HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Arachnia rubra (GCA_937974815.1)

Select a Genome:
BAKTA Annotations for GCA_937974815.1
Genome Selected: Arachnia rubra
ContigsBases CDSrRNA tmRNAtRNA
223 3200054 2964 1 2 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6050 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 6050 [13 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CALJVG010000020.1 GCA937974815_00247 gene open 1733-2815
502 CALJVG010000020.1 GCA937974815_00248 gene open 2843-3073 tusA
503 CALJVG010000020.1 GCA937974815_00249 gene open 3229-3897 gntR
504 CALJVG010000020.1 GCA937974815_00250 gene open 3902-4594
505 CALJVG010000020.1 GCA937974815_00251 gene open 4591-5016
506 CALJVG010000020.1 GCA937974815_00252 gene open 5010-5315
507 CALJVG010000020.1 GCA937974815_00253 gene open 5312-6736
508 CALJVG010000020.1 GCA937974815_00254 gene open 6829-6954
509 CALJVG010000021.1 GCA937974815_00255 CDS open 9-248 _na     79_aa hypothetical protein
510 CALJVG010000021.1 GCA937974815_00256 CDS open 256-825 _na     189_aa GNAT family N-acetyltransferase
511 CALJVG010000021.1 GCA937974815_00257 CDS open 883-2154 _na     423_aa ATP-binding protein
512 CALJVG010000021.1 GCA937974815_00258 CDS open 2200-2376 _na     58_aa PEP-utilizing enzyme
513 CALJVG010000021.1 GCA937974815_00255 gene open 9-248
514 CALJVG010000021.1 GCA937974815_00256 gene open 256-825
515 CALJVG010000021.1 GCA937974815_00257 gene open 883-2154
516 CALJVG010000021.1 GCA937974815_00258 gene open 2200-2376
517 CALJVG010000022.1 GCA937974815_00259 CDS open 378-494 _na     38_aa hypothetical protein
518 CALJVG010000022.1 GCA937974815_00260 CDS open 1048-1749 _na     233_aa metalloregulator ArsR/SmtB family transcription factor
519 CALJVG010000022.1 GCA937974815_00261 CDS open 1937-3100 _na     387_aa MFS transporter
520 CALJVG010000022.1 GCA937974815_00262 CDS open 3067-3240 _na     57_aa hypothetical protein
521 CALJVG010000022.1 GCA937974815_00263 CDS open 3253-4611 _na     452_aa narK NarK/NasA family nitrate transporter
522 CALJVG010000022.1 GCA937974815_00265 CDS open 4854-5456 _na     200_aa CE1759 family FMN reductase
523 CALJVG010000022.1 GCA937974815_00266 CDS open 5453-6616 _na     387_aa LLM class flavin-dependent oxidoreductase
524 CALJVG010000022.1 GCA937974815_00267 CDS open 6773-7612 _na     279_aa fepC putative siderophore transport system ATP-binding protein YusV
525 CALJVG010000022.1 GCA937974815_00268 CDS open 7609-8625 _na     338_aa iron-siderophore ABC transporter substrate-binding protein
526 CALJVG010000022.1 GCA937974815_00269 CDS open 8730-9779 _na     349_aa iron ABC transporter permease
527 CALJVG010000022.1 GCA937974815_00270 CDS open 9776-10840 _na     354_aa iron chelate uptake ABC transporter family permease subunit
528 CALJVG010000022.1 GCA937974815_00271 CDS open 11012-12367 _na     451_aa D-serine ammonia-lyase
529 CALJVG010000022.1 GCA937974815_00272 CDS open 12456-12674 _na     72_aa csbD CsbD family protein
530 CALJVG010000022.1 GCA937974815_00273 CDS open 13095-14855 _na     586_aa glycoside hydrolase family 3 N-terminal domain-containing protein
531 CALJVG010000022.1 GCA937974815_00274 CDS open 14900-15286 _na     128_aa L-rhamnose mutarotase
532 CALJVG010000022.1 GCA937974815_00275 CDS open 15269-16177 _na     302_aa ABC transporter substrate-binding protein
533 CALJVG010000022.1 GCA937974815_00276 CDS open 16174-16866 _na     230_aa ABC transporter permease
534 CALJVG010000022.1 GCA937974815_00277 CDS open 16863-17513 _na     216_aa ABC transporter permease
535 CALJVG010000022.1 GCA937974815_00278 CDS open 17510-18352 _na     280_aa ABC transporter ATP-binding protein
536 CALJVG010000022.1 GCA937974815_00279 CDS open 18356-18904 _na     182_aa marR MarR family winged helix-turn-helix transcriptional regulator
537 CALJVG010000022.1 GCA937974815_00280 CDS open 19047-19412 _na     121_aa trxA thioredoxin
538 CALJVG010000022.1 GCA937974815_00281 CDS open 19488-20177 _na     229_aa mntR Iron-dependent repressor IdeR
539 CALJVG010000022.1 GCA937974815_00282 CDS open 20287-20907 _na     206_aa GNAT family N-acetyltransferase
540 CALJVG010000022.1 GCA937974815_00283 CDS open 20904-22022 _na     372_aa nagA N-acetylglucosamine-6-phosphate deacetylase
541 CALJVG010000022.1 GCA937974815_00284 CDS open 22102-23196 _na     364_aa serC phosphoserine transaminase
542 CALJVG010000022.1 GCA937974815_00285 CDS open 23193-24200 _na     335_aa WD40 repeat domain-containing protein
543 CALJVG010000022.1 GCA937974815_00286 CDS open 24221-24811 _na     196_aa hypothetical protein
544 CALJVG010000022.1 GCA937974815_00287 CDS open 24884-25216 _na     110_aa hypothetical protein
545 CALJVG010000022.1 GCA937974815_00288 CDS open 25713-25928 _na     71_aa hypothetical protein
546 CALJVG010000022.1 GCA937974815_00259 gene open 378-494
547 CALJVG010000022.1 GCA937974815_00260 gene open 1048-1749
548 CALJVG010000022.1 GCA937974815_00261 gene open 1937-3100
549 CALJVG010000022.1 GCA937974815_00262 gene open 3067-3240
550 CALJVG010000022.1 GCA937974815_00263 gene open 3253-4611 narK
551 CALJVG010000022.1 GCA937974815_00265 gene open 4854-5456
552 CALJVG010000022.1 GCA937974815_00266 gene open 5453-6616
553 CALJVG010000022.1 GCA937974815_00267 gene open 6773-7612 fepC
554 CALJVG010000022.1 GCA937974815_00268 gene open 7609-8625
555 CALJVG010000022.1 GCA937974815_00269 gene open 8730-9779
556 CALJVG010000022.1 GCA937974815_00270 gene open 9776-10840
557 CALJVG010000022.1 GCA937974815_00271 gene open 11012-12367
558 CALJVG010000022.1 GCA937974815_00272 gene open 12456-12674 csbD
559 CALJVG010000022.1 GCA937974815_00273 gene open 13095-14855
560 CALJVG010000022.1 GCA937974815_00274 gene open 14900-15286
561 CALJVG010000022.1 GCA937974815_00275 gene open 15269-16177
562 CALJVG010000022.1 GCA937974815_00276 gene open 16174-16866
563 CALJVG010000022.1 GCA937974815_00277 gene open 16863-17513
564 CALJVG010000022.1 GCA937974815_00278 gene open 17510-18352
565 CALJVG010000022.1 GCA937974815_00279 gene open 18356-18904 marR
566 CALJVG010000022.1 GCA937974815_00280 gene open 19047-19412 trxA
567 CALJVG010000022.1 GCA937974815_00281 gene open 19488-20177 mntR
568 CALJVG010000022.1 GCA937974815_00282 gene open 20287-20907
569 CALJVG010000022.1 GCA937974815_00283 gene open 20904-22022 nagA
570 CALJVG010000022.1 GCA937974815_00284 gene open 22102-23196 serC
571 CALJVG010000022.1 GCA937974815_00285 gene open 23193-24200
572 CALJVG010000022.1 GCA937974815_00286 gene open 24221-24811
573 CALJVG010000022.1 GCA937974815_00287 gene open 24884-25216
574 CALJVG010000022.1 GCA937974815_00288 gene open 25713-25928
575 CALJVG010000022.1 GCA937974815_00264 gene open 4684-4756 trnR
576 CALJVG010000022.1 GCA937974815_00264 tRNA open 4684-4756 trnR tRNA-Arg(cct)
577 CALJVG010000023.1 GCA937974815_00289 CDS open 624-1715 _na     363_aa wecE UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase
578 CALJVG010000023.1 GCA937974815_00290 CDS open 1712-2317 _na     201_aa glmU N-acetyltransferase
579 CALJVG010000023.1 GCA937974815_00291 CDS open 2571-3497 _na     308_aa hypothetical protein
580 CALJVG010000023.1 GCA937974815_00292 CDS open 3605-4627 _na     340_aa meaB methylmalonyl Co-A mutase-associated GTPase MeaB
581 CALJVG010000023.1 GCA937974815_00293 CDS open 4800-5507 _na     235_aa fHA DUF3662 domain-containing protein
582 CALJVG010000023.1 GCA937974815_00294 CDS open 5511-5972 _na     153_aa FHA domain-containing protein
583 CALJVG010000023.1 GCA937974815_00295 CDS open 5972-7399 _na     475_aa PP2C family serine/threonine-protein phosphatase
584 CALJVG010000023.1 GCA937974815_00289 gene open 624-1715 wecE
585 CALJVG010000023.1 GCA937974815_00290 gene open 1712-2317 glmU
586 CALJVG010000023.1 GCA937974815_00291 gene open 2571-3497
587 CALJVG010000023.1 GCA937974815_00292 gene open 3605-4627 meaB
588 CALJVG010000023.1 GCA937974815_00293 gene open 4800-5507 fHA
589 CALJVG010000023.1 GCA937974815_00294 gene open 5511-5972
590 CALJVG010000023.1 GCA937974815_00295 gene open 5972-7399
591 CALJVG010000024.1 GCA937974815_00296 CDS open 16-819 _na     267_aa cysE serine O-acetyltransferase
592 CALJVG010000024.1 GCA937974815_00297 CDS open 829-1029 _na     66_aa biotin/lipoyl-containing protein
593 CALJVG010000024.1 GCA937974815_00296 gene open 16-819 cysE
594 CALJVG010000024.1 GCA937974815_00297 gene open 829-1029
595 CALJVG010000025.1 GCA937974815_00298 gene open 300-417 rrf
596 CALJVG010000025.1 GCA937974815_00298 rRNA open 300-417 rrf 5S ribosomal RNA
597 CALJVG010000025.1 GCA937974815_00299 CDS open 654-2048 _na     464_aa hypothetical protein
598 CALJVG010000025.1 GCA937974815_00300 CDS open 2045-3034 _na     329_aa HAD-IIA family hydrolase
599 CALJVG010000025.1 GCA937974815_00301 CDS open 3031-3240 _na     69_aa hypothetical protein
600 CALJVG010000025.1 GCA937974815_00302 CDS open 3237-3974 _na     245_aa tlyA TlyA family RNA methyltransferase
601 CALJVG010000025.1 GCA937974815_00303 CDS open 3974-4876 _na     300_aa NAD kinase
602 CALJVG010000025.1 GCA937974815_00304 CDS open 4870-6546 _na     558_aa recN DNA repair protein RecN
603 CALJVG010000025.1 GCA937974815_00305 CDS open 6558-7130 _na     190_aa isochorismatase family protein
604 CALJVG010000025.1 GCA937974815_00306 CDS open 7225-8139 _na     304_aa hypothetical protein
605 CALJVG010000025.1 GCA937974815_00307 CDS open 8241-8954 _na     237_aa hypothetical protein
606 CALJVG010000025.1 GCA937974815_00308 CDS open 9028-9906 _na     292_aa LCP family protein
607 CALJVG010000025.1 GCA937974815_00309 CDS open 9973-10599 _na     208_aa NUDIX domain-containing protein
608 CALJVG010000025.1 GCA937974815_00310 CDS open 10600-11511 _na     303_aa xerD site-specific tyrosine recombinase XerD
609 CALJVG010000025.1 GCA937974815_00311 CDS open 11621-12517 _na     298_aa Sporulation initiation inhibitor protein soj
610 CALJVG010000025.1 GCA937974815_00312 CDS open 12508-12882 _na     124_aa Cobyrinic acid a%2Cc-diamide synthase
611 CALJVG010000025.1 GCA937974815_00313 CDS open 12879-13703 _na     274_aa scpA ScpA family protein
612 CALJVG010000025.1 GCA937974815_00314 CDS open 13700-14263 _na     187_aa scpB SMC-Scp complex subunit ScpB
613 CALJVG010000025.1 GCA937974815_00315 CDS open 14256-14990 _na     244_aa Pseudouridine synthase
614 CALJVG010000025.1 GCA937974815_00316 CDS open 15043-16044 _na     333_aa FKBP-type peptidyl-prolyl cis-trans isomerase
615 CALJVG010000025.1 GCA937974815_00317 CDS open 16028-16948 _na     306_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
616 CALJVG010000025.1 GCA937974815_00318 CDS open 17025-17954 _na     309_aa yafY YafY family protein
617 CALJVG010000025.1 GCA937974815_00319 CDS open 17951-18880 _na     309_aa yobV Proteasome accessory factor C
618 CALJVG010000025.1 GCA937974815_00320 CDS open 18877-19089 _na     70_aa hypothetical protein
619 CALJVG010000025.1 GCA937974815_00321 CDS open 19132-19458 _na     108_aa tatA Sec-independent protein translocase protein TatA
620 CALJVG010000025.1 GCA937974815_00322 CDS open 19551-20339 _na     262_aa tatC twin-arginine translocase subunit TatC
621 CALJVG010000025.1 GCA937974815_00323 CDS open 20336-21250 _na     304_aa diacylglycerol kinase family protein
622 CALJVG010000025.1 GCA937974815_00324 CDS open 21214-24018 _na     934_aa dob10 Ski2-like helicase
623 CALJVG010000025.1 GCA937974815_00325 CDS open 24018-24785 _na     255_aa hisF Imidazole glycerol phosphate synthase subunit HisF
624 CALJVG010000025.1 GCA937974815_00326 CDS open 24791-25192 _na     133_aa HIT family protein
625 CALJVG010000025.1 GCA937974815_00327 CDS open 25205-25582 _na     125_aa cupin domain-containing protein
626 CALJVG010000025.1 GCA937974815_00328 CDS open 25644-26459 _na     271_aa lexA transcriptional repressor LexA
627 CALJVG010000025.1 GCA937974815_00329 CDS open 26677-26970 _na     97_aa hypothetical protein
628 CALJVG010000025.1 GCA937974815_00330 CDS open 27160-27696 _na     178_aa nrdR transcriptional regulator NrdR
629 CALJVG010000025.1 GCA937974815_00331 CDS open 27736-30588 _na     950_aa nrdA vitamin B12-dependent ribonucleotide reductase
630 CALJVG010000025.1 GCA937974815_00332 CDS open 30704-32071 _na     455_aa thrE threonine/serine exporter ThrE family protein
631 CALJVG010000025.1 GCA937974815_00333 CDS open 32334-33143 _na     269_aa class I SAM-dependent methyltransferase
632 CALJVG010000025.1 GCA937974815_00334 CDS open 33533-34120 _na     195_aa hypothetical protein
633 CALJVG010000025.1 GCA937974815_00299 gene open 654-2048
634 CALJVG010000025.1 GCA937974815_00300 gene open 2045-3034
635 CALJVG010000025.1 GCA937974815_00301 gene open 3031-3240
636 CALJVG010000025.1 GCA937974815_00302 gene open 3237-3974 tlyA
637 CALJVG010000025.1 GCA937974815_00303 gene open 3974-4876
638 CALJVG010000025.1 GCA937974815_00304 gene open 4870-6546 recN
639 CALJVG010000025.1 GCA937974815_00305 gene open 6558-7130
640 CALJVG010000025.1 GCA937974815_00306 gene open 7225-8139
641 CALJVG010000025.1 GCA937974815_00307 gene open 8241-8954
642 CALJVG010000025.1 GCA937974815_00308 gene open 9028-9906
643 CALJVG010000025.1 GCA937974815_00309 gene open 9973-10599
644 CALJVG010000025.1 GCA937974815_00310 gene open 10600-11511 xerD
645 CALJVG010000025.1 GCA937974815_00311 gene open 11621-12517
646 CALJVG010000025.1 GCA937974815_00312 gene open 12508-12882
647 CALJVG010000025.1 GCA937974815_00313 gene open 12879-13703 scpA
648 CALJVG010000025.1 GCA937974815_00314 gene open 13700-14263 scpB
649 CALJVG010000025.1 GCA937974815_00315 gene open 14256-14990
650 CALJVG010000025.1 GCA937974815_00316 gene open 15043-16044
651 CALJVG010000025.1 GCA937974815_00317 gene open 16028-16948 gluQRS
652 CALJVG010000025.1 GCA937974815_00318 gene open 17025-17954 yafY
653 CALJVG010000025.1 GCA937974815_00319 gene open 17951-18880 yobV
654 CALJVG010000025.1 GCA937974815_00320 gene open 18877-19089
655 CALJVG010000025.1 GCA937974815_00321 gene open 19132-19458 tatA
656 CALJVG010000025.1 GCA937974815_00322 gene open 19551-20339 tatC
657 CALJVG010000025.1 GCA937974815_00323 gene open 20336-21250
658 CALJVG010000025.1 GCA937974815_00324 gene open 21214-24018 dob10
659 CALJVG010000025.1 GCA937974815_00325 gene open 24018-24785 hisF
660 CALJVG010000025.1 GCA937974815_00326 gene open 24791-25192
661 CALJVG010000025.1 GCA937974815_00327 gene open 25205-25582
662 CALJVG010000025.1 GCA937974815_00328 gene open 25644-26459 lexA
663 CALJVG010000025.1 GCA937974815_00329 gene open 26677-26970
664 CALJVG010000025.1 GCA937974815_00330 gene open 27160-27696 nrdR
665 CALJVG010000025.1 GCA937974815_00331 gene open 27736-30588 nrdA
666 CALJVG010000025.1 GCA937974815_00332 gene open 30704-32071 thrE
667 CALJVG010000025.1 GCA937974815_00333 gene open 32334-33143
668 CALJVG010000025.1 GCA937974815_00334 gene open 33533-34120
669 CALJVG010000026.1 GCA937974815_00335 CDS open 45-1349 _na     434_aa hypothetical protein
670 CALJVG010000026.1 GCA937974815_00336 CDS open 1711-2781 _na     356_aa hypothetical protein
671 CALJVG010000026.1 GCA937974815_00337 CDS open 2889-6788 _na     1299_aa class I SAM-dependent DNA methyltransferase
672 CALJVG010000026.1 GCA937974815_00335 gene open 45-1349
673 CALJVG010000026.1 GCA937974815_00336 gene open 1711-2781
674 CALJVG010000026.1 GCA937974815_00337 gene open 2889-6788
675 CALJVG010000027.1 GCA937974815_00338 CDS open 286-771 _na     161_aa marR MarR family winged helix-turn-helix transcriptional regulator
676 CALJVG010000027.1 GCA937974815_00339 CDS open 886-1881 _na     331_aa NADP-dependent oxidoreductase
677 CALJVG010000027.1 GCA937974815_00340 CDS open 1982-3394 _na     470_aa FtsX-like permease family
678 CALJVG010000027.1 GCA937974815_00341 CDS open 3391-4101 _na     236_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
679 CALJVG010000027.1 GCA937974815_00342 CDS open 4576-5289 _na     237_aa comP histidine kinase
680 CALJVG010000027.1 GCA937974815_00343 CDS open 5286-5957 _na     223_aa HTH luxR-type domain-containing protein
681 CALJVG010000027.1 GCA937974815_00338 gene open 286-771 marR
682 CALJVG010000027.1 GCA937974815_00339 gene open 886-1881
683 CALJVG010000027.1 GCA937974815_00340 gene open 1982-3394
684 CALJVG010000027.1 GCA937974815_00341 gene open 3391-4101 lolD
685 CALJVG010000027.1 GCA937974815_00342 gene open 4576-5289 comP
686 CALJVG010000027.1 GCA937974815_00343 gene open 5286-5957
687 CALJVG010000028.1 GCA937974815_00344 CDS open 65-523 _na     152_aa hypothetical protein
688 CALJVG010000028.1 GCA937974815_00345 CDS open 520-1329 _na     269_aa hypothetical protein
689 CALJVG010000028.1 GCA937974815_00344 gene open 65-523
690 CALJVG010000028.1 GCA937974815_00345 gene open 520-1329
691 CALJVG010000029.1 GCA937974815_00346 CDS open 838-1212 _na     124_aa rhodanese-like domain-containing protein
692 CALJVG010000029.1 GCA937974815_00347 CDS open 1221-1961 _na     246_aa SGNH/GDSL hydrolase family protein
693 CALJVG010000029.1 GCA937974815_00346 gene open 838-1212
694 CALJVG010000029.1 GCA937974815_00347 gene open 1221-1961
695 CALJVG010000030.1 GCA937974815_00348 CDS open 66-455 _na     129_aa irtA Iron import ATP-binding/permease protein IrtA
696 CALJVG010000030.1 GCA937974815_00349 CDS open 452-2188 _na     578_aa mdlB ABC transporter ATP-binding protein
697 CALJVG010000030.1 GCA937974815_00350 CDS open 2323-2847 _na     174_aa GNAT family N-acetyltransferase
698 CALJVG010000030.1 GCA937974815_00351 CDS open 3008-3718 _na     236_aa Pyrimidine utilization regulatory protein R
699 CALJVG010000030.1 GCA937974815_00352 CDS open 3733-4971 _na     412_aa FAD-dependent monooxygenase
700 CALJVG010000030.1 GCA937974815_00353 CDS open 5011-5232 _na     73_aa hypothetical protein
701 CALJVG010000030.1 GCA937974815_00354 CDS open 5292-5702 _na     136_aa TetR/AcrR family transcriptional regulator
702 CALJVG010000030.1 GCA937974815_00355 CDS open 5754-6050 _na     98_aa hypothetical protein
703 CALJVG010000030.1 GCA937974815_00356 CDS open 6149-6535 _na     128_aa VOC family protein
704 CALJVG010000030.1 GCA937974815_00357 CDS open 6703-7662 _na     319_aa Restriction endonuclease
705 CALJVG010000030.1 GCA937974815_00358 CDS open 7659-8030 _na     123_aa hypothetical protein
706 CALJVG010000030.1 GCA937974815_00359 CDS open 8376-8519 _na     47_aa hypothetical protein
707 CALJVG010000030.1 GCA937974815_00360 CDS open 9328-9585 _na     85_aa hypothetical protein
708 CALJVG010000030.1 GCA937974815_00361 CDS open 9593-10288 _na     231_aa HXXEE domain-containing protein
709 CALJVG010000030.1 GCA937974815_00362 CDS open 10408-11001 _na     197_aa tetR TetR family transcriptional regulator
710 CALJVG010000030.1 GCA937974815_00363 CDS open 11078-12226 _na     382_aa alpha/beta hydrolase
711 CALJVG010000030.1 GCA937974815_00364 CDS open 12547-12648 _na     33_aa hypothetical protein
712 CALJVG010000030.1 GCA937974815_00365 CDS open 12887-13357 _na     156_aa osmC OsmC family protein
713 CALJVG010000030.1 GCA937974815_00348 gene open 66-455 irtA
714 CALJVG010000030.1 GCA937974815_00349 gene open 452-2188 mdlB
715 CALJVG010000030.1 GCA937974815_00350 gene open 2323-2847
716 CALJVG010000030.1 GCA937974815_00351 gene open 3008-3718
717 CALJVG010000030.1 GCA937974815_00352 gene open 3733-4971
718 CALJVG010000030.1 GCA937974815_00353 gene open 5011-5232
719 CALJVG010000030.1 GCA937974815_00354 gene open 5292-5702
720 CALJVG010000030.1 GCA937974815_00355 gene open 5754-6050
721 CALJVG010000030.1 GCA937974815_00356 gene open 6149-6535
722 CALJVG010000030.1 GCA937974815_00357 gene open 6703-7662
723 CALJVG010000030.1 GCA937974815_00358 gene open 7659-8030
724 CALJVG010000030.1 GCA937974815_00359 gene open 8376-8519
725 CALJVG010000030.1 GCA937974815_00360 gene open 9328-9585
726 CALJVG010000030.1 GCA937974815_00361 gene open 9593-10288
727 CALJVG010000030.1 GCA937974815_00362 gene open 10408-11001 tetR
728 CALJVG010000030.1 GCA937974815_00363 gene open 11078-12226
729 CALJVG010000030.1 GCA937974815_00364 gene open 12547-12648
730 CALJVG010000030.1 GCA937974815_00365 gene open 12887-13357 osmC
731 CALJVG010000031.1 GCA937974815_00366 CDS open 32-520 _na     162_aa Glycerol dehydratase
732 CALJVG010000031.1 GCA937974815_00367 CDS open 531-1094 _na     187_aa diol dehydratase small subunit
733 CALJVG010000031.1 GCA937974815_00368 CDS open 1128-2942 _na     604_aa diol dehydratase reactivase subunit alpha
734 CALJVG010000031.1 GCA937974815_00369 CDS open 2939-3304 _na     121_aa Glycerol dehydratase reactivation factor%2C small subunit
735 CALJVG010000031.1 GCA937974815_00370 CDS open 3304-4137 _na     277_aa BMC domain-containing protein
736 CALJVG010000031.1 GCA937974815_00371 CDS open 4134-4403 _na     89_aa eutM ethanolamine utilization microcompartment protein EutM
737 CALJVG010000031.1 GCA937974815_00372 CDS open 4400-5227 _na     275_aa eutJ ethanolamine utilization protein EutJ
738 CALJVG010000031.1 GCA937974815_00373 CDS open 5224-6084 _na     286_aa flavoprotein
739 CALJVG010000031.1 GCA937974815_00374 CDS open 6105-7124 _na     339_aa cob(I)yrinic acid a%2Cc-diamide adenosyltransferase
740 CALJVG010000031.1 GCA937974815_00375 CDS open 7128-8573 _na     481_aa aldehyde dehydrogenase family protein
741 CALJVG010000031.1 GCA937974815_00376 CDS open 8577-9560 _na     327_aa malate dehydrogenase
742 CALJVG010000031.1 GCA937974815_00377 CDS open 9695-10912 _na     405_aa hypothetical protein
743 CALJVG010000031.1 GCA937974815_00378 CDS open 11222-14011 _na     929_aa hypothetical protein
744 CALJVG010000031.1 GCA937974815_00379 CDS open 14302-14808 _na     168_aa BadM/Rrf2 family transcriptional regulator
745 CALJVG010000031.1 GCA937974815_00380 CDS open 14844-16253 _na     469_aa Transporter%2C major facilitator family protein
746 CALJVG010000031.1 GCA937974815_00381 CDS open 16544-17431 _na     295_aa Fructose-bisphosphate aldolase class 1
747 CALJVG010000031.1 GCA937974815_00382 CDS open 17654-17971 _na     105_aa type II toxin-antitoxin system PemK/MazF family toxin
748 CALJVG010000031.1 GCA937974815_00383 CDS open 17974-18222 _na     82_aa hypothetical protein
749 CALJVG010000031.1 GCA937974815_00384 CDS open 18320-18853 _na     177_aa HXXEE domain-containing protein
750 CALJVG010000031.1 GCA937974815_00385 CDS open 18924-19727 _na     267_aa TetR/AcrR family transcriptional regulator
751 CALJVG010000031.1 GCA937974815_00386 CDS open 19823-21088 _na     421_aa hypothetical protein
752 CALJVG010000031.1 GCA937974815_00387 CDS open 21422-22708 _na     428_aa hypothetical protein
753 CALJVG010000031.1 GCA937974815_00388 CDS open 22984-23289 _na     101_aa hypothetical protein
754 CALJVG010000031.1 GCA937974815_00389 CDS open 23322-23654 _na     110_aa WXG100 family type VII secretion target
755 CALJVG010000031.1 GCA937974815_00390 CDS open 24138-24467 _na     109_aa ABC transporter permease
756 CALJVG010000031.1 GCA937974815_00391 CDS open 24464-25759 _na     431_aa eccD Type VII secretion integral membrane protein EccD
757 CALJVG010000031.1 GCA937974815_00392 CDS open 25927-26979 _na     350_aa hypothetical protein
758 CALJVG010000031.1 GCA937974815_00393 CDS open 26984-30943 _na     1319_aa Type VII secretion protein EccCa
759 CALJVG010000031.1 GCA937974815_00394 CDS open 31129-31581 _na     150_aa hypothetical protein
760 CALJVG010000031.1 GCA937974815_00395 CDS open 31578-32147 _na     189_aa Ankyrin repeat domain-containing protein
761 CALJVG010000031.1 GCA937974815_00396 CDS open 32305-32775 _na     156_aa hypothetical protein
762 CALJVG010000031.1 GCA937974815_00366 gene open 32-520
763 CALJVG010000031.1 GCA937974815_00367 gene open 531-1094
764 CALJVG010000031.1 GCA937974815_00368 gene open 1128-2942
765 CALJVG010000031.1 GCA937974815_00369 gene open 2939-3304
766 CALJVG010000031.1 GCA937974815_00370 gene open 3304-4137
767 CALJVG010000031.1 GCA937974815_00371 gene open 4134-4403 eutM
768 CALJVG010000031.1 GCA937974815_00372 gene open 4400-5227 eutJ
769 CALJVG010000031.1 GCA937974815_00373 gene open 5224-6084
770 CALJVG010000031.1 GCA937974815_00374 gene open 6105-7124
771 CALJVG010000031.1 GCA937974815_00375 gene open 7128-8573
772 CALJVG010000031.1 GCA937974815_00376 gene open 8577-9560
773 CALJVG010000031.1 GCA937974815_00377 gene open 9695-10912
774 CALJVG010000031.1 GCA937974815_00378 gene open 11222-14011
775 CALJVG010000031.1 GCA937974815_00379 gene open 14302-14808
776 CALJVG010000031.1 GCA937974815_00380 gene open 14844-16253
777 CALJVG010000031.1 GCA937974815_00381 gene open 16544-17431
778 CALJVG010000031.1 GCA937974815_00382 gene open 17654-17971
779 CALJVG010000031.1 GCA937974815_00383 gene open 17974-18222
780 CALJVG010000031.1 GCA937974815_00384 gene open 18320-18853
781 CALJVG010000031.1 GCA937974815_00385 gene open 18924-19727
782 CALJVG010000031.1 GCA937974815_00386 gene open 19823-21088
783 CALJVG010000031.1 GCA937974815_00387 gene open 21422-22708
784 CALJVG010000031.1 GCA937974815_00388 gene open 22984-23289
785 CALJVG010000031.1 GCA937974815_00389 gene open 23322-23654
786 CALJVG010000031.1 GCA937974815_00390 gene open 24138-24467
787 CALJVG010000031.1 GCA937974815_00391 gene open 24464-25759 eccD
788 CALJVG010000031.1 GCA937974815_00392 gene open 25927-26979
789 CALJVG010000031.1 GCA937974815_00393 gene open 26984-30943
790 CALJVG010000031.1 GCA937974815_00394 gene open 31129-31581
791 CALJVG010000031.1 GCA937974815_00395 gene open 31578-32147
792 CALJVG010000031.1 GCA937974815_00396 gene open 32305-32775
793 CALJVG010000032.1 repeat_region open 12709-14454 CRISPR array with 29 repeats of length 28%2C consensus sequence GTATTCCCCGCGAGAGCGGGGATGATCC and spacer length 33
794 CALJVG010000032.1 repeat_region open 14844-18542 CRISPR array with 43 repeats of length 28%2C consensus sequence GTATTCCCCGCGAGAGCGGGGATGATCC and spacer length 59
795 CALJVG010000032.1 repeat_region open 17406-18542 CRISPR array with 19 repeats of length 28%2C consensus sequence GTATTCCCCGCGAGAGCGGGGATGATCC and spacer length 33
796 CALJVG010000032.1 GCA937974815_00397 CDS open 223-519 _na     98_aa hypothetical protein
797 CALJVG010000032.1 GCA937974815_00398 CDS open 701-949 _na     82_aa hypothetical protein
798 CALJVG010000032.1 GCA937974815_00399 CDS open 1117-1614 _na     165_aa Flavodoxin-like domain-containing protein
799 CALJVG010000032.1 GCA937974815_00400 CDS open 1611-2048 _na     145_aa Rieske (2Fe-2S) protein
800 CALJVG010000032.1 GCA937974815_00401 CDS open 2143-3018 _na     291_aa HTH tetR-type domain-containing protein
801 CALJVG010000032.1 GCA937974815_00402 CDS open 3345-6356 _na     1003_aa CRISPR-associated helicase Cas3'
802 CALJVG010000032.1 GCA937974815_00403 CDS open 6343-8007 _na     554_aa casA type I-E CRISPR-associated protein Cse1/CasA
803 CALJVG010000032.1 GCA937974815_00404 CDS open 8004-8690 _na     228_aa casB type I-E CRISPR-associated protein Cse2/CasB
804 CALJVG010000032.1 GCA937974815_00405 CDS open 8710-9846 _na     378_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
805 CALJVG010000032.1 GCA937974815_00406 CDS open 9843-10574 _na     243_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
806 CALJVG010000032.1 GCA937974815_00407 CDS open 10574-11335 _na     253_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
807 CALJVG010000032.1 GCA937974815_00408 CDS open 11332-12285 _na     317_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
808 CALJVG010000032.1 GCA937974815_00409 CDS open 19071-19730 _na     219_aa hypothetical protein
809 CALJVG010000032.1 GCA937974815_00410 CDS open 19733-20335 _na     200_aa hypothetical protein
810 CALJVG010000032.1 GCA937974815_00411 CDS open 20325-20918 _na     197_aa cas1 CRISPR-associated endonuclease Cas1
811 CALJVG010000032.1 GCA937974815_00412 CDS open 20922-21206 _na     94_aa cas2 CRISPR-associated endonuclease Cas2
812 CALJVG010000032.1 GCA937974815_00413 CDS open 21637-22665 _na     342_aa czcD Cadmium%2C cobalt and zinc/H(+)-K(+) antiporter
813 CALJVG010000032.1 GCA937974815_00414 CDS open 22662-23012 _na     116_aa arsR HTH-type transcriptional regulator CmtR
814 CALJVG010000032.1 GCA937974815_00415 CDS open 23120-23884 _na     254_aa DUF364 domain-containing protein
815 CALJVG010000032.1 GCA937974815_00416 CDS open 23901-24356 _na     151_aa cupin domain-containing protein
816 CALJVG010000032.1 GCA937974815_00417 CDS open 24413-24850 _na     145_aa hypothetical protein
817 CALJVG010000032.1 GCA937974815_00418 CDS open 24917-25381 _na     154_aa hypothetical protein
818 CALJVG010000032.1 GCA937974815_00419 CDS open 25395-26864 _na     489_aa lysU Lysine--tRNA ligase
819 CALJVG010000032.1 GCA937974815_00420 CDS open 26957-27634 _na     225_aa HAD-IA family hydrolase
820 CALJVG010000032.1 GCA937974815_00421 CDS open 27638-27934 _na     98_aa crgA Cell division protein CrgA
821 CALJVG010000032.1 GCA937974815_00422 CDS open 28025-28792 _na     255_aa ylxW DUF881 domain-containing protein
822 CALJVG010000032.1 GCA937974815_00423 CDS open 29080-29799 _na     239_aa hypothetical protein
823 CALJVG010000032.1 GCA937974815_00424 CDS open 30203-30613 _na     136_aa hypothetical protein
824 CALJVG010000032.1 GCA937974815_00425 CDS open 30769-31410 _na     213_aa aminodeoxychorismate/anthranilate synthase component II
825 CALJVG010000032.1 GCA937974815_00426 CDS open 31551-33494 _na     647_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
826 CALJVG010000032.1 GCA937974815_00397 gene open 223-519
827 CALJVG010000032.1 GCA937974815_00398 gene open 701-949
828 CALJVG010000032.1 GCA937974815_00399 gene open 1117-1614
829 CALJVG010000032.1 GCA937974815_00400 gene open 1611-2048
830 CALJVG010000032.1 GCA937974815_00401 gene open 2143-3018
831 CALJVG010000032.1 GCA937974815_00402 gene open 3345-6356
832 CALJVG010000032.1 GCA937974815_00403 gene open 6343-8007 casA
833 CALJVG010000032.1 GCA937974815_00404 gene open 8004-8690 casB
834 CALJVG010000032.1 GCA937974815_00405 gene open 8710-9846 cas7e
835 CALJVG010000032.1 GCA937974815_00406 gene open 9843-10574 cas5e
836 CALJVG010000032.1 GCA937974815_00407 gene open 10574-11335 cas6e
837 CALJVG010000032.1 GCA937974815_00408 gene open 11332-12285 cas1e
838 CALJVG010000032.1 GCA937974815_00409 gene open 19071-19730
839 CALJVG010000032.1 GCA937974815_00410 gene open 19733-20335
840 CALJVG010000032.1 GCA937974815_00411 gene open 20325-20918 cas1
841 CALJVG010000032.1 GCA937974815_00412 gene open 20922-21206 cas2
842 CALJVG010000032.1 GCA937974815_00413 gene open 21637-22665 czcD
843 CALJVG010000032.1 GCA937974815_00414 gene open 22662-23012 arsR
844 CALJVG010000032.1 GCA937974815_00415 gene open 23120-23884
845 CALJVG010000032.1 GCA937974815_00416 gene open 23901-24356
846 CALJVG010000032.1 GCA937974815_00417 gene open 24413-24850
847 CALJVG010000032.1 GCA937974815_00418 gene open 24917-25381
848 CALJVG010000032.1 GCA937974815_00419 gene open 25395-26864 lysU
849 CALJVG010000032.1 GCA937974815_00420 gene open 26957-27634
850 CALJVG010000032.1 GCA937974815_00421 gene open 27638-27934 crgA
851 CALJVG010000032.1 GCA937974815_00422 gene open 28025-28792 ylxW
852 CALJVG010000032.1 GCA937974815_00423 gene open 29080-29799
853 CALJVG010000032.1 GCA937974815_00424 gene open 30203-30613
854 CALJVG010000032.1 GCA937974815_00425 gene open 30769-31410
855 CALJVG010000032.1 GCA937974815_00426 gene open 31551-33494 pknB
856 CALJVG010000033.1 GCA937974815_00427 CDS open 6-527 _na     173_aa hypothetical protein
857 CALJVG010000033.1 GCA937974815_00428 CDS open 831-1334 _na     167_aa NfeD-like C-terminal domain-containing protein
858 CALJVG010000033.1 GCA937974815_00429 CDS open 1355-2857 _na     500_aa yqiK Flotillin family protein
859 CALJVG010000033.1 GCA937974815_00430 CDS open 2915-4054 _na     379_aa 3-isopropylmalate dehydrogenase
860 CALJVG010000033.1 GCA937974815_00431 CDS open 4086-4889 _na     267_aa fumarylacetoacetate hydrolase family protein
861 CALJVG010000033.1 GCA937974815_00432 CDS open 4925-5770 _na     281_aa CPBP family intramembrane glutamic endopeptidase
862 CALJVG010000033.1 GCA937974815_00433 CDS open 5838-6755 _na     305_aa asparaginase
863 CALJVG010000033.1 GCA937974815_00434 CDS open 6767-6877 _na     36_aa hypothetical protein
864 CALJVG010000033.1 GCA937974815_00437 CDS open 7226-7951 _na     241_aa iclR IclR family transcriptional regulator
865 CALJVG010000033.1 GCA937974815_00438 CDS open 8052-9458 _na     468_aa leuC 3-isopropylmalate dehydratase large subunit
866 CALJVG010000033.1 GCA937974815_00439 CDS open 9461-10075 _na     204_aa 3-isopropylmalate dehydratase small subunit
867 CALJVG010000033.1 GCA937974815_00440 CDS open 10289-10894 _na     201_aa 1-acyl-sn-glycerol-3-phosphate acyltransferases
868 CALJVG010000033.1 GCA937974815_00441 CDS open 10898-11908 _na     336_aa Gfo/Idh/MocA family protein
869 CALJVG010000033.1 GCA937974815_00442 CDS open 12304-13323 _na     339_aa iron ABC transporter permease
870 CALJVG010000033.1 GCA937974815_00443 CDS open 13317-14120 _na     267_aa ABC transporter ATP-binding protein
871 CALJVG010000033.1 GCA937974815_00444 CDS open 14117-14866 _na     249_aa Rossmann-like domain-containing protein
872 CALJVG010000033.1 GCA937974815_00445 CDS open 14863-15795 _na     310_aa ABC transporter substrate-binding protein
873 CALJVG010000033.1 GCA937974815_00446 CDS open 15792-15962 _na     56_aa hypothetical protein
874 CALJVG010000033.1 GCA937974815_00447 CDS open 16020-17132 _na     370_aa D-alanine--D-alanine ligase family protein
875 CALJVG010000033.1 GCA937974815_00448 CDS open 17132-18055 _na     307_aa thiamine-phosphate kinase
876 CALJVG010000033.1 GCA937974815_00449 CDS open 18067-18279 _na     70_aa Mop domain-containing protein
877 CALJVG010000033.1 GCA937974815_00450 CDS open 18620-20884 _na     754_aa ftsK DNA translocase FtsK
878 CALJVG010000033.1 GCA937974815_00451 CDS open 20982-21572 _na     196_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
879 CALJVG010000033.1 GCA937974815_00452 CDS open 21584-22405 _na     273_aa glpR Glycerol-3-phosphate regulon repressor
880 CALJVG010000033.1 GCA937974815_00453 CDS open 22511-22705 _na     64_aa DUF3046 domain-containing protein
881 CALJVG010000033.1 GCA937974815_00454 CDS open 22891-23943 _na     350_aa recA recombinase RecA
882 CALJVG010000033.1 GCA937974815_00455 CDS open 23933-24451 _na     172_aa recX regulatory protein RecX
883 CALJVG010000033.1 GCA937974815_00456 CDS open 24613-26220 _na     535_aa rny ribonuclease Y
884 CALJVG010000033.1 GCA937974815_00457 CDS open 26235-27116 _na     293_aa aldose epimerase
885 CALJVG010000033.1 GCA937974815_00458 CDS open 27184-28650 _na     488_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
886 CALJVG010000033.1 GCA937974815_00459 CDS open 28836-29024 _na     62_aa antitoxin
887 CALJVG010000033.1 GCA937974815_00460 CDS open 29111-30037 _na     308_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
888 CALJVG010000033.1 GCA937974815_00461 CDS open 30067-30891 _na     274_aa dapF diaminopimelate epimerase
889 CALJVG010000033.1 GCA937974815_00462 CDS open 30930-32324 _na     464_aa hflX GTPase HflX
890 CALJVG010000033.1 GCA937974815_00463 CDS open 32947-33432 _na     161_aa hypothetical protein
891 CALJVG010000033.1 GCA937974815_00427 gene open 6-527
892 CALJVG010000033.1 GCA937974815_00428 gene open 831-1334
893 CALJVG010000033.1 GCA937974815_00429 gene open 1355-2857 yqiK
894 CALJVG010000033.1 GCA937974815_00430 gene open 2915-4054
895 CALJVG010000033.1 GCA937974815_00431 gene open 4086-4889
896 CALJVG010000033.1 GCA937974815_00432 gene open 4925-5770
897 CALJVG010000033.1 GCA937974815_00433 gene open 5838-6755
898 CALJVG010000033.1 GCA937974815_00434 gene open 6767-6877
899 CALJVG010000033.1 GCA937974815_00437 gene open 7226-7951 iclR
900 CALJVG010000033.1 GCA937974815_00438 gene open 8052-9458 leuC
901 CALJVG010000033.1 GCA937974815_00439 gene open 9461-10075
902 CALJVG010000033.1 GCA937974815_00440 gene open 10289-10894
903 CALJVG010000033.1 GCA937974815_00441 gene open 10898-11908
904 CALJVG010000033.1 GCA937974815_00442 gene open 12304-13323
905 CALJVG010000033.1 GCA937974815_00443 gene open 13317-14120
906 CALJVG010000033.1 GCA937974815_00444 gene open 14117-14866
907 CALJVG010000033.1 GCA937974815_00445 gene open 14863-15795
908 CALJVG010000033.1 GCA937974815_00446 gene open 15792-15962
909 CALJVG010000033.1 GCA937974815_00447 gene open 16020-17132
910 CALJVG010000033.1 GCA937974815_00448 gene open 17132-18055
911 CALJVG010000033.1 GCA937974815_00449 gene open 18067-18279
912 CALJVG010000033.1 GCA937974815_00450 gene open 18620-20884 ftsK
913 CALJVG010000033.1 GCA937974815_00451 gene open 20982-21572 pgsA
914 CALJVG010000033.1 GCA937974815_00452 gene open 21584-22405 glpR
915 CALJVG010000033.1 GCA937974815_00453 gene open 22511-22705
916 CALJVG010000033.1 GCA937974815_00454 gene open 22891-23943 recA
917 CALJVG010000033.1 GCA937974815_00455 gene open 23933-24451 recX
918 CALJVG010000033.1 GCA937974815_00456 gene open 24613-26220 rny
919 CALJVG010000033.1 GCA937974815_00457 gene open 26235-27116
920 CALJVG010000033.1 GCA937974815_00458 gene open 27184-28650 miaB
921 CALJVG010000033.1 GCA937974815_00459 gene open 28836-29024
922 CALJVG010000033.1 GCA937974815_00460 gene open 29111-30037 miaA
923 CALJVG010000033.1 GCA937974815_00461 gene open 30067-30891 dapF
924 CALJVG010000033.1 GCA937974815_00462 gene open 30930-32324 hflX
925 CALJVG010000033.1 GCA937974815_00463 gene open 32947-33432
926 CALJVG010000033.1 GCA937974815_00435 gene open 6921-6992 trnQ
927 CALJVG010000033.1 GCA937974815_00436 gene open 7030-7105 trnE
928 CALJVG010000033.1 GCA937974815_00435 tRNA open 6921-6992 trnQ tRNA-Gln(ctg)
929 CALJVG010000033.1 GCA937974815_00436 tRNA open 7030-7105 trnE tRNA-Glu(ctc)
930 CALJVG010000034.1 regulatory_region open 1165-1261 TPP riboswitch aptamer (THI element)
931 CALJVG010000034.1 GCA937974815_00464 CDS open 379-1176 _na     265_aa thiM hydroxyethylthiazole kinase
932 CALJVG010000034.1 GCA937974815_00465 CDS open 1173-1334 _na     53_aa hypothetical protein
933 CALJVG010000034.1 GCA937974815_00466 CDS open 1430-4642 _na     1070_aa S8 family serine peptidase
934 CALJVG010000034.1 GCA937974815_00467 CDS open 4691-6211 _na     506_aa DUF2397 domain-containing protein
935 CALJVG010000034.1 GCA937974815_00468 CDS open 6208-7323 _na     371_aa TIGR02678 family protein
936 CALJVG010000034.1 GCA937974815_00469 CDS open 7323-11384 _na     1353_aa SbcC/MukB-like Walker B domain-containing protein
937 CALJVG010000034.1 GCA937974815_00470 CDS open 11535-13406 _na     623_aa pepCK phosphoenolpyruvate carboxykinase (GTP)
938 CALJVG010000034.1 GCA937974815_00471 CDS open 13635-16205 _na     856_aa clpB ATP-dependent chaperone ClpB
939 CALJVG010000034.1 GCA937974815_00472 CDS open 16310-17302 _na     330_aa Lrp/AsnC family transcriptional regulator
940 CALJVG010000034.1 GCA937974815_00473 CDS open 17696-18739 _na     347_aa ord 2%2C4-diaminopentanoate dehydrogenase
941 CALJVG010000034.1 GCA937974815_00474 CDS open 18770-19063 _na     97_aa ortA 2-amino-4-oxopentanoate thiolase subunit OrtA
942 CALJVG010000034.1 GCA937974815_00475 CDS open 19060-20451 _na     463_aa ortB 2-amino-4-oxopentanoate thiolase subunit OrtB
943 CALJVG010000034.1 GCA937974815_00476 CDS open 20467-20853 _na     128_aa D-Lysine 5%2C6-aminomutase alpha subunit domain-containing protein
944 CALJVG010000034.1 GCA937974815_00477 CDS open 20859-23072 _na     737_aa oraE D-ornithine 4%2C5-aminomutase subunit OraE
945 CALJVG010000034.1 GCA937974815_00478 CDS open 23077-24432 _na     451_aa Methylaspartate mutase
946 CALJVG010000034.1 GCA937974815_00479 CDS open 24429-25511 _na     360_aa alanine racemase
947 CALJVG010000034.1 GCA937974815_00480 CDS open 25557-26996 _na     479_aa amino acid permease
948 CALJVG010000034.1 GCA937974815_00481 CDS open 27071-28480 _na     469_aa NAD(P)/FAD-dependent oxidoreductase
949 CALJVG010000034.1 GCA937974815_00482 CDS open 28493-29806 _na     437_aa MATE family efflux transporter
950 CALJVG010000034.1 GCA937974815_00483 CDS open 29901-33497 _na     1198_aa WD40 repeat domain-containing protein
951 CALJVG010000034.1 GCA937974815_00484 CDS open 33780-39857 _na     2025_aa Ig-like domain-containing protein
952 CALJVG010000034.1 GCA937974815_00485 CDS open 39891-40862 _na     323_aa mMP0363 MoxR family ATPase
953 CALJVG010000034.1 GCA937974815_00486 CDS open 40916-42088 _na     390_aa DUF58 domain-containing protein
954 CALJVG010000034.1 GCA937974815_00487 CDS open 42085-44430 _na     781_aa transglutaminase domain-containing protein
955 CALJVG010000034.1 GCA937974815_00488 CDS open 44441-45988 _na     515_aa FHA domain-containing protein
956 CALJVG010000034.1 GCA937974815_00489 CDS open 46000-46788 _na     262_aa PP2C family serine/threonine-protein phosphatase
957 CALJVG010000034.1 GCA937974815_00490 CDS open 46788-47888 _na     366_aa FHA domain-containing protein
958 CALJVG010000034.1 GCA937974815_00491 CDS open 47888-49471 _na     527_aa serine/threonine-protein kinase
959 CALJVG010000034.1 GCA937974815_00492 CDS open 50112-50876 _na     254_aa spermidine synthase
960 CALJVG010000034.1 GCA937974815_00493 CDS open 50876-51454 _na     192_aa orotate phosphoribosyltransferase
961 CALJVG010000034.1 GCA937974815_00494 CDS open 51526-52140 _na     204_aa lemA LemA family protein
962 CALJVG010000034.1 GCA937974815_00495 CDS open 52202-53125 _na     307_aa DUF368 domain-containing protein
963 CALJVG010000034.1 GCA937974815_00496 CDS open 53122-53748 _na     208_aa trmH TrmH family RNA methyltransferase
964 CALJVG010000034.1 GCA937974815_00497 CDS open 53889-54461 _na     190_aa DUF304 domain-containing protein
965 CALJVG010000034.1 GCA937974815_00498 CDS open 54636-55763 _na     375_aa radical SAM protein
966 CALJVG010000034.1 GCA937974815_00499 CDS open 55760-56446 _na     228_aa radical SAM protein
967 CALJVG010000034.1 GCA937974815_00500 CDS open 56443-57279 _na     278_aa hypothetical protein
968 CALJVG010000034.1 GCA937974815_00501 CDS open 57400-58419 _na     339_aa fbaA class II fructose-bisphosphate aldolase
969 CALJVG010000034.1 GCA937974815_00502 CDS open 58700-60217 _na     505_aa sugar ABC transporter ATP-binding protein
970 CALJVG010000034.1 GCA937974815_00503 CDS open 60214-61212 _na     332_aa ABC transporter permease
971 CALJVG010000034.1 GCA937974815_00504 CDS open 61268-62299 _na     343_aa ABC transporter substrate-binding protein
972 CALJVG010000034.1 GCA937974815_00505 CDS open 62438-64201 _na     587_aa fucI L-fucose isomerase
973 CALJVG010000034.1 GCA937974815_00506 CDS open 64341-65738 _na     465_aa rhamnulokinase family protein
974 CALJVG010000034.1 GCA937974815_00507 CDS open 65735-66724 _na     329_aa lacI LacI family DNA-binding transcriptional regulator
975 CALJVG010000034.1 GCA937974815_00508 CDS open 66726-67169 _na     147_aa fucU RbsD / FucU transport protein family
976 CALJVG010000034.1 GCA937974815_00509 CDS open 67486-68769 _na     427_aa hypothetical protein
977 CALJVG010000034.1 GCA937974815_00510 CDS open 69179-69460 _na     93_aa Transposase Helix-turn-helix domain-containing protein
978 CALJVG010000034.1 GCA937974815_00511 CDS open 69833-70432 _na     199_aa hypothetical protein
979 CALJVG010000034.1 GCA937974815_00464 gene open 379-1176 thiM
980 CALJVG010000034.1 GCA937974815_00465 gene open 1173-1334
981 CALJVG010000034.1 GCA937974815_00466 gene open 1430-4642
982 CALJVG010000034.1 GCA937974815_00467 gene open 4691-6211
983 CALJVG010000034.1 GCA937974815_00468 gene open 6208-7323
984 CALJVG010000034.1 GCA937974815_00469 gene open 7323-11384
985 CALJVG010000034.1 GCA937974815_00470 gene open 11535-13406 pepCK
986 CALJVG010000034.1 GCA937974815_00471 gene open 13635-16205 clpB
987 CALJVG010000034.1 GCA937974815_00472 gene open 16310-17302
988 CALJVG010000034.1 GCA937974815_00473 gene open 17696-18739 ord
989 CALJVG010000034.1 GCA937974815_00474 gene open 18770-19063 ortA
990 CALJVG010000034.1 GCA937974815_00475 gene open 19060-20451 ortB
991 CALJVG010000034.1 GCA937974815_00476 gene open 20467-20853
992 CALJVG010000034.1 GCA937974815_00477 gene open 20859-23072 oraE
993 CALJVG010000034.1 GCA937974815_00478 gene open 23077-24432
994 CALJVG010000034.1 GCA937974815_00479 gene open 24429-25511
995 CALJVG010000034.1 GCA937974815_00480 gene open 25557-26996
996 CALJVG010000034.1 GCA937974815_00481 gene open 27071-28480
997 CALJVG010000034.1 GCA937974815_00482 gene open 28493-29806
998 CALJVG010000034.1 GCA937974815_00483 gene open 29901-33497
999 CALJVG010000034.1 GCA937974815_00484 gene open 33780-39857
1000 CALJVG010000034.1 GCA937974815_00485 gene open 39891-40862 mMP0363