreductase subunit C |
| 2389 | CALJVF010000055.1 | GCA937974765_01201 | CDS | open | 20525-21859 | _na 444_aa | nuoD | NADH-quinone oxidoreductase subunit D |
| 2390 | CALJVF010000055.1 | GCA937974765_01202 | CDS | open | 21856-22596 | _na 246_aa | nuoE | NADH-quinone oxidoreductase subunit NuoE |
| 2391 | CALJVF010000055.1 | GCA937974765_01203 | CDS | open | 22593-23909 | _na 438_aa | nuoF | NADH-quinone oxidoreductase subunit NuoF |
| 2392 | CALJVF010000055.1 | GCA937974765_01204 | CDS | open | 23906-26299 | _na 797_aa | nuoG | NADH-quinone oxidoreductase subunit G |
| 2393 | CALJVF010000055.1 | GCA937974765_01205 | CDS | open | 26296-27585 | _na 429_aa | nuoH | NADH-quinone oxidoreductase subunit NuoH |
| 2394 | CALJVF010000055.1 | GCA937974765_01206 | CDS | open | 27585-28139 | _na 184_aa | nuoI | NADH-quinone oxidoreductase subunit NuoI |
| 2395 | CALJVF010000055.1 | GCA937974765_01207 | CDS | open | 28136-28954 | _na 272_aa | nuoJ | NADH-quinone oxidoreductase subunit J |
| 2396 | CALJVF010000055.1 | GCA937974765_01208 | CDS | open | 28951-29250 | _na 99_aa | nuoK | NADH-quinone oxidoreductase subunit NuoK |
| 2397 | CALJVF010000055.1 | GCA937974765_01209 | CDS | open | 29261-31168 | _na 635_aa | nuoL | NADH-quinone oxidoreductase subunit L |
| 2398 | CALJVF010000055.1 | GCA937974765_01210 | CDS | open | 31185-32702 | _na 505_aa | nuoM | NADH-quinone oxidoreductase subunit M |
| 2399 | CALJVF010000055.1 | GCA937974765_01211 | CDS | open | 32702-34273 | _na 523_aa | nuoN | NADH-quinone oxidoreductase subunit NuoN |
| 2400 | CALJVF010000055.1 | GCA937974765_01212 | CDS | open | 34288-35238 | _na 316_aa | ispA | Heptaprenyl diphosphate synthase component 2 |
| 2401 | CALJVF010000055.1 | GCA937974765_01213 | CDS | open | 35754-37733 | _na 659_aa | hypothetical protein | |
| 2402 | CALJVF010000055.1 | GCA937974765_01214 | CDS | open | 38879-39184 | _na 101_aa | hypothetical protein | |
| 2403 | CALJVF010000055.1 | GCA937974765_01215 | CDS | open | 40165-41037 | _na 290_aa | hypothetical protein | |
| 2404 | CALJVF010000055.1 | GCA937974765_01216 | CDS | open | 41194-41646 | _na 150_aa | hypothetical protein | |
| 2405 | CALJVF010000055.1 | GCA937974765_01217 | CDS | open | 41870-42895 | _na 341_aa | hypothetical protein | |
| 2406 | CALJVF010000055.1 | GCA937974765_01182 | gene | open | 10-930 | |||
| 2407 | CALJVF010000055.1 | GCA937974765_01183 | gene | open | 948-1433 | |||
| 2408 | CALJVF010000055.1 | GCA937974765_01184 | gene | open | 1651-3177 | pntA | ||
| 2409 | CALJVF010000055.1 | GCA937974765_01185 | gene | open | 3181-4575 | pntB | ||
| 2410 | CALJVF010000055.1 | GCA937974765_01186 | gene | open | 4664-6619 | |||
| 2411 | CALJVF010000055.1 | GCA937974765_01187 | gene | open | 6647-7225 | |||
| 2412 | CALJVF010000055.1 | GCA937974765_01188 | gene | open | 7275-8729 | |||
| 2413 | CALJVF010000055.1 | GCA937974765_01189 | gene | open | 8843-10540 | recB | ||
| 2414 | CALJVF010000055.1 | GCA937974765_01190 | gene | open | 10537-11229 | ubiE | ||
| 2415 | CALJVF010000055.1 | GCA937974765_01191 | gene | open | 11262-11831 | |||
| 2416 | CALJVF010000055.1 | GCA937974765_01192 | gene | open | 11954-12604 | rbbA | ||
| 2417 | CALJVF010000055.1 | GCA937974765_01193 | gene | open | 12601-14226 | |||
| 2418 | CALJVF010000055.1 | GCA937974765_01194 | gene | open | 14314-15150 | |||
| 2419 | CALJVF010000055.1 | GCA937974765_01195 | gene | open | 15245-15511 | |||
| 2420 | CALJVF010000055.1 | GCA937974765_01196 | gene | open | 16114-17550 | menF | ||
| 2421 | CALJVF010000055.1 | GCA937974765_01197 | gene | open | 17622-18884 | fixC | ||
| 2422 | CALJVF010000055.1 | GCA937974765_01198 | gene | open | 18913-19272 | nuoA | ||
| 2423 | CALJVF010000055.1 | GCA937974765_01199 | gene | open | 19288-19842 | nuoB | ||
| 2424 | CALJVF010000055.1 | GCA937974765_01200 | gene | open | 19839-20525 | nuoC | ||
| 2425 | CALJVF010000055.1 | GCA937974765_01201 | gene | open | 20525-21859 | nuoD | ||
| 2426 | CALJVF010000055.1 | GCA937974765_01202 | gene | open | 21856-22596 | nuoE | ||
| 2427 | CALJVF010000055.1 | GCA937974765_01203 | gene | open | 22593-23909 | nuoF | ||
| 2428 | CALJVF010000055.1 | GCA937974765_01204 | gene | open | 23906-26299 | nuoG | ||
| 2429 | CALJVF010000055.1 | GCA937974765_01205 | gene | open | 26296-27585 | nuoH | ||
| 2430 | CALJVF010000055.1 | GCA937974765_01206 | gene | open | 27585-28139 | nuoI | ||
| 2431 | CALJVF010000055.1 | GCA937974765_01207 | gene | open | 28136-28954 | nuoJ | ||
| 2432 | CALJVF010000055.1 | GCA937974765_01208 | gene | open | 28951-29250 | nuoK | ||
| 2433 | CALJVF010000055.1 | GCA937974765_01209 | gene | open | 29261-31168 | nuoL | ||
| 2434 | CALJVF010000055.1 | GCA937974765_01210 | gene | open | 31185-32702 | nuoM | ||
| 2435 | CALJVF010000055.1 | GCA937974765_01211 | gene | open | 32702-34273 | nuoN | ||
| 2436 | CALJVF010000055.1 | GCA937974765_01212 | gene | open | 34288-35238 | ispA | ||
| 2437 | CALJVF010000055.1 | GCA937974765_01213 | gene | open | 35754-37733 | |||
| 2438 | CALJVF010000055.1 | GCA937974765_01214 | gene | open | 38879-39184 | |||
| 2439 | CALJVF010000055.1 | GCA937974765_01215 | gene | open | 40165-41037 | |||
| 2440 | CALJVF010000055.1 | GCA937974765_01216 | gene | open | 41194-41646 | |||
| 2441 | CALJVF010000055.1 | GCA937974765_01217 | gene | open | 41870-42895 | |||
| 2442 | CALJVF010000056.1 | GCA937974765_01218 | CDS | open | 683-2485 | _na 600_aa | mdlB | Multidrug export ATP-binding/permease protein SAV1866 |
| 2443 | CALJVF010000056.1 | GCA937974765_01219 | CDS | open | 2478-3602 | _na 374_aa | rfaB | GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase |
| 2444 | CALJVF010000056.1 | GCA937974765_01220 | CDS | open | 3599-4792 | _na 397_aa | rfaB | GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase |
| 2445 | CALJVF010000056.1 | GCA937974765_01221 | CDS | open | 4789-5037 | _na 82_aa | hypothetical protein | |
| 2446 | CALJVF010000056.1 | GCA937974765_01218 | gene | open | 683-2485 | mdlB | ||
| 2447 | CALJVF010000056.1 | GCA937974765_01219 | gene | open | 2478-3602 | rfaB | ||
| 2448 | CALJVF010000056.1 | GCA937974765_01220 | gene | open | 3599-4792 | rfaB | ||
| 2449 | CALJVF010000056.1 | GCA937974765_01221 | gene | open | 4789-5037 | |||
| 2450 | CALJVF010000057.1 | GCA937974765_01222 | CDS | open | 57-398 | _na 113_aa | hypothetical protein | |
| 2451 | CALJVF010000057.1 | GCA937974765_01223 | CDS | open | 642-1034 | _na 130_aa | hypothetical protein | |
| 2452 | CALJVF010000057.1 | GCA937974765_01224 | CDS | open | 1285-2190 | _na 301_aa | carB | Carbamoyl phosphate synthase-like protein |
| 2453 | CALJVF010000057.1 | GCA937974765_01225 | CDS | open | 2187-3086 | _na 299_aa | lmbE | PIG-L family deacetylase |
| 2454 | CALJVF010000057.1 | GCA937974765_01226 | CDS | open | 3602-4627 | _na 341_aa | mviM | Inositol 2-dehydrogenase |
| 2455 | CALJVF010000057.1 | GCA937974765_01227 | CDS | open | 4624-5415 | _na 263_aa | hyi | Hydroxypyruvate isomerase |
| 2456 | CALJVF010000057.1 | GCA937974765_01228 | CDS | open | 5529-7058 | _na 509_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 2457 | CALJVF010000057.1 | GCA937974765_01229 | CDS | open | 7058-8026 | _na 322_aa | araH | ABC transporter permease |
| 2458 | CALJVF010000057.1 | GCA937974765_01230 | CDS | open | 8063-9013 | _na 316_aa | rbsB | D-ribose-binding periplasmic protein |
| 2459 | CALJVF010000057.1 | GCA937974765_01231 | CDS | open | 9104-10120 | _na 338_aa | purR | LacI family DNA-binding transcriptional regulator |
| 2460 | CALJVF010000057.1 | GCA937974765_01232 | CDS | open | 10194-11423 | _na 409_aa | hypothetical protein | |
| 2461 | CALJVF010000057.1 | GCA937974765_01233 | CDS | open | 11827-12828 | _na 333_aa | purR | Mgl repressor and galactose ultrainduction factor |
| 2462 | CALJVF010000057.1 | GCA937974765_01234 | CDS | open | 12991-14169 | _na 392_aa | mviM | 1%2C5-anhydro-D-fructose reductase |
| 2463 | CALJVF010000057.1 | GCA937974765_01235 | CDS | open | 14185-15114 | _na 309_aa | ycjR | Inosose dehydratase |
| 2464 | CALJVF010000057.1 | GCA937974765_01236 | CDS | open | 15525-17081 | _na 518_aa | rbsA | Ribose import ATP-binding protein RbsA |
| 2465 | CALJVF010000057.1 | GCA937974765_01237 | CDS | open | 17081-18088 | _na 335_aa | araH | ABC transporter permease |
| 2466 | CALJVF010000057.1 | GCA937974765_01238 | CDS | open | 18147-19112 | _na 321_aa | rbsB | D-allose-binding periplasmic protein |
| 2467 | CALJVF010000057.1 | GCA937974765_01239 | CDS | open | 19241-20509 | _na 422_aa | ATP-binding protein | |
| 2468 | CALJVF010000057.1 | GCA937974765_01240 | CDS | open | 20537-21325 | _na 262_aa | yaaA | peroxide stress protein YaaA |
| 2469 | CALJVF010000057.1 | GCA937974765_01241 | CDS | open | 21613-22806 | _na 397_aa | Glycosyl transferase family 28 C-terminal domain-containing protein | |
| 2470 | CALJVF010000057.1 | GCA937974765_01242 | CDS | open | 22803-24014 | _na 403_aa | Glycosyltransferase%2C group 1 family protein | |
| 2471 | CALJVF010000057.1 | GCA937974765_01243 | CDS | open | 24024-25148 | _na 374_aa | Glycosyltransferase%2C group 1 family protein | |
| 2472 | CALJVF010000057.1 | GCA937974765_01244 | CDS | open | 25479-25874 | _na 131_aa | hypothetical protein | |
| 2473 | CALJVF010000057.1 | GCA937974765_01222 | gene | open | 57-398 | |||
| 2474 | CALJVF010000057.1 | GCA937974765_01223 | gene | open | 642-1034 | |||
| 2475 | CALJVF010000057.1 | GCA937974765_01224 | gene | open | 1285-2190 | carB | ||
| 2476 | CALJVF010000057.1 | GCA937974765_01225 | gene | open | 2187-3086 | lmbE | ||
| 2477 | CALJVF010000057.1 | GCA937974765_01226 | gene | open | 3602-4627 | mviM | ||
| 2478 | CALJVF010000057.1 | GCA937974765_01227 | gene | open | 4624-5415 | hyi | ||
| 2479 | CALJVF010000057.1 | GCA937974765_01228 | gene | open | 5529-7058 | ccmA | ||
| 2480 | CALJVF010000057.1 | GCA937974765_01229 | gene | open | 7058-8026 | araH | ||
| 2481 | CALJVF010000057.1 | GCA937974765_01230 | gene | open | 8063-9013 | rbsB | ||
| 2482 | CALJVF010000057.1 | GCA937974765_01231 | gene | open | 9104-10120 | purR | ||
| 2483 | CALJVF010000057.1 | GCA937974765_01232 | gene | open | 10194-11423 | |||
| 2484 | CALJVF010000057.1 | GCA937974765_01233 | gene | open | 11827-12828 | purR | ||
| 2485 | CALJVF010000057.1 | GCA937974765_01234 | gene | open | 12991-14169 | mviM | ||
| 2486 | CALJVF010000057.1 | GCA937974765_01235 | gene | open | 14185-15114 | ycjR | ||
| 2487 | CALJVF010000057.1 | GCA937974765_01236 | gene | open | 15525-17081 | rbsA | ||
| 2488 | CALJVF010000057.1 | GCA937974765_01237 | gene | open | 17081-18088 | araH | ||
| 2489 | CALJVF010000057.1 | GCA937974765_01238 | gene | open | 18147-19112 | rbsB | ||
| 2490 | CALJVF010000057.1 | GCA937974765_01239 | gene | open | 19241-20509 | |||
| 2491 | CALJVF010000057.1 | GCA937974765_01240 | gene | open | 20537-21325 | yaaA | ||
| 2492 | CALJVF010000057.1 | GCA937974765_01241 | gene | open | 21613-22806 | |||
| 2493 | CALJVF010000057.1 | GCA937974765_01242 | gene | open | 22803-24014 | |||
| 2494 | CALJVF010000057.1 | GCA937974765_01243 | gene | open | 24024-25148 | |||
| 2495 | CALJVF010000057.1 | GCA937974765_01244 | gene | open | 25479-25874 | |||
| 2496 | CALJVF010000058.1 | GCA937974765_01245 | CDS | open | 657-1355 | _na 232_aa | Lipoprotein | |
| 2497 | CALJVF010000058.1 | GCA937974765_01246 | CDS | open | 1474-3324 | _na 616_aa | typA | translational GTPase TypA |
| 2498 | CALJVF010000058.1 | GCA937974765_01245 | gene | open | 657-1355 | |||
| 2499 | CALJVF010000058.1 | GCA937974765_01246 | gene | open | 1474-3324 | typA | ||
| 2500 | CALJVF010000059.1 | GCA937974765_01247 | CDS | open | 273-725 | _na 150_aa | SMI1/KNR4 family protein |

