HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Arachnia rubra (GCA_937974815.1)

Select a Genome:
BAKTA Annotations for GCA_937974815.1
Genome Selected: Arachnia rubra
ContigsBases CDSrRNA tmRNAtRNA
223 3200054 2964 1 2 46
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 6050 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 6050 [13 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  11  12  13  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CALJVG010000074.1 GCA937974815_00997 CDS open 55-1704 _na     549_aa PQQ-binding-like beta-propeller repeat protein
2002 CALJVG010000074.1 GCA937974815_00998 CDS open 1712-3424 _na     570_aa hypothetical protein
2003 CALJVG010000074.1 GCA937974815_00999 CDS open 3513-4088 _na     191_aa TetR/AcrR family transcriptional regulator
2004 CALJVG010000074.1 GCA937974815_01000 CDS open 4162-4950 _na     262_aa SDR family oxidoreductase
2005 CALJVG010000074.1 GCA937974815_01001 CDS open 4976-5299 _na     107_aa helix-turn-helix transcriptional regulator
2006 CALJVG010000074.1 GCA937974815_01002 CDS open 5465-6652 _na     395_aa MFS transporter
2007 CALJVG010000074.1 GCA937974815_01003 CDS open 6655-7398 _na     247_aa helical backbone metal receptor
2008 CALJVG010000074.1 GCA937974815_01004 CDS open 7431-8345 _na     304_aa hypothetical protein
2009 CALJVG010000074.1 GCA937974815_01005 CDS open 8426-8977 _na     183_aa TetR/AcrR family transcriptional regulator
2010 CALJVG010000074.1 GCA937974815_01006 CDS open 9057-9788 _na     243_aa SDR family oxidoreductase
2011 CALJVG010000074.1 GCA937974815_01007 CDS open 10001-10591 _na     196_aa nifU NifU family protein
2012 CALJVG010000074.1 GCA937974815_01008 CDS open 10588-12525 _na     645_aa feoB ferrous iron transport protein B
2013 CALJVG010000074.1 GCA937974815_01009 CDS open 12522-12770 _na     82_aa feoA FeoA family protein
2014 CALJVG010000074.1 GCA937974815_01010 CDS open 12892-13485 _na     197_aa hypothetical protein
2015 CALJVG010000074.1 GCA937974815_01011 CDS open 13602-13955 _na     117_aa hypothetical protein
2016 CALJVG010000074.1 GCA937974815_00997 gene open 55-1704
2017 CALJVG010000074.1 GCA937974815_00998 gene open 1712-3424
2018 CALJVG010000074.1 GCA937974815_00999 gene open 3513-4088
2019 CALJVG010000074.1 GCA937974815_01000 gene open 4162-4950
2020 CALJVG010000074.1 GCA937974815_01001 gene open 4976-5299
2021 CALJVG010000074.1 GCA937974815_01002 gene open 5465-6652
2022 CALJVG010000074.1 GCA937974815_01003 gene open 6655-7398
2023 CALJVG010000074.1 GCA937974815_01004 gene open 7431-8345
2024 CALJVG010000074.1 GCA937974815_01005 gene open 8426-8977
2025 CALJVG010000074.1 GCA937974815_01006 gene open 9057-9788
2026 CALJVG010000074.1 GCA937974815_01007 gene open 10001-10591 nifU
2027 CALJVG010000074.1 GCA937974815_01008 gene open 10588-12525 feoB
2028 CALJVG010000074.1 GCA937974815_01009 gene open 12522-12770 feoA
2029 CALJVG010000074.1 GCA937974815_01010 gene open 12892-13485
2030 CALJVG010000074.1 GCA937974815_01011 gene open 13602-13955
2031 CALJVG010000075.1 GCA937974815_01012 CDS open 49-1116 _na     355_aa alkene reductase
2032 CALJVG010000075.1 GCA937974815_01012 gene open 49-1116
2033 CALJVG010000076.1 GCA937974815_01013 CDS open 751-1659 _na     302_aa putative tRNA-dihydrouridine synthase
2034 CALJVG010000076.1 GCA937974815_01013 gene open 751-1659
2035 CALJVG010000077.1 GCA937974815_01014 CDS open 170-739 _na     189_aa dTDP-4-dehydrorhamnose 3%2C5-epimerase family protein
2036 CALJVG010000077.1 GCA937974815_01015 CDS open 790-1809 _na     339_aa NAD(P)-dependent oxidoreductase
2037 CALJVG010000077.1 GCA937974815_01016 CDS open 1806-2477 _na     223_aa PIG-L deacetylase family protein
2038 CALJVG010000077.1 GCA937974815_01017 CDS open 2447-3184 _na     245_aa glucose-1-phosphate cytidylyltransferase
2039 CALJVG010000077.1 GCA937974815_01018 CDS open 3181-4425 _na     414_aa class I SAM-dependent methyltransferase
2040 CALJVG010000077.1 GCA937974815_01019 CDS open 4441-5427 _na     328_aa glycosyltransferase family 2 protein
2041 CALJVG010000077.1 GCA937974815_01020 CDS open 5442-6317 _na     291_aa glycosyltransferase family 2 protein
2042 CALJVG010000077.1 GCA937974815_01021 CDS open 7027-8328 _na     433_aa alpha-L-fucosidase
2043 CALJVG010000077.1 GCA937974815_01022 CDS open 8318-9160 _na     280_aa ugpE Inner membrane ABC transporter permease protein ycjP
2044 CALJVG010000077.1 GCA937974815_01023 CDS open 9150-10043 _na     297_aa ugpA Inner membrane ABC transporter permease protein ycjO
2045 CALJVG010000077.1 GCA937974815_01024 CDS open 10087-11313 _na     408_aa ugpB Maltodextrin-binding protein mdxE
2046 CALJVG010000077.1 GCA937974815_01025 CDS open 12035-12760 _na     241_aa hypothetical protein
2047 CALJVG010000077.1 GCA937974815_01026 CDS open 13382-13606 _na     74_aa hypothetical protein
2048 CALJVG010000077.1 GCA937974815_01027 CDS open 13665-14198 _na     177_aa hypothetical protein
2049 CALJVG010000077.1 GCA937974815_01028 CDS open 14397-14594 _na     65_aa hypothetical protein
2050 CALJVG010000077.1 GCA937974815_01029 CDS open 15007-15825 _na     272_aa class I SAM-dependent methyltransferase
2051 CALJVG010000077.1 GCA937974815_01030 CDS open 15936-16295 _na     119_aa hypothetical protein
2052 CALJVG010000077.1 GCA937974815_01031 CDS open 16445-17212 _na     255_aa ABC transporter ATP-binding protein
2053 CALJVG010000077.1 GCA937974815_01032 CDS open 17222-19636 _na     804_aa FtsX-like permease family protein
2054 CALJVG010000077.1 GCA937974815_01033 CDS open 19694-19783 _na     29_aa hypothetical protein
2055 CALJVG010000077.1 GCA937974815_01034 CDS open 20113-20268 _na     51_aa hypothetical protein
2056 CALJVG010000077.1 GCA937974815_01035 CDS open 20433-21272 _na     279_aa hypothetical protein
2057 CALJVG010000077.1 GCA937974815_01036 CDS open 21265-22152 _na     295_aa ATP-binding cassette domain-containing protein
2058 CALJVG010000077.1 GCA937974815_01037 CDS open 22145-22786 _na     213_aa ATP-binding cassette domain-containing protein
2059 CALJVG010000077.1 GCA937974815_01038 CDS open 22783-24198 _na     471_aa hypothetical protein
2060 CALJVG010000077.1 GCA937974815_01039 CDS open 24257-24622 _na     121_aa hypothetical protein
2061 CALJVG010000077.1 GCA937974815_01014 gene open 170-739
2062 CALJVG010000077.1 GCA937974815_01015 gene open 790-1809
2063 CALJVG010000077.1 GCA937974815_01016 gene open 1806-2477
2064 CALJVG010000077.1 GCA937974815_01017 gene open 2447-3184
2065 CALJVG010000077.1 GCA937974815_01018 gene open 3181-4425
2066 CALJVG010000077.1 GCA937974815_01019 gene open 4441-5427
2067 CALJVG010000077.1 GCA937974815_01020 gene open 5442-6317
2068 CALJVG010000077.1 GCA937974815_01021 gene open 7027-8328
2069 CALJVG010000077.1 GCA937974815_01022 gene open 8318-9160 ugpE
2070 CALJVG010000077.1 GCA937974815_01023 gene open 9150-10043 ugpA
2071 CALJVG010000077.1 GCA937974815_01024 gene open 10087-11313 ugpB
2072 CALJVG010000077.1 GCA937974815_01025 gene open 12035-12760
2073 CALJVG010000077.1 GCA937974815_01026 gene open 13382-13606
2074 CALJVG010000077.1 GCA937974815_01027 gene open 13665-14198
2075 CALJVG010000077.1 GCA937974815_01028 gene open 14397-14594
2076 CALJVG010000077.1 GCA937974815_01029 gene open 15007-15825
2077 CALJVG010000077.1 GCA937974815_01030 gene open 15936-16295
2078 CALJVG010000077.1 GCA937974815_01031 gene open 16445-17212
2079 CALJVG010000077.1 GCA937974815_01032 gene open 17222-19636
2080 CALJVG010000077.1 GCA937974815_01033 gene open 19694-19783
2081 CALJVG010000077.1 GCA937974815_01034 gene open 20113-20268
2082 CALJVG010000077.1 GCA937974815_01035 gene open 20433-21272
2083 CALJVG010000077.1 GCA937974815_01036 gene open 21265-22152
2084 CALJVG010000077.1 GCA937974815_01037 gene open 22145-22786
2085 CALJVG010000077.1 GCA937974815_01038 gene open 22783-24198
2086 CALJVG010000077.1 GCA937974815_01039 gene open 24257-24622
2087 CALJVG010000078.1 repeat_region open 234-3449 CRISPR array with 53 repeats of length 28%2C consensus sequence GGTTCATCCCCACTCGCGCGGGGAAAAT and spacer length 33
2088 CALJVG010000078.1 GCA937974815_01040 CDS open 3863-4816 _na     317_aa CRISPR-associated endonuclease Cas1
2089 CALJVG010000078.1 GCA937974815_01041 CDS open 4813-5589 _na     258_aa Cse3 family CRISPR-associated protein
2090 CALJVG010000078.1 GCA937974815_01042 CDS open 5589-6314 _na     241_aa Type I-E CRISPR-associated protein Cas5/CasD
2091 CALJVG010000078.1 GCA937974815_01043 CDS open 6311-7447 _na     378_aa Cse4 family CRISPR-associated protein
2092 CALJVG010000078.1 GCA937974815_01044 CDS open 7462-8148 _na     228_aa type I-E CRISPR-associated protein Cse2/CasB
2093 CALJVG010000078.1 GCA937974815_01045 CDS open 8145-9839 _na     564_aa Cse1 family CRISPR-associated protein
2094 CALJVG010000078.1 GCA937974815_01046 CDS open 9836-12850 _na     1004_aa casA CRISPR-associated endonuclease/helicase Cas3/CRISPR system Cascade subunit CasA
2095 CALJVG010000078.1 GCA937974815_01047 CDS open 12956-13300 _na     114_aa hypothetical protein
2096 CALJVG010000078.1 GCA937974815_01048 CDS open 13317-13904 _na     195_aa TetR/AcrR family transcriptional regulator
2097 CALJVG010000078.1 GCA937974815_01049 CDS open 13901-15643 _na     580_aa ABC transporter ATP-binding protein
2098 CALJVG010000078.1 GCA937974815_01050 CDS open 15640-17619 _na     659_aa ABC transporter ATP-binding protein
2099 CALJVG010000078.1 GCA937974815_01051 CDS open 17688-19205 _na     505_aa nhaP2 potassium/proton antiporter
2100 CALJVG010000078.1 GCA937974815_01052 CDS open 19263-19724 _na     153_aa hypothetical protein
2101 CALJVG010000078.1 GCA937974815_01053 CDS open 19728-20111 _na     127_aa hypothetical protein
2102 CALJVG010000078.1 GCA937974815_01055 CDS open 20393-21268 _na     291_aa fliL flagellar basal body-associated protein FliL
2103 CALJVG010000078.1 GCA937974815_01056 CDS open 21411-21872 _na     153_aa hypothetical protein
2104 CALJVG010000078.1 GCA937974815_01057 CDS open 21970-22659 _na     229_aa hypothetical protein
2105 CALJVG010000078.1 GCA937974815_01058 CDS open 22748-23959 _na     403_aa glycosyltransferase
2106 CALJVG010000078.1 GCA937974815_01059 CDS open 23956-24699 _na     247_aa PIG-L family deacetylase
2107 CALJVG010000078.1 GCA937974815_01040 gene open 3863-4816
2108 CALJVG010000078.1 GCA937974815_01041 gene open 4813-5589
2109 CALJVG010000078.1 GCA937974815_01042 gene open 5589-6314
2110 CALJVG010000078.1 GCA937974815_01043 gene open 6311-7447
2111 CALJVG010000078.1 GCA937974815_01044 gene open 7462-8148
2112 CALJVG010000078.1 GCA937974815_01045 gene open 8145-9839
2113 CALJVG010000078.1 GCA937974815_01046 gene open 9836-12850 casA
2114 CALJVG010000078.1 GCA937974815_01047 gene open 12956-13300
2115 CALJVG010000078.1 GCA937974815_01048 gene open 13317-13904
2116 CALJVG010000078.1 GCA937974815_01049 gene open 13901-15643
2117 CALJVG010000078.1 GCA937974815_01050 gene open 15640-17619
2118 CALJVG010000078.1 GCA937974815_01051 gene open 17688-19205 nhaP2
2119 CALJVG010000078.1 GCA937974815_01052 gene open 19263-19724
2120 CALJVG010000078.1 GCA937974815_01053 gene open 19728-20111
2121 CALJVG010000078.1 GCA937974815_01055 gene open 20393-21268 fliL
2122 CALJVG010000078.1 GCA937974815_01056 gene open 21411-21872
2123 CALJVG010000078.1 GCA937974815_01057 gene open 21970-22659
2124 CALJVG010000078.1 GCA937974815_01058 gene open 22748-23959
2125 CALJVG010000078.1 GCA937974815_01059 gene open 23956-24699
2126 CALJVG010000078.1 GCA937974815_01054 gene open 20213-20295 trnL
2127 CALJVG010000078.1 GCA937974815_01054 tRNA open 20213-20295 trnL tRNA-Leu(cag)
2128 CALJVG010000079.1 GCA937974815_01060 CDS open 15-545 _na     176_aa MFS transporter
2129 CALJVG010000079.1 GCA937974815_01061 CDS open 665-1153 _na     162_aa diadenosine tetraphosphate hydrolase
2130 CALJVG010000079.1 GCA937974815_01062 CDS open 1779-2345 _na     188_aa CAP domain-containing protein
2131 CALJVG010000079.1 GCA937974815_01063 CDS open 2513-3988 _na     491_aa MFS transporter
2132 CALJVG010000079.1 GCA937974815_01064 CDS open 3985-4557 _na     190_aa TetR/AcrR family transcriptional regulator
2133 CALJVG010000079.1 GCA937974815_01065 CDS open 4639-4947 _na     102_aa DUF2316 domain-containing protein
2134 CALJVG010000079.1 GCA937974815_01066 CDS open 5018-5356 _na     112_aa Carboxymuconolactone decarboxylase-like domain-containing protein
2135 CALJVG010000079.1 GCA937974815_01067 CDS open 5356-5781 _na     141_aa cupin domain-containing protein
2136 CALJVG010000079.1 GCA937974815_01068 CDS open 5794-6114 _na     106_aa putative quinol monooxygenase
2137 CALJVG010000079.1 GCA937974815_01069 CDS open 6279-9437 _na     1052_aa bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase
2138 CALJVG010000079.1 GCA937974815_01070 CDS open 9832-10071 _na     79_aa hypothetical protein
2139 CALJVG010000079.1 GCA937974815_01071 CDS open 10717-12210 _na     497_aa glutamine synthetase family protein
2140 CALJVG010000079.1 GCA937974815_01072 CDS open 12283-13122 _na     279_aa hypothetical protein
2141 CALJVG010000079.1 GCA937974815_01073 CDS open 13476-13871 _na     131_aa sdpI SdpI family protein
2142 CALJVG010000079.1 GCA937974815_01074 CDS open 14035-14694 _na     219_aa Lipoprotein
2143 CALJVG010000079.1 GCA937974815_01075 CDS open 14864-16564 _na     566_aa sfcA NAD-dependent malic enzyme
2144 CALJVG010000079.1 GCA937974815_01076 CDS open 16761-17102 _na     113_aa Imm51 family immunity protein
2145 CALJVG010000079.1 GCA937974815_01077 CDS open 17198-18244 _na     348_aa glycoside hydrolase family 76 protein
2146 CALJVG010000079.1 GCA937974815_01078 CDS open 18466-18672 _na     68_aa Antitoxin VapB32
2147 CALJVG010000079.1 GCA937974815_01079 CDS open 18669-19031 _na     120_aa vapC type II toxin-antitoxin system VapC family toxin
2148 CALJVG010000079.1 GCA937974815_01080 CDS open 19118-19963 _na     281_aa carbohydrate ABC transporter permease
2149 CALJVG010000079.1 GCA937974815_01081 CDS open 19956-20894 _na     312_aa carbohydrate ABC transporter permease
2150 CALJVG010000079.1 GCA937974815_01082 CDS open 20900-22162 _na     420_aa sugar ABC transporter substrate-binding protein
2151 CALJVG010000079.1 GCA937974815_01083 CDS open 22186-24471 _na     761_aa ROK family protein
2152 CALJVG010000079.1 GCA937974815_01060 gene open 15-545
2153 CALJVG010000079.1 GCA937974815_01061 gene open 665-1153
2154 CALJVG010000079.1 GCA937974815_01062 gene open 1779-2345
2155 CALJVG010000079.1 GCA937974815_01063 gene open 2513-3988
2156 CALJVG010000079.1 GCA937974815_01064 gene open 3985-4557
2157 CALJVG010000079.1 GCA937974815_01065 gene open 4639-4947
2158 CALJVG010000079.1 GCA937974815_01066 gene open 5018-5356
2159 CALJVG010000079.1 GCA937974815_01067 gene open 5356-5781
2160 CALJVG010000079.1 GCA937974815_01068 gene open 5794-6114
2161 CALJVG010000079.1 GCA937974815_01069 gene open 6279-9437
2162 CALJVG010000079.1 GCA937974815_01070 gene open 9832-10071
2163 CALJVG010000079.1 GCA937974815_01071 gene open 10717-12210
2164 CALJVG010000079.1 GCA937974815_01072 gene open 12283-13122
2165 CALJVG010000079.1 GCA937974815_01073 gene open 13476-13871 sdpI
2166 CALJVG010000079.1 GCA937974815_01074 gene open 14035-14694
2167 CALJVG010000079.1 GCA937974815_01075 gene open 14864-16564 sfcA
2168 CALJVG010000079.1 GCA937974815_01076 gene open 16761-17102
2169 CALJVG010000079.1 GCA937974815_01077 gene open 17198-18244
2170 CALJVG010000079.1 GCA937974815_01078 gene open 18466-18672
2171 CALJVG010000079.1 GCA937974815_01079 gene open 18669-19031 vapC
2172 CALJVG010000079.1 GCA937974815_01080 gene open 19118-19963
2173 CALJVG010000079.1 GCA937974815_01081 gene open 19956-20894
2174 CALJVG010000079.1 GCA937974815_01082 gene open 20900-22162
2175 CALJVG010000079.1 GCA937974815_01083 gene open 22186-24471
2176 CALJVG010000080.1 GCA937974815_01084 CDS open 299-553 _na     84_aa hypothetical protein
2177 CALJVG010000080.1 GCA937974815_01085 CDS open 568-1254 _na     228_aa ftsE cell division ATP-binding protein FtsE
2178 CALJVG010000080.1 GCA937974815_01086 CDS open 1375-2490 _na     371_aa prfB peptide chain release factor 2
2179 CALJVG010000080.1 GCA937974815_01087 CDS open 2562-3029 _na     155_aa GatB/YqeY domain-containing protein
2180 CALJVG010000080.1 GCA937974815_01089 CDS open 3293-4507 _na     404_aa hypothetical protein
2181 CALJVG010000080.1 GCA937974815_01090 CDS open 4529-6742 _na     737_aa 6-phosphofructokinase
2182 CALJVG010000080.1 GCA937974815_01091 CDS open 6768-7151 _na     127_aa DUF3052 domain-containing protein
2183 CALJVG010000080.1 GCA937974815_01092 CDS open 7274-10036 _na     920_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
2184 CALJVG010000080.1 GCA937974815_01093 CDS open 10181-11581 _na     466_aa ABC transporter substrate-binding protein
2185 CALJVG010000080.1 GCA937974815_01094 CDS open 11916-13106 _na     396_aa cdaR CdaR family transcriptional regulator
2186 CALJVG010000080.1 GCA937974815_01095 CDS open 13221-14150 _na     309_aa ACP S-malonyltransferase
2187 CALJVG010000080.1 GCA937974815_01096 CDS open 14194-15189 _na     331_aa beta-ketoacyl-ACP synthase III
2188 CALJVG010000080.1 GCA937974815_01097 CDS open 15228-15473 _na     81_aa acyl carrier protein
2189 CALJVG010000080.1 GCA937974815_01098 CDS open 15553-16809 _na     418_aa fabB 3-oxoacyl-[acyl-carrier-protein] synthase 1
2190 CALJVG010000080.1 GCA937974815_01099 CDS open 16982-17506 _na     174_aa DUF3145 domain-containing protein
2191 CALJVG010000080.1 GCA937974815_01100 CDS open 17637-19496 _na     619_aa S9 family peptidase
2192 CALJVG010000080.1 GCA937974815_01101 CDS open 19551-20516 _na     321_aa VWA domain-containing protein
2193 CALJVG010000080.1 GCA937974815_01102 CDS open 20513-21475 _na     320_aa VWA domain-containing protein
2194 CALJVG010000080.1 GCA937974815_01103 CDS open 21475-22530 _na     351_aa mMP0362 DUF58 domain-containing protein
2195 CALJVG010000080.1 GCA937974815_01104 CDS open 22541-23602 _na     353_aa moxR MoxR family ATPase
2196 CALJVG010000080.1 GCA937974815_01105 CDS open 23735-24565 _na     276_aa hypothetical protein
2197 CALJVG010000080.1 GCA937974815_01084 gene open 299-553
2198 CALJVG010000080.1 GCA937974815_01085 gene open 568-1254 ftsE
2199 CALJVG010000080.1 GCA937974815_01086 gene open 1375-2490 prfB
2200 CALJVG010000080.1 GCA937974815_01087 gene open 2562-3029
2201 CALJVG010000080.1 GCA937974815_01089 gene open 3293-4507
2202 CALJVG010000080.1 GCA937974815_01090 gene open 4529-6742
2203 CALJVG010000080.1 GCA937974815_01091 gene open 6768-7151
2204 CALJVG010000080.1 GCA937974815_01092 gene open 7274-10036 aceE
2205 CALJVG010000080.1 GCA937974815_01093 gene open 10181-11581
2206 CALJVG010000080.1 GCA937974815_01094 gene open 11916-13106 cdaR
2207 CALJVG010000080.1 GCA937974815_01095 gene open 13221-14150
2208 CALJVG010000080.1 GCA937974815_01096 gene open 14194-15189
2209 CALJVG010000080.1 GCA937974815_01097 gene open 15228-15473
2210 CALJVG010000080.1 GCA937974815_01098 gene open 15553-16809 fabB
2211 CALJVG010000080.1 GCA937974815_01099 gene open 16982-17506
2212 CALJVG010000080.1 GCA937974815_01100 gene open 17637-19496
2213 CALJVG010000080.1 GCA937974815_01101 gene open 19551-20516
2214 CALJVG010000080.1 GCA937974815_01102 gene open 20513-21475
2215 CALJVG010000080.1 GCA937974815_01103 gene open 21475-22530 mMP0362
2216 CALJVG010000080.1 GCA937974815_01104 gene open 22541-23602 moxR
2217 CALJVG010000080.1 GCA937974815_01105 gene open 23735-24565
2218 CALJVG010000080.1 GCA937974815_01088 gene open 3074-3147 trnV
2219 CALJVG010000080.1 GCA937974815_01088 tRNA open 3074-3147 trnV tRNA-Val(tac)
2220 CALJVG010000081.1 GCA937974815_01106 CDS open 520-1923 _na     467_aa dihydrolipoyl dehydrogenase
2221 CALJVG010000081.1 GCA937974815_01107 CDS open 2027-2281 _na     84_aa hypothetical protein
2222 CALJVG010000081.1 GCA937974815_01108 CDS open 2510-2995 _na     161_aa hypothetical protein
2223 CALJVG010000081.1 GCA937974815_01109 CDS open 3100-4593 _na     497_aa leucyl aminopeptidase
2224 CALJVG010000081.1 GCA937974815_01110 CDS open 4698-4904 _na     68_aa hypothetical protein
2225 CALJVG010000081.1 GCA937974815_01111 CDS open 4901-5596 _na     231_aa DUF3043 domain-containing protein
2226 CALJVG010000081.1 GCA937974815_01112 CDS open 5913-6704 _na     263_aa Phage shock A-like protein
2227 CALJVG010000081.1 GCA937974815_01113 CDS open 6701-7060 _na     119_aa PspA-associated protein PspAA
2228 CALJVG010000081.1 GCA937974815_01106 gene open 520-1923
2229 CALJVG010000081.1 GCA937974815_01107 gene open 2027-2281
2230 CALJVG010000081.1 GCA937974815_01108 gene open 2510-2995
2231 CALJVG010000081.1 GCA937974815_01109 gene open 3100-4593
2232 CALJVG010000081.1 GCA937974815_01110 gene open 4698-4904
2233 CALJVG010000081.1 GCA937974815_01111 gene open 4901-5596
2234 CALJVG010000081.1 GCA937974815_01112 gene open 5913-6704
2235 CALJVG010000081.1 GCA937974815_01113 gene open 6701-7060
2236 CALJVG010000082.1 GCA937974815_01114 CDS open 13-924 _na     303_aa THUMP-like domain-containing protein
2237 CALJVG010000082.1 GCA937974815_01115 CDS open 1262-1558 _na     98_aa groES co-chaperone GroES
2238 CALJVG010000082.1 GCA937974815_01116 CDS open 1574-3163 _na     529_aa groL chaperonin GroEL
2239 CALJVG010000082.1 GCA937974815_01117 CDS open 3426-4826 _na     466_aa right-handed parallel beta-helix repeat-containing protein
2240 CALJVG010000082.1 GCA937974815_01118 CDS open 5031-6401 _na     456_aa right-handed parallel beta-helix repeat-containing protein
2241 CALJVG010000082.1 GCA937974815_01119 CDS open 6527-7261 _na     244_aa glycoside hydrolase family 125 protein
2242 CALJVG010000082.1 GCA937974815_01114 gene open 13-924
2243 CALJVG010000082.1 GCA937974815_01115 gene open 1262-1558 groES
2244 CALJVG010000082.1 GCA937974815_01116 gene open 1574-3163 groL
2245 CALJVG010000082.1 GCA937974815_01117 gene open 3426-4826
2246 CALJVG010000082.1 GCA937974815_01118 gene open 5031-6401
2247 CALJVG010000082.1 GCA937974815_01119 gene open 6527-7261
2248 CALJVG010000083.1 GCA937974815_01120 CDS open 75-581 _na     168_aa Lipoprotein
2249 CALJVG010000083.1 GCA937974815_01121 CDS open 634-1050 _na     138_aa hypothetical protein
2250 CALJVG010000083.1 GCA937974815_01122 CDS open 1178-1963 _na     261_aa ADP-dependent (S)-NAD(P)H-hydrate dehydratase
2251 CALJVG010000083.1 GCA937974815_01120 gene open 75-581
2252 CALJVG010000083.1 GCA937974815_01121 gene open 634-1050
2253 CALJVG010000083.1 GCA937974815_01122 gene open 1178-1963
2254 CALJVG010000084.1 GCA937974815_01123 CDS open 21-485 _na     154_aa hypothetical protein
2255 CALJVG010000084.1 GCA937974815_01124 CDS open 522-932 _na     136_aa hypothetical protein
2256 CALJVG010000084.1 GCA937974815_01125 CDS open 1167-1670 _na     167_aa hypothetical protein
2257 CALJVG010000084.1 GCA937974815_01123 gene open 21-485
2258 CALJVG010000084.1 GCA937974815_01124 gene open 522-932
2259 CALJVG010000084.1 GCA937974815_01125 gene open 1167-1670
2260 CALJVG010000085.1 GCA937974815_01126 CDS open 937-2220 _na     427_aa HNH endonuclease signature motif containing protein
2261 CALJVG010000085.1 GCA937974815_01127 CDS open 2280-2780 _na     166_aa hypothetical protein
2262 CALJVG010000085.1 GCA937974815_01128 CDS open 2991-4730 _na     579_aa ABC transporter ATP-binding protein
2263 CALJVG010000085.1 GCA937974815_01129 CDS open 4723-6504 _na     593_aa ABC transporter ATP-binding protein
2264 CALJVG010000085.1 GCA937974815_01130 CDS open 6639-8483 _na     614_aa hypothetical protein
2265 CALJVG010000085.1 GCA937974815_01126 gene open 937-2220
2266 CALJVG010000085.1 GCA937974815_01127 gene open 2280-2780
2267 CALJVG010000085.1 GCA937974815_01128 gene open 2991-4730
2268 CALJVG010000085.1 GCA937974815_01129 gene open 4723-6504
2269 CALJVG010000085.1 GCA937974815_01130 gene open 6639-8483
2270 CALJVG010000086.1 GCA937974815_01131 CDS open 134-373 _na     79_aa Holin
2271 CALJVG010000086.1 GCA937974815_01132 CDS open 375-722 _na     115_aa hypothetical protein
2272 CALJVG010000086.1 GCA937974815_01133 CDS open 639-845 _na     68_aa hypothetical protein
2273 CALJVG010000086.1 GCA937974815_01134 CDS open 791-1063 _na     90_aa hypothetical protein
2274 CALJVG010000086.1 GCA937974815_01135 CDS open 1272-1487 _na     71_aa Gp28 phagic protein
2275 CALJVG010000086.1 GCA937974815_01136 CDS open 1475-2362 _na     295_aa hypothetical protein
2276 CALJVG010000086.1 GCA937974815_01137 CDS open 2359-2784 _na     141_aa hypothetical protein
2277 CALJVG010000086.1 GCA937974815_01138 CDS open 3199-3894 _na     231_aa dedA DedA family protein
2278 CALJVG010000086.1 GCA937974815_01139 CDS open 4004-4741 _na     245_aa DeoR/GlpR family DNA-binding transcription regulator
2279 CALJVG010000086.1 GCA937974815_01140 CDS open 4878-5339 _na     153_aa ribose-5-phosphate isomerase
2280 CALJVG010000086.1 GCA937974815_01141 CDS open 5369-6466 _na     365_aa Permease
2281 CALJVG010000086.1 GCA937974815_01142 CDS open 6643-7479 _na     278_aa nagD putative hydrolase yutF
2282 CALJVG010000086.1 GCA937974815_01143 CDS open 7490-9052 _na     520_aa araB Ribulokinase
2283 CALJVG010000086.1 GCA937974815_01144 CDS open 9054-10415 _na     453_aa sn-glycerol-1-phosphate dehydrogenase
2284 CALJVG010000086.1 GCA937974815_01145 CDS open 10441-12108 _na     555_aa araB ribulokinase
2285 CALJVG010000086.1 GCA937974815_01146 CDS open 12146-12601 _na     151_aa excalibur calcium-binding domain-containing protein
2286 CALJVG010000086.1 GCA937974815_01147 CDS open 12699-13187 _na     162_aa PH domain-containing protein
2287 CALJVG010000086.1 GCA937974815_01131 gene open 134-373
2288 CALJVG010000086.1 GCA937974815_01132 gene open 375-722
2289 CALJVG010000086.1 GCA937974815_01133 gene open 639-845
2290 CALJVG010000086.1 GCA937974815_01134 gene open 791-1063
2291 CALJVG010000086.1 GCA937974815_01135 gene open 1272-1487
2292 CALJVG010000086.1 GCA937974815_01136 gene open 1475-2362
2293 CALJVG010000086.1 GCA937974815_01137 gene open 2359-2784
2294 CALJVG010000086.1 GCA937974815_01138 gene open 3199-3894 dedA
2295 CALJVG010000086.1 GCA937974815_01139 gene open 4004-4741
2296 CALJVG010000086.1 GCA937974815_01140 gene open 4878-5339
2297 CALJVG010000086.1 GCA937974815_01141 gene open 5369-6466
2298 CALJVG010000086.1 GCA937974815_01142 gene open 6643-7479 nagD
2299 CALJVG010000086.1 GCA937974815_01143 gene open 7490-9052 araB
2300 CALJVG010000086.1 GCA937974815_01144 gene open 9054-10415
2301 CALJVG010000086.1 GCA937974815_01145 gene open 10441-12108 araB
2302 CALJVG010000086.1 GCA937974815_01146 gene open 12146-12601
2303 CALJVG010000086.1 GCA937974815_01147 gene open 12699-13187
2304 CALJVG010000087.1 GCA937974815_01148 CDS open 126-1049 _na     307_aa hypothetical protein
2305 CALJVG010000087.1 GCA937974815_01149 CDS open 1276-2529 _na     417_aa ATP-binding protein
2306 CALJVG010000087.1 GCA937974815_01150 CDS open 3240-4766 _na     508_aa FGGY-family carbohydrate kinase
2307 CALJVG010000087.1 GCA937974815_01151 CDS open 4793-5131 _na     112_aa hypothetical protein
2308 CALJVG010000087.1 GCA937974815_01148 gene open 126-1049
2309 CALJVG010000087.1 GCA937974815_01149 gene open 1276-2529
2310 CALJVG010000087.1 GCA937974815_01150 gene open 3240-4766
2311 CALJVG010000087.1 GCA937974815_01151 gene open 4793-5131
2312 CALJVG010000088.1 GCA937974815_01160 gene open 9982-10348 ssrA
2313 CALJVG010000088.1 GCA937974815_01160 tmRNA open 9982-10348 ssrA transfer-messenger RNA%2C SsrA
2314 CALJVG010000088.1 GCA937974815_01152 CDS open 298-912 _na     204_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2315 CALJVG010000088.1 GCA937974815_01153 CDS open 1025-1480 _na     151_aa comF ComF family protein
2316 CALJVG010000088.1 GCA937974815_01154 CDS open 1713-3413 _na     566_aa GerMN domain-containing protein
2317 CALJVG010000088.1 GCA937974815_01155 CDS open 3410-4993 _na     527_aa mtrB MtrAB system histidine kinase MtrB
2318 CALJVG010000088.1 GCA937974815_01156 CDS open 4974-5675 _na     233_aa mtrA MtrAB system response regulator MtrA
2319 CALJVG010000088.1 GCA937974815_01157 CDS open 5921-6481 _na     186_aa YqgE/AlgH family protein
2320 CALJVG010000088.1 GCA937974815_01158 CDS open 6516-7760 _na     414_aa alpha-amylase family protein
2321 CALJVG010000088.1 GCA937974815_01159 CDS open 8432-9595 _na     387_aa hypothetical protein
2322 CALJVG010000088.1 GCA937974815_01161 CDS open 10387-10962 _na     191_aa DUF1707 domain-containing protein
2323 CALJVG010000088.1 GCA937974815_01162 CDS open 11032-11517 _na     161_aa smpB SsrA-binding protein SmpB
2324 CALJVG010000088.1 GCA937974815_01163 CDS open 11542-12915 _na     457_aa M23 family metallopeptidase
2325 CALJVG010000088.1 GCA937974815_01164 CDS open 12933-13295 _na     120_aa FtsX-like permease family protein
2326 CALJVG010000088.1 GCA937974815_01152 gene open 298-912 hpf
2327 CALJVG010000088.1 GCA937974815_01153 gene open 1025-1480 comF
2328 CALJVG010000088.1 GCA937974815_01154 gene open 1713-3413
2329 CALJVG010000088.1 GCA937974815_01155 gene open 3410-4993 mtrB
2330 CALJVG010000088.1 GCA937974815_01156 gene open 4974-5675 mtrA
2331 CALJVG010000088.1 GCA937974815_01157 gene open 5921-6481
2332 CALJVG010000088.1 GCA937974815_01158 gene open 6516-7760
2333 CALJVG010000088.1 GCA937974815_01159 gene open 8432-9595
2334 CALJVG010000088.1 GCA937974815_01161 gene open 10387-10962
2335 CALJVG010000088.1 GCA937974815_01162 gene open 11032-11517 smpB
2336 CALJVG010000088.1 GCA937974815_01163 gene open 11542-12915
2337 CALJVG010000088.1 GCA937974815_01164 gene open 12933-13295
2338 CALJVG010000089.1 GCA937974815_01165 CDS open 308-1804 _na     498_aa hypothetical protein
2339 CALJVG010000089.1 GCA937974815_01166 CDS open 1900-2109 _na     69_aa heavy-metal-associated domain-containing protein
2340 CALJVG010000089.1 GCA937974815_01167 CDS open 2167-4380 _na     737_aa cation-translocating P-type ATPase
2341 CALJVG010000089.1 GCA937974815_01168 CDS open 4642-5871 _na     409_aa rlpA septal ring lytic transglycosylase RlpA family protein
2342 CALJVG010000089.1 GCA937974815_01169 CDS open 6061-6396 _na     111_aa hypothetical protein
2343 CALJVG010000089.1 GCA937974815_01170 CDS open 6400-9159 _na     919_aa hypothetical protein
2344 CALJVG010000089.1 GCA937974815_01171 CDS open 9299-9829 _na     176_aa hypothetical protein
2345 CALJVG010000089.1 GCA937974815_01172 CDS open 9999-10529 _na     176_aa hypothetical protein
2346 CALJVG010000089.1 GCA937974815_01173 CDS open 10718-12010 _na     430_aa rfaB GDP-mannose-dependent alpha-mannosyltransferase
2347 CALJVG010000089.1 GCA937974815_01174 CDS open 12120-12554 _na     144_aa cydC Thiol reductant ABC exporter subunit CydC
2348 CALJVG010000089.1 GCA937974815_01165 gene open 308-1804
2349 CALJVG010000089.1 GCA937974815_01166 gene open 1900-2109
2350 CALJVG010000089.1 GCA937974815_01167 gene open 2167-4380
2351 CALJVG010000089.1 GCA937974815_01168 gene open 4642-5871 rlpA
2352 CALJVG010000089.1 GCA937974815_01169 gene open 6061-6396
2353 CALJVG010000089.1 GCA937974815_01170 gene open 6400-9159
2354 CALJVG010000089.1 GCA937974815_01171 gene open 9299-9829
2355 CALJVG010000089.1 GCA937974815_01172 gene open 9999-10529
2356 CALJVG010000089.1 GCA937974815_01173 gene open 10718-12010 rfaB
2357 CALJVG010000089.1 GCA937974815_01174 gene open 12120-12554 cydC
2358 CALJVG010000090.1 GCA937974815_01175 CDS open 14-616 _na     200_aa response regulator transcription factor
2359 CALJVG010000090.1 GCA937974815_01176 CDS open 869-1774 _na     301_aa Regulator of protease activity HflC%2C stomatin/prohibitin superfamily
2360 CALJVG010000090.1 GCA937974815_01177 CDS open 2125-4116 _na     663_aa serine hydrolase
2361 CALJVG010000090.1 GCA937974815_01178 CDS open 4745-5194 _na     149_aa hypothetical protein
2362 CALJVG010000090.1 GCA937974815_01179 CDS open 5647-6510 _na     287_aa ycjR Inosose dehydratase
2363 CALJVG010000090.1 GCA937974815_01180 CDS open 6507-7151 _na     214_aa hypothetical protein
2364 CALJVG010000090.1 GCA937974815_01175 gene open 14-616
2365 CALJVG010000090.1 GCA937974815_01176 gene open 869-1774
2366 CALJVG010000090.1 GCA937974815_01177 gene open 2125-4116
2367 CALJVG010000090.1 GCA937974815_01178 gene open 4745-5194
2368 CALJVG010000090.1 GCA937974815_01179 gene open 5647-6510 ycjR
2369 CALJVG010000090.1 GCA937974815_01180 gene open 6507-7151
2370 CALJVG010000091.1 GCA937974815_01181 CDS open 223-1632 _na     469_aa ABC transporter permease
2371 CALJVG010000091.1 GCA937974815_01182 CDS open 1638-2270 _na     210_aa 5%2C6-dimethylbenzimidazole synthase
2372 CALJVG010000091.1 GCA937974815_01183 CDS open 2318-4105 _na     595_aa AMP-binding enzyme
2373 CALJVG010000091.1 GCA937974815_01184 CDS open 4542-5360 _na     272_aa Transcriptional regulator%2C effector binding domain protein
2374 CALJVG010000091.1 GCA937974815_01185 CDS open 5485-6849 _na     454_aa glycoside-pentoside-hexuronide (GPH):cation symporter
2375 CALJVG010000091.1 GCA937974815_01187 CDS open 7121-7612 _na     163_aa yajQ YajQ family cyclic di-GMP-binding protein
2376 CALJVG010000091.1 GCA937974815_01188 CDS open 8529-9596 _na     355_aa winged helix-turn-helix domain-containing protein
2377 CALJVG010000091.1 GCA937974815_01189 CDS open 9841-10590 _na     249_aa deoC deoxyribose-phosphate aldolase
2378 CALJVG010000091.1 GCA937974815_01190 CDS open 10960-11691 _na     243_aa gntR GntR family transcriptional regulator
2379 CALJVG010000091.1 GCA937974815_01191 CDS open 11699-12319 _na     206_aa trans-aconitate 2-methyltransferase
2380 CALJVG010000091.1 GCA937974815_01192 CDS open 12329-13222 _na     297_aa DUF808 domain-containing protein
2381 CALJVG010000091.1 GCA937974815_01193 CDS open 13313-14230 _na     305_aa exodeoxyribonuclease III
2382 CALJVG010000091.1 GCA937974815_01194 CDS open 14206-15696 _na     496_aa mptB polyprenol phosphomannose-dependent alpha 1%2C6 mannosyltransferase MptB
2383 CALJVG010000091.1 GCA937974815_01195 CDS open 16151-18016 _na     621_aa porG 2-oxoglutarate ferredoxin oxidoreductase subunit alpha
2384 CALJVG010000091.1 GCA937974815_01181 gene open 223-1632
2385 CALJVG010000091.1 GCA937974815_01182 gene open 1638-2270
2386 CALJVG010000091.1 GCA937974815_01183 gene open 2318-4105
2387 CALJVG010000091.1 GCA937974815_01184 gene open 4542-5360
2388 CALJVG010000091.1 GCA937974815_01185 gene open 5485-6849
2389 CALJVG010000091.1 GCA937974815_01187 gene open 7121-7612 yajQ
2390 CALJVG010000091.1 GCA937974815_01188 gene open 8529-9596
2391 CALJVG010000091.1 GCA937974815_01189 gene open 9841-10590 deoC
2392 CALJVG010000091.1 GCA937974815_01190 gene open 10960-11691 gntR
2393 CALJVG010000091.1 GCA937974815_01191 gene open 11699-12319
2394 CALJVG010000091.1 GCA937974815_01192 gene open 12329-13222
2395 CALJVG010000091.1 GCA937974815_01193 gene open 13313-14230
2396 CALJVG010000091.1 GCA937974815_01194 gene open 14206-15696 mptB
2397 CALJVG010000091.1 GCA937974815_01195 gene open 16151-18016 porG
2398 CALJVG010000091.1 GCA937974815_01186 gene open 6928-7009 trnY
2399 CALJVG010000091.1 GCA937974815_01186 tRNA open 6928-7009 trnY tRNA-Tyr(gta)
2400 CALJVG010000092.1 GCA937974815_01196 CDS open 275-1855 _na     526_aa Pyruvate carboxylase
2401 CALJVG010000092.1 GCA937974815_01196 gene open 275-1855
2402 CALJVG010000093.1 GCA937974815_01197 CDS open 998-1777 _na     259_aa fadR Pyruvate dehydrogenase complex repressor
2403 CALJVG010000093.1 GCA937974815_01198 CDS open 1896-4130 _na     744_aa gcvP aminomethyl-transferring glycine dehydrogenase
2404 CALJVG010000093.1 GCA937974815_01199 CDS open 4679-5842 _na     387_aa DUF58 domain-containing protein
2405 CALJVG010000093.1 GCA937974815_01200 CDS open 5887-6855 _na     322_aa moxR MoxR family ATPase
2406 CALJVG010000093.1 GCA937974815_01201 CDS open 6869-12886 _na     2005_aa Ig-like domain-containing protein
2407 CALJVG010000093.1 GCA937974815_01202 CDS open 13092-13988 _na     298_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
2408 CALJVG010000093.1 GCA937974815_01203 CDS open 14051-14782 _na     243_aa glycerophosphodiester phosphodiesterase
2409 CALJVG010000093.1 GCA937974815_01204 CDS open 14836-15132 _na     98_aa hypothetical protein
2410 CALJVG010000093.1 GCA937974815_01197 gene open 998-1777 fadR
2411 CALJVG010000093.1 GCA937974815_01198 gene open 1896-4130 gcvP
2412 CALJVG010000093.1 GCA937974815_01199 gene open 4679-5842
2413 CALJVG010000093.1 GCA937974815_01200 gene open 5887-6855 moxR
2414 CALJVG010000093.1 GCA937974815_01201 gene open 6869-12886
2415 CALJVG010000093.1 GCA937974815_01202 gene open 13092-13988 menB
2416 CALJVG010000093.1 GCA937974815_01203 gene open 14051-14782
2417 CALJVG010000093.1 GCA937974815_01204 gene open 14836-15132
2418 CALJVG010000094.1 GCA937974815_01205 CDS open 149-631 _na     160_aa Molybdopterin adenylyltransferase
2419 CALJVG010000094.1 GCA937974815_01206 CDS open 735-1262 _na     175_aa hypothetical protein
2420 CALJVG010000094.1 GCA937974815_01205 gene open 149-631
2421 CALJVG010000094.1 GCA937974815_01206 gene open 735-1262
2422 CALJVG010000095.1 GCA937974815_01207 CDS open 287-1744 _na     485_aa pepP Xaa-Pro aminopeptidase
2423 CALJVG010000095.1 GCA937974815_01208 CDS open 1774-2595 _na     273_aa alpha/beta fold hydrolase
2424 CALJVG010000095.1 GCA937974815_01209 CDS open 2609-3139 _na     176_aa general stress protein
2425 CALJVG010000095.1 GCA937974815_01210 CDS open 3201-4466 _na     421_aa mgtE Magnesium transporter mgtE
2426 CALJVG010000095.1 GCA937974815_01211 CDS open 4459-4968 _na     169_aa DUF1003 domain-containing protein
2427 CALJVG010000095.1 GCA937974815_01212 CDS open 4965-5327 _na     120_aa hypothetical protein
2428 CALJVG010000095.1 GCA937974815_01213 CDS open 5349-6506 _na     385_aa paaD Iron-sulfur cluster carrier protein
2429 CALJVG010000095.1 GCA937974815_01214 CDS open 6507-6908 _na     133_aa sec-independent translocase
2430 CALJVG010000095.1 GCA937974815_01215 CDS open 6936-8357 _na     473_aa zf-HC2 domain-containing protein
2431 CALJVG010000095.1 GCA937974815_01216 CDS open 8358-8930 _na     190_aa sigE RNA polymerase sigma factor SigE
2432 CALJVG010000095.1 GCA937974815_01217 CDS open 9057-9947 _na     296_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
2433 CALJVG010000095.1 GCA937974815_01218 CDS open 9987-10193 _na     68_aa hypothetical protein
2434 CALJVG010000095.1 GCA937974815_01219 CDS open 10190-10846 _na     218_aa trmR O-methyltransferase MSMEG_5073
2435 CALJVG010000095.1 GCA937974815_01220 CDS open 10925-12151 _na     408_aa glgC glucose-1-phosphate adenylyltransferase
2436 CALJVG010000095.1 GCA937974815_01221 CDS open 12215-13405 _na     396_aa rfaB Capsular glucan synthase
2437 CALJVG010000095.1 GCA937974815_01222 CDS open 13464-13631 _na     55_aa DUF3117 domain-containing protein
2438 CALJVG010000095.1 GCA937974815_01223 CDS open 13641-14102 _na     153_aa DivIVA domain-containing protein
2439 CALJVG010000095.1 GCA937974815_01224 CDS open 14114-14842 _na     242_aa TIGR00730 family Rossman fold protein
2440 CALJVG010000095.1 GCA937974815_01225 CDS open 14988-16088 _na     366_aa dapE succinyl-diaminopimelate desuccinylase
2441 CALJVG010000095.1 GCA937974815_01226 CDS open 16161-17093 _na     310_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
2442 CALJVG010000095.1 GCA937974815_01227 CDS open 17095-17928 _na     277_aa Heavy metal transporter
2443 CALJVG010000095.1 GCA937974815_01228 CDS open 18010-19236 _na     408_aa serpin family protein
2444 CALJVG010000095.1 GCA937974815_01229 CDS open 19238-20329 _na     363_aa dapC succinyldiaminopimelate transaminase
2445 CALJVG010000095.1 GCA937974815_01230 CDS open 20329-20649 _na     106_aa fdxA ferredoxin
2446 CALJVG010000095.1 GCA937974815_01231 CDS open 20699-22435 _na     578_aa vanW VanW family protein
2447 CALJVG010000095.1 GCA937974815_01232 CDS open 22537-23754 _na     405_aa MFS transporter
2448 CALJVG010000095.1 GCA937974815_01233 CDS open 23765-25474 _na     569_aa sppA signal peptide peptidase SppA
2449 CALJVG010000095.1 GCA937974815_01234 CDS open 25515-27569 _na     684_aa tkt transketolase
2450 CALJVG010000095.1 GCA937974815_01235 CDS open 27657-27866 _na     69_aa hypothetical protein
2451 CALJVG010000095.1 GCA937974815_01236 CDS open 27912-28406 _na     164_aa phosphoribosyltransferase
2452 CALJVG010000095.1 GCA937974815_01237 CDS open 28416-28931 _na     171_aa GNAT family N-acetyltransferase
2453 CALJVG010000095.1 GCA937974815_01238 CDS open 28982-30130 _na     382_aa VWA domain-containing protein
2454 CALJVG010000095.1 GCA937974815_01239 CDS open 30127-32265 _na     712_aa DUF5682 domain-containing protein
2455 CALJVG010000095.1 GCA937974815_01240 CDS open 32279-33364 _na     361_aa mMP0363 AAA family ATPase
2456 CALJVG010000095.1 GCA937974815_01241 CDS open 33361-34593 _na     410_aa DUF5691 domain-containing protein
2457 CALJVG010000095.1 GCA937974815_01242 CDS open 34823-36229 _na     468_aa SWIM zinc finger domain-containing protein
2458 CALJVG010000095.1 GCA937974815_01243 CDS open 36255-38786 _na     843_aa Ski2-like helicase
2459 CALJVG010000095.1 GCA937974815_01244 CDS open 38941-39978 _na     345_aa serine protease
2460 CALJVG010000095.1 GCA937974815_01245 CDS open 41128-41961 _na     277_aa GNAT family N-acetyltransferase
2461 CALJVG010000095.1 GCA937974815_01246 CDS open 42059-42787 _na     242_aa hypothetical protein
2462 CALJVG010000095.1 GCA937974815_01247 CDS open 42858-44606 _na     582_aa sSL2 DNA phosphorothioation system restriction enzyme
2463 CALJVG010000095.1 GCA937974815_01248 CDS open 44680-45054 _na     124_aa NINE protein
2464 CALJVG010000095.1 GCA937974815_01249 CDS open 45096-45896 _na     266_aa xapA purine-nucleoside phosphorylase
2465 CALJVG010000095.1 GCA937974815_01250 CDS open 46058-46348 _na     96_aa hypothetical protein
2466 CALJVG010000095.1 GCA937974815_01207 gene open 287-1744 pepP
2467 CALJVG010000095.1 GCA937974815_01208 gene open 1774-2595
2468 CALJVG010000095.1 GCA937974815_01209 gene open 2609-3139
2469 CALJVG010000095.1 GCA937974815_01210 gene open 3201-4466 mgtE
2470 CALJVG010000095.1 GCA937974815_01211 gene open 4459-4968
2471 CALJVG010000095.1 GCA937974815_01212 gene open 4965-5327
2472 CALJVG010000095.1 GCA937974815_01213 gene open 5349-6506 paaD
2473 CALJVG010000095.1 GCA937974815_01214 gene open 6507-6908
2474 CALJVG010000095.1 GCA937974815_01215 gene open 6936-8357
2475 CALJVG010000095.1 GCA937974815_01216 gene open 8358-8930 sigE
2476 CALJVG010000095.1 GCA937974815_01217 gene open 9057-9947 dapA
2477 CALJVG010000095.1 GCA937974815_01218 gene open 9987-10193
2478 CALJVG010000095.1 GCA937974815_01219 gene open 10190-10846 trmR
2479 CALJVG010000095.1 GCA937974815_01220 gene open 10925-12151 glgC
2480 CALJVG010000095.1 GCA937974815_01221 gene open 12215-13405 rfaB
2481 CALJVG010000095.1 GCA937974815_01222 gene open 13464-13631
2482 CALJVG010000095.1 GCA937974815_01223 gene open 13641-14102
2483 CALJVG010000095.1 GCA937974815_01224 gene open 14114-14842
2484 CALJVG010000095.1 GCA937974815_01225 gene open 14988-16088 dapE
2485 CALJVG010000095.1 GCA937974815_01226 gene open 16161-17093 dapD
2486 CALJVG010000095.1 GCA937974815_01227 gene open 17095-17928
2487 CALJVG010000095.1 GCA937974815_01228 gene open 18010-19236
2488 CALJVG010000095.1 GCA937974815_01229 gene open 19238-20329 dapC
2489 CALJVG010000095.1 GCA937974815_01230 gene open 20329-20649 fdxA
2490 CALJVG010000095.1 GCA937974815_01231 gene open 20699-22435 vanW
2491 CALJVG010000095.1 GCA937974815_01232 gene open 22537-23754
2492 CALJVG010000095.1 GCA937974815_01233 gene open 23765-25474 sppA
2493 CALJVG010000095.1 GCA937974815_01234 gene open 25515-27569 tkt
2494 CALJVG010000095.1 GCA937974815_01235 gene open 27657-27866
2495 CALJVG010000095.1 GCA937974815_01236 gene open 27912-28406
2496 CALJVG010000095.1 GCA937974815_01237 gene open 28416-28931
2497 CALJVG010000095.1 GCA937974815_01238 gene open 28982-30130
2498 CALJVG010000095.1 GCA937974815_01239 gene open 30127-32265
2499 CALJVG010000095.1 GCA937974815_01240 gene open 32279-33364 mMP0363
2500 CALJVG010000095.1 GCA937974815_01241 gene open 33361-34593