HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptostreptococcaceae [G1 Eubacterium"]" sulci (GCA_938014155.1)

Select a Genome:
BAKTA Annotations for GCA_938014155.1
Genome Selected: Peptostreptococcaceae [G1 Eubacterium"]" sulci
ContigsBases CDSrRNA tmRNAtRNA
24 1790637 1667 0 1 32
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3431 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3431 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CALLSA010000013.1 GCA938014155_01056 CDS open 131287-131685 _na     132_aa rpsH 30S ribosomal protein S8
2002 CALLSA010000013.1 GCA938014155_01057 CDS open 131698-132240 _na     180_aa rplF 50S ribosomal protein L6
2003 CALLSA010000013.1 GCA938014155_01058 CDS open 132258-132623 _na     121_aa rplR 50S ribosomal protein L18
2004 CALLSA010000013.1 GCA938014155_01059 CDS open 132640-133143 _na     167_aa rpsE 30S ribosomal protein S5
2005 CALLSA010000013.1 GCA938014155_01060 CDS open 133155-133337 _na     60_aa rpmD 50S ribosomal protein L30
2006 CALLSA010000013.1 GCA938014155_01061 CDS open 133356-133796 _na     146_aa rplO 50S ribosomal protein L15
2007 CALLSA010000013.1 GCA938014155_01062 CDS open 133798-135081 _na     427_aa secY preprotein translocase subunit SecY
2008 CALLSA010000013.1 GCA938014155_01063 CDS open 135096-135743 _na     215_aa adenylate kinase
2009 CALLSA010000013.1 GCA938014155_01064 CDS open 135746-136507 _na     253_aa map type I methionyl aminopeptidase
2010 CALLSA010000013.1 GCA938014155_01065 CDS open 136513-136731 _na     72_aa infA translation initiation factor IF-1
2011 CALLSA010000013.1 GCA938014155_01066 CDS open 136782-136895 _na     37_aa rpmJ 50S ribosomal protein L36
2012 CALLSA010000013.1 GCA938014155_01067 CDS open 137016-137384 _na     122_aa rpsM 30S ribosomal protein S13
2013 CALLSA010000013.1 GCA938014155_01068 CDS open 137402-137800 _na     132_aa rpsK 30S ribosomal protein S11
2014 CALLSA010000013.1 GCA938014155_01069 CDS open 137822-138409 _na     195_aa rpsD 30S ribosomal protein S4
2015 CALLSA010000013.1 GCA938014155_01070 CDS open 138463-139407 _na     314_aa DNA-directed RNA polymerase subunit alpha
2016 CALLSA010000013.1 GCA938014155_01071 CDS open 139432-139773 _na     113_aa rplQ 50S ribosomal protein L17
2017 CALLSA010000013.1 GCA938014155_01072 CDS open 139824-140387 _na     187_aa ahpC alkyl hydroperoxide reductase subunit C
2018 CALLSA010000013.1 GCA938014155_01073 CDS open 140552-140719 _na     55_aa hypothetical protein
2019 CALLSA010000013.1 GCA938014155_01074 CDS open 141011-141814 _na     267_aa Xylose isomerase-like TIM barrel domain-containing protein
2020 CALLSA010000013.1 GCA938014155_01075 CDS open 141830-144055 _na     741_aa DNA 3'-5' helicase
2021 CALLSA010000013.1 GCA938014155_01076 CDS open 144079-146055 _na     658_aa ligA NAD-dependent DNA ligase LigA
2022 CALLSA010000013.1 GCA938014155_01077 CDS open 146072-147070 _na     332_aa AIR synthase
2023 CALLSA010000013.1 GCA938014155_01080 CDS open 147337-149082 _na     581_aa DNA-directed DNA polymerase
2024 CALLSA010000013.1 GCA938014155_01081 CDS open 149094-149462 _na     122_aa Nucleoid-associated protein CLL_A3446
2025 CALLSA010000013.1 GCA938014155_01082 CDS open 149474-150073 _na     199_aa recR recombination mediator RecR
2026 CALLSA010000013.1 GCA938014155_01083 CDS open 150423-151823 _na     466_aa Transporter
2027 CALLSA010000013.1 GCA938014155_01084 CDS open 151853-153271 _na     472_aa Transporter
2028 CALLSA010000013.1 GCA938014155_01085 CDS open 153457-153741 _na     94_aa sdpR Autorepressor SdpR family transcription factor
2029 CALLSA010000013.1 GCA938014155_01086 CDS open 153725-154366 _na     213_aa hypothetical protein
2030 CALLSA010000013.1 GCA938014155_01087 CDS open 154408-155052 _na     214_aa putative membrane protein
2031 CALLSA010000013.1 GCA938014155_01088 CDS open 155354-156568 _na     404_aa Amidohydrolase-related domain-containing protein
2032 CALLSA010000013.1 GCA938014155_01089 CDS open 156628-159801 _na     1057_aa carB carbamoyl-phosphate synthase large subunit
2033 CALLSA010000013.1 GCA938014155_01090 CDS open 159902-160633 _na     243_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
2034 CALLSA010000013.1 GCA938014155_01091 CDS open 160627-161538 _na     303_aa dihydroorotate dehydrogenase
2035 CALLSA010000013.1 GCA938014155_01092 CDS open 161538-162266 _na     242_aa pyrF orotidine-5'-phosphate decarboxylase
2036 CALLSA010000013.1 GCA938014155_01093 CDS open 162287-162931 _na     214_aa Orotate phosphoribosyltransferase
2037 CALLSA010000013.1 GCA938014155_01094 CDS open 162919-164049 _na     376_aa Aspartate carbamoyltransferase
2038 CALLSA010000013.1 GCA938014155_01095 CDS open 164143-164301 _na     52_aa hypothetical protein
2039 CALLSA010000013.1 GCA938014155_01096 CDS open 164403-165623 _na     406_aa BioF2-like acetyltransferase domain-containing protein
2040 CALLSA010000013.1 GCA938014155_01097 CDS open 165669-166901 _na     410_aa BioF2-like acetyltransferase domain-containing protein
2041 CALLSA010000013.1 GCA938014155_01098 CDS open 167024-168247 _na     407_aa Peptidase M20 dimerisation domain-containing protein
2042 CALLSA010000013.1 GCA938014155_01099 CDS open 168478-169287 _na     269_aa D-aminopeptidase
2043 CALLSA010000013.1 GCA938014155_01100 CDS open 169336-170400 _na     354_aa D-aminopeptidase
2044 CALLSA010000013.1 GCA938014155_01101 CDS open 170416-171129 _na     237_aa Aspartate racemase
2045 CALLSA010000013.1 GCA938014155_01102 CDS open 171133-171588 _na     151_aa D-aminoacyl-tRNA deacylase
2046 CALLSA010000013.1 GCA938014155_01103 CDS open 171724-172635 _na     303_aa Cobalt transport protein
2047 CALLSA010000013.1 GCA938014155_01104 CDS open 172608-174278 _na     556_aa energy-coupling factor transporter ATPase
2048 CALLSA010000013.1 GCA938014155_01105 CDS open 174257-175231 _na     324_aa ECF transporter S component
2049 CALLSA010000013.1 GCA938014155_01106 CDS open 175247-175777 _na     176_aa Transcobalamin-like C-terminal domain-containing protein
2050 CALLSA010000013.1 GCA938014155_01107 CDS open 175788-177635 _na     615_aa Ig-like domain-containing protein
2051 CALLSA010000013.1 GCA938014155_01108 CDS open 177632-178723 _na     363_aa Squalene cyclase C-terminal domain-containing protein
2052 CALLSA010000013.1 GCA938014155_01109 CDS open 178736-179686 _na     316_aa AAA+ ATPase domain-containing protein
2053 CALLSA010000013.1 GCA938014155_01110 CDS open 179696-180796 _na     366_aa DUF58 domain-containing protein
2054 CALLSA010000013.1 GCA938014155_01111 CDS open 180812-183193 _na     793_aa Transglutaminase-like domain-containing protein
2055 CALLSA010000013.1 GCA938014155_01112 CDS open 183344-187933 _na     1529_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
2056 CALLSA010000013.1 GCA938014155_01113 CDS open 188091-188612 _na     173_aa queT QueT transporter
2057 CALLSA010000013.1 GCA938014155_01114 CDS open 188569-189204 _na     211_aa D-alanyl-D-alanine dipeptidase
2058 CALLSA010000013.1 GCA938014155_01115 CDS open 189223-190308 _na     361_aa Methylthioribose-1-phosphate isomerase
2059 CALLSA010000013.1 GCA938014155_01116 CDS open 190308-191084 _na     258_aa Segregation and condensation protein A
2060 CALLSA010000013.1 GCA938014155_01117 CDS open 191074-191649 _na     191_aa scpB SMC-Scp complex subunit ScpB
2061 CALLSA010000013.1 GCA938014155_01118 CDS open 191686-192411 _na     241_aa Cyclic nucleotide-binding domain-containing protein
2062 CALLSA010000013.1 GCA938014155_01119 CDS open 192548-194470 _na     640_aa Rubredoxin-like domain-containing protein
2063 CALLSA010000013.1 GCA938014155_01120 CDS open 194470-195678 _na     402_aa Flavodoxin-like domain-containing protein
2064 CALLSA010000013.1 GCA938014155_01121 CDS open 195838-196680 _na     280_aa Competence-specific nuclease
2065 CALLSA010000013.1 GCA938014155_01122 CDS open 196687-197535 _na     282_aa Glutamate 5-kinase
2066 CALLSA010000013.1 GCA938014155_01123 CDS open 197548-198789 _na     413_aa glutamate-5-semialdehyde dehydrogenase
2067 CALLSA010000013.1 GCA938014155_01124 CDS open 198800-199117 _na     105_aa UPF0145 protein HMPREF0380_00521
2068 CALLSA010000013.1 GCA938014155_01125 CDS open 200191-201306 _na     371_aa CAAX amino terminal protease family protein
2069 CALLSA010000013.1 GCA938014155_01126 CDS open 201630-201911 _na     93_aa glutaredoxin domain-containing protein
2070 CALLSA010000013.1 GCA938014155_01127 CDS open 201945-202805 _na     286_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
2071 CALLSA010000013.1 GCA938014155_01128 CDS open 202850-203233 _na     127_aa uspA UspA domain-containing protein
2072 CALLSA010000013.1 GCA938014155_01129 CDS open 203254-204480 _na     408_aa BaiN-like insert domain-containing protein
2073 CALLSA010000013.1 GCA938014155_01130 CDS open 204501-204986 _na     161_aa DUF5104 domain-containing protein
2074 CALLSA010000013.1 GCA938014155_01131 CDS open 204991-205671 _na     226_aa DUF4304 domain-containing protein
2075 CALLSA010000013.1 GCA938014155_00928 gene open 125-556
2076 CALLSA010000013.1 GCA938014155_00929 gene open 736-957
2077 CALLSA010000013.1 GCA938014155_00930 gene open 957-1070
2078 CALLSA010000013.1 GCA938014155_00931 gene open 1113-1538 crcB
2079 CALLSA010000013.1 GCA938014155_00932 gene open 1910-4006
2080 CALLSA010000013.1 GCA938014155_00933 gene open 4009-6087
2081 CALLSA010000013.1 GCA938014155_00934 gene open 6178-6816
2082 CALLSA010000013.1 GCA938014155_00935 gene open 6898-7533
2083 CALLSA010000013.1 GCA938014155_00936 gene open 7555-8355
2084 CALLSA010000013.1 GCA938014155_00937 gene open 8352-8828 rlmH
2085 CALLSA010000013.1 GCA938014155_00938 gene open 8950-9270
2086 CALLSA010000013.1 GCA938014155_00939 gene open 9566-10957
2087 CALLSA010000013.1 GCA938014155_00940 gene open 11247-12305 ord
2088 CALLSA010000013.1 GCA938014155_00941 gene open 12375-12671 ortA
2089 CALLSA010000013.1 GCA938014155_00942 gene open 12671-14077 ortB
2090 CALLSA010000013.1 GCA938014155_00943 gene open 14098-14463
2091 CALLSA010000013.1 GCA938014155_00944 gene open 14466-16721 oraE
2092 CALLSA010000013.1 GCA938014155_00945 gene open 16788-18377
2093 CALLSA010000013.1 GCA938014155_00946 gene open 18390-19478 orr
2094 CALLSA010000013.1 GCA938014155_00947 gene open 19645-20211
2095 CALLSA010000013.1 GCA938014155_00948 gene open 20407-21915 nhaC
2096 CALLSA010000013.1 GCA938014155_00949 gene open 22024-23244
2097 CALLSA010000013.1 GCA938014155_00950 gene open 23351-24025
2098 CALLSA010000013.1 GCA938014155_00951 gene open 24219-24674 tadA
2099 CALLSA010000013.1 GCA938014155_00952 gene open 24674-25531 sbsA
2100 CALLSA010000013.1 GCA938014155_00953 gene open 25570-26547 ispE
2101 CALLSA010000013.1 GCA938014155_00954 gene open 26576-27271
2102 CALLSA010000013.1 GCA938014155_00955 gene open 27402-28934
2103 CALLSA010000013.1 GCA938014155_00956 gene open 29176-29604
2104 CALLSA010000013.1 GCA938014155_00957 gene open 29730-31244
2105 CALLSA010000013.1 GCA938014155_00958 gene open 31263-32651
2106 CALLSA010000013.1 GCA938014155_00959 gene open 32704-34062
2107 CALLSA010000013.1 GCA938014155_00960 gene open 34289-34723
2108 CALLSA010000013.1 GCA938014155_00961 gene open 34780-36312
2109 CALLSA010000013.1 GCA938014155_00962 gene open 36332-36886
2110 CALLSA010000013.1 GCA938014155_00963 gene open 37050-38420
2111 CALLSA010000013.1 GCA938014155_00964 gene open 38738-39634 eamA
2112 CALLSA010000013.1 GCA938014155_00965 gene open 39801-40949 cobT
2113 CALLSA010000013.1 GCA938014155_00966 gene open 40951-41490
2114 CALLSA010000013.1 GCA938014155_00967 gene open 41517-42308
2115 CALLSA010000013.1 GCA938014155_00968 gene open 42333-42713
2116 CALLSA010000013.1 GCA938014155_00969 gene open 42714-43373
2117 CALLSA010000013.1 GCA938014155_00970 gene open 43389-44183 srtB
2118 CALLSA010000013.1 GCA938014155_00971 gene open 44343-45311 birA
2119 CALLSA010000013.1 GCA938014155_00972 gene open 45488-46777
2120 CALLSA010000013.1 GCA938014155_00973 gene open 46774-49566 secA
2121 CALLSA010000013.1 GCA938014155_00974 gene open 49670-50707 prfB
2122 CALLSA010000013.1 GCA938014155_00975 gene open 50725-51003
2123 CALLSA010000013.1 GCA938014155_00976 gene open 51203-51631
2124 CALLSA010000013.1 GCA938014155_00977 gene open 51666-52739
2125 CALLSA010000013.1 GCA938014155_00978 gene open 52897-53745
2126 CALLSA010000013.1 GCA938014155_00979 gene open 54063-54473
2127 CALLSA010000013.1 GCA938014155_00980 gene open 54460-54846
2128 CALLSA010000013.1 GCA938014155_00981 gene open 54881-55951
2129 CALLSA010000013.1 GCA938014155_00982 gene open 56014-56217
2130 CALLSA010000013.1 GCA938014155_00983 gene open 56310-57014
2131 CALLSA010000013.1 GCA938014155_00984 gene open 57173-57835
2132 CALLSA010000013.1 GCA938014155_00985 gene open 57838-59043
2133 CALLSA010000013.1 GCA938014155_00986 gene open 59046-59747
2134 CALLSA010000013.1 GCA938014155_00987 gene open 59773-61185
2135 CALLSA010000013.1 GCA938014155_00988 gene open 61193-61447
2136 CALLSA010000013.1 GCA938014155_00989 gene open 61601-62341
2137 CALLSA010000013.1 GCA938014155_00990 gene open 62363-64732
2138 CALLSA010000013.1 GCA938014155_00991 gene open 64873-65415
2139 CALLSA010000013.1 GCA938014155_00992 gene open 65438-66052
2140 CALLSA010000013.1 GCA938014155_00993 gene open 66039-66620
2141 CALLSA010000013.1 GCA938014155_00994 gene open 66821-67855
2142 CALLSA010000013.1 GCA938014155_00995 gene open 68005-68676
2143 CALLSA010000013.1 GCA938014155_00996 gene open 68788-69468
2144 CALLSA010000013.1 GCA938014155_00997 gene open 69485-70300
2145 CALLSA010000013.1 GCA938014155_00998 gene open 70618-72387 thrS
2146 CALLSA010000013.1 GCA938014155_00999 gene open 72520-73893
2147 CALLSA010000013.1 GCA938014155_01000 gene open 73903-74100
2148 CALLSA010000013.1 GCA938014155_01001 gene open 74322-75434
2149 CALLSA010000013.1 GCA938014155_01002 gene open 75448-76098
2150 CALLSA010000013.1 GCA938014155_01003 gene open 76350-78257
2151 CALLSA010000013.1 GCA938014155_01004 gene open 78399-79340
2152 CALLSA010000013.1 GCA938014155_01005 gene open 79340-80416
2153 CALLSA010000013.1 GCA938014155_01006 gene open 80429-81496
2154 CALLSA010000013.1 GCA938014155_01007 gene open 81498-82448 gsiA
2155 CALLSA010000013.1 GCA938014155_01008 gene open 82602-84575 uvrB
2156 CALLSA010000013.1 GCA938014155_01009 gene open 84624-87467 uvrA
2157 CALLSA010000013.1 GCA938014155_01010 gene open 87542-88978
2158 CALLSA010000013.1 GCA938014155_01011 gene open 89076-89336
2159 CALLSA010000013.1 GCA938014155_01012 gene open 89494-90423 fba
2160 CALLSA010000013.1 GCA938014155_01013 gene open 90488-90997 mltG
2161 CALLSA010000013.1 GCA938014155_01014 gene open 91086-92126
2162 CALLSA010000013.1 GCA938014155_01015 gene open 92092-93036
2163 CALLSA010000013.1 GCA938014155_01016 gene open 93046-93507 smpB
2164 CALLSA010000013.1 GCA938014155_01018 gene open 94123-94230
2165 CALLSA010000013.1 GCA938014155_01019 gene open 94297-94803
2166 CALLSA010000013.1 GCA938014155_01020 gene open 95043-100421 lytC
2167 CALLSA010000013.1 GCA938014155_01021 gene open 100476-102179
2168 CALLSA010000013.1 GCA938014155_01022 gene open 102317-104503
2169 CALLSA010000013.1 GCA938014155_01023 gene open 104598-105296
2170 CALLSA010000013.1 GCA938014155_01024 gene open 105606-106538 cysK
2171 CALLSA010000013.1 GCA938014155_01025 gene open 106667-107380
2172 CALLSA010000013.1 GCA938014155_01026 gene open 107426-108229
2173 CALLSA010000013.1 GCA938014155_01027 gene open 108232-109380
2174 CALLSA010000013.1 GCA938014155_01028 gene open 109493-110872 norM
2175 CALLSA010000013.1 GCA938014155_01029 gene open 110941-111828 phzF
2176 CALLSA010000013.1 GCA938014155_01030 gene open 111941-112864 eamA
2177 CALLSA010000013.1 GCA938014155_01031 gene open 113015-114310 eno
2178 CALLSA010000013.1 GCA938014155_01032 gene open 114395-115825
2179 CALLSA010000013.1 GCA938014155_01033 gene open 115836-116342
2180 CALLSA010000013.1 GCA938014155_01034 gene open 116459-116773 csoR
2181 CALLSA010000013.1 GCA938014155_01035 gene open 116799-119354
2182 CALLSA010000013.1 GCA938014155_01036 gene open 119517-119735
2183 CALLSA010000013.1 GCA938014155_01037 gene open 119752-119976
2184 CALLSA010000013.1 GCA938014155_01038 gene open 120013-122298
2185 CALLSA010000013.1 GCA938014155_01039 gene open 122338-122541
2186 CALLSA010000013.1 GCA938014155_01040 gene open 122604-123920
2187 CALLSA010000013.1 GCA938014155_01041 gene open 124228-124509
2188 CALLSA010000013.1 GCA938014155_01042 gene open 124466-124777 rpsJ
2189 CALLSA010000013.1 GCA938014155_01043 gene open 124854-125489 rplC
2190 CALLSA010000013.1 GCA938014155_01044 gene open 125516-126139 rplD
2191 CALLSA010000013.1 GCA938014155_01045 gene open 126139-126429 rplW
2192 CALLSA010000013.1 GCA938014155_01046 gene open 126447-127280 rplB
2193 CALLSA010000013.1 GCA938014155_01047 gene open 127297-127575 rpsS
2194 CALLSA010000013.1 GCA938014155_01048 gene open 127593-127934 rplV
2195 CALLSA010000013.1 GCA938014155_01049 gene open 127946-128824 rpsC
2196 CALLSA010000013.1 GCA938014155_01050 gene open 128845-129276 rplP
2197 CALLSA010000013.1 GCA938014155_01051 gene open 129276-129479 rpmC
2198 CALLSA010000013.1 GCA938014155_01052 gene open 129498-129758 rpsQ
2199 CALLSA010000013.1 GCA938014155_01053 gene open 129773-130147 rplN
2200 CALLSA010000013.1 GCA938014155_01054 gene open 130160-130465 rplX
2201 CALLSA010000013.1 GCA938014155_01055 gene open 130483-131025 rplE
2202 CALLSA010000013.1 GCA938014155_01056 gene open 131287-131685 rpsH
2203 CALLSA010000013.1 GCA938014155_01057 gene open 131698-132240 rplF
2204 CALLSA010000013.1 GCA938014155_01058 gene open 132258-132623 rplR
2205 CALLSA010000013.1 GCA938014155_01059 gene open 132640-133143 rpsE
2206 CALLSA010000013.1 GCA938014155_01060 gene open 133155-133337 rpmD
2207 CALLSA010000013.1 GCA938014155_01061 gene open 133356-133796 rplO
2208 CALLSA010000013.1 GCA938014155_01062 gene open 133798-135081 secY
2209 CALLSA010000013.1 GCA938014155_01063 gene open 135096-135743
2210 CALLSA010000013.1 GCA938014155_01064 gene open 135746-136507 map
2211 CALLSA010000013.1 GCA938014155_01065 gene open 136513-136731 infA
2212 CALLSA010000013.1 GCA938014155_01066 gene open 136782-136895 rpmJ
2213 CALLSA010000013.1 GCA938014155_01067 gene open 137016-137384 rpsM
2214 CALLSA010000013.1 GCA938014155_01068 gene open 137402-137800 rpsK
2215 CALLSA010000013.1 GCA938014155_01069 gene open 137822-138409 rpsD
2216 CALLSA010000013.1 GCA938014155_01070 gene open 138463-139407
2217 CALLSA010000013.1 GCA938014155_01071 gene open 139432-139773 rplQ
2218 CALLSA010000013.1 GCA938014155_01072 gene open 139824-140387 ahpC
2219 CALLSA010000013.1 GCA938014155_01073 gene open 140552-140719
2220 CALLSA010000013.1 GCA938014155_01074 gene open 141011-141814
2221 CALLSA010000013.1 GCA938014155_01075 gene open 141830-144055
2222 CALLSA010000013.1 GCA938014155_01076 gene open 144079-146055 ligA
2223 CALLSA010000013.1 GCA938014155_01077 gene open 146072-147070
2224 CALLSA010000013.1 GCA938014155_01080 gene open 147337-149082
2225 CALLSA010000013.1 GCA938014155_01081 gene open 149094-149462
2226 CALLSA010000013.1 GCA938014155_01082 gene open 149474-150073 recR
2227 CALLSA010000013.1 GCA938014155_01083 gene open 150423-151823
2228 CALLSA010000013.1 GCA938014155_01084 gene open 151853-153271
2229 CALLSA010000013.1 GCA938014155_01085 gene open 153457-153741 sdpR
2230 CALLSA010000013.1 GCA938014155_01086 gene open 153725-154366
2231 CALLSA010000013.1 GCA938014155_01087 gene open 154408-155052
2232 CALLSA010000013.1 GCA938014155_01088 gene open 155354-156568
2233 CALLSA010000013.1 GCA938014155_01089 gene open 156628-159801 carB
2234 CALLSA010000013.1 GCA938014155_01090 gene open 159902-160633
2235 CALLSA010000013.1 GCA938014155_01091 gene open 160627-161538
2236 CALLSA010000013.1 GCA938014155_01092 gene open 161538-162266 pyrF
2237 CALLSA010000013.1 GCA938014155_01093 gene open 162287-162931
2238 CALLSA010000013.1 GCA938014155_01094 gene open 162919-164049
2239 CALLSA010000013.1 GCA938014155_01095 gene open 164143-164301
2240 CALLSA010000013.1 GCA938014155_01096 gene open 164403-165623
2241 CALLSA010000013.1 GCA938014155_01097 gene open 165669-166901
2242 CALLSA010000013.1 GCA938014155_01098 gene open 167024-168247
2243 CALLSA010000013.1 GCA938014155_01099 gene open 168478-169287
2244 CALLSA010000013.1 GCA938014155_01100 gene open 169336-170400
2245 CALLSA010000013.1 GCA938014155_01101 gene open 170416-171129
2246 CALLSA010000013.1 GCA938014155_01102 gene open 171133-171588
2247 CALLSA010000013.1 GCA938014155_01103 gene open 171724-172635
2248 CALLSA010000013.1 GCA938014155_01104 gene open 172608-174278
2249 CALLSA010000013.1 GCA938014155_01105 gene open 174257-175231
2250 CALLSA010000013.1 GCA938014155_01106 gene open 175247-175777
2251 CALLSA010000013.1 GCA938014155_01107 gene open 175788-177635
2252 CALLSA010000013.1 GCA938014155_01108 gene open 177632-178723
2253 CALLSA010000013.1 GCA938014155_01109 gene open 178736-179686
2254 CALLSA010000013.1 GCA938014155_01110 gene open 179696-180796
2255 CALLSA010000013.1 GCA938014155_01111 gene open 180812-183193
2256 CALLSA010000013.1 GCA938014155_01112 gene open 183344-187933 lytC
2257 CALLSA010000013.1 GCA938014155_01113 gene open 188091-188612 queT
2258 CALLSA010000013.1 GCA938014155_01114 gene open 188569-189204
2259 CALLSA010000013.1 GCA938014155_01115 gene open 189223-190308
2260 CALLSA010000013.1 GCA938014155_01116 gene open 190308-191084
2261 CALLSA010000013.1 GCA938014155_01117 gene open 191074-191649 scpB
2262 CALLSA010000013.1 GCA938014155_01118 gene open 191686-192411
2263 CALLSA010000013.1 GCA938014155_01119 gene open 192548-194470
2264 CALLSA010000013.1 GCA938014155_01120 gene open 194470-195678
2265 CALLSA010000013.1 GCA938014155_01121 gene open 195838-196680
2266 CALLSA010000013.1 GCA938014155_01122 gene open 196687-197535
2267 CALLSA010000013.1 GCA938014155_01123 gene open 197548-198789
2268 CALLSA010000013.1 GCA938014155_01124 gene open 198800-199117
2269 CALLSA010000013.1 GCA938014155_01125 gene open 200191-201306
2270 CALLSA010000013.1 GCA938014155_01126 gene open 201630-201911
2271 CALLSA010000013.1 GCA938014155_01127 gene open 201945-202805
2272 CALLSA010000013.1 GCA938014155_01128 gene open 202850-203233 uspA
2273 CALLSA010000013.1 GCA938014155_01129 gene open 203254-204480
2274 CALLSA010000013.1 GCA938014155_01130 gene open 204501-204986
2275 CALLSA010000013.1 GCA938014155_01131 gene open 204991-205671
2276 CALLSA010000014.1 repeat_region open 162134-162331 CRISPR array with 3 repeats of length 32%2C consensus sequence GTCGCACTCCTCGTGAGTGCGTGGATTGAAAT and spacer length 34
2277 CALLSA010000014.1 GCA938014155_01132 CDS open 108-1646 _na     512_aa Bacterial repeat domain-containing protein
2278 CALLSA010000014.1 GCA938014155_01133 CDS open 1930-2409 _na     159_aa DUF4145 domain-containing protein
2279 CALLSA010000014.1 GCA938014155_01134 CDS open 2513-3901 _na     462_aa TrpB-like pyridoxal phosphate-dependent enzyme
2280 CALLSA010000014.1 GCA938014155_01135 CDS open 4308-5636 _na     442_aa Nitrogenase/oxidoreductase component 1 domain-containing protein
2281 CALLSA010000014.1 GCA938014155_01136 CDS open 5599-7911 _na     770_aa AAA family ATPase
2282 CALLSA010000014.1 GCA938014155_01137 CDS open 7942-8226 _na     94_aa Cysteine-rich small domain-containing protein
2283 CALLSA010000014.1 GCA938014155_01138 CDS open 8314-11991 _na     1225_aa DNA polymerase III subunit alpha
2284 CALLSA010000014.1 GCA938014155_01139 CDS open 12010-12969 _na     319_aa ATP-dependent 6-phosphofructokinase
2285 CALLSA010000014.1 GCA938014155_01140 CDS open 13009-14478 _na     489_aa Major facilitator superfamily (MFS) profile domain-containing protein
2286 CALLSA010000014.1 GCA938014155_01141 CDS open 14490-15251 _na     253_aa GP-PDE domain-containing protein
2287 CALLSA010000014.1 GCA938014155_01142 CDS open 15244-16248 _na     334_aa Serine aminopeptidase S33 domain-containing protein
2288 CALLSA010000014.1 GCA938014155_01143 CDS open 16611-16790 _na     59_aa Fido domain-containing protein
2289 CALLSA010000014.1 GCA938014155_01144 CDS open 16787-17029 _na     80_aa Antitoxin
2290 CALLSA010000014.1 GCA938014155_01145 CDS open 17181-19121 _na     646_aa rnr ribonuclease R
2291 CALLSA010000014.1 GCA938014155_01146 CDS open 19256-20668 _na     470_aa aminopeptidase
2292 CALLSA010000014.1 GCA938014155_01147 CDS open 20823-21662 _na     279_aa purine-nucleoside phosphorylase
2293 CALLSA010000014.1 GCA938014155_01148 CDS open 21663-22388 _na     241_aa 3-oxoacyl-[acyl-carrier-protein] reductase
2294 CALLSA010000014.1 GCA938014155_01149 CDS open 22415-24184 _na     589_aa FHA domain-containing protein
2295 CALLSA010000014.1 GCA938014155_01150 CDS open 24181-25512 _na     443_aa Penicillin-binding protein transpeptidase domain-containing protein
2296 CALLSA010000014.1 GCA938014155_01151 CDS open 25579-26844 _na     421_aa Methionine gamma-lyase
2297 CALLSA010000014.1 GCA938014155_01152 CDS open 26984-27385 _na     133_aa DUF4854 domain-containing protein
2298 CALLSA010000014.1 GCA938014155_01153 CDS open 27497-29314 _na     605_aa lepA translation elongation factor 4
2299 CALLSA010000014.1 GCA938014155_01154 CDS open 29298-30521 _na     407_aa hemW Heme chaperone HemW
2300 CALLSA010000014.1 GCA938014155_01155 CDS open 30552-32045 _na     497_aa glpK glycerol kinase GlpK
2301 CALLSA010000014.1 GCA938014155_01156 CDS open 31984-32202 _na     72_aa hypothetical protein
2302 CALLSA010000014.1 GCA938014155_01157 CDS open 32336-33385 _na     349_aa hrcA heat-inducible transcriptional repressor HrcA
2303 CALLSA010000014.1 GCA938014155_01158 CDS open 33375-33926 _na     183_aa grpE Protein GrpE
2304 CALLSA010000014.1 GCA938014155_01159 CDS open 33970-35835 _na     621_aa dnaK molecular chaperone DnaK
2305 CALLSA010000014.1 GCA938014155_01160 CDS open 35867-37054 _na     395_aa dnaJ molecular chaperone DnaJ
2306 CALLSA010000014.1 GCA938014155_01161 CDS open 37193-37759 _na     188_aa Biotin transporter
2307 CALLSA010000014.1 GCA938014155_01162 CDS open 37876-38847 _na     323_aa Ribosomal protein L11 methyltransferase
2308 CALLSA010000014.1 GCA938014155_01163 CDS open 39183-39413 _na     76_aa acpP acyl carrier protein
2309 CALLSA010000014.1 GCA938014155_01164 CDS open 39416-39868 _na     150_aa Biotin carboxyl carrier protein of acetyl-CoA carboxylase
2310 CALLSA010000014.1 GCA938014155_01165 CDS open 39862-41247 _na     461_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
2311 CALLSA010000014.1 GCA938014155_01166 CDS open 41247-42971 _na     574_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
2312 CALLSA010000014.1 GCA938014155_01167 CDS open 42973-43914 _na     313_aa 3-oxoacyl-[acyl-carrier-protein] synthase 3
2313 CALLSA010000014.1 GCA938014155_01168 CDS open 43926-44852 _na     308_aa Nitronate monooxygenase domain-containing protein
2314 CALLSA010000014.1 GCA938014155_01169 CDS open 44836-45891 _na     351_aa Nitronate monooxygenase domain-containing protein
2315 CALLSA010000014.1 GCA938014155_01170 CDS open 45913-46836 _na     307_aa fabD ACP S-malonyltransferase
2316 CALLSA010000014.1 GCA938014155_01171 CDS open 46842-47579 _na     245_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
2317 CALLSA010000014.1 GCA938014155_01172 CDS open 47589-48821 _na     410_aa fabF beta-ketoacyl-ACP synthase II
2318 CALLSA010000014.1 GCA938014155_01173 CDS open 48843-49268 _na     141_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2319 CALLSA010000014.1 GCA938014155_01174 CDS open 49281-49763 _na     160_aa HTH marR-type domain-containing protein
2320 CALLSA010000014.1 GCA938014155_01175 CDS open 49979-51454 _na     491_aa cstA CstA N-terminal domain-containing protein
2321 CALLSA010000014.1 GCA938014155_01176 CDS open 51826-53115 _na     429_aa BaiN-like insert domain-containing protein
2322 CALLSA010000014.1 GCA938014155_01177 CDS open 53144-54709 _na     521_aa FAD-dependent protein C-terminal domain-containing protein
2323 CALLSA010000014.1 GCA938014155_01178 CDS open 54737-56488 _na     583_aa Carboxylic ester hydrolase
2324 CALLSA010000014.1 GCA938014155_01179 CDS open 56614-56946 _na     110_aa Transmembrane protein
2325 CALLSA010000014.1 GCA938014155_01180 CDS open 56943-57137 _na     64_aa HTH cro/C1-type domain-containing protein
2326 CALLSA010000014.1 GCA938014155_01181 CDS open 57425-57970 _na     181_aa ECF transporter S component
2327 CALLSA010000014.1 GCA938014155_01182 CDS open 57958-59085 _na     375_aa Aminotransferase class V domain-containing protein
2328 CALLSA010000014.1 GCA938014155_01183 CDS open 59143-59610 _na     155_aa Small multidrug export protein
2329 CALLSA010000014.1 GCA938014155_01184 CDS open 59654-60160 _na     168_aa 8-oxo-dGTP diphosphatase
2330 CALLSA010000014.1 GCA938014155_01185 CDS open 60182-60772 _na     196_aa Cysteine/O-acetylserine efflux protein
2331 CALLSA010000014.1 GCA938014155_01186 CDS open 61008-63209 _na     733_aa inlB InlB B-repeat-containing protein
2332 CALLSA010000014.1 GCA938014155_01187 CDS open 63372-65669 _na     765_aa Gram-positive cocci surface proteins LPxTG domain-containing protein
2333 CALLSA010000014.1 GCA938014155_01188 CDS open 65832-68132 _na     766_aa inlB InlB B-repeat-containing protein
2334 CALLSA010000014.1 GCA938014155_01189 CDS open 68216-68659 _na     147_aa N-acetyltransferase domain-containing protein
2335 CALLSA010000014.1 GCA938014155_01190 CDS open 68704-69303 _na     199_aa Peptidase C39-like domain-containing protein
2336 CALLSA010000014.1 GCA938014155_01191 CDS open 69434-69742 _na     102_aa trxA thioredoxin
2337 CALLSA010000014.1 GCA938014155_01192 CDS open 69792-70226 _na     144_aa HTH marR-type domain-containing protein
2338 CALLSA010000014.1 GCA938014155_01193 CDS open 70236-70712 _na     158_aa Glutathione peroxidase
2339 CALLSA010000014.1 GCA938014155_01194 CDS open 70859-72220 _na     453_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
2340 CALLSA010000014.1 GCA938014155_01195 CDS open 72213-72554 _na     113_aa HIT domain-containing protein
2341 CALLSA010000014.1 GCA938014155_01196 CDS open 72647-73090 _na     147_aa ardA Antirestriction protein ArdA
2342 CALLSA010000014.1 GCA938014155_01197 CDS open 73223-73402 _na     59_aa rpsU 30S ribosomal protein S21
2343 CALLSA010000014.1 GCA938014155_01198 CDS open 73427-73873 _na     148_aa YqeY-like protein
2344 CALLSA010000014.1 GCA938014155_01199 CDS open 73938-74429 _na     163_aa DUF3592 domain-containing protein
2345 CALLSA010000014.1 GCA938014155_01200 CDS open 74521-75189 _na     222_aa Nitroreductase family
2346 CALLSA010000014.1 GCA938014155_01201 CDS open 75241-77877 _na     878_aa calcium-translocating P-type ATPase%2C PMCA-type
2347 CALLSA010000014.1 GCA938014155_01202 CDS open 77880-78146 _na     88_aa hypothetical protein
2348 CALLSA010000014.1 GCA938014155_01203 CDS open 78165-78482 _na     105_aa hypothetical protein
2349 CALLSA010000014.1 GCA938014155_01204 CDS open 78740-79507 _na     255_aa Hydroxyethylthiazole kinase
2350 CALLSA010000014.1 GCA938014155_01205 CDS open 79497-80138 _na     213_aa Thiamine-phosphate synthase
2351 CALLSA010000014.1 GCA938014155_01206 CDS open 80152-80670 _na     172_aa thiW energy coupling factor transporter S component ThiW
2352 CALLSA010000014.1 GCA938014155_01207 CDS open 80680-81474 _na     264_aa Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase
2353 CALLSA010000014.1 GCA938014155_01208 CDS open 81568-82881 _na     437_aa thiC phosphomethylpyrimidine synthase ThiC
2354 CALLSA010000014.1 GCA938014155_01209 CDS open 82935-84038 _na     367_aa Cation efflux protein cytoplasmic domain-containing protein
2355 CALLSA010000014.1 GCA938014155_01210 CDS open 84048-84725 _na     225_aa Stage 0 sporulation A-like protein
2356 CALLSA010000014.1 GCA938014155_01211 CDS open 84722-85717 _na     331_aa histidine kinase
2357 CALLSA010000014.1 GCA938014155_01212 CDS open 85738-86559 _na     273_aa Peptide ABC transporter ATPase
2358 CALLSA010000014.1 GCA938014155_01213 CDS open 86552-88567 _na     671_aa ABC3 transporter permease C-terminal domain-containing protein
2359 CALLSA010000014.1 GCA938014155_01214 CDS open 88731-89243 _na     170_aa Ferritin
2360 CALLSA010000014.1 GCA938014155_01215 CDS open 89478-89780 _na     100_aa DUF1490 domain-containing protein
2361 CALLSA010000014.1 GCA938014155_01216 CDS open 89814-91895 _na     693_aa Cd(2+)-exporting ATPase
2362 CALLSA010000014.1 GCA938014155_01217 CDS open 91994-92596 _na     200_aa Lipoprotein
2363 CALLSA010000014.1 GCA938014155_01218 CDS open 92658-93509 _na     283_aa ABC transporter
2364 CALLSA010000014.1 GCA938014155_01219 CDS open 93502-94212 _na     236_aa ABC transporter domain-containing protein
2365 CALLSA010000014.1 GCA938014155_01220 CDS open 94231-95232 _na     333_aa Zinc ABC transporter substrate-binding protein
2366 CALLSA010000014.1 GCA938014155_01221 CDS open 95323-95739 _na     138_aa Ferric uptake regulation protein
2367 CALLSA010000014.1 GCA938014155_01222 CDS open 95681-95812 _na     43_aa hypothetical protein
2368 CALLSA010000014.1 GCA938014155_01223 CDS open 95970-97613 _na     547_aa hcp hydroxylamine reductase
2369 CALLSA010000014.1 GCA938014155_01224 CDS open 97882-98862 _na     326_aa guaA glutamine-hydrolyzing GMP synthase
2370 CALLSA010000014.1 GCA938014155_01225 CDS open 99013-99267 _na     84_aa hypothetical protein
2371 CALLSA010000014.1 GCA938014155_01226 CDS open 99356-99796 _na     146_aa HTH cro/C1-type domain-containing protein
2372 CALLSA010000014.1 GCA938014155_01227 CDS open 100038-100274 _na     78_aa DNA-binding protein
2373 CALLSA010000014.1 GCA938014155_01228 CDS open 100277-101401 _na     374_aa Phage integrase
2374 CALLSA010000014.1 GCA938014155_01229 CDS open 101391-101753 _na     120_aa Mobilization protein
2375 CALLSA010000014.1 GCA938014155_01230 CDS open 101774-102772 _na     332_aa putative phage DNA-polymerase or DNA-primase
2376 CALLSA010000014.1 GCA938014155_01231 CDS open 102732-104162 _na     476_aa Virulence-associated protein E-like domain-containing protein
2377 CALLSA010000014.1 GCA938014155_01232 CDS open 104481-104822 _na     113_aa nikA Mobilization protein NikA
2378 CALLSA010000014.1 GCA938014155_01233 CDS open 104968-105393 _na     141_aa helix-turn-helix domain-containing protein
2379 CALLSA010000014.1 GCA938014155_01234 CDS open 105386-107356 _na     656_aa site-specific DNA-methyltransferase (adenine-specific)
2380 CALLSA010000014.1 GCA938014155_01235 CDS open 107337-108434 _na     365_aa Restriction enzyme%2C beta subunit
2381 CALLSA010000014.1 GCA938014155_01236 CDS open 108434-108943 _na     169_aa Restriction enzyme subunit beta
2382 CALLSA010000014.1 GCA938014155_01237 CDS open 108972-110513 _na     513_aa ATP-binding protein
2383 CALLSA010000014.1 GCA938014155_01238 CDS open 110527-112287 _na     586_aa DUF262 domain-containing protein
2384 CALLSA010000014.1 GCA938014155_01239 CDS open 112886-114793 _na     635_aa AAA family ATPase
2385 CALLSA010000014.1 GCA938014155_01240 CDS open 116127-117086 _na     319_aa hypothetical protein
2386 CALLSA010000014.1 GCA938014155_01241 CDS open 117890-118189 _na     99_aa hypothetical protein
2387 CALLSA010000014.1 GCA938014155_01242 CDS open 118229-118336 _na     35_aa hypothetical protein
2388 CALLSA010000014.1 GCA938014155_01243 CDS open 118336-118815 _na     159_aa transposase
2389 CALLSA010000014.1 GCA938014155_01244 CDS open 118842-119033 _na     63_aa hypothetical protein
2390 CALLSA010000014.1 GCA938014155_01245 CDS open 119250-120272 _na     340_aa DNA cytosine methyltransferase
2391 CALLSA010000014.1 GCA938014155_01246 CDS open 120310-121395 _na     361_aa HpaII family restriction endonuclease
2392 CALLSA010000014.1 GCA938014155_01247 CDS open 121699-121821 _na     40_aa hypothetical protein
2393 CALLSA010000014.1 GCA938014155_01248 CDS open 121899-122618 _na     239_aa traX Conjugal transfer protein TraX
2394 CALLSA010000014.1 GCA938014155_01249 CDS open 122725-124581 _na     618_aa Sigma-54-dependent Fis family transcriptional regulator
2395 CALLSA010000014.1 GCA938014155_01250 CDS open 124641-125507 _na     288_aa dapF diaminopimelate epimerase
2396 CALLSA010000014.1 GCA938014155_01251 CDS open 125636-126940 _na     434_aa lysA diaminopimelate decarboxylase
2397 CALLSA010000014.1 GCA938014155_01252 CDS open 126982-127626 _na     214_aa hypothetical protein
2398 CALLSA010000014.1 GCA938014155_01253 CDS open 127696-127947 _na     83_aa hypothetical protein
2399 CALLSA010000014.1 GCA938014155_01254 CDS open 128210-130564 _na     784_aa CRISPR-associated helicase Cas3
2400 CALLSA010000014.1 GCA938014155_01255 CDS open 130782-131375 _na     197_aa Phage replisome organizer%2C putative%2C N-terminal region
2401 CALLSA010000014.1 GCA938014155_01256 CDS open 131362-131985 _na     207_aa hypothetical protein
2402 CALLSA010000014.1 GCA938014155_01257 CDS open 131978-132250 _na     90_aa Transposase and inactivated derivatives%2C IS30 family
2403 CALLSA010000014.1 GCA938014155_01258 CDS open 132231-132638 _na     135_aa hypothetical protein
2404 CALLSA010000014.1 GCA938014155_01259 CDS open 132661-133002 _na     113_aa hypothetical protein
2405 CALLSA010000014.1 GCA938014155_01260 CDS open 133015-133797 _na     260_aa Sporulation initiation inhibitor protein soj
2406 CALLSA010000014.1 GCA938014155_01261 CDS open 133813-134997 _na     394_aa Nucleoid occlusion protein
2407 CALLSA010000014.1 GCA938014155_01262 CDS open 135531-135866 _na     111_aa DUF4258 domain-containing protein
2408 CALLSA010000014.1 GCA938014155_01263 CDS open 135869-136672 _na     267_aa Plasmid recombination enzyme
2409 CALLSA010000014.1 GCA938014155_01264 CDS open 136762-137394 _na     210_aa hypothetical protein
2410 CALLSA010000014.1 GCA938014155_01265 CDS open 137551-139521 _na     656_aa hypothetical protein
2411 CALLSA010000014.1 GCA938014155_01266 CDS open 139576-139905 _na     109_aa Single-stranded DNA-binding protein
2412 CALLSA010000014.1 GCA938014155_01267 CDS open 139939-140055 _na     38_aa hypothetical protein
2413 CALLSA010000014.1 GCA938014155_01268 CDS open 140027-141025 _na     332_aa radC DNA repair protein RadC
2414 CALLSA010000014.1 GCA938014155_01269 CDS open 141003-142010 _na     335_aa hypothetical protein
2415 CALLSA010000014.1 GCA938014155_01270 CDS open 142034-142357 _na     107_aa hypothetical protein
2416 CALLSA010000014.1 GCA938014155_01271 CDS open 142385-142609 _na     74_aa TrbC/VIRB2 family protein
2417 CALLSA010000014.1 GCA938014155_01272 CDS open 142660-145149 _na     829_aa traC Conjugal transfer ATP-binding protein TraC
2418 CALLSA010000014.1 GCA938014155_01273 CDS open 145151-145828 _na     225_aa NlpC/P60 domain-containing protein
2419 CALLSA010000014.1 GCA938014155_01274 CDS open 145782-147734 _na     650_aa hypothetical protein
2420 CALLSA010000014.1 GCA938014155_01275 CDS open 147721-148035 _na     104_aa prgI PrgI family protein
2421 CALLSA010000014.1 GCA938014155_01276 CDS open 148010-148843 _na     277_aa hypothetical protein
2422 CALLSA010000014.1 GCA938014155_01277 CDS open 148933-149361 _na     142_aa hypothetical protein
2423 CALLSA010000014.1 GCA938014155_01278 CDS open 149361-150065 _na     234_aa Response regulatory domain-containing protein
2424 CALLSA010000014.1 GCA938014155_01279 CDS open 150132-150251 _na     39_aa hypothetical protein
2425 CALLSA010000014.1 GCA938014155_01280 CDS open 150235-151266 _na     343_aa hypothetical protein
2426 CALLSA010000014.1 GCA938014155_01281 CDS open 151269-152684 _na     471_aa virD4 Type IV secretion system protein VirD4
2427 CALLSA010000014.1 GCA938014155_01282 CDS open 152699-153019 _na     106_aa hypothetical protein
2428 CALLSA010000014.1 GCA938014155_01283 CDS open 153092-154693 _na     533_aa DUF3991 domain-containing protein
2429 CALLSA010000014.1 GCA938014155_01284 CDS open 154896-155954 _na     352_aa IS30 family transposase
2430 CALLSA010000014.1 GCA938014155_01285 CDS open 156191-156430 _na     79_aa hypothetical protein
2431 CALLSA010000014.1 GCA938014155_01286 CDS open 156451-157182 _na     243_aa pre-crRNA processing endonuclease
2432 CALLSA010000014.1 GCA938014155_01287 CDS open 157186-159126 _na     646_aa CRISPR-associated protein%2C Csd1 family
2433 CALLSA010000014.1 GCA938014155_01288 CDS open 159119-159967 _na     282_aa Type I-C CRISPR-associated protein Cas7/Csd2
2434 CALLSA010000014.1 GCA938014155_01289 CDS open 159980-160630 _na     216_aa cas4 CRISPR-associated protein Cas4
2435 CALLSA010000014.1 GCA938014155_01290 CDS open 160630-161661 _na     343_aa cas1c type I-C CRISPR-associated endonuclease Cas1c
2436 CALLSA010000014.1 GCA938014155_01291 CDS open 161666-161959 _na     97_aa cas2 CRISPR-associated endonuclease Cas2
2437 CALLSA010000014.1 GCA938014155_01132 gene open 108-1646
2438 CALLSA010000014.1 GCA938014155_01133 gene open 1930-2409
2439 CALLSA010000014.1 GCA938014155_01134 gene open 2513-3901
2440 CALLSA010000014.1 GCA938014155_01135 gene open 4308-5636
2441 CALLSA010000014.1 GCA938014155_01136 gene open 5599-7911
2442 CALLSA010000014.1 GCA938014155_01137 gene open 7942-8226
2443 CALLSA010000014.1 GCA938014155_01138 gene open 8314-11991
2444 CALLSA010000014.1 GCA938014155_01139 gene open 12010-12969
2445 CALLSA010000014.1 GCA938014155_01140 gene open 13009-14478
2446 CALLSA010000014.1 GCA938014155_01141 gene open 14490-15251
2447 CALLSA010000014.1 GCA938014155_01142 gene open 15244-16248
2448 CALLSA010000014.1 GCA938014155_01143 gene open 16611-16790
2449 CALLSA010000014.1 GCA938014155_01144 gene open 16787-17029
2450 CALLSA010000014.1 GCA938014155_01145 gene open 17181-19121 rnr
2451 CALLSA010000014.1 GCA938014155_01146 gene open 19256-20668
2452 CALLSA010000014.1 GCA938014155_01147 gene open 20823-21662
2453 CALLSA010000014.1 GCA938014155_01148 gene open 21663-22388
2454 CALLSA010000014.1 GCA938014155_01149 gene open 22415-24184
2455 CALLSA010000014.1 GCA938014155_01150 gene open 24181-25512
2456 CALLSA010000014.1 GCA938014155_01151 gene open 25579-26844
2457 CALLSA010000014.1 GCA938014155_01152 gene open 26984-27385
2458 CALLSA010000014.1 GCA938014155_01153 gene open 27497-29314 lepA
2459 CALLSA010000014.1 GCA938014155_01154 gene open 29298-30521 hemW
2460 CALLSA010000014.1 GCA938014155_01155 gene open 30552-32045 glpK
2461 CALLSA010000014.1 GCA938014155_01156 gene open 31984-32202
2462 CALLSA010000014.1 GCA938014155_01157 gene open 32336-33385 hrcA
2463 CALLSA010000014.1 GCA938014155_01158 gene open 33375-33926 grpE
2464 CALLSA010000014.1 GCA938014155_01159 gene open 33970-35835 dnaK
2465 CALLSA010000014.1 GCA938014155_01160 gene open 35867-37054 dnaJ
2466 CALLSA010000014.1 GCA938014155_01161 gene open 37193-37759
2467 CALLSA010000014.1 GCA938014155_01162 gene open 37876-38847
2468 CALLSA010000014.1 GCA938014155_01163 gene open 39183-39413 acpP
2469 CALLSA010000014.1 GCA938014155_01164 gene open 39416-39868
2470 CALLSA010000014.1 GCA938014155_01165 gene open 39862-41247 accC
2471 CALLSA010000014.1 GCA938014155_01166 gene open 41247-42971 accD
2472 CALLSA010000014.1 GCA938014155_01167 gene open 42973-43914
2473 CALLSA010000014.1 GCA938014155_01168 gene open 43926-44852
2474 CALLSA010000014.1 GCA938014155_01169 gene open 44836-45891
2475 CALLSA010000014.1 GCA938014155_01170 gene open 45913-46836 fabD
2476 CALLSA010000014.1 GCA938014155_01171 gene open 46842-47579 fabG
2477 CALLSA010000014.1 GCA938014155_01172 gene open 47589-48821 fabF
2478 CALLSA010000014.1 GCA938014155_01173 gene open 48843-49268 fabZ
2479 CALLSA010000014.1 GCA938014155_01174 gene open 49281-49763
2480 CALLSA010000014.1 GCA938014155_01175 gene open 49979-51454 cstA
2481 CALLSA010000014.1 GCA938014155_01176 gene open 51826-53115
2482 CALLSA010000014.1 GCA938014155_01177 gene open 53144-54709
2483 CALLSA010000014.1 GCA938014155_01178 gene open 54737-56488
2484 CALLSA010000014.1 GCA938014155_01179 gene open 56614-56946
2485 CALLSA010000014.1 GCA938014155_01180 gene open 56943-57137
2486 CALLSA010000014.1 GCA938014155_01181 gene open 57425-57970
2487 CALLSA010000014.1 GCA938014155_01182 gene open 57958-59085
2488 CALLSA010000014.1 GCA938014155_01183 gene open 59143-59610
2489 CALLSA010000014.1 GCA938014155_01184 gene open 59654-60160
2490 CALLSA010000014.1 GCA938014155_01185 gene open 60182-60772
2491 CALLSA010000014.1 GCA938014155_01186 gene open 61008-63209 inlB
2492 CALLSA010000014.1 GCA938014155_01187 gene open 63372-65669
2493 CALLSA010000014.1 GCA938014155_01188 gene open 65832-68132 inlB
2494 CALLSA010000014.1 GCA938014155_01189 gene open 68216-68659
2495 CALLSA010000014.1 GCA938014155_01190 gene open 68704-69303
2496 CALLSA010000014.1 GCA938014155_01191 gene open 69434-69742 trxA
2497 CALLSA010000014.1 GCA938014155_01192 gene open 69792-70226
2498 CALLSA010000014.1 GCA938014155_01193 gene open 70236-70712
2499 CALLSA010000014.1 GCA938014155_01194 gene open 70859-72220 mtaB
2500 CALLSA010000014.1 GCA938014155_01195 gene open 72213-72554