HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Pseudoleptotrichia sp. HMT-212 (GCA_938011375.1)

Select a Genome:
BAKTA Annotations for GCA_938011375.1
Genome Selected: Pseudoleptotrichia sp. HMT-212
ContigsBases CDSrRNA tmRNAtRNA
121 2345923 2292 1 1 20
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4650 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4650 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CALLUC010000097.1 GCA938011375_01755 CDS open 19971-20516 _na     181_aa IDEAL domain-containing protein
3502 CALLUC010000097.1 GCA938011375_01756 CDS open 20503-21000 _na     165_aa hypothetical protein
3503 CALLUC010000097.1 GCA938011375_01757 CDS open 21056-23029 _na     657_aa hypothetical protein
3504 CALLUC010000097.1 GCA938011375_01758 CDS open 23104-24261 _na     385_aa Secretion system protein E
3505 CALLUC010000097.1 GCA938011375_01759 CDS open 24254-24562 _na     102_aa hypothetical protein
3506 CALLUC010000097.1 GCA938011375_01760 CDS open 24597-24896 _na     99_aa hypothetical protein
3507 CALLUC010000097.1 GCA938011375_01761 CDS open 24925-25233 _na     102_aa hypothetical protein
3508 CALLUC010000097.1 GCA938011375_01762 CDS open 25245-25544 _na     99_aa hypothetical protein
3509 CALLUC010000097.1 GCA938011375_01763 CDS open 25689-26501 _na     270_aa virB8 Bacterial virulence protein VirB8 domain-containing protein
3510 CALLUC010000097.1 GCA938011375_01764 CDS open 26513-27697 _na     394_aa hypothetical protein
3511 CALLUC010000097.1 GCA938011375_01765 CDS open 27675-30137 _na     820_aa traG Conjugal transfer protein TraG
3512 CALLUC010000097.1 GCA938011375_01766 CDS open 30206-30403 _na     65_aa Lipoprotein
3513 CALLUC010000097.1 GCA938011375_01767 CDS open 30418-31098 _na     226_aa hypothetical protein
3514 CALLUC010000097.1 GCA938011375_01768 CDS open 31128-31709 _na     193_aa hypothetical protein
3515 CALLUC010000097.1 GCA938011375_01769 CDS open 32067-32516 _na     149_aa hypothetical protein
3516 CALLUC010000097.1 GCA938011375_01770 CDS open 32594-35197 _na     867_aa virB CagE%2C TrbE%2C VirB family%2C component of type IV transporter system
3517 CALLUC010000097.1 GCA938011375_01771 CDS open 35229-35630 _na     133_aa trbC Conjugal transfer protein TrbC
3518 CALLUC010000097.1 GCA938011375_01772 CDS open 35849-36682 _na     277_aa hypothetical protein
3519 CALLUC010000097.1 GCA938011375_01773 CDS open 36743-37273 _na     176_aa hypothetical protein
3520 CALLUC010000097.1 GCA938011375_01774 CDS open 37284-37808 _na     174_aa pantothenate kinase
3521 CALLUC010000097.1 GCA938011375_01775 CDS open 37857-38234 _na     125_aa Pantothenate kinase
3522 CALLUC010000097.1 GCA938011375_01776 CDS open 38300-38821 _na     173_aa hypothetical protein
3523 CALLUC010000097.1 GCA938011375_01737 gene open 136-495
3524 CALLUC010000097.1 GCA938011375_01738 gene open 648-1586
3525 CALLUC010000097.1 GCA938011375_01739 gene open 1595-1720
3526 CALLUC010000097.1 GCA938011375_01740 gene open 1721-2245
3527 CALLUC010000097.1 GCA938011375_01741 gene open 2267-3919
3528 CALLUC010000097.1 GCA938011375_01742 gene open 3946-5124
3529 CALLUC010000097.1 GCA938011375_01743 gene open 5207-5842
3530 CALLUC010000097.1 GCA938011375_01744 gene open 5962-7239
3531 CALLUC010000097.1 GCA938011375_01745 gene open 7431-8099
3532 CALLUC010000097.1 GCA938011375_01746 gene open 8323-9084 trpA
3533 CALLUC010000097.1 GCA938011375_01747 gene open 9077-10294 trpB
3534 CALLUC010000097.1 GCA938011375_01748 gene open 10339-11004
3535 CALLUC010000097.1 GCA938011375_01749 gene open 11022-11750
3536 CALLUC010000097.1 GCA938011375_01750 gene open 11796-13439
3537 CALLUC010000097.1 GCA938011375_01751 gene open 13442-14779
3538 CALLUC010000097.1 GCA938011375_01752 gene open 15276-15875
3539 CALLUC010000097.1 GCA938011375_01753 gene open 15872-17659
3540 CALLUC010000097.1 GCA938011375_01754 gene open 17640-19946
3541 CALLUC010000097.1 GCA938011375_01755 gene open 19971-20516
3542 CALLUC010000097.1 GCA938011375_01756 gene open 20503-21000
3543 CALLUC010000097.1 GCA938011375_01757 gene open 21056-23029
3544 CALLUC010000097.1 GCA938011375_01758 gene open 23104-24261
3545 CALLUC010000097.1 GCA938011375_01759 gene open 24254-24562
3546 CALLUC010000097.1 GCA938011375_01760 gene open 24597-24896
3547 CALLUC010000097.1 GCA938011375_01761 gene open 24925-25233
3548 CALLUC010000097.1 GCA938011375_01762 gene open 25245-25544
3549 CALLUC010000097.1 GCA938011375_01763 gene open 25689-26501 virB8
3550 CALLUC010000097.1 GCA938011375_01764 gene open 26513-27697
3551 CALLUC010000097.1 GCA938011375_01765 gene open 27675-30137 traG
3552 CALLUC010000097.1 GCA938011375_01766 gene open 30206-30403
3553 CALLUC010000097.1 GCA938011375_01767 gene open 30418-31098
3554 CALLUC010000097.1 GCA938011375_01768 gene open 31128-31709
3555 CALLUC010000097.1 GCA938011375_01769 gene open 32067-32516
3556 CALLUC010000097.1 GCA938011375_01770 gene open 32594-35197 virB
3557 CALLUC010000097.1 GCA938011375_01771 gene open 35229-35630 trbC
3558 CALLUC010000097.1 GCA938011375_01772 gene open 35849-36682
3559 CALLUC010000097.1 GCA938011375_01773 gene open 36743-37273
3560 CALLUC010000097.1 GCA938011375_01774 gene open 37284-37808
3561 CALLUC010000097.1 GCA938011375_01775 gene open 37857-38234
3562 CALLUC010000097.1 GCA938011375_01776 gene open 38300-38821
3563 CALLUC010000097.1 GCA938011375_01736 gene open 3-66
3564 CALLUC010000097.1 GCA938011375_01736 tRNA open 3-66 tRNA-Xxx
3565 CALLUC010000098.1 GCA938011375_01777 CDS open 158-340 _na     60_aa hypothetical protein
3566 CALLUC010000098.1 GCA938011375_01778 CDS open 357-1433 _na     358_aa Tail sheath protein C-terminal domain-containing protein
3567 CALLUC010000098.1 GCA938011375_01779 CDS open 1455-1892 _na     145_aa xkdM XkdM protein%2C phage-like element PBSX
3568 CALLUC010000098.1 GCA938011375_01780 CDS open 1911-2282 _na     123_aa Phage XkdN-like protein
3569 CALLUC010000098.1 GCA938011375_01781 CDS open 2412-4418 _na     668_aa hypothetical protein
3570 CALLUC010000098.1 GCA938011375_01782 CDS open 4458-5006 _na     182_aa Dit-like phage tail protein N-terminal domain-containing protein
3571 CALLUC010000098.1 GCA938011375_01783 CDS open 5022-6053 _na     343_aa Terminase
3572 CALLUC010000098.1 GCA938011375_01784 CDS open 6053-6490 _na     145_aa DUF2577 domain-containing protein
3573 CALLUC010000098.1 GCA938011375_01785 CDS open 6493-6924 _na     143_aa Terminase
3574 CALLUC010000098.1 GCA938011375_01786 CDS open 6917-7981 _na     354_aa Baseplate protein J-like domain-containing protein
3575 CALLUC010000098.1 GCA938011375_01787 CDS open 7971-8519 _na     182_aa DUF2313 domain-containing protein
3576 CALLUC010000098.1 GCA938011375_01788 CDS open 8530-9237 _na     235_aa Tail fiber protein
3577 CALLUC010000098.1 GCA938011375_01789 CDS open 9258-9971 _na     237_aa DUF4376 domain-containing protein
3578 CALLUC010000098.1 GCA938011375_01790 CDS open 9980-10453 _na     157_aa hypothetical protein
3579 CALLUC010000098.1 GCA938011375_01791 CDS open 10454-10981 _na     175_aa Peptidoglycan domain protein
3580 CALLUC010000098.1 GCA938011375_01792 CDS open 10983-11531 _na     182_aa N-acetylmuramoyl-L-alanine amidase
3581 CALLUC010000098.1 GCA938011375_01793 CDS open 11747-12073 _na     108_aa hypothetical protein
3582 CALLUC010000098.1 GCA938011375_01794 CDS open 12095-12448 _na     117_aa Toxin secretion/phage lysis holin
3583 CALLUC010000098.1 GCA938011375_01795 CDS open 12612-12776 _na     54_aa hypothetical protein
3584 CALLUC010000098.1 GCA938011375_01796 CDS open 13010-13996 _na     328_aa fba class II fructose-bisphosphate aldolase
3585 CALLUC010000098.1 GCA938011375_01797 CDS open 14235-15848 _na     537_aa pyrG CTP synthase
3586 CALLUC010000098.1 GCA938011375_01798 CDS open 15940-16200 _na     86_aa ptsH Phosphocarrier protein HPr
3587 CALLUC010000098.1 GCA938011375_01799 CDS open 16321-18000 _na     559_aa Fibronectin-binding protein A
3588 CALLUC010000098.1 GCA938011375_01800 CDS open 18019-18705 _na     228_aa feoA FeoA domain protein
3589 CALLUC010000098.1 GCA938011375_01801 CDS open 18721-19356 _na     211_aa rpe ribulose-phosphate 3-epimerase
3590 CALLUC010000098.1 GCA938011375_01802 CDS open 19400-20161 _na     253_aa rsgA ribosome small subunit-dependent GTPase A
3591 CALLUC010000098.1 GCA938011375_01803 CDS open 20317-21324 _na     335_aa PASTA domain protein
3592 CALLUC010000098.1 GCA938011375_01804 CDS open 21561-22661 _na     366_aa ltrA Low temperature requirement protein LtrA
3593 CALLUC010000098.1 GCA938011375_01805 CDS open 22774-23331 _na     185_aa hpt hypoxanthine phosphoribosyltransferase
3594 CALLUC010000098.1 GCA938011375_01806 CDS open 23375-24202 _na     275_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
3595 CALLUC010000098.1 GCA938011375_01807 CDS open 24231-24470 _na     79_aa DUF4911 domain-containing protein
3596 CALLUC010000098.1 GCA938011375_01808 CDS open 24570-24812 _na     80_aa khpA RNA-binding protein KhpA
3597 CALLUC010000098.1 GCA938011375_01809 CDS open 24815-25207 _na     130_aa Acyl-CoA thioester hydrolase%2C YbgC/YbaW family
3598 CALLUC010000098.1 GCA938011375_01810 CDS open 25244-25687 _na     147_aa rpiB ribose 5-phosphate isomerase B
3599 CALLUC010000098.1 GCA938011375_01811 CDS open 25739-26080 _na     113_aa hinT Histidine triad domain protein
3600 CALLUC010000098.1 GCA938011375_01777 gene open 158-340
3601 CALLUC010000098.1 GCA938011375_01778 gene open 357-1433
3602 CALLUC010000098.1 GCA938011375_01779 gene open 1455-1892 xkdM
3603 CALLUC010000098.1 GCA938011375_01780 gene open 1911-2282
3604 CALLUC010000098.1 GCA938011375_01781 gene open 2412-4418
3605 CALLUC010000098.1 GCA938011375_01782 gene open 4458-5006
3606 CALLUC010000098.1 GCA938011375_01783 gene open 5022-6053
3607 CALLUC010000098.1 GCA938011375_01784 gene open 6053-6490
3608 CALLUC010000098.1 GCA938011375_01785 gene open 6493-6924
3609 CALLUC010000098.1 GCA938011375_01786 gene open 6917-7981
3610 CALLUC010000098.1 GCA938011375_01787 gene open 7971-8519
3611 CALLUC010000098.1 GCA938011375_01788 gene open 8530-9237
3612 CALLUC010000098.1 GCA938011375_01789 gene open 9258-9971
3613 CALLUC010000098.1 GCA938011375_01790 gene open 9980-10453
3614 CALLUC010000098.1 GCA938011375_01791 gene open 10454-10981
3615 CALLUC010000098.1 GCA938011375_01792 gene open 10983-11531
3616 CALLUC010000098.1 GCA938011375_01793 gene open 11747-12073
3617 CALLUC010000098.1 GCA938011375_01794 gene open 12095-12448
3618 CALLUC010000098.1 GCA938011375_01795 gene open 12612-12776
3619 CALLUC010000098.1 GCA938011375_01796 gene open 13010-13996 fba
3620 CALLUC010000098.1 GCA938011375_01797 gene open 14235-15848 pyrG
3621 CALLUC010000098.1 GCA938011375_01798 gene open 15940-16200 ptsH
3622 CALLUC010000098.1 GCA938011375_01799 gene open 16321-18000
3623 CALLUC010000098.1 GCA938011375_01800 gene open 18019-18705 feoA
3624 CALLUC010000098.1 GCA938011375_01801 gene open 18721-19356 rpe
3625 CALLUC010000098.1 GCA938011375_01802 gene open 19400-20161 rsgA
3626 CALLUC010000098.1 GCA938011375_01803 gene open 20317-21324
3627 CALLUC010000098.1 GCA938011375_01804 gene open 21561-22661 ltrA
3628 CALLUC010000098.1 GCA938011375_01805 gene open 22774-23331 hpt
3629 CALLUC010000098.1 GCA938011375_01806 gene open 23375-24202 rsmA
3630 CALLUC010000098.1 GCA938011375_01807 gene open 24231-24470
3631 CALLUC010000098.1 GCA938011375_01808 gene open 24570-24812 khpA
3632 CALLUC010000098.1 GCA938011375_01809 gene open 24815-25207
3633 CALLUC010000098.1 GCA938011375_01810 gene open 25244-25687 rpiB
3634 CALLUC010000098.1 GCA938011375_01811 gene open 25739-26080 hinT
3635 CALLUC010000099.1 GCA938011375_01812 CDS open 94-315 _na     73_aa hypothetical protein
3636 CALLUC010000099.1 GCA938011375_01813 CDS open 312-827 _na     171_aa Flavodoxin
3637 CALLUC010000099.1 GCA938011375_01814 CDS open 772-2895 _na     707_aa Radical SAM protein
3638 CALLUC010000099.1 GCA938011375_01815 CDS open 2955-3245 _na     96_aa DUF2470 domain-containing protein
3639 CALLUC010000099.1 GCA938011375_01816 CDS open 3294-4184 _na     296_aa tonB TonB C-terminal domain-containing protein
3640 CALLUC010000099.1 GCA938011375_01817 CDS open 4217-5110 _na     297_aa Hemin ABC transporter substrate-binding protein
3641 CALLUC010000099.1 GCA938011375_01818 CDS open 5123-5908 _na     261_aa Heme ABC transporter ATP-binding protein
3642 CALLUC010000099.1 GCA938011375_01819 CDS open 5913-6911 _na     332_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
3643 CALLUC010000099.1 GCA938011375_01820 CDS open 6901-8916 _na     671_aa Signal protein
3644 CALLUC010000099.1 GCA938011375_01821 CDS open 8983-9402 _na     139_aa exbD Biopolymer transporter ExbD
3645 CALLUC010000099.1 GCA938011375_01822 CDS open 9460-10107 _na     215_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
3646 CALLUC010000099.1 GCA938011375_01823 CDS open 10356-10781 _na     141_aa HTH marR-type domain-containing protein
3647 CALLUC010000099.1 GCA938011375_01824 CDS open 10868-11539 _na     223_aa Hemolysin D
3648 CALLUC010000099.1 GCA938011375_01825 CDS open 11604-14789 _na     1061_aa DNA 3'-5' helicase
3649 CALLUC010000099.1 GCA938011375_01826 CDS open 14773-17535 _na     920_aa PD-(D/E)XK endonuclease-like domain-containing protein
3650 CALLUC010000099.1 GCA938011375_01827 CDS open 17734-17937 _na     67_aa secG preprotein translocase subunit SecG
3651 CALLUC010000099.1 GCA938011375_01828 CDS open 17975-18742 _na     255_aa tpiA triose-phosphate isomerase
3652 CALLUC010000099.1 GCA938011375_01829 CDS open 18879-19793 _na     304_aa Peptidase
3653 CALLUC010000099.1 GCA938011375_01830 CDS open 19839-20261 _na     140_aa NfeD-like C-terminal domain-containing protein
3654 CALLUC010000099.1 GCA938011375_01831 CDS open 20445-23096 _na     883_aa valine--tRNA ligase
3655 CALLUC010000099.1 GCA938011375_01832 CDS open 23201-23674 _na     157_aa rimI ribosomal protein S18-alanine N-acetyltransferase
3656 CALLUC010000099.1 GCA938011375_01833 CDS open 23641-25155 _na     504_aa lepB signal peptidase I
3657 CALLUC010000099.1 GCA938011375_01834 CDS open 25205-25555 _na     116_aa rplS 50S ribosomal protein L19
3658 CALLUC010000099.1 GCA938011375_01835 CDS open 25727-26794 _na     355_aa asparaginase
3659 CALLUC010000099.1 GCA938011375_01836 CDS open 26985-27647 _na     220_aa Cyclic nucleotide-binding domain protein
3660 CALLUC010000099.1 GCA938011375_01837 CDS open 28276-28800 _na     174_aa Nitroreductase family protein
3661 CALLUC010000099.1 GCA938011375_01838 CDS open 28818-29477 _na     219_aa DUF1275 domain-containing protein
3662 CALLUC010000099.1 GCA938011375_01812 gene open 94-315
3663 CALLUC010000099.1 GCA938011375_01813 gene open 312-827
3664 CALLUC010000099.1 GCA938011375_01814 gene open 772-2895
3665 CALLUC010000099.1 GCA938011375_01815 gene open 2955-3245
3666 CALLUC010000099.1 GCA938011375_01816 gene open 3294-4184 tonB
3667 CALLUC010000099.1 GCA938011375_01817 gene open 4217-5110
3668 CALLUC010000099.1 GCA938011375_01818 gene open 5123-5908
3669 CALLUC010000099.1 GCA938011375_01819 gene open 5913-6911
3670 CALLUC010000099.1 GCA938011375_01820 gene open 6901-8916
3671 CALLUC010000099.1 GCA938011375_01821 gene open 8983-9402 exbD
3672 CALLUC010000099.1 GCA938011375_01822 gene open 9460-10107
3673 CALLUC010000099.1 GCA938011375_01823 gene open 10356-10781
3674 CALLUC010000099.1 GCA938011375_01824 gene open 10868-11539
3675 CALLUC010000099.1 GCA938011375_01825 gene open 11604-14789
3676 CALLUC010000099.1 GCA938011375_01826 gene open 14773-17535
3677 CALLUC010000099.1 GCA938011375_01827 gene open 17734-17937 secG
3678 CALLUC010000099.1 GCA938011375_01828 gene open 17975-18742 tpiA
3679 CALLUC010000099.1 GCA938011375_01829 gene open 18879-19793
3680 CALLUC010000099.1 GCA938011375_01830 gene open 19839-20261
3681 CALLUC010000099.1 GCA938011375_01831 gene open 20445-23096
3682 CALLUC010000099.1 GCA938011375_01832 gene open 23201-23674 rimI
3683 CALLUC010000099.1 GCA938011375_01833 gene open 23641-25155 lepB
3684 CALLUC010000099.1 GCA938011375_01834 gene open 25205-25555 rplS
3685 CALLUC010000099.1 GCA938011375_01835 gene open 25727-26794
3686 CALLUC010000099.1 GCA938011375_01836 gene open 26985-27647
3687 CALLUC010000099.1 GCA938011375_01837 gene open 28276-28800
3688 CALLUC010000099.1 GCA938011375_01838 gene open 28818-29477
3689 CALLUC010000100.1 regulatory_region open 3185-3284 Glycine riboswitch aptamer
3690 CALLUC010000100.1 regulatory_region open 8061-8098 Selenocysteine insertion sequence 4
3691 CALLUC010000100.1 GCA938011375_01839 CDS open 222-437 _na     71_aa Heavy metal transporter
3692 CALLUC010000100.1 GCA938011375_01840 CDS open 602-1210 _na     202_aa Methyltransferase
3693 CALLUC010000100.1 GCA938011375_01841 CDS open 1397-1891 _na     164_aa flavodoxin
3694 CALLUC010000100.1 GCA938011375_01842 CDS open 1861-2262 _na     133_aa DUF2023 domain-containing protein
3695 CALLUC010000100.1 GCA938011375_01843 CDS open 2531-3034 _na     167_aa hypothetical protein
3696 CALLUC010000100.1 GCA938011375_01844 CDS open 3378-3749 _na     123_aa grdX GrdX family protein
3697 CALLUC010000100.1 GCA938011375_01845 CDS open 3777-4721 _na     314_aa trxB thioredoxin-disulfide reductase
3698 CALLUC010000100.1 GCA938011375_01846 CDS open 4807-5124 _na     105_aa trxA thioredoxin TrxA
3699 CALLUC010000100.1 GCA938011375_01847 CDS open 5144-6430 _na     428_aa Glycine reductase%2C subunit ABC
3700 CALLUC010000100.1 GCA938011375_01848 CDS open 6520-6984 _na     154_aa grdA glycine/sarcosine/betaine reductase complex selenoprotein A
3701 CALLUC010000100.1 GCA938011375_01849 CDS open 7011-8321 _na     436_aa grdB glycine reductase complex selenoprotein B
3702 CALLUC010000100.1 GCA938011375_01850 CDS open 8364-9926 _na     520_aa Glycine/sarcosine/betaine reductase complex component C subunit beta
3703 CALLUC010000100.1 GCA938011375_01851 CDS open 9943-11085 _na     380_aa grdD glycine/sarcosine/betaine reductase complex component C subunit alpha
3704 CALLUC010000100.1 GCA938011375_01852 CDS open 11371-12783 _na     470_aa Alanine glycine permease
3705 CALLUC010000100.1 GCA938011375_01839 gene open 222-437
3706 CALLUC010000100.1 GCA938011375_01840 gene open 602-1210
3707 CALLUC010000100.1 GCA938011375_01841 gene open 1397-1891
3708 CALLUC010000100.1 GCA938011375_01842 gene open 1861-2262
3709 CALLUC010000100.1 GCA938011375_01843 gene open 2531-3034
3710 CALLUC010000100.1 GCA938011375_01844 gene open 3378-3749 grdX
3711 CALLUC010000100.1 GCA938011375_01845 gene open 3777-4721 trxB
3712 CALLUC010000100.1 GCA938011375_01846 gene open 4807-5124 trxA
3713 CALLUC010000100.1 GCA938011375_01847 gene open 5144-6430
3714 CALLUC010000100.1 GCA938011375_01848 gene open 6520-6984 grdA
3715 CALLUC010000100.1 GCA938011375_01849 gene open 7011-8321 grdB
3716 CALLUC010000100.1 GCA938011375_01850 gene open 8364-9926
3717 CALLUC010000100.1 GCA938011375_01851 gene open 9943-11085 grdD
3718 CALLUC010000100.1 GCA938011375_01852 gene open 11371-12783
3719 CALLUC010000101.1 GCA938011375_01853 CDS open 119-991 _na     290_aa hypothetical protein
3720 CALLUC010000101.1 GCA938011375_01854 CDS open 1017-1772 _na     251_aa thiF ThiF family protein
3721 CALLUC010000101.1 GCA938011375_01853 gene open 119-991
3722 CALLUC010000101.1 GCA938011375_01854 gene open 1017-1772 thiF
3723 CALLUC010000102.1 GCA938011375_01855 CDS open 31-681 _na     216_aa hypothetical protein
3724 CALLUC010000102.1 GCA938011375_01856 CDS open 691-1410 _na     239_aa cobI precorrin-2 C(20)-methyltransferase
3725 CALLUC010000102.1 GCA938011375_01857 CDS open 1452-2519 _na     355_aa yhcG Cytoplasmic protein
3726 CALLUC010000102.1 GCA938011375_01858 CDS open 2503-2841 _na     112_aa hxlR HTH-type transcriptional activator HxlR
3727 CALLUC010000102.1 GCA938011375_01859 CDS open 2858-3274 _na     138_aa Pyridoxamine 5'-phosphate oxidase N-terminal domain-containing protein
3728 CALLUC010000102.1 GCA938011375_01860 CDS open 3382-3495 _na     37_aa hypothetical protein
3729 CALLUC010000102.1 GCA938011375_01861 CDS open 3521-3637 _na     38_aa hypothetical protein
3730 CALLUC010000102.1 GCA938011375_01862 CDS open 3712-4473 _na     253_aa cobM precorrin-4 C(11)-methyltransferase
3731 CALLUC010000102.1 GCA938011375_01863 CDS open 4733-5743 _na     336_aa cbiG cobalt-precorrin 5A hydrolase
3732 CALLUC010000102.1 GCA938011375_01864 CDS open 5736-6476 _na     246_aa Precorrin-3B C(17)-methyltransferase
3733 CALLUC010000102.1 GCA938011375_01865 CDS open 6534-7778 _na     414_aa Radical SAM protein
3734 CALLUC010000102.1 GCA938011375_01866 CDS open 7837-8598 _na     253_aa DUF4130 domain-containing protein
3735 CALLUC010000102.1 GCA938011375_01867 CDS open 8690-9223 _na     177_aa Phosphopentomutase
3736 CALLUC010000102.1 GCA938011375_01868 CDS open 9296-9874 _na     192_aa Diamine acetyltransferase
3737 CALLUC010000102.1 GCA938011375_01869 CDS open 10152-10625 _na     157_aa Acetyltransferase%2C GNAT family
3738 CALLUC010000102.1 GCA938011375_01870 CDS open 10753-11109 _na     118_aa DUF4825 domain-containing protein
3739 CALLUC010000102.1 GCA938011375_01855 gene open 31-681
3740 CALLUC010000102.1 GCA938011375_01856 gene open 691-1410 cobI
3741 CALLUC010000102.1 GCA938011375_01857 gene open 1452-2519 yhcG
3742 CALLUC010000102.1 GCA938011375_01858 gene open 2503-2841 hxlR
3743 CALLUC010000102.1 GCA938011375_01859 gene open 2858-3274
3744 CALLUC010000102.1 GCA938011375_01860 gene open 3382-3495
3745 CALLUC010000102.1 GCA938011375_01861 gene open 3521-3637
3746 CALLUC010000102.1 GCA938011375_01862 gene open 3712-4473 cobM
3747 CALLUC010000102.1 GCA938011375_01863 gene open 4733-5743 cbiG
3748 CALLUC010000102.1 GCA938011375_01864 gene open 5736-6476
3749 CALLUC010000102.1 GCA938011375_01865 gene open 6534-7778
3750 CALLUC010000102.1 GCA938011375_01866 gene open 7837-8598
3751 CALLUC010000102.1 GCA938011375_01867 gene open 8690-9223
3752 CALLUC010000102.1 GCA938011375_01868 gene open 9296-9874
3753 CALLUC010000102.1 GCA938011375_01869 gene open 10152-10625
3754 CALLUC010000102.1 GCA938011375_01870 gene open 10753-11109
3755 CALLUC010000103.1 GCA938011375_01871 CDS open 144-701 _na     185_aa DNA-3-methyladenine glycosylase
3756 CALLUC010000103.1 GCA938011375_01872 CDS open 721-1137 _na     138_aa Pyridoxamine 5'-phosphate oxidase family protein
3757 CALLUC010000103.1 GCA938011375_01873 CDS open 1237-1902 _na     221_aa Transcriptional regulator
3758 CALLUC010000103.1 GCA938011375_01874 CDS open 2029-3018 _na     329_aa Phosphate ABC transporter substrate-binding protein
3759 CALLUC010000103.1 GCA938011375_01875 CDS open 3167-3919 _na     250_aa phnC phosphonate ABC transporter ATP-binding protein
3760 CALLUC010000103.1 GCA938011375_01876 CDS open 3976-4770 _na     264_aa Phosphonate ABC transporter permease
3761 CALLUC010000103.1 GCA938011375_01877 CDS open 4792-5634 _na     280_aa ABC transporter permease
3762 CALLUC010000103.1 GCA938011375_01878 CDS open 5830-8580 _na     916_aa ftsK Cell division protein FtsK
3763 CALLUC010000103.1 GCA938011375_01879 CDS open 8607-9647 _na     346_aa mreB Cell shape-determining protein MreB
3764 CALLUC010000103.1 GCA938011375_01880 CDS open 9678-10310 _na     210_aa scpB SMC-Scp complex subunit ScpB
3765 CALLUC010000103.1 GCA938011375_01881 CDS open 10297-10983 _na     228_aa Pseudouridine synthase
3766 CALLUC010000103.1 GCA938011375_01882 CDS open 11034-11675 _na     213_aa HAD phosphoserine phosphatase-like hydrolase%2C family IB
3767 CALLUC010000103.1 GCA938011375_01883 CDS open 11708-11911 _na     67_aa DpnD/PcfM-like C-terminal domain-containing protein
3768 CALLUC010000103.1 GCA938011375_01884 CDS open 11971-13437 _na     488_aa Sau3AI family type II restriction endonuclease
3769 CALLUC010000103.1 GCA938011375_01885 CDS open 13437-14669 _na     410_aa Cytosine-specific methyltransferase
3770 CALLUC010000103.1 GCA938011375_01886 CDS open 14686-14985 _na     99_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
3771 CALLUC010000103.1 GCA938011375_01887 CDS open 15009-15752 _na     247_aa DUF4253 domain-containing protein
3772 CALLUC010000103.1 GCA938011375_01888 CDS open 15772-17235 _na     487_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
3773 CALLUC010000103.1 GCA938011375_01889 CDS open 17269-18339 _na     356_aa DUF3829 domain-containing protein
3774 CALLUC010000103.1 GCA938011375_01890 CDS open 18421-19854 _na     477_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
3775 CALLUC010000103.1 GCA938011375_01891 CDS open 19867-21867 _na     666_aa Peptidoglycan glycosyltransferase
3776 CALLUC010000103.1 GCA938011375_01892 CDS open 21901-24111 _na     736_aa priA primosomal protein N'
3777 CALLUC010000103.1 GCA938011375_01893 CDS open 24155-24484 _na     109_aa ylxM YlxM family DNA-binding protein
3778 CALLUC010000103.1 GCA938011375_01894 CDS open 24484-25830 _na     448_aa ffh signal recognition particle protein
3779 CALLUC010000103.1 GCA938011375_01895 CDS open 25934-26956 _na     340_aa Sel1 repeat family protein
3780 CALLUC010000103.1 GCA938011375_01896 CDS open 27168-28553 _na     461_aa Multidrug-efflux transporter
3781 CALLUC010000103.1 GCA938011375_01897 CDS open 28756-29484 _na     242_aa Methyltransferase type 11
3782 CALLUC010000103.1 GCA938011375_01898 CDS open 29551-29742 _na     63_aa hicA Toxin-antitoxin system%2C toxin component%2C HicA family
3783 CALLUC010000103.1 GCA938011375_01899 CDS open 29758-30150 _na     130_aa hicB Toxin-antitoxin system%2C antitoxin component%2C HicB family
3784 CALLUC010000103.1 GCA938011375_01900 CDS open 30176-31090 _na     304_aa lysR HTH lysR-type domain-containing protein
3785 CALLUC010000103.1 GCA938011375_01871 gene open 144-701
3786 CALLUC010000103.1 GCA938011375_01872 gene open 721-1137
3787 CALLUC010000103.1 GCA938011375_01873 gene open 1237-1902
3788 CALLUC010000103.1 GCA938011375_01874 gene open 2029-3018
3789 CALLUC010000103.1 GCA938011375_01875 gene open 3167-3919 phnC
3790 CALLUC010000103.1 GCA938011375_01876 gene open 3976-4770
3791 CALLUC010000103.1 GCA938011375_01877 gene open 4792-5634
3792 CALLUC010000103.1 GCA938011375_01878 gene open 5830-8580 ftsK
3793 CALLUC010000103.1 GCA938011375_01879 gene open 8607-9647 mreB
3794 CALLUC010000103.1 GCA938011375_01880 gene open 9678-10310 scpB
3795 CALLUC010000103.1 GCA938011375_01881 gene open 10297-10983
3796 CALLUC010000103.1 GCA938011375_01882 gene open 11034-11675
3797 CALLUC010000103.1 GCA938011375_01883 gene open 11708-11911
3798 CALLUC010000103.1 GCA938011375_01884 gene open 11971-13437
3799 CALLUC010000103.1 GCA938011375_01885 gene open 13437-14669
3800 CALLUC010000103.1 GCA938011375_01886 gene open 14686-14985 gatC
3801 CALLUC010000103.1 GCA938011375_01887 gene open 15009-15752
3802 CALLUC010000103.1 GCA938011375_01888 gene open 15772-17235 gatA
3803 CALLUC010000103.1 GCA938011375_01889 gene open 17269-18339
3804 CALLUC010000103.1 GCA938011375_01890 gene open 18421-19854 gatB
3805 CALLUC010000103.1 GCA938011375_01891 gene open 19867-21867
3806 CALLUC010000103.1 GCA938011375_01892 gene open 21901-24111 priA
3807 CALLUC010000103.1 GCA938011375_01893 gene open 24155-24484 ylxM
3808 CALLUC010000103.1 GCA938011375_01894 gene open 24484-25830 ffh
3809 CALLUC010000103.1 GCA938011375_01895 gene open 25934-26956
3810 CALLUC010000103.1 GCA938011375_01896 gene open 27168-28553
3811 CALLUC010000103.1 GCA938011375_01897 gene open 28756-29484
3812 CALLUC010000103.1 GCA938011375_01898 gene open 29551-29742 hicA
3813 CALLUC010000103.1 GCA938011375_01899 gene open 29758-30150 hicB
3814 CALLUC010000103.1 GCA938011375_01900 gene open 30176-31090 lysR
3815 CALLUC010000104.1 GCA938011375_01901 CDS open 74-2704 _na     876_aa mutS DNA mismatch repair protein MutS
3816 CALLUC010000104.1 GCA938011375_01902 CDS open 2704-5079 _na     791_aa lptC LPS export ABC transporter periplasmic protein LptC
3817 CALLUC010000104.1 GCA938011375_01903 CDS open 5128-5862 _na     244_aa lptB LPS export ABC transporter ATP-binding protein
3818 CALLUC010000104.1 GCA938011375_01904 CDS open 5892-8504 _na     870_aa alaS alanine--tRNA ligase
3819 CALLUC010000104.1 GCA938011375_01905 CDS open 8546-8962 _na     138_aa ruvX Holliday junction resolvase RuvX
3820 CALLUC010000104.1 GCA938011375_01906 CDS open 9012-10241 _na     409_aa secD Protein translocase subunit SecD
3821 CALLUC010000104.1 GCA938011375_01907 CDS open 10213-11187 _na     324_aa secF Protein-export membrane protein SecF
3822 CALLUC010000104.1 GCA938011375_01908 CDS open 11549-12628 _na     359_aa alr alanine racemase
3823 CALLUC010000104.1 GCA938011375_01909 CDS open 12663-13238 _na     191_aa Colicin V production protein
3824 CALLUC010000104.1 GCA938011375_01910 CDS open 13268-14371 _na     367_aa Permease%2C YjgP/YjgQ family
3825 CALLUC010000104.1 GCA938011375_01911 CDS open 14376-15452 _na     358_aa Permease%2C YjgP/YjgQ family
3826 CALLUC010000104.1 GCA938011375_01901 gene open 74-2704 mutS
3827 CALLUC010000104.1 GCA938011375_01902 gene open 2704-5079 lptC
3828 CALLUC010000104.1 GCA938011375_01903 gene open 5128-5862 lptB
3829 CALLUC010000104.1 GCA938011375_01904 gene open 5892-8504 alaS
3830 CALLUC010000104.1 GCA938011375_01905 gene open 8546-8962 ruvX
3831 CALLUC010000104.1 GCA938011375_01906 gene open 9012-10241 secD
3832 CALLUC010000104.1 GCA938011375_01907 gene open 10213-11187 secF
3833 CALLUC010000104.1 GCA938011375_01908 gene open 11549-12628 alr
3834 CALLUC010000104.1 GCA938011375_01909 gene open 12663-13238
3835 CALLUC010000104.1 GCA938011375_01910 gene open 13268-14371
3836 CALLUC010000104.1 GCA938011375_01911 gene open 14376-15452
3837 CALLUC010000105.1 GCA938011375_01912 CDS open 84-398 _na     104_aa hypothetical protein
3838 CALLUC010000105.1 GCA938011375_01913 CDS open 627-773 _na     48_aa hypothetical protein
3839 CALLUC010000105.1 GCA938011375_01914 CDS open 1435-1914 _na     159_aa NADH dehydrogenase
3840 CALLUC010000105.1 GCA938011375_01915 CDS open 2504-3253 _na     249_aa MgtC/SapB/SrpB/YhiD N-terminal domain-containing protein
3841 CALLUC010000105.1 GCA938011375_01916 CDS open 3317-3637 _na     106_aa tfoX TfoX N-terminal domain-containing protein
3842 CALLUC010000105.1 GCA938011375_01912 gene open 84-398
3843 CALLUC010000105.1 GCA938011375_01913 gene open 627-773
3844 CALLUC010000105.1 GCA938011375_01914 gene open 1435-1914
3845 CALLUC010000105.1 GCA938011375_01915 gene open 2504-3253
3846 CALLUC010000105.1 GCA938011375_01916 gene open 3317-3637 tfoX
3847 CALLUC010000106.1 GCA938011375_01917 CDS open 174-920 _na     248_aa hypothetical protein
3848 CALLUC010000106.1 GCA938011375_01918 CDS open 898-1761 _na     287_aa hypothetical protein
3849 CALLUC010000106.1 GCA938011375_01919 CDS open 1789-2604 _na     271_aa Shikimate dehydrogenase (NADP(+))
3850 CALLUC010000106.1 GCA938011375_01920 CDS open 2626-3372 _na     248_aa Pseudouridine synthase
3851 CALLUC010000106.1 GCA938011375_01921 CDS open 3394-4563 _na     389_aa Bifunctional chorismate mutase/prephenate dehydratase
3852 CALLUC010000106.1 GCA938011375_01922 CDS open 4661-5278 _na     205_aa hypothetical protein
3853 CALLUC010000106.1 GCA938011375_01923 CDS open 5504-6769 _na     421_aa Glycosyltransferase family 28 protein
3854 CALLUC010000106.1 GCA938011375_01924 CDS open 6824-8449 _na     541_aa Uracil-DNA glycosylase
3855 CALLUC010000106.1 GCA938011375_01925 CDS open 8474-8950 _na     158_aa hypothetical protein
3856 CALLUC010000106.1 GCA938011375_01917 gene open 174-920
3857 CALLUC010000106.1 GCA938011375_01918 gene open 898-1761
3858 CALLUC010000106.1 GCA938011375_01919 gene open 1789-2604
3859 CALLUC010000106.1 GCA938011375_01920 gene open 2626-3372
3860 CALLUC010000106.1 GCA938011375_01921 gene open 3394-4563
3861 CALLUC010000106.1 GCA938011375_01922 gene open 4661-5278
3862 CALLUC010000106.1 GCA938011375_01923 gene open 5504-6769
3863 CALLUC010000106.1 GCA938011375_01924 gene open 6824-8449
3864 CALLUC010000106.1 GCA938011375_01925 gene open 8474-8950
3865 CALLUC010000107.1 GCA938011375_01926 CDS open 485-1240 _na     251_aa lktB Leukotoxin translocation ATP-binding protein LktB
3866 CALLUC010000107.1 GCA938011375_01927 CDS open 1249-2013 _na     254_aa Transport permease protein
3867 CALLUC010000107.1 GCA938011375_01928 CDS open 1997-3493 _na     498_aa hypothetical protein
3868 CALLUC010000107.1 GCA938011375_01929 CDS open 3505-4269 _na     254_aa Glycosyltransferase 2-like domain-containing protein
3869 CALLUC010000107.1 GCA938011375_01930 CDS open 4287-5582 _na     431_aa Exopolysaccharide biosynthesis polyprenyl glycosylphosphotransferase
3870 CALLUC010000107.1 GCA938011375_01931 CDS open 5723-6664 _na     313_aa galU UTP--glucose-1-phosphate uridylyltransferase GalU
3871 CALLUC010000107.1 GCA938011375_01932 CDS open 6835-7446 _na     203_aa Outer membrane protein beta-barrel domain-containing protein
3872 CALLUC010000107.1 GCA938011375_01933 CDS open 7620-8291 _na     223_aa ABC transporter permease
3873 CALLUC010000107.1 GCA938011375_01926 gene open 485-1240 lktB
3874 CALLUC010000107.1 GCA938011375_01927 gene open 1249-2013
3875 CALLUC010000107.1 GCA938011375_01928 gene open 1997-3493
3876 CALLUC010000107.1 GCA938011375_01929 gene open 3505-4269
3877 CALLUC010000107.1 GCA938011375_01930 gene open 4287-5582
3878 CALLUC010000107.1 GCA938011375_01931 gene open 5723-6664 galU
3879 CALLUC010000107.1 GCA938011375_01932 gene open 6835-7446
3880 CALLUC010000107.1 GCA938011375_01933 gene open 7620-8291
3881 CALLUC010000108.1 GCA938011375_01934 CDS open 162-398 _na     78_aa hypothetical protein
3882 CALLUC010000108.1 GCA938011375_01935 CDS open 457-882 _na     141_aa Lipocalin-like domain-containing protein
3883 CALLUC010000108.1 GCA938011375_01936 CDS open 967-2082 _na     371_aa Lipoprotein
3884 CALLUC010000108.1 GCA938011375_01937 CDS open 2121-2723 _na     200_aa psbP PsbP C-terminal domain-containing protein
3885 CALLUC010000108.1 GCA938011375_01938 CDS open 2820-3107 _na     95_aa ubiquinol-cytochrome C reductase
3886 CALLUC010000108.1 GCA938011375_01939 CDS open 3771-4898 _na     375_aa Acyl-CoA dehydrogenase protein
3887 CALLUC010000108.1 GCA938011375_01940 CDS open 4929-5744 _na     271_aa Phosphate/phosphite/phosphonate ABC transporter%2C periplasmic binding protein
3888 CALLUC010000108.1 GCA938011375_01941 CDS open 5754-6932 _na     392_aa Methionine synthase%2C vitamin-B12 independent
3889 CALLUC010000108.1 GCA938011375_01942 CDS open 6925-7392 _na     155_aa OsmC-like protein
3890 CALLUC010000108.1 GCA938011375_01944 CDS open 7942-8763 _na     273_aa selD selenide%2C water dikinase SelD
3891 CALLUC010000108.1 GCA938011375_01945 CDS open 8838-9653 _na     271_aa yedF sulfurtransferase-like selenium metabolism protein YedF
3892 CALLUC010000108.1 GCA938011375_01946 CDS open 9664-9963 _na     99_aa Putative Se/S carrier protein-like domain-containing protein
3893 CALLUC010000108.1 GCA938011375_01947 CDS open 9981-11864 _na     627_aa selB selenocysteine-specific translation elongation factor
3894 CALLUC010000108.1 GCA938011375_01948 CDS open 11868-13241 _na     457_aa selA L-seryl-tRNA(Sec) selenium transferase
3895 CALLUC010000108.1 GCA938011375_01949 CDS open 13516-14664 _na     382_aa double-cubane-cluster-containing anaerobic reductase
3896 CALLUC010000108.1 GCA938011375_01950 CDS open 14692-15474 _na     260_aa Putative R-phenyllactate dehydratase activator
3897 CALLUC010000108.1 GCA938011375_01951 CDS open 15594-16532 _na     312_aa C4-dicarboxylate transporter/malic acid transport protein
3898 CALLUC010000108.1 GCA938011375_01952 CDS open 16590-18254 _na     554_aa Solute-binding protein family 5 domain-containing protein
3899 CALLUC010000108.1 GCA938011375_01953 CDS open 18289-19242 _na     317_aa ABC transmembrane type-1 domain-containing protein
3900 CALLUC010000108.1 GCA938011375_01954 CDS open 19244-20047 _na     267_aa ABC transmembrane type-1 domain-containing protein
3901 CALLUC010000108.1 GCA938011375_01955 CDS open 20031-20783 _na     250_aa ABC transporter domain-containing protein
3902 CALLUC010000108.1 GCA938011375_01956 CDS open 20784-21401 _na     205_aa ABC transporter domain-containing protein
3903 CALLUC010000108.1 GCA938011375_01957 CDS open 21532-22665 _na     377_aa Acyl-CoA dehydrogenase
3904 CALLUC010000108.1 GCA938011375_01958 CDS open 22969-23058 _na     29_aa hypothetical protein
3905 CALLUC010000108.1 GCA938011375_01959 CDS open 23555-25009 _na     484_aa fUI1 NCS1 nucleoside transporter family protein
3906 CALLUC010000108.1 GCA938011375_01934 gene open 162-398
3907 CALLUC010000108.1 GCA938011375_01935 gene open 457-882
3908 CALLUC010000108.1 GCA938011375_01936 gene open 967-2082
3909 CALLUC010000108.1 GCA938011375_01937 gene open 2121-2723 psbP
3910 CALLUC010000108.1 GCA938011375_01938 gene open 2820-3107
3911 CALLUC010000108.1 GCA938011375_01939 gene open 3771-4898
3912 CALLUC010000108.1 GCA938011375_01940 gene open 4929-5744
3913 CALLUC010000108.1 GCA938011375_01941 gene open 5754-6932
3914 CALLUC010000108.1 GCA938011375_01942 gene open 6925-7392
3915 CALLUC010000108.1 GCA938011375_01944 gene open 7942-8763 selD
3916 CALLUC010000108.1 GCA938011375_01945 gene open 8838-9653 yedF
3917 CALLUC010000108.1 GCA938011375_01946 gene open 9664-9963
3918 CALLUC010000108.1 GCA938011375_01947 gene open 9981-11864 selB
3919 CALLUC010000108.1 GCA938011375_01948 gene open 11868-13241 selA
3920 CALLUC010000108.1 GCA938011375_01949 gene open 13516-14664
3921 CALLUC010000108.1 GCA938011375_01950 gene open 14692-15474
3922 CALLUC010000108.1 GCA938011375_01951 gene open 15594-16532
3923 CALLUC010000108.1 GCA938011375_01952 gene open 16590-18254
3924 CALLUC010000108.1 GCA938011375_01953 gene open 18289-19242
3925 CALLUC010000108.1 GCA938011375_01954 gene open 19244-20047
3926 CALLUC010000108.1 GCA938011375_01955 gene open 20031-20783
3927 CALLUC010000108.1 GCA938011375_01956 gene open 20784-21401
3928 CALLUC010000108.1 GCA938011375_01957 gene open 21532-22665
3929 CALLUC010000108.1 GCA938011375_01958 gene open 22969-23058
3930 CALLUC010000108.1 GCA938011375_01959 gene open 23555-25009 fUI1
3931 CALLUC010000108.1 GCA938011375_01943 gene open 7444-7540 trnU
3932 CALLUC010000108.1 GCA938011375_01943 tRNA open 7444-7540 trnU tRNA-SeC(tca)
3933 CALLUC010000109.1 repeat_region open 26601-28000 CRISPR array with 21 repeats of length 36%2C consensus sequence GTTTTAGTCCCCTTCGATATTGGGGTGGTCTATATC and spacer length 31
3934 CALLUC010000109.1 GCA938011375_01960 CDS open 76-936 _na     286_aa htpX zinc metalloprotease HtpX
3935 CALLUC010000109.1 GCA938011375_01961 CDS open 1111-1821 _na     236_aa OmpA-like domain-containing protein
3936 CALLUC010000109.1 GCA938011375_01962 CDS open 2100-3188 _na     362_aa ABC 3 transport family protein
3937 CALLUC010000109.1 GCA938011375_01963 CDS open 3185-4153 _na     322_aa ABC 3 transport family protein
3938 CALLUC010000109.1 GCA938011375_01964 CDS open 4158-4967 _na     269_aa mntA Putative manganese transport system ATP-binding protein MntA
3939 CALLUC010000109.1 GCA938011375_01965 CDS open 5010-5978 _na     322_aa ABC transporter%2C substrate-binding protein
3940 CALLUC010000109.1 GCA938011375_01966 CDS open 5968-6642 _na     224_aa dtxR DtxR family transcriptional regulator
3941 CALLUC010000109.1 GCA938011375_01967 CDS open 6859-7134 _na     91_aa Tat pathway signal sequence domain protein
3942 CALLUC010000109.1 GCA938011375_01968 CDS open 7152-7898 _na     248_aa F-box domain-containing protein
3943 CALLUC010000109.1 GCA938011375_01969 CDS open 7913-10087 _na     724_aa Heavy metal translocating P-type ATPase
3944 CALLUC010000109.1 GCA938011375_01970 CDS open 10077-10466 _na     129_aa Cation transporter
3945 CALLUC010000109.1 GCA938011375_01971 CDS open 10466-10951 _na     161_aa Heavy metal translocating P-type ATPase
3946 CALLUC010000109.1 GCA938011375_01972 CDS open 11039-11956 _na     305_aa DUF1385 domain-containing protein
3947 CALLUC010000109.1 GCA938011375_01973 CDS open 11988-13061 _na     357_aa disA DNA integrity scanning diadenylate cyclase DisA
3948 CALLUC010000109.1 GCA938011375_01974 CDS open 13062-14429 _na     455_aa radA DNA repair protein RadA
3949 CALLUC010000109.1 GCA938011375_01975 CDS open 14449-14949 _na     166_aa coaD pantetheine-phosphate adenylyltransferase
3950 CALLUC010000109.1 GCA938011375_01976 CDS open 15026-15730 _na     234_aa rnc ribonuclease III
3951 CALLUC010000109.1 GCA938011375_01977 CDS open 15886-17121 _na     411_aa fabF beta-ketoacyl-ACP synthase II
3952 CALLUC010000109.1 GCA938011375_01978 CDS open 17249-17473 _na     74_aa acyl carrier protein
3953 CALLUC010000109.1 GCA938011375_01979 CDS open 17542-18459 _na     305_aa fabD ACP S-malonyltransferase
3954 CALLUC010000109.1 GCA938011375_01980 CDS open 18545-18943 _na     132_aa liaF LiaF transmembrane domain-containing protein
3955 CALLUC010000109.1 GCA938011375_01981 CDS open 18979-19956 _na     325_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
3956 CALLUC010000109.1 GCA938011375_01982 CDS open 20148-20348 _na     66_aa rpmF 50S ribosomal protein L32
3957 CALLUC010000109.1 GCA938011375_01983 CDS open 20495-21085 _na     196_aa hypothetical protein
3958 CALLUC010000109.1 GCA938011375_01984 CDS open 21127-22356 _na     409_aa G domain-containing protein
3959 CALLUC010000109.1 GCA938011375_01985 CDS open 22440-23183 _na     247_aa Calcineurin-like phosphoesterase domain-containing protein
3960 CALLUC010000109.1 GCA938011375_01986 CDS open 23303-25012 _na     569_aa AAA-ATPase-like domain-containing protein
3961 CALLUC010000109.1 GCA938011375_01987 CDS open 25289-25462 _na     57_aa hypothetical protein
3962 CALLUC010000109.1 GCA938011375_01988 CDS open 25769-26098 _na     109_aa Glyoxalase family protein
3963 CALLUC010000109.1 GCA938011375_01989 CDS open 26088-26552 _na     154_aa Activator of Hsp90 ATPase-like ue 1/2-like C-terminal domain-containing protein
3964 CALLUC010000109.1 GCA938011375_01990 CDS open 28132-28455 _na     107_aa CRISPR-associated endoribonuclease Cas2
3965 CALLUC010000109.1 GCA938011375_01991 CDS open 28439-29353 _na     304_aa CRISPR-associated endonuclease Cas1
3966 CALLUC010000109.1 GCA938011375_01992 CDS open 29384-33607 _na     1407_aa CRISPR-associated endoribonuclease Cas13a
3967 CALLUC010000109.1 GCA938011375_01993 CDS open 33860-34822 _na     320_aa WYL domain-containing protein
3968 CALLUC010000109.1 GCA938011375_01994 CDS open 35234-35371 _na     45_aa hypothetical protein
3969 CALLUC010000109.1 GCA938011375_01995 CDS open 35399-35860 _na     153_aa C-type lectin domain-containing protein
3970 CALLUC010000109.1 GCA938011375_01996 CDS open 35918-37732 _na     604_aa typA translational GTPase TypA
3971 CALLUC010000109.1 GCA938011375_01997 CDS open 38062-39735 _na     557_aa hypothetical protein
3972 CALLUC010000109.1 GCA938011375_01998 CDS open 40098-41093 _na     331_aa ABC transporter substrate binding protein
3973 CALLUC010000109.1 GCA938011375_01999 CDS open 41205-43436 _na     743_aa Copper-exporting ATPase
3974 CALLUC010000109.1 GCA938011375_02000 CDS open 43479-43955 _na     158_aa CopY/TcrY family copper transport repressor
3975 CALLUC010000109.1 GCA938011375_02001 CDS open 44176-44991 _na     271_aa Cof-like hydrolase
3976 CALLUC010000109.1 GCA938011375_02002 CDS open 45118-45657 _na     179_aa Flavin reductase like domain-containing protein
3977 CALLUC010000109.1 GCA938011375_02003 CDS open 45809-46057 _na     82_aa DUF2442 domain-containing protein
3978 CALLUC010000109.1 GCA938011375_02004 CDS open 46072-46326 _na     84_aa DUF4160 domain-containing protein
3979 CALLUC010000109.1 GCA938011375_02005 CDS open 46520-47164 _na     214_aa V-type ATP synthase subunit D
3980 CALLUC010000109.1 GCA938011375_02006 CDS open 47167-48546 _na     459_aa ntpB V-type ATP synthase beta chain
3981 CALLUC010000109.1 GCA938011375_02007 CDS open 48539-50311 _na     590_aa ntpA V-type ATP synthase alpha chain
3982 CALLUC010000109.1 GCA938011375_02008 CDS open 50366-50674 _na     102_aa V-type ATP synthase subunit F
3983 CALLUC010000109.1 GCA938011375_02009 CDS open 50667-51668 _na     333_aa V-type ATP synthase subunit C
3984 CALLUC010000109.1 GCA938011375_02010 CDS open 51695-52249 _na     184_aa V-type proton ATPase subunit E
3985 CALLUC010000109.1 GCA938011375_02011 CDS open 52274-52753 _na     159_aa V-type ATP synthase subunit K
3986 CALLUC010000109.1 GCA938011375_02012 CDS open 52839-54803 _na     654_aa V-type ATP synthase subunit I
3987 CALLUC010000109.1 GCA938011375_02013 CDS open 54803-55114 _na     103_aa ATP synthase archaeal%2C H subunit
3988 CALLUC010000109.1 GCA938011375_02014 CDS open 55436-55825 _na     129_aa ftsL Cell division protein FtsL
3989 CALLUC010000109.1 GCA938011375_02015 CDS open 55828-56784 _na     318_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
3990 CALLUC010000109.1 GCA938011375_02016 CDS open 56815-57240 _na     141_aa mraZ division/cell wall cluster transcriptional repressor MraZ
3991 CALLUC010000109.1 GCA938011375_02017 CDS open 57585-58139 _na     184_aa DJ-1 family glyoxalase III
3992 CALLUC010000109.1 GCA938011375_02018 CDS open 58230-59939 _na     569_aa Phosphoenolpyruvate-protein phosphotransferase
3993 CALLUC010000109.1 GCA938011375_02019 CDS open 60027-61238 _na     403_aa Metallo-beta-lactamase domain protein
3994 CALLUC010000109.1 GCA938011375_02020 CDS open 61295-62065 _na     256_aa Ankyrin repeat protein
3995 CALLUC010000109.1 GCA938011375_02021 CDS open 62229-62675 _na     148_aa bcp thioredoxin-dependent thiol peroxidase
3996 CALLUC010000109.1 GCA938011375_02022 CDS open 62697-65372 _na     891_aa ftsH ATP-dependent zinc metalloprotease FtsH
3997 CALLUC010000109.1 GCA938011375_02023 CDS open 65362-66717 _na     451_aa tRNA(Ile)-lysidine synthase
3998 CALLUC010000109.1 GCA938011375_02024 CDS open 66736-67686 _na     316_aa Endolytic murein transglycosylase
3999 CALLUC010000109.1 GCA938011375_02025 CDS open 67778-68593 _na     271_aa hypothetical protein
4000 CALLUC010000109.1 GCA938011375_02026 CDS open 68755-69708 _na     317_aa Membrane associated protein