HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Bulleidia extructa (GCA_938029445.1)

Select a Genome:
BAKTA Annotations for GCA_938029445.1
Genome Selected: Bulleidia extructa
ContigsBases CDSrRNA tmRNAtRNA
289 1157370 1122 0 1 29
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2323 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 2323 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CALHFY010000061.1 GCA938029445_00250 CDS open 1292-2752 _na     486_aa Hemerythrin HHE cation binding domain protein
502 CALHFY010000061.1 GCA938029445_00251 CDS open 2764-3189 _na     141_aa Lipoprotein
503 CALHFY010000061.1 GCA938029445_00252 CDS open 3186-4016 _na     276_aa ABC 3 transport family protein
504 CALHFY010000061.1 GCA938029445_00253 CDS open 4013-4678 _na     221_aa ABC transporter%2C ATP-binding protein
505 CALHFY010000061.1 GCA938029445_00254 CDS open 4692-5531 _na     279_aa ABC transporter%2C substrate-binding protein
506 CALHFY010000061.1 GCA938029445_00249 gene open 26-1192
507 CALHFY010000061.1 GCA938029445_00250 gene open 1292-2752
508 CALHFY010000061.1 GCA938029445_00251 gene open 2764-3189
509 CALHFY010000061.1 GCA938029445_00252 gene open 3186-4016
510 CALHFY010000061.1 GCA938029445_00253 gene open 4013-4678
511 CALHFY010000061.1 GCA938029445_00254 gene open 4692-5531
512 CALHFY010000062.1 GCA938029445_00255 gene open 556-628 trnF
513 CALHFY010000062.1 GCA938029445_00256 gene open 631-708 trnfM
514 CALHFY010000062.1 GCA938029445_00257 gene open 730-820 trnS
515 CALHFY010000062.1 GCA938029445_00258 gene open 826-899 trnI
516 CALHFY010000062.1 GCA938029445_00259 gene open 931-1007 trnM
517 CALHFY010000062.1 GCA938029445_00255 tRNA open 556-628 trnF tRNA-Phe(gaa)
518 CALHFY010000062.1 GCA938029445_00256 tRNA open 631-708 trnfM tRNA-fMet(cat)
519 CALHFY010000062.1 GCA938029445_00257 tRNA open 730-820 trnS tRNA-Ser(tga)
520 CALHFY010000062.1 GCA938029445_00258 tRNA open 826-899 trnI tRNA-Ile2(cat)
521 CALHFY010000062.1 GCA938029445_00259 tRNA open 931-1007 trnM tRNA-Met(cat)
522 CALHFY010000063.1 GCA938029445_00260 CDS open 305-1435 _na     376_aa Nuclease SbcCD subunit D
523 CALHFY010000063.1 GCA938029445_00261 CDS open 1731-3035 _na     434_aa M18 family aminopeptidase
524 CALHFY010000063.1 GCA938029445_00262 CDS open 3032-4279 _na     415_aa Thermophilic metalloprotease (M29)
525 CALHFY010000063.1 GCA938029445_00263 CDS open 4276-5061 _na     261_aa sseB SseB protein N-terminal domain-containing protein
526 CALHFY010000063.1 GCA938029445_00264 CDS open 5145-5447 _na     100_aa hypothetical protein
527 CALHFY010000063.1 GCA938029445_00265 CDS open 5457-6113 _na     218_aa Prepilin peptidase A24 N-terminal domain-containing protein
528 CALHFY010000063.1 GCA938029445_00266 CDS open 6149-6595 _na     148_aa DUF5673 domain-containing protein
529 CALHFY010000063.1 GCA938029445_00267 CDS open 6718-7107 _na     129_aa hypothetical protein
530 CALHFY010000063.1 GCA938029445_00260 gene open 305-1435
531 CALHFY010000063.1 GCA938029445_00261 gene open 1731-3035
532 CALHFY010000063.1 GCA938029445_00262 gene open 3032-4279
533 CALHFY010000063.1 GCA938029445_00263 gene open 4276-5061 sseB
534 CALHFY010000063.1 GCA938029445_00264 gene open 5145-5447
535 CALHFY010000063.1 GCA938029445_00265 gene open 5457-6113
536 CALHFY010000063.1 GCA938029445_00266 gene open 6149-6595
537 CALHFY010000063.1 GCA938029445_00267 gene open 6718-7107
538 CALHFY010000064.1 GCA938029445_00268 CDS open 1290-2153 _na     287_aa Metallo-beta-lactamase domain protein
539 CALHFY010000064.1 GCA938029445_00268 gene open 1290-2153
540 CALHFY010000065.1 GCA938029445_00269 CDS open 357-1625 _na     422_aa Citrate transporter
541 CALHFY010000065.1 GCA938029445_00269 gene open 357-1625
542 CALHFY010000066.1 GCA938029445_00270 CDS open 447-1106 _na     219_aa hypothetical protein
543 CALHFY010000066.1 GCA938029445_00271 CDS open 1149-2579 _na     476_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
544 CALHFY010000066.1 GCA938029445_00272 CDS open 2579-3970 _na     463_aa Aspartyl/glutamyl-tRNA amidotransferase subunit A
545 CALHFY010000066.1 GCA938029445_00273 CDS open 3970-4266 _na     98_aa Aspartyl/glutamyl-tRNA(Asn/Gln) amidotransferase%2C C subunit
546 CALHFY010000066.1 GCA938029445_00274 CDS open 4308-6014 _na     568_aa ligA NAD-dependent DNA ligase LigA
547 CALHFY010000066.1 GCA938029445_00270 gene open 447-1106
548 CALHFY010000066.1 GCA938029445_00271 gene open 1149-2579 gatB
549 CALHFY010000066.1 GCA938029445_00272 gene open 2579-3970
550 CALHFY010000066.1 GCA938029445_00273 gene open 3970-4266
551 CALHFY010000066.1 GCA938029445_00274 gene open 4308-6014 ligA
552 CALHFY010000067.1 GCA938029445_00275 CDS open 177-1166 _na     329_aa DUF3137 domain-containing protein
553 CALHFY010000067.1 GCA938029445_00276 CDS open 1252-1722 _na     156_aa DUF4367 domain-containing protein
554 CALHFY010000067.1 GCA938029445_00277 CDS open 1800-2762 _na     320_aa Oxidoreductase%2C NAD-binding domain protein
555 CALHFY010000067.1 GCA938029445_00275 gene open 177-1166
556 CALHFY010000067.1 GCA938029445_00276 gene open 1252-1722
557 CALHFY010000067.1 GCA938029445_00277 gene open 1800-2762
558 CALHFY010000068.1 GCA938029445_00278 CDS open 128-2302 _na     724_aa ccmA heme ABC exporter ATP-binding protein CcmA
559 CALHFY010000068.1 GCA938029445_00279 CDS open 2314-2907 _na     197_aa TIGR02185 family protein
560 CALHFY010000068.1 GCA938029445_00278 gene open 128-2302 ccmA
561 CALHFY010000068.1 GCA938029445_00279 gene open 2314-2907
562 CALHFY010000069.1 GCA938029445_00280 CDS open 35-520 _na     161_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
563 CALHFY010000069.1 GCA938029445_00281 CDS open 565-1605 _na     346_aa recA recombinase RecA
564 CALHFY010000069.1 GCA938029445_00282 CDS open 1636-3111 _na     491_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
565 CALHFY010000069.1 GCA938029445_00280 gene open 35-520 pgsA
566 CALHFY010000069.1 GCA938029445_00281 gene open 565-1605 recA
567 CALHFY010000069.1 GCA938029445_00282 gene open 1636-3111
568 CALHFY010000070.1 GCA938029445_00283 CDS open 106-726 _na     206_aa Riboflavin transporter
569 CALHFY010000070.1 GCA938029445_00284 CDS open 783-1622 _na     279_aa hypothetical protein
570 CALHFY010000070.1 GCA938029445_00285 CDS open 1622-2266 _na     214_aa cmk (d)CMP kinase
571 CALHFY010000070.1 GCA938029445_00286 CDS open 2081-2461 _na     126_aa hypothetical protein
572 CALHFY010000070.1 GCA938029445_00283 gene open 106-726
573 CALHFY010000070.1 GCA938029445_00284 gene open 783-1622
574 CALHFY010000070.1 GCA938029445_00285 gene open 1622-2266 cmk
575 CALHFY010000070.1 GCA938029445_00286 gene open 2081-2461
576 CALHFY010000071.1 repeat_region open 34-210 CRISPR array with 3 repeats of length 37%2C consensus sequence GTTTTTGTACTCTAAAGTTTTAAGTGAATGTAAAACA and spacer length 29
577 CALHFY010000071.1 GCA938029445_00289 CDS open 556-1911 _na     451_aa mgtE magnesium transporter
578 CALHFY010000071.1 GCA938029445_00289 gene open 556-1911 mgtE
579 CALHFY010000071.1 GCA938029445_00287 gene open 308-378 trnC
580 CALHFY010000071.1 GCA938029445_00288 gene open 384-466 trnL
581 CALHFY010000071.1 GCA938029445_00287 tRNA open 308-378 trnC tRNA-Cys(gca)
582 CALHFY010000071.1 GCA938029445_00288 tRNA open 384-466 trnL tRNA-Leu(taa)
583 CALHFY010000072.1 GCA938029445_00290 CDS open 20-715 _na     231_aa hypothetical protein
584 CALHFY010000072.1 GCA938029445_00291 CDS open 910-2619 _na     569_aa ABC transporter%2C ATP-binding protein
585 CALHFY010000072.1 GCA938029445_00292 CDS open 2612-4294 _na     560_aa ABC transporter%2C ATP-binding protein
586 CALHFY010000072.1 GCA938029445_00293 CDS open 4274-5221 _na     315_aa Serine-type D-Ala-D-Ala carboxypeptidase
587 CALHFY010000072.1 GCA938029445_00294 CDS open 5356-5511 _na     51_aa hypothetical protein
588 CALHFY010000072.1 GCA938029445_00290 gene open 20-715
589 CALHFY010000072.1 GCA938029445_00291 gene open 910-2619
590 CALHFY010000072.1 GCA938029445_00292 gene open 2612-4294
591 CALHFY010000072.1 GCA938029445_00293 gene open 4274-5221
592 CALHFY010000072.1 GCA938029445_00294 gene open 5356-5511
593 CALHFY010000074.1 GCA938029445_00295 CDS open 297-554 _na     85_aa hypothetical protein
594 CALHFY010000074.1 GCA938029445_00295 gene open 297-554
595 CALHFY010000075.1 GCA938029445_00296 CDS open 42-761 _na     239_aa hypothetical protein
596 CALHFY010000075.1 GCA938029445_00297 CDS open 764-994 _na     76_aa Carrier domain-containing protein
597 CALHFY010000075.1 GCA938029445_00298 CDS open 1060-1374 _na     104_aa Phosphopantetheine--protein transferase domain protein
598 CALHFY010000075.1 GCA938029445_00299 CDS open 1430-3928 _na     832_aa peptidoglycan glycosyltransferase
599 CALHFY010000075.1 GCA938029445_00296 gene open 42-761
600 CALHFY010000075.1 GCA938029445_00297 gene open 764-994
601 CALHFY010000075.1 GCA938029445_00298 gene open 1060-1374
602 CALHFY010000075.1 GCA938029445_00299 gene open 1430-3928
603 CALHFY010000076.1 regulatory_region open 843-1078 T-box leader
604 CALHFY010000076.1 GCA938029445_00300 CDS open 71-355 _na     94_aa hypothetical protein
605 CALHFY010000076.1 GCA938029445_00301 CDS open 416-799 _na     127_aa Rhodanese-like protein
606 CALHFY010000076.1 GCA938029445_00302 CDS open 1123-2142 _na     339_aa ABC transporter%2C ATP-binding protein
607 CALHFY010000076.1 GCA938029445_00303 CDS open 2144-2800 _na     218_aa ABC transporter%2C permease protein
608 CALHFY010000076.1 GCA938029445_00304 CDS open 2826-3665 _na     279_aa Lipoprotein
609 CALHFY010000076.1 GCA938029445_00300 gene open 71-355
610 CALHFY010000076.1 GCA938029445_00301 gene open 416-799
611 CALHFY010000076.1 GCA938029445_00302 gene open 1123-2142
612 CALHFY010000076.1 GCA938029445_00303 gene open 2144-2800
613 CALHFY010000076.1 GCA938029445_00304 gene open 2826-3665
614 CALHFY010000077.1 GCA938029445_00305 CDS open 1179-1904 _na     241_aa dprA DNA-processing protein DprA
615 CALHFY010000077.1 GCA938029445_00306 CDS open 1940-2251 _na     103_aa Ribonuclease
616 CALHFY010000077.1 GCA938029445_00305 gene open 1179-1904 dprA
617 CALHFY010000077.1 GCA938029445_00306 gene open 1940-2251
618 CALHFY010000078.1 GCA938029445_00307 CDS open 275-1048 _na     257_aa hypothetical protein
619 CALHFY010000078.1 GCA938029445_00308 CDS open 1045-1455 _na     136_aa DNA-binding helix-turn-helix protein
620 CALHFY010000078.1 GCA938029445_00309 CDS open 1554-3497 _na     647_aa htpG molecular chaperone HtpG
621 CALHFY010000078.1 GCA938029445_00307 gene open 275-1048
622 CALHFY010000078.1 GCA938029445_00308 gene open 1045-1455
623 CALHFY010000078.1 GCA938029445_00309 gene open 1554-3497 htpG
624 CALHFY010000079.1 regulatory_region open 692-877 T-box leader
625 CALHFY010000079.1 GCA938029445_00310 CDS open 895-1626 _na     243_aa hypothetical protein
626 CALHFY010000079.1 GCA938029445_00311 CDS open 1682-2533 _na     283_aa Ser/Thr phosphatase family protein
627 CALHFY010000079.1 GCA938029445_00312 CDS open 2669-2932 _na     87_aa hypothetical protein
628 CALHFY010000079.1 GCA938029445_00313 CDS open 2916-3776 _na     286_aa Putative ABC transporter ATP-binding protein
629 CALHFY010000079.1 GCA938029445_00310 gene open 895-1626
630 CALHFY010000079.1 GCA938029445_00311 gene open 1682-2533
631 CALHFY010000079.1 GCA938029445_00312 gene open 2669-2932
632 CALHFY010000079.1 GCA938029445_00313 gene open 2916-3776
633 CALHFY010000080.1 GCA938029445_00314 CDS open 52-1533 _na     493_aa AMP-binding enzyme
634 CALHFY010000080.1 GCA938029445_00315 CDS open 1534-2853 _na     439_aa MBOAT family protein
635 CALHFY010000080.1 GCA938029445_00314 gene open 52-1533
636 CALHFY010000080.1 GCA938029445_00315 gene open 1534-2853
637 CALHFY010000081.1 GCA938029445_00316 CDS open 113-961 _na     282_aa hypothetical protein
638 CALHFY010000081.1 GCA938029445_00317 CDS open 967-2535 _na     522_aa glgA glycogen synthase GlgA
639 CALHFY010000081.1 GCA938029445_00316 gene open 113-961
640 CALHFY010000081.1 GCA938029445_00317 gene open 967-2535 glgA
641 CALHFY010000082.1 GCA938029445_00318 CDS open 54-476 _na     140_aa hypothetical protein
642 CALHFY010000082.1 GCA938029445_00319 CDS open 479-1027 _na     182_aa hpt hypoxanthine phosphoribosyltransferase
643 CALHFY010000082.1 GCA938029445_00320 CDS open 1030-2877 _na     615_aa ftsH ATP-dependent zinc metalloprotease FtsH
644 CALHFY010000082.1 GCA938029445_00321 CDS open 3005-4006 _na     333_aa FMN-binding domain-containing protein
645 CALHFY010000082.1 GCA938029445_00322 CDS open 4132-4494 _na     120_aa hypothetical protein
646 CALHFY010000082.1 GCA938029445_00318 gene open 54-476
647 CALHFY010000082.1 GCA938029445_00319 gene open 479-1027 hpt
648 CALHFY010000082.1 GCA938029445_00320 gene open 1030-2877 ftsH
649 CALHFY010000082.1 GCA938029445_00321 gene open 3005-4006
650 CALHFY010000082.1 GCA938029445_00322 gene open 4132-4494
651 CALHFY010000083.1 GCA938029445_00323 CDS open 16-744 _na     242_aa parA Sporulation initiation inhibitor protein Soj
652 CALHFY010000083.1 GCA938029445_00324 CDS open 716-1618 _na     300_aa ParB-like protein
653 CALHFY010000083.1 GCA938029445_00325 CDS open 1690-2016 _na     108_aa ATP synthase subunit I
654 CALHFY010000083.1 GCA938029445_00326 CDS open 2030-2731 _na     233_aa ATP synthase subunit a
655 CALHFY010000083.1 GCA938029445_00327 CDS open 2742-2966 _na     74_aa ATP synthase subunit c
656 CALHFY010000083.1 GCA938029445_00328 CDS open 2979-3560 _na     193_aa ATP synthase subunit b
657 CALHFY010000083.1 GCA938029445_00329 CDS open 3550-4095 _na     181_aa atpH ATP synthase F1 subunit delta
658 CALHFY010000083.1 GCA938029445_00330 CDS open 4092-5618 _na     508_aa atpA F0F1 ATP synthase subunit alpha
659 CALHFY010000083.1 GCA938029445_00323 gene open 16-744 parA
660 CALHFY010000083.1 GCA938029445_00324 gene open 716-1618
661 CALHFY010000083.1 GCA938029445_00325 gene open 1690-2016
662 CALHFY010000083.1 GCA938029445_00326 gene open 2030-2731
663 CALHFY010000083.1 GCA938029445_00327 gene open 2742-2966
664 CALHFY010000083.1 GCA938029445_00328 gene open 2979-3560
665 CALHFY010000083.1 GCA938029445_00329 gene open 3550-4095 atpH
666 CALHFY010000083.1 GCA938029445_00330 gene open 4092-5618 atpA
667 CALHFY010000084.1 GCA938029445_00331 CDS open 47-673 _na     208_aa hypothetical protein
668 CALHFY010000084.1 GCA938029445_00331 gene open 47-673
669 CALHFY010000085.1 GCA938029445_00332 CDS open 266-430 _na     54_aa Sugar kinase
670 CALHFY010000085.1 GCA938029445_00333 CDS open 427-1284 _na     285_aa pfkB Kinase%2C PfkB family
671 CALHFY010000085.1 GCA938029445_00334 CDS open 1286-2269 _na     327_aa 2-dehydro-3-deoxy-phosphogluconate aldolase
672 CALHFY010000085.1 GCA938029445_00335 CDS open 2454-2753 _na     99_aa hypothetical protein
673 CALHFY010000085.1 GCA938029445_00336 CDS open 2696-3661 _na     321_aa Glycosyl hydrolase%2C family 88
674 CALHFY010000085.1 GCA938029445_00337 CDS open 3672-4163 _na     163_aa agaB PTS system%2C mannose/fructose/sorbose family%2C IIB component
675 CALHFY010000085.1 GCA938029445_00338 CDS open 4185-4973 _na     262_aa manY PTS system sorbose-specific iic component
676 CALHFY010000085.1 GCA938029445_00339 CDS open 4960-5778 _na     272_aa PTS system mannose/fructose/sorbose family IID component
677 CALHFY010000085.1 GCA938029445_00332 gene open 266-430
678 CALHFY010000085.1 GCA938029445_00333 gene open 427-1284 pfkB
679 CALHFY010000085.1 GCA938029445_00334 gene open 1286-2269
680 CALHFY010000085.1 GCA938029445_00335 gene open 2454-2753
681 CALHFY010000085.1 GCA938029445_00336 gene open 2696-3661
682 CALHFY010000085.1 GCA938029445_00337 gene open 3672-4163 agaB
683 CALHFY010000085.1 GCA938029445_00338 gene open 4185-4973 manY
684 CALHFY010000085.1 GCA938029445_00339 gene open 4960-5778
685 CALHFY010000086.1 GCA938029445_00340 CDS open 525-1484 _na     319_aa hypothetical protein
686 CALHFY010000086.1 GCA938029445_00340 gene open 525-1484
687 CALHFY010000087.1 GCA938029445_00341 CDS open 633-968 _na     111_aa hypothetical protein
688 CALHFY010000087.1 GCA938029445_00341 gene open 633-968
689 CALHFY010000088.1 GCA938029445_00342 CDS open 199-1434 _na     411_aa Phospholipase%2C patatin family
690 CALHFY010000088.1 GCA938029445_00343 CDS open 1437-1922 _na     161_aa dUTP diphosphatase
691 CALHFY010000088.1 GCA938029445_00344 CDS open 1934-2788 _na     284_aa map type I methionyl aminopeptidase
692 CALHFY010000088.1 GCA938029445_00345 CDS open 2788-4425 _na     545_aa pPX1 putative manganese-dependent inorganic diphosphatase
693 CALHFY010000088.1 GCA938029445_00346 CDS open 4438-5349 _na     303_aa ribonuclease Z
694 CALHFY010000088.1 GCA938029445_00347 CDS open 5349-6245 _na     298_aa Lipid kinase%2C YegS/Rv2252/BmrU family
695 CALHFY010000088.1 GCA938029445_00348 CDS open 6385-6522 _na     45_aa Entericidin EcnA/B family protein
696 CALHFY010000088.1 GCA938029445_00350 CDS open 6862-7881 _na     339_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
697 CALHFY010000088.1 GCA938029445_00351 CDS open 7882-8634 _na     250_aa ABC transporter%2C ATP-binding protein
698 CALHFY010000088.1 GCA938029445_00352 CDS open 8648-9778 _na     376_aa Periplasmic binding protein
699 CALHFY010000088.1 GCA938029445_00342 gene open 199-1434
700 CALHFY010000088.1 GCA938029445_00343 gene open 1437-1922
701 CALHFY010000088.1 GCA938029445_00344 gene open 1934-2788 map
702 CALHFY010000088.1 GCA938029445_00345 gene open 2788-4425 pPX1
703 CALHFY010000088.1 GCA938029445_00346 gene open 4438-5349
704 CALHFY010000088.1 GCA938029445_00347 gene open 5349-6245
705 CALHFY010000088.1 GCA938029445_00348 gene open 6385-6522
706 CALHFY010000088.1 GCA938029445_00350 gene open 6862-7881
707 CALHFY010000088.1 GCA938029445_00351 gene open 7882-8634
708 CALHFY010000088.1 GCA938029445_00352 gene open 8648-9778
709 CALHFY010000088.1 GCA938029445_00349 gene open 6645-6718 trnR
710 CALHFY010000088.1 GCA938029445_00349 tRNA open 6645-6718 trnR tRNA-Arg(ccg)
711 CALHFY010000089.1 GCA938029445_00353 CDS open 23-1063 _na     346_aa tRNA(Met) cytidine acetate ligase
712 CALHFY010000089.1 GCA938029445_00354 CDS open 1033-1575 _na     180_aa hypothetical protein
713 CALHFY010000089.1 GCA938029445_00355 CDS open 1643-2374 _na     243_aa tACO1 putative transcriptional regulatory protein HMPREF9013_0604
714 CALHFY010000089.1 GCA938029445_00356 CDS open 2466-3176 _na     236_aa Diadenosine tetraphosphatase
715 CALHFY010000089.1 GCA938029445_00353 gene open 23-1063
716 CALHFY010000089.1 GCA938029445_00354 gene open 1033-1575
717 CALHFY010000089.1 GCA938029445_00355 gene open 1643-2374 tACO1
718 CALHFY010000089.1 GCA938029445_00356 gene open 2466-3176
719 CALHFY010000090.1 GCA938029445_00357 CDS open 619-1008 _na     129_aa Phage protein
720 CALHFY010000090.1 GCA938029445_00358 CDS open 1261-1926 _na     221_aa Bacterial transferase hexapeptide repeat protein
721 CALHFY010000090.1 GCA938029445_00359 CDS open 1938-2255 _na     105_aa hypothetical protein
722 CALHFY010000090.1 GCA938029445_00357 gene open 619-1008
723 CALHFY010000090.1 GCA938029445_00358 gene open 1261-1926
724 CALHFY010000090.1 GCA938029445_00359 gene open 1938-2255
725 CALHFY010000092.1 GCA938029445_00360 CDS open 51-2708 _na     885_aa DNA-directed DNA polymerase
726 CALHFY010000092.1 GCA938029445_00361 CDS open 2734-3396 _na     220_aa Methyltransferase domain-containing protein
727 CALHFY010000092.1 GCA938029445_00362 CDS open 3411-4250 _na     279_aa hypothetical protein
728 CALHFY010000092.1 GCA938029445_00363 CDS open 4375-4899 _na     174_aa WYL domain-containing protein
729 CALHFY010000092.1 GCA938029445_00364 CDS open 4908-5132 _na     74_aa Multidrug efflux transporter
730 CALHFY010000092.1 GCA938029445_00365 CDS open 5257-5745 _na     162_aa DUF5673 domain-containing protein
731 CALHFY010000092.1 GCA938029445_00366 CDS open 5818-6525 _na     235_aa ABC transporter%2C ATP-binding protein
732 CALHFY010000092.1 GCA938029445_00360 gene open 51-2708
733 CALHFY010000092.1 GCA938029445_00361 gene open 2734-3396
734 CALHFY010000092.1 GCA938029445_00362 gene open 3411-4250
735 CALHFY010000092.1 GCA938029445_00363 gene open 4375-4899
736 CALHFY010000092.1 GCA938029445_00364 gene open 4908-5132
737 CALHFY010000092.1 GCA938029445_00365 gene open 5257-5745
738 CALHFY010000092.1 GCA938029445_00366 gene open 5818-6525
739 CALHFY010000093.1 GCA938029445_00367 CDS open 32-277 _na     81_aa hypothetical protein
740 CALHFY010000093.1 GCA938029445_00368 CDS open 336-914 _na     192_aa ruvA Holliday junction branch migration protein RuvA
741 CALHFY010000093.1 GCA938029445_00369 CDS open 928-1941 _na     337_aa ruvB Holliday junction branch migration DNA helicase RuvB
742 CALHFY010000093.1 GCA938029445_00367 gene open 32-277
743 CALHFY010000093.1 GCA938029445_00368 gene open 336-914 ruvA
744 CALHFY010000093.1 GCA938029445_00369 gene open 928-1941 ruvB
745 CALHFY010000094.1 GCA938029445_00370 CDS open 296-421 _na     41_aa hypothetical protein
746 CALHFY010000094.1 GCA938029445_00371 CDS open 517-1350 _na     277_aa PF14132 domain protein
747 CALHFY010000094.1 GCA938029445_00372 CDS open 1402-1929 _na     175_aa Nitroreductase family protein
748 CALHFY010000094.1 GCA938029445_00373 CDS open 1930-2610 _na     226_aa DNA alkylation repair enzyme
749 CALHFY010000094.1 GCA938029445_00374 CDS open 3091-3291 _na     66_aa yafQ Type II toxin-antitoxin system YafQ family toxin
750 CALHFY010000094.1 GCA938029445_00375 CDS open 3284-3553 _na     89_aa hypothetical protein
751 CALHFY010000094.1 GCA938029445_00376 CDS open 3630-3767 _na     45_aa hypothetical protein
752 CALHFY010000094.1 GCA938029445_00378 CDS open 4169-4348 _na     59_aa hypothetical protein
753 CALHFY010000094.1 GCA938029445_00379 CDS open 4442-5290 _na     282_aa Oxidoreductase%2C aldo/keto reductase family protein
754 CALHFY010000094.1 GCA938029445_00380 CDS open 5327-5572 _na     81_aa Heavy metal-associated domain protein
755 CALHFY010000094.1 GCA938029445_00381 CDS open 5565-8057 _na     830_aa P-type Cu(+) transporter
756 CALHFY010000094.1 GCA938029445_00382 CDS open 8066-8359 _na     97_aa csoR Copper-sensing transcriptional repressor CsoR
757 CALHFY010000094.1 GCA938029445_00383 CDS open 8410-8511 _na     33_aa hypothetical protein
758 CALHFY010000094.1 GCA938029445_00384 CDS open 8560-9324 _na     254_aa endonuclease/exonuclease/phosphatase family protein
759 CALHFY010000094.1 GCA938029445_00385 CDS open 9263-10324 _na     353_aa hypothetical protein
760 CALHFY010000094.1 GCA938029445_00370 gene open 296-421
761 CALHFY010000094.1 GCA938029445_00371 gene open 517-1350
762 CALHFY010000094.1 GCA938029445_00372 gene open 1402-1929
763 CALHFY010000094.1 GCA938029445_00373 gene open 1930-2610
764 CALHFY010000094.1 GCA938029445_00374 gene open 3091-3291 yafQ
765 CALHFY010000094.1 GCA938029445_00375 gene open 3284-3553
766 CALHFY010000094.1 GCA938029445_00376 gene open 3630-3767
767 CALHFY010000094.1 GCA938029445_00378 gene open 4169-4348
768 CALHFY010000094.1 GCA938029445_00379 gene open 4442-5290
769 CALHFY010000094.1 GCA938029445_00380 gene open 5327-5572
770 CALHFY010000094.1 GCA938029445_00381 gene open 5565-8057
771 CALHFY010000094.1 GCA938029445_00382 gene open 8066-8359 csoR
772 CALHFY010000094.1 GCA938029445_00383 gene open 8410-8511
773 CALHFY010000094.1 GCA938029445_00384 gene open 8560-9324
774 CALHFY010000094.1 GCA938029445_00385 gene open 9263-10324
775 CALHFY010000094.1 GCA938029445_00377 gene open 3960-4032 trnN
776 CALHFY010000094.1 GCA938029445_00377 tRNA open 3960-4032 trnN tRNA-Asn(gtt)
777 CALHFY010000095.1 GCA938029445_00386 CDS open 26-1168 _na     380_aa secA Preprotein translocase subunit SecA
778 CALHFY010000095.1 GCA938029445_00387 CDS open 1226-2266 _na     346_aa prfB peptide chain release factor 2
779 CALHFY010000095.1 GCA938029445_00388 CDS open 2287-3117 _na     276_aa nudC NAD(+) diphosphatase
780 CALHFY010000095.1 GCA938029445_00389 CDS open 3569-4150 _na     193_aa Acetyltransferase%2C GNAT family
781 CALHFY010000095.1 GCA938029445_00390 CDS open 4218-6011 _na     597_aa Creatinase
782 CALHFY010000095.1 GCA938029445_00391 CDS open 6011-6766 _na     251_aa exodeoxyribonuclease III
783 CALHFY010000095.1 GCA938029445_00392 CDS open 6784-8145 _na     453_aa argE Putative dipeptidase
784 CALHFY010000095.1 GCA938029445_00393 CDS open 8192-9031 _na     279_aa Haloacid dehalogenase-like hydrolase
785 CALHFY010000095.1 GCA938029445_00394 CDS open 9019-9783 _na     254_aa Putative N-acetylmuramoyl-L-alanine amidase
786 CALHFY010000095.1 GCA938029445_00386 gene open 26-1168 secA
787 CALHFY010000095.1 GCA938029445_00387 gene open 1226-2266 prfB
788 CALHFY010000095.1 GCA938029445_00388 gene open 2287-3117 nudC
789 CALHFY010000095.1 GCA938029445_00389 gene open 3569-4150
790 CALHFY010000095.1 GCA938029445_00390 gene open 4218-6011
791 CALHFY010000095.1 GCA938029445_00391 gene open 6011-6766
792 CALHFY010000095.1 GCA938029445_00392 gene open 6784-8145 argE
793 CALHFY010000095.1 GCA938029445_00393 gene open 8192-9031
794 CALHFY010000095.1 GCA938029445_00394 gene open 9019-9783
795 CALHFY010000096.1 GCA938029445_00395 CDS open 231-1169 _na     312_aa yejF ABC transporter%2C ATP-binding protein
796 CALHFY010000096.1 GCA938029445_00396 CDS open 1162-2142 _na     326_aa dppD ABC transporter%2C ATP-binding protein
797 CALHFY010000096.1 GCA938029445_00395 gene open 231-1169 yejF
798 CALHFY010000096.1 GCA938029445_00396 gene open 1162-2142 dppD
799 CALHFY010000097.1 GCA938029445_00397 CDS open 71-2077 _na     668_aa tex Tex-like protein N-terminal domain protein
800 CALHFY010000097.1 GCA938029445_00397 gene open 71-2077 tex
801 CALHFY010000098.1 GCA938029445_00398 CDS open 54-482 _na     142_aa Endonuclease III
802 CALHFY010000098.1 GCA938029445_00399 CDS open 541-1434 _na     297_aa degV EDD domain protein%2C DegV family
803 CALHFY010000098.1 GCA938029445_00400 CDS open 1483-1659 _na     58_aa hypothetical protein
804 CALHFY010000098.1 GCA938029445_00401 CDS open 1794-1931 _na     45_aa hypothetical protein
805 CALHFY010000098.1 GCA938029445_00398 gene open 54-482
806 CALHFY010000098.1 GCA938029445_00399 gene open 541-1434 degV
807 CALHFY010000098.1 GCA938029445_00400 gene open 1483-1659
808 CALHFY010000098.1 GCA938029445_00401 gene open 1794-1931
809 CALHFY010000099.1 GCA938029445_00402 CDS open 3-596 _na     197_aa uppS polyprenyl diphosphate synthase
810 CALHFY010000099.1 GCA938029445_00403 CDS open 593-1387 _na     264_aa Phosphatidate cytidylyltransferase
811 CALHFY010000099.1 GCA938029445_00404 CDS open 1384-2535 _na     383_aa dxr 1-deoxy-D-xylulose-5-phosphate reductoisomerase
812 CALHFY010000099.1 GCA938029445_00402 gene open 3-596 uppS
813 CALHFY010000099.1 GCA938029445_00403 gene open 593-1387
814 CALHFY010000099.1 GCA938029445_00404 gene open 1384-2535 dxr
815 CALHFY010000100.1 GCA938029445_00405 CDS open 61-543 _na     160_aa hypothetical protein
816 CALHFY010000100.1 GCA938029445_00406 CDS open 641-946 _na     101_aa PTS system%2C Lactose/Cellobiose specific IIB subunit
817 CALHFY010000100.1 GCA938029445_00407 CDS open 953-1258 _na     101_aa PTS system%2C Lactose/Cellobiose specific IIA subunit
818 CALHFY010000100.1 GCA938029445_00408 CDS open 1418-3175 _na     585_aa ABC transporter%2C ATP-binding protein
819 CALHFY010000100.1 GCA938029445_00409 CDS open 3177-4262 _na     361_aa ABC transporter%2C ATP-binding protein
820 CALHFY010000100.1 GCA938029445_00405 gene open 61-543
821 CALHFY010000100.1 GCA938029445_00406 gene open 641-946
822 CALHFY010000100.1 GCA938029445_00407 gene open 953-1258
823 CALHFY010000100.1 GCA938029445_00408 gene open 1418-3175
824 CALHFY010000100.1 GCA938029445_00409 gene open 3177-4262
825 CALHFY010000101.1 GCA938029445_00410 CDS open 184-1161 _na     325_aa DNA polymerase III%2C delta' subunit
826 CALHFY010000101.1 GCA938029445_00411 CDS open 1151-1819 _na     222_aa tmk dTMP kinase
827 CALHFY010000101.1 GCA938029445_00412 CDS open 2032-2811 _na     259_aa Serine-type D-Ala-D-Ala carboxypeptidase
828 CALHFY010000101.1 GCA938029445_00413 CDS open 2821-3318 _na     165_aa queT QueT transporter
829 CALHFY010000101.1 GCA938029445_00414 CDS open 3533-4603 _na     356_aa phnD Phosphate/phosphite/phosphonate ABC transporter%2C periplasmic binding protein
830 CALHFY010000101.1 GCA938029445_00415 CDS open 4668-5234 _na     188_aa ABC transporter domain-containing protein
831 CALHFY010000101.1 GCA938029445_00416 CDS open 5250-5423 _na     57_aa hypothetical protein
832 CALHFY010000101.1 GCA938029445_00417 CDS open 5420-6247 _na     275_aa phnE phosphonate ABC transporter%2C permease protein PhnE
833 CALHFY010000101.1 GCA938029445_00418 CDS open 6258-7073 _na     271_aa phnE phosphonate ABC transporter%2C permease protein PhnE
834 CALHFY010000101.1 GCA938029445_00410 gene open 184-1161
835 CALHFY010000101.1 GCA938029445_00411 gene open 1151-1819 tmk
836 CALHFY010000101.1 GCA938029445_00412 gene open 2032-2811
837 CALHFY010000101.1 GCA938029445_00413 gene open 2821-3318 queT
838 CALHFY010000101.1 GCA938029445_00414 gene open 3533-4603 phnD
839 CALHFY010000101.1 GCA938029445_00415 gene open 4668-5234
840 CALHFY010000101.1 GCA938029445_00416 gene open 5250-5423
841 CALHFY010000101.1 GCA938029445_00417 gene open 5420-6247 phnE
842 CALHFY010000101.1 GCA938029445_00418 gene open 6258-7073 phnE
843 CALHFY010000102.1 GCA938029445_00419 CDS open 140-769 _na     209_aa rpe ribulose-phosphate 3-epimerase
844 CALHFY010000102.1 GCA938029445_00420 CDS open 766-1635 _na     289_aa rsgA ribosome small subunit-dependent GTPase A
845 CALHFY010000102.1 GCA938029445_00421 CDS open 1643-1801 _na     52_aa hypothetical protein
846 CALHFY010000102.1 GCA938029445_00419 gene open 140-769 rpe
847 CALHFY010000102.1 GCA938029445_00420 gene open 766-1635 rsgA
848 CALHFY010000102.1 GCA938029445_00421 gene open 1643-1801
849 CALHFY010000103.1 GCA938029445_00422 CDS open 18-341 _na     107_aa hypothetical protein
850 CALHFY010000103.1 GCA938029445_00423 CDS open 389-712 _na     107_aa darA Transcriptional regulator
851 CALHFY010000103.1 GCA938029445_00424 CDS open 782-1885 _na     367_aa ychF redox-regulated ATPase YchF
852 CALHFY010000103.1 GCA938029445_00425 CDS open 1889-2083 _na     64_aa DUF951 domain-containing protein
853 CALHFY010000103.1 GCA938029445_00426 CDS open 2076-2918 _na     280_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
854 CALHFY010000103.1 GCA938029445_00427 CDS open 2906-3364 _na     152_aa dtd D-aminoacyl-tRNA deacylase
855 CALHFY010000103.1 GCA938029445_00428 CDS open 3507-4637 _na     376_aa CHAP domain protein
856 CALHFY010000103.1 GCA938029445_00429 CDS open 4740-5063 _na     107_aa Phage holin family protein
857 CALHFY010000103.1 GCA938029445_00430 CDS open 5079-5285 _na     68_aa hypothetical protein
858 CALHFY010000103.1 GCA938029445_00422 gene open 18-341
859 CALHFY010000103.1 GCA938029445_00423 gene open 389-712 darA
860 CALHFY010000103.1 GCA938029445_00424 gene open 782-1885 ychF
861 CALHFY010000103.1 GCA938029445_00425 gene open 1889-2083
862 CALHFY010000103.1 GCA938029445_00426 gene open 2076-2918 folD
863 CALHFY010000103.1 GCA938029445_00427 gene open 2906-3364 dtd
864 CALHFY010000103.1 GCA938029445_00428 gene open 3507-4637
865 CALHFY010000103.1 GCA938029445_00429 gene open 4740-5063
866 CALHFY010000103.1 GCA938029445_00430 gene open 5079-5285
867 CALHFY010000104.1 GCA938029445_00431 CDS open 487-774 _na     95_aa Zn-dependent carboxypeptidase
868 CALHFY010000104.1 GCA938029445_00432 CDS open 726-1967 _na     413_aa Metal-dependent carboxypeptidase
869 CALHFY010000104.1 GCA938029445_00433 CDS open 2220-3284 _na     354_aa Ketopantoate reductase PanE/ApbA
870 CALHFY010000104.1 GCA938029445_00434 CDS open 3432-4373 _na     313_aa nupQ Branched-chain amino acid ABC transporter%2C permease protein
871 CALHFY010000104.1 GCA938029445_00435 CDS open 4370-5485 _na     371_aa nupP Branched-chain amino acid ABC transporter%2C permease protein
872 CALHFY010000104.1 GCA938029445_00436 CDS open 5475-7022 _na     515_aa nupO ABC transporter%2C ATP-binding protein
873 CALHFY010000104.1 GCA938029445_00437 CDS open 7135-8331 _na     398_aa Basic membrane protein
874 CALHFY010000104.1 GCA938029445_00431 gene open 487-774
875 CALHFY010000104.1 GCA938029445_00432 gene open 726-1967
876 CALHFY010000104.1 GCA938029445_00433 gene open 2220-3284
877 CALHFY010000104.1 GCA938029445_00434 gene open 3432-4373 nupQ
878 CALHFY010000104.1 GCA938029445_00435 gene open 4370-5485 nupP
879 CALHFY010000104.1 GCA938029445_00436 gene open 5475-7022 nupO
880 CALHFY010000104.1 GCA938029445_00437 gene open 7135-8331
881 CALHFY010000105.1 GCA938029445_00438 CDS open 22-1644 _na     540_aa recN DNA repair protein RecN
882 CALHFY010000105.1 GCA938029445_00438 gene open 22-1644 recN
883 CALHFY010000106.1 GCA938029445_00439 CDS open 550-1221 _na     223_aa radC DNA repair protein RadC
884 CALHFY010000106.1 GCA938029445_00440 CDS open 1266-2129 _na     287_aa pepI proline iminopeptidase
885 CALHFY010000106.1 GCA938029445_00439 gene open 550-1221 radC
886 CALHFY010000106.1 GCA938029445_00440 gene open 1266-2129 pepI
887 CALHFY010000107.1 GCA938029445_00441 CDS open 41-889 _na     282_aa guaC GMP reductase
888 CALHFY010000107.1 GCA938029445_00441 gene open 41-889 guaC
889 CALHFY010000108.1 GCA938029445_00442 CDS open 91-1032 _na     313_aa rseP RIP metalloprotease RseP
890 CALHFY010000108.1 GCA938029445_00443 CDS open 1041-1412 _na     123_aa hypothetical protein
891 CALHFY010000108.1 GCA938029445_00442 gene open 91-1032 rseP
892 CALHFY010000108.1 GCA938029445_00443 gene open 1041-1412
893 CALHFY010000109.1 GCA938029445_00444 CDS open 495-1412 _na     305_aa Pyridine nucleotide-disulfide oxidoreductase
894 CALHFY010000109.1 GCA938029445_00446 CDS open 1952-2143 _na     63_aa copG Ribbon-helix-helix protein CopG domain-containing protein
895 CALHFY010000109.1 GCA938029445_00447 CDS open 2430-3146 _na     238_aa thiF ThiF family protein
896 CALHFY010000109.1 GCA938029445_00448 CDS open 3221-3694 _na     157_aa ybaK Cys-tRNA(Pro) deacylase
897 CALHFY010000109.1 GCA938029445_00444 gene open 495-1412
898 CALHFY010000109.1 GCA938029445_00446 gene open 1952-2143 copG
899 CALHFY010000109.1 GCA938029445_00447 gene open 2430-3146 thiF
900 CALHFY010000109.1 GCA938029445_00448 gene open 3221-3694 ybaK
901 CALHFY010000109.1 GCA938029445_00445 gene open 1536-1615 trnL
902 CALHFY010000109.1 GCA938029445_00445 tRNA open 1536-1615 trnL tRNA-Leu(tag)
903 CALHFY010000110.1 GCA938029445_00449 CDS open 58-1047 _na     329_aa dusB tRNA dihydrouridine synthase DusB
904 CALHFY010000110.1 GCA938029445_00450 CDS open 1022-1906 _na     294_aa hslO Hsp33 family molecular chaperone HslO
905 CALHFY010000110.1 GCA938029445_00451 CDS open 1896-2192 _na     98_aa hypothetical protein
906 CALHFY010000110.1 GCA938029445_00449 gene open 58-1047 dusB
907 CALHFY010000110.1 GCA938029445_00450 gene open 1022-1906 hslO
908 CALHFY010000110.1 GCA938029445_00451 gene open 1896-2192
909 CALHFY010000111.1 GCA938029445_00452 CDS open 63-1415 _na     450_aa Polysaccharide biosynthesis protein
910 CALHFY010000111.1 GCA938029445_00453 CDS open 1556-1744 _na     62_aa hypothetical protein
911 CALHFY010000111.1 GCA938029445_00452 gene open 63-1415
912 CALHFY010000111.1 GCA938029445_00453 gene open 1556-1744
913 CALHFY010000112.1 GCA938029445_00454 CDS open 388-915 _na     175_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
914 CALHFY010000112.1 GCA938029445_00455 CDS open 971-2428 _na     485_aa DUF2779 domain-containing protein
915 CALHFY010000112.1 GCA938029445_00456 CDS open 2425-3327 _na     300_aa ROK family protein
916 CALHFY010000112.1 GCA938029445_00457 CDS open 3381-4694 _na     437_aa pepC Aminopeptidase
917 CALHFY010000112.1 GCA938029445_00458 CDS open 4936-5526 _na     196_aa DUF6707 domain-containing protein
918 CALHFY010000112.1 GCA938029445_00459 CDS open 5594-6100 _na     168_aa DUF1877 domain-containing protein
919 CALHFY010000112.1 GCA938029445_00460 CDS open 6119-6454 _na     111_aa hypothetical protein
920 CALHFY010000112.1 GCA938029445_00461 CDS open 6894-7373 _na     159_aa Integral membrane protein
921 CALHFY010000112.1 GCA938029445_00462 CDS open 7813-8223 _na     136_aa hypothetical protein
922 CALHFY010000112.1 GCA938029445_00454 gene open 388-915 hpf
923 CALHFY010000112.1 GCA938029445_00455 gene open 971-2428
924 CALHFY010000112.1 GCA938029445_00456 gene open 2425-3327
925 CALHFY010000112.1 GCA938029445_00457 gene open 3381-4694 pepC
926 CALHFY010000112.1 GCA938029445_00458 gene open 4936-5526
927 CALHFY010000112.1 GCA938029445_00459 gene open 5594-6100
928 CALHFY010000112.1 GCA938029445_00460 gene open 6119-6454
929 CALHFY010000112.1 GCA938029445_00461 gene open 6894-7373
930 CALHFY010000112.1 GCA938029445_00462 gene open 7813-8223
931 CALHFY010000113.1 GCA938029445_00463 CDS open 919-2601 _na     560_aa Phosphoglucomutase
932 CALHFY010000113.1 GCA938029445_00464 CDS open 2655-2921 _na     88_aa ptsH phosphocarrier protein HPr
933 CALHFY010000113.1 GCA938029445_00465 CDS open 3167-3643 _na     158_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
934 CALHFY010000113.1 GCA938029445_00466 CDS open 3643-3738 _na     31_aa hypothetical protein
935 CALHFY010000113.1 GCA938029445_00467 CDS open 3831-4631 _na     266_aa Metallo-beta-lactamase domain protein
936 CALHFY010000113.1 GCA938029445_00468 CDS open 4628-6118 _na     496_aa Peptidase%2C M23 family
937 CALHFY010000113.1 GCA938029445_00469 CDS open 6118-7482 _na     454_aa dnaB replicative DNA helicase
938 CALHFY010000113.1 GCA938029445_00470 CDS open 7482-7928 _na     148_aa rplI 50S ribosomal protein L9
939 CALHFY010000113.1 GCA938029445_00471 CDS open 7900-9879 _na     659_aa gdpP Cyclic-di-AMP phosphodiesterase
940 CALHFY010000113.1 GCA938029445_00472 CDS open 9885-10853 _na     322_aa DUF2232 domain-containing protein
941 CALHFY010000113.1 GCA938029445_00473 CDS open 11242-12480 _na     412_aa Bacterial capsule synthesis protein
942 CALHFY010000113.1 GCA938029445_00463 gene open 919-2601
943 CALHFY010000113.1 GCA938029445_00464 gene open 2655-2921 ptsH
944 CALHFY010000113.1 GCA938029445_00465 gene open 3167-3643 rlmH
945 CALHFY010000113.1 GCA938029445_00466 gene open 3643-3738
946 CALHFY010000113.1 GCA938029445_00467 gene open 3831-4631
947 CALHFY010000113.1 GCA938029445_00468 gene open 4628-6118
948 CALHFY010000113.1 GCA938029445_00469 gene open 6118-7482 dnaB
949 CALHFY010000113.1 GCA938029445_00470 gene open 7482-7928 rplI
950 CALHFY010000113.1 GCA938029445_00471 gene open 7900-9879 gdpP
951 CALHFY010000113.1 GCA938029445_00472 gene open 9885-10853
952 CALHFY010000113.1 GCA938029445_00473 gene open 11242-12480
953 CALHFY010000114.1 GCA938029445_00474 CDS open 990-1706 _na     238_aa ABC transporter%2C ATP-binding protein
954 CALHFY010000114.1 GCA938029445_00475 CDS open 1833-3527 _na     564_aa manB phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent)
955 CALHFY010000114.1 GCA938029445_00476 CDS open 3587-4660 _na     357_aa hypothetical protein
956 CALHFY010000114.1 GCA938029445_00474 gene open 990-1706
957 CALHFY010000114.1 GCA938029445_00475 gene open 1833-3527 manB
958 CALHFY010000114.1 GCA938029445_00476 gene open 3587-4660
959 CALHFY010000115.1 GCA938029445_00477 CDS open 182-1465 _na     427_aa Efflux ABC transporter%2C permease protein
960 CALHFY010000115.1 GCA938029445_00478 CDS open 1680-2039 _na     119_aa DUF2798 domain-containing protein
961 CALHFY010000115.1 GCA938029445_00479 CDS open 2230-2358 _na     42_aa hypothetical protein
962 CALHFY010000115.1 GCA938029445_00480 CDS open 2392-3741 _na     449_aa mepA Multidrug export protein MepA
963 CALHFY010000115.1 GCA938029445_00481 CDS open 3810-4103 _na     97_aa hypothetical protein
964 CALHFY010000115.1 GCA938029445_00482 CDS open 4150-5406 _na     418_aa ccmA heme ABC exporter ATP-binding protein CcmA
965 CALHFY010000115.1 GCA938029445_00477 gene open 182-1465
966 CALHFY010000115.1 GCA938029445_00478 gene open 1680-2039
967 CALHFY010000115.1 GCA938029445_00479 gene open 2230-2358
968 CALHFY010000115.1 GCA938029445_00480 gene open 2392-3741 mepA
969 CALHFY010000115.1 GCA938029445_00481 gene open 3810-4103
970 CALHFY010000115.1 GCA938029445_00482 gene open 4150-5406 ccmA
971 CALHFY010000116.1 GCA938029445_00483 CDS open 685-1302 _na     205_aa hypothetical protein
972 CALHFY010000116.1 GCA938029445_00484 CDS open 1320-2480 _na     386_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
973 CALHFY010000116.1 GCA938029445_00485 CDS open 2482-3102 _na     206_aa Haloacid dehalogenase-like hydrolase
974 CALHFY010000116.1 GCA938029445_00486 CDS open 3158-4534 _na     458_aa murC UDP-N-acetylmuramate--L-alanine ligase
975 CALHFY010000116.1 GCA938029445_00487 CDS open 4602-5135 _na     177_aa Acetyltransferase%2C GNAT family
976 CALHFY010000116.1 GCA938029445_00488 CDS open 5225-5656 _na     143_aa Membrane protein
977 CALHFY010000116.1 GCA938029445_00489 CDS open 5704-6120 _na     138_aa DUF2871 domain-containing protein
978 CALHFY010000116.1 GCA938029445_00490 CDS open 6117-6782 _na     221_aa Histidine kinase N-terminal 7TM region domain-containing protein
979 CALHFY010000116.1 GCA938029445_00483 gene open 685-1302
980 CALHFY010000116.1 GCA938029445_00484 gene open 1320-2480 rlmD
981 CALHFY010000116.1 GCA938029445_00485 gene open 2482-3102
982 CALHFY010000116.1 GCA938029445_00486 gene open 3158-4534 murC
983 CALHFY010000116.1 GCA938029445_00487 gene open 4602-5135
984 CALHFY010000116.1 GCA938029445_00488 gene open 5225-5656
985 CALHFY010000116.1 GCA938029445_00489 gene open 5704-6120
986 CALHFY010000116.1 GCA938029445_00490 gene open 6117-6782
987 CALHFY010000117.1 GCA938029445_00491 CDS open 569-1498 _na     309_aa fmt methionyl-tRNA formyltransferase
988 CALHFY010000117.1 GCA938029445_00491 gene open 569-1498 fmt
989 CALHFY010000118.1 GCA938029445_00492 CDS open 984-1091 _na     35_aa hypothetical protein
990 CALHFY010000118.1 GCA938029445_00493 CDS open 1522-2031 _na     169_aa tetR Transcriptional regulator%2C TetR family
991 CALHFY010000118.1 GCA938029445_00494 CDS open 2132-2899 _na     255_aa Uridine phosphorylase
992 CALHFY010000118.1 GCA938029445_00492 gene open 984-1091
993 CALHFY010000118.1 GCA938029445_00493 gene open 1522-2031 tetR
994 CALHFY010000118.1 GCA938029445_00494 gene open 2132-2899
995 CALHFY010000119.1 GCA938029445_00495 CDS open 9-416 _na     135_aa hypothetical protein
996 CALHFY010000119.1 GCA938029445_00497 CDS open 912-1286 _na     124_aa hypothetical protein
997 CALHFY010000119.1 GCA938029445_00495 gene open 9-416
998 CALHFY010000119.1 GCA938029445_00497 gene open 912-1286
999 CALHFY010000119.1 GCA938029445_00496 gene open 655-735 trnL
1000 CALHFY010000119.1 GCA938029445_00496 tRNA open 655-735 trnL tRNA-Leu(cag)