BAKTAGenome Explorer: Oribacterium sp. HMT-078 (GCA_938031325.1)
Select a Genome:
|
BAKTA Annotations for GCA_938031325.1
|
Search & Sort all 4954 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CALHHZ010000040.1 | GCA938031325_01738 | gene | open | 87314-89764 | |||
| 3502 | CALHHZ010000040.1 | GCA938031325_01739 | gene | open | 89803-90303 | |||
| 3503 | CALHHZ010000040.1 | GCA938031325_01740 | gene | open | 90360-90506 | |||
| 3504 | CALHHZ010000040.1 | GCA938031325_01741 | gene | open | 90526-91455 | |||
| 3505 | CALHHZ010000040.1 | GCA938031325_01742 | gene | open | 91458-92222 | |||
| 3506 | CALHHZ010000040.1 | GCA938031325_01743 | gene | open | 92773-93246 | |||
| 3507 | CALHHZ010000040.1 | GCA938031325_01744 | gene | open | 93429-94214 | rsmG | ||
| 3508 | CALHHZ010000040.1 | GCA938031325_01745 | gene | open | 94298-96187 | |||
| 3509 | CALHHZ010000040.1 | GCA938031325_01746 | gene | open | 96751-98130 | mnmE | ||
| 3510 | CALHHZ010000040.1 | GCA938031325_01747 | gene | open | 98216-99430 | jag | ||
| 3511 | CALHHZ010000040.1 | GCA938031325_01748 | gene | open | 99474-100799 | |||
| 3512 | CALHHZ010000040.1 | GCA938031325_01749 | gene | open | 101134-101499 | rnpA | ||
| 3513 | CALHHZ010000040.1 | GCA938031325_01750 | gene | open | 102039-103403 | dnaA | ||
| 3514 | CALHHZ010000040.1 | GCA938031325_01751 | gene | open | 103562-104683 | dnaN | ||
| 3515 | CALHHZ010000040.1 | GCA938031325_01752 | gene | open | 104683-105822 | recF | ||
| 3516 | CALHHZ010000040.1 | GCA938031325_01753 | gene | open | 105895-107865 | gyrB | ||
| 3517 | CALHHZ010000040.1 | GCA938031325_01754 | gene | open | 107895-110372 | gyrA | ||
| 3518 | CALHHZ010000040.1 | GCA938031325_01755 | gene | open | 110675-110764 | trnS | ||
| 3519 | CALHHZ010000040.1 | GCA938031325_01755 | tRNA | open | 110675-110764 | trnS | tRNA-Ser(gct) | |
| 3520 | CALHHZ010000041.1 | GCA938031325_01812 | gene | open | 73712-74052 | ssrA | ||
| 3521 | CALHHZ010000041.1 | GCA938031325_01812 | tmRNA | open | 73712-74052 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3522 | CALHHZ010000041.1 | regulatory_region | open | 30905-31143 | T-box leader | |||
| 3523 | CALHHZ010000041.1 | repeat_region | open | 24641-26554 | CRISPR array with 27 repeats of length 36%2C consensus sequence GTTTCCGTCCCCTTCGGGGATATCGGTTCTTCAAAT and spacer length 35 | |||
| 3524 | CALHHZ010000041.1 | repeat_region | open | 26579-27859 | CRISPR array with 18 repeats of length 36%2C consensus sequence GTTTCCGTCCCCTTCGGGGATATCGGTTCTTCAAAT and spacer length 36 | |||
| 3525 | CALHHZ010000041.1 | GCA938031325_01756 | CDS | open | 329-1321 | _na 330_aa | Serine-type D-Ala-D-Ala carboxypeptidase | |
| 3526 | CALHHZ010000041.1 | GCA938031325_01757 | CDS | open | 1455-2165 | _na 236_aa | tlpA | TlpA family protein disulfide reductase |
| 3527 | CALHHZ010000041.1 | GCA938031325_01758 | CDS | open | 2197-2415 | _na 72_aa | hypothetical protein | |
| 3528 | CALHHZ010000041.1 | GCA938031325_01759 | CDS | open | 2620-4233 | _na 537_aa | ABC transporter%2C substrate-binding protein%2C family 5 | |
| 3529 | CALHHZ010000041.1 | GCA938031325_01760 | CDS | open | 4733-5683 | _na 316_aa | appB | Putative oligopeptide ABC transporter%2C permease protein AppB |
| 3530 | CALHHZ010000041.1 | GCA938031325_01761 | CDS | open | 5932-6936 | _na 334_aa | appC | Oligopeptide ABC transporter%2C permease protein AppC family protein |
| 3531 | CALHHZ010000041.1 | GCA938031325_01762 | CDS | open | 6929-7960 | _na 343_aa | ABC transporter%2C ATP-binding protein | |
| 3532 | CALHHZ010000041.1 | GCA938031325_01763 | CDS | open | 7978-8958 | _na 326_aa | ABC transporter%2C ATP-binding protein | |
| 3533 | CALHHZ010000041.1 | GCA938031325_01764 | CDS | open | 9102-10340 | _na 412_aa | Mutator family transposase | |
| 3534 | CALHHZ010000041.1 | GCA938031325_01765 | CDS | open | 10445-12139 | _na 564_aa | G domain-containing protein | |
| 3535 | CALHHZ010000041.1 | GCA938031325_01766 | CDS | open | 12150-14252 | _na 700_aa | GTPase domain-containing protein | |
| 3536 | CALHHZ010000041.1 | GCA938031325_01767 | CDS | open | 14264-14827 | _na 187_aa | hypothetical protein | |
| 3537 | CALHHZ010000041.1 | GCA938031325_01768 | CDS | open | 14982-16124 | _na 380_aa | CRISPR system Cms protein Csm5 | |
| 3538 | CALHHZ010000041.1 | GCA938031325_01769 | CDS | open | 16121-17038 | _na 305_aa | CRISPR system Cms protein Csm4 | |
| 3539 | CALHHZ010000041.1 | GCA938031325_01770 | CDS | open | 17007-17768 | _na 253_aa | CRISPR system Cms endoribonuclease Csm3 | |
| 3540 | CALHHZ010000041.1 | GCA938031325_01771 | CDS | open | 17778-18299 | _na 173_aa | CRISPR system Cms protein Csm2 | |
| 3541 | CALHHZ010000041.1 | GCA938031325_01772 | CDS | open | 18280-20673 | _na 797_aa | cas10 | type III-A CRISPR-associated protein Cas10/Csm1 |
| 3542 | CALHHZ010000041.1 | GCA938031325_01773 | CDS | open | 20654-21415 | _na 253_aa | CRISPR-associated endoribonuclease Cas6 | |
| 3543 | CALHHZ010000041.1 | GCA938031325_01774 | CDS | open | 21593-22969 | _na 458_aa | CRISPR-associated protein%2C Csm6 family | |
| 3544 | CALHHZ010000041.1 | GCA938031325_01775 | CDS | open | 22981-23298 | _na 105_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3545 | CALHHZ010000041.1 | GCA938031325_01776 | CDS | open | 23304-24302 | _na 332_aa | cas1 | CRISPR-associated endonuclease Cas1 |
| 3546 | CALHHZ010000041.1 | GCA938031325_01777 | CDS | open | 28112-29788 | _na 558_aa | ilvD | dihydroxy-acid dehydratase |
| 3547 | CALHHZ010000041.1 | GCA938031325_01778 | CDS | open | 29835-30818 | _na 327_aa | Bile acid transporter | |
| 3548 | CALHHZ010000041.1 | GCA938031325_01779 | CDS | open | 31238-33118 | _na 626_aa | thrS | threonine--tRNA ligase |
| 3549 | CALHHZ010000041.1 | GCA938031325_01780 | CDS | open | 33239-35017 | _na 592_aa | 1-deoxy-D-xylulose-5-phosphate synthase | |
| 3550 | CALHHZ010000041.1 | GCA938031325_01781 | CDS | open | 35120-35572 | _na 150_aa | hypothetical protein | |
| 3551 | CALHHZ010000041.1 | GCA938031325_01782 | CDS | open | 35670-36953 | _na 427_aa | O-acetylhomoserine aminocarboxypropyltransferase | |
| 3552 | CALHHZ010000041.1 | GCA938031325_01783 | CDS | open | 37261-39696 | _na 811_aa | Cell wall-binding repeat protein | |
| 3553 | CALHHZ010000041.1 | GCA938031325_01784 | CDS | open | 40169-41371 | _na 400_aa | Glycosyl hydrolase%2C family 88 | |
| 3554 | CALHHZ010000041.1 | GCA938031325_01785 | CDS | open | 41554-42918 | _na 454_aa | Arylsulfatase | |
| 3555 | CALHHZ010000041.1 | GCA938031325_01786 | CDS | open | 43003-43899 | _na 298_aa | ABC transporter%2C permease protein | |
| 3556 | CALHHZ010000041.1 | GCA938031325_01787 | CDS | open | 43945-44853 | _na 302_aa | ABC transporter%2C permease protein | |
| 3557 | CALHHZ010000041.1 | GCA938031325_01788 | CDS | open | 44884-46218 | _na 444_aa | ABC transporter%2C solute-binding protein | |
| 3558 | CALHHZ010000041.1 | GCA938031325_01789 | CDS | open | 46477-47613 | _na 378_aa | HTH lacI-type domain-containing protein | |
| 3559 | CALHHZ010000041.1 | GCA938031325_01790 | CDS | open | 47802-48164 | _na 120_aa | hypothetical protein | |
| 3560 | CALHHZ010000041.1 | GCA938031325_01791 | CDS | open | 48246-49919 | _na 557_aa | recG | ATP-dependent DNA helicase RecG |
| 3561 | CALHHZ010000041.1 | GCA938031325_01792 | CDS | open | 50381-51517 | _na 378_aa | Putative anaerobic sulfatase maturase | |
| 3562 | CALHHZ010000041.1 | GCA938031325_01793 | CDS | open | 51693-52430 | _na 245_aa | hypothetical protein | |
| 3563 | CALHHZ010000041.1 | GCA938031325_01794 | CDS | open | 52442-52606 | _na 54_aa | hypothetical protein | |
| 3564 | CALHHZ010000041.1 | GCA938031325_01795 | CDS | open | 52709-54073 | _na 454_aa | MATE efflux family protein | |
| 3565 | CALHHZ010000041.1 | GCA938031325_01796 | CDS | open | 54221-55261 | _na 346_aa | lacI | Transcriptional regulator%2C LacI family |
| 3566 | CALHHZ010000041.1 | GCA938031325_01797 | CDS | open | 55325-56194 | _na 289_aa | Transcriptional regulator%2C effector binding domain protein | |
| 3567 | CALHHZ010000041.1 | GCA938031325_01798 | CDS | open | 56527-57003 | _na 158_aa | GIY-YIG domain-containing protein | |
| 3568 | CALHHZ010000041.1 | GCA938031325_01799 | CDS | open | 57097-58236 | _na 379_aa | Acyl-coenzyme A:6-aminopenicillanic acid acyl-transferase | |
| 3569 | CALHHZ010000041.1 | GCA938031325_01800 | CDS | open | 58389-59402 | _na 337_aa | Oxidoreductase%2C NAD-binding domain protein | |
| 3570 | CALHHZ010000041.1 | GCA938031325_01801 | CDS | open | 59399-60409 | _na 336_aa | rbsC | Putative ribose transport system permease protein RbsC |
| 3571 | CALHHZ010000041.1 | GCA938031325_01802 | CDS | open | 60413-61906 | _na 497_aa | Putative sugar ABC transporter%2C ATP binding protein | |
| 3572 | CALHHZ010000041.1 | GCA938031325_01803 | CDS | open | 62055-63146 | _na 363_aa | Sugar-binding domain protein | |
| 3573 | CALHHZ010000041.1 | GCA938031325_01804 | CDS | open | 63310-64332 | _na 340_aa | iolG | inositol 2-dehydrogenase |
| 3574 | CALHHZ010000041.1 | GCA938031325_01805 | CDS | open | 64394-65290 | _na 298_aa | iolE | myo-inosose-2 dehydratase |
| 3575 | CALHHZ010000041.1 | GCA938031325_01806 | CDS | open | 65526-66311 | _na 261_aa | iolB | Myo-inositol catabolism protein IolB |
| 3576 | CALHHZ010000041.1 | GCA938031325_01807 | CDS | open | 66328-68259 | _na 643_aa | iolD | 3D-(3%2C5/4)-trihydroxycyclohexane-1%2C2-dione acylhydrolase (decyclizing) |
| 3577 | CALHHZ010000041.1 | GCA938031325_01808 | CDS | open | 68252-69298 | _na 348_aa | Putative 5-dehydro-2-deoxygluconokinase | |
| 3578 | CALHHZ010000041.1 | GCA938031325_01809 | CDS | open | 69316-70170 | _na 284_aa | Ketose-bisphosphate aldolase | |
| 3579 | CALHHZ010000041.1 | GCA938031325_01810 | CDS | open | 70357-71157 | _na 266_aa | iolR | Putative HTH-type transcriptional regulator IolR |
| 3580 | CALHHZ010000041.1 | GCA938031325_01811 | CDS | open | 71402-73105 | _na 567_aa | Methylmalonate-semialdehyde dehydrogenase (Acylating) | |
| 3581 | CALHHZ010000041.1 | GCA938031325_01813 | CDS | open | 75482-75961 | _na 159_aa | hypothetical protein | |
| 3582 | CALHHZ010000041.1 | GCA938031325_01814 | CDS | open | 75987-76337 | _na 116_aa | hypothetical protein | |
| 3583 | CALHHZ010000041.1 | GCA938031325_01815 | CDS | open | 76492-76695 | _na 67_aa | XRE family transcriptional regulator | |
| 3584 | CALHHZ010000041.1 | GCA938031325_01816 | CDS | open | 76817-77338 | _na 173_aa | hypothetical protein | |
| 3585 | CALHHZ010000041.1 | GCA938031325_01817 | CDS | open | 77448-77648 | _na 66_aa | hypothetical protein | |
| 3586 | CALHHZ010000041.1 | GCA938031325_01818 | CDS | open | 77666-77923 | _na 85_aa | hypothetical protein | |
| 3587 | CALHHZ010000041.1 | GCA938031325_01819 | CDS | open | 78013-78660 | _na 215_aa | hypothetical protein | |
| 3588 | CALHHZ010000041.1 | GCA938031325_01820 | CDS | open | 78657-79070 | _na 137_aa | hypothetical protein | |
| 3589 | CALHHZ010000041.1 | GCA938031325_01821 | CDS | open | 79060-80265 | _na 401_aa | DUF2800 domain-containing protein | |
| 3590 | CALHHZ010000041.1 | GCA938031325_01822 | CDS | open | 80332-80466 | _na 44_aa | hypothetical protein | |
| 3591 | CALHHZ010000041.1 | GCA938031325_01823 | CDS | open | 80453-80683 | _na 76_aa | hypothetical protein | |
| 3592 | CALHHZ010000041.1 | GCA938031325_01824 | CDS | open | 80698-81282 | _na 194_aa | hypothetical protein | |
| 3593 | CALHHZ010000041.1 | GCA938031325_01825 | CDS | open | 81263-83359 | _na 698_aa | DNA-directed DNA polymerase | |
| 3594 | CALHHZ010000041.1 | GCA938031325_01826 | CDS | open | 83364-83669 | _na 101_aa | hypothetical protein | |
| 3595 | CALHHZ010000041.1 | GCA938031325_01827 | CDS | open | 83666-83809 | _na 47_aa | hypothetical protein | |
| 3596 | CALHHZ010000041.1 | GCA938031325_01828 | CDS | open | 83821-84150 | _na 109_aa | hypothetical protein | |
| 3597 | CALHHZ010000041.1 | GCA938031325_01829 | CDS | open | 84147-84602 | _na 151_aa | hypothetical protein | |
| 3598 | CALHHZ010000041.1 | GCA938031325_01830 | CDS | open | 84652-87105 | _na 817_aa | AAA domain-containing protein | |
| 3599 | CALHHZ010000041.1 | GCA938031325_01831 | CDS | open | 87395-87682 | _na 95_aa | hypothetical protein | |
| 3600 | CALHHZ010000041.1 | GCA938031325_01832 | CDS | open | 87679-87984 | _na 101_aa | VRR-NUC domain-containing protein | |
| 3601 | CALHHZ010000041.1 | GCA938031325_01833 | CDS | open | 87981-88169 | _na 62_aa | hypothetical protein | |
| 3602 | CALHHZ010000041.1 | GCA938031325_01834 | CDS | open | 88139-89518 | _na 459_aa | Helicase ATP-binding domain-containing protein | |
| 3603 | CALHHZ010000041.1 | GCA938031325_01835 | CDS | open | 89520-89753 | _na 77_aa | hypothetical protein | |
| 3604 | CALHHZ010000041.1 | GCA938031325_01836 | CDS | open | 89774-89980 | _na 68_aa | hypothetical protein | |
| 3605 | CALHHZ010000041.1 | GCA938031325_01837 | CDS | open | 89983-90516 | _na 177_aa | hypothetical protein | |
| 3606 | CALHHZ010000041.1 | GCA938031325_01838 | CDS | open | 90506-90934 | _na 142_aa | hypothetical protein | |
| 3607 | CALHHZ010000041.1 | GCA938031325_01839 | CDS | open | 91141-91548 | _na 135_aa | HNH endonuclease | |
| 3608 | CALHHZ010000041.1 | GCA938031325_01840 | CDS | open | 91664-92137 | _na 157_aa | hypothetical protein | |
| 3609 | CALHHZ010000041.1 | GCA938031325_01841 | CDS | open | 92134-93885 | _na 583_aa | Terminase large subunit | |
| 3610 | CALHHZ010000041.1 | GCA938031325_01842 | CDS | open | 93885-95165 | _na 426_aa | Phage portal protein | |
| 3611 | CALHHZ010000041.1 | GCA938031325_01843 | CDS | open | 95162-95884 | _na 240_aa | ATP-dependent Clp protease proteolytic subunit | |
| 3612 | CALHHZ010000041.1 | GCA938031325_01844 | CDS | open | 95905-97227 | _na 440_aa | hypothetical protein | |
| 3613 | CALHHZ010000041.1 | GCA938031325_01845 | CDS | open | 97240-97425 | _na 61_aa | hypothetical protein | |
| 3614 | CALHHZ010000041.1 | GCA938031325_01846 | CDS | open | 97439-97795 | _na 118_aa | hypothetical protein | |
| 3615 | CALHHZ010000041.1 | GCA938031325_01847 | CDS | open | 97792-98154 | _na 120_aa | Putative phage head-tail adaptor | |
| 3616 | CALHHZ010000041.1 | GCA938031325_01848 | CDS | open | 98147-98575 | _na 142_aa | HK97 gp10 family phage protein | |
| 3617 | CALHHZ010000041.1 | GCA938031325_01849 | CDS | open | 98572-99015 | _na 147_aa | DUF3168 domain-containing protein | |
| 3618 | CALHHZ010000041.1 | GCA938031325_01850 | CDS | open | 99033-100151 | _na 372_aa | Tail sheath protein C-terminal domain-containing protein | |
| 3619 | CALHHZ010000041.1 | GCA938031325_01851 | CDS | open | 100164-100601 | _na 145_aa | xkdM | Phage-like element PBSX protein XkdM |
| 3620 | CALHHZ010000041.1 | GCA938031325_01852 | CDS | open | 100616-101017 | _na 133_aa | XkdN-like protein | |
| 3621 | CALHHZ010000041.1 | GCA938031325_01853 | CDS | open | 101044-101175 | _na 43_aa | hypothetical protein | |
| 3622 | CALHHZ010000041.1 | GCA938031325_01854 | CDS | open | 101168-103381 | _na 737_aa | hypothetical protein | |
| 3623 | CALHHZ010000041.1 | GCA938031325_01855 | CDS | open | 103365-104060 | _na 231_aa | lysM | LysM domain-containing protein |
| 3624 | CALHHZ010000041.1 | GCA938031325_01856 | CDS | open | 104060-105058 | _na 332_aa | Phage late control protein D protein | |
| 3625 | CALHHZ010000041.1 | GCA938031325_01857 | CDS | open | 105055-105378 | _na 107_aa | hypothetical protein | |
| 3626 | CALHHZ010000041.1 | GCA938031325_01858 | CDS | open | 105375-105815 | _na 146_aa | DUF2634 domain-containing protein | |
| 3627 | CALHHZ010000041.1 | GCA938031325_01859 | CDS | open | 105799-106869 | _na 356_aa | hypothetical protein | |
| 3628 | CALHHZ010000041.1 | GCA938031325_01860 | CDS | open | 106880-107452 | _na 190_aa | hypothetical protein | |
| 3629 | CALHHZ010000041.1 | GCA938031325_01861 | CDS | open | 107449-107715 | _na 88_aa | hypothetical protein | |
| 3630 | CALHHZ010000041.1 | GCA938031325_01862 | CDS | open | 107734-108585 | _na 283_aa | hypothetical protein | |
| 3631 | CALHHZ010000041.1 | GCA938031325_01863 | CDS | open | 108637-109167 | _na 176_aa | hypothetical protein | |
| 3632 | CALHHZ010000041.1 | GCA938031325_01864 | CDS | open | 109233-109460 | _na 75_aa | hypothetical protein | |
| 3633 | CALHHZ010000041.1 | GCA938031325_01865 | CDS | open | 109474-109599 | _na 41_aa | hypothetical protein | |
| 3634 | CALHHZ010000041.1 | GCA938031325_01866 | CDS | open | 109648-110142 | _na 164_aa | hypothetical protein | |
| 3635 | CALHHZ010000041.1 | GCA938031325_01867 | CDS | open | 110108-110362 | _na 84_aa | hypothetical protein | |
| 3636 | CALHHZ010000041.1 | GCA938031325_01868 | CDS | open | 110372-111655 | _na 427_aa | hypothetical protein | |
| 3637 | CALHHZ010000041.1 | GCA938031325_01869 | CDS | open | 112138-112575 | _na 145_aa | HicB-like antitoxin of toxin-antitoxin system domain-containing protein | |
| 3638 | CALHHZ010000041.1 | GCA938031325_01870 | CDS | open | 112623-112793 | _na 56_aa | YcfA-like protein | |
| 3639 | CALHHZ010000041.1 | GCA938031325_01871 | CDS | open | 112999-113664 | _na 221_aa | Integrase catalytic domain-containing protein | |
| 3640 | CALHHZ010000041.1 | GCA938031325_01872 | CDS | open | 113695-113850 | _na 51_aa | hypothetical protein | |
| 3641 | CALHHZ010000041.1 | GCA938031325_01873 | CDS | open | 113883-114152 | _na 89_aa | Transposase | |
| 3642 | CALHHZ010000041.1 | GCA938031325_01874 | CDS | open | 114287-114457 | _na 56_aa | hypothetical protein | |
| 3643 | CALHHZ010000041.1 | GCA938031325_01875 | CDS | open | 114600-115100 | _na 166_aa | DNA-binding helix-turn-helix protein | |
| 3644 | CALHHZ010000041.1 | GCA938031325_01876 | CDS | open | 115171-115395 | _na 74_aa | hypothetical protein | |
| 3645 | CALHHZ010000041.1 | GCA938031325_01756 | gene | open | 329-1321 | |||
| 3646 | CALHHZ010000041.1 | GCA938031325_01757 | gene | open | 1455-2165 | tlpA | ||
| 3647 | CALHHZ010000041.1 | GCA938031325_01758 | gene | open | 2197-2415 | |||
| 3648 | CALHHZ010000041.1 | GCA938031325_01759 | gene | open | 2620-4233 | |||
| 3649 | CALHHZ010000041.1 | GCA938031325_01760 | gene | open | 4733-5683 | appB | ||
| 3650 | CALHHZ010000041.1 | GCA938031325_01761 | gene | open | 5932-6936 | appC | ||
| 3651 | CALHHZ010000041.1 | GCA938031325_01762 | gene | open | 6929-7960 | |||
| 3652 | CALHHZ010000041.1 | GCA938031325_01763 | gene | open | 7978-8958 | |||
| 3653 | CALHHZ010000041.1 | GCA938031325_01764 | gene | open | 9102-10340 | |||
| 3654 | CALHHZ010000041.1 | GCA938031325_01765 | gene | open | 10445-12139 | |||
| 3655 | CALHHZ010000041.1 | GCA938031325_01766 | gene | open | 12150-14252 | |||
| 3656 | CALHHZ010000041.1 | GCA938031325_01767 | gene | open | 14264-14827 | |||
| 3657 | CALHHZ010000041.1 | GCA938031325_01768 | gene | open | 14982-16124 | |||
| 3658 | CALHHZ010000041.1 | GCA938031325_01769 | gene | open | 16121-17038 | |||
| 3659 | CALHHZ010000041.1 | GCA938031325_01770 | gene | open | 17007-17768 | |||
| 3660 | CALHHZ010000041.1 | GCA938031325_01771 | gene | open | 17778-18299 | |||
| 3661 | CALHHZ010000041.1 | GCA938031325_01772 | gene | open | 18280-20673 | cas10 | ||
| 3662 | CALHHZ010000041.1 | GCA938031325_01773 | gene | open | 20654-21415 | |||
| 3663 | CALHHZ010000041.1 | GCA938031325_01774 | gene | open | 21593-22969 | |||
| 3664 | CALHHZ010000041.1 | GCA938031325_01775 | gene | open | 22981-23298 | cas2 | ||
| 3665 | CALHHZ010000041.1 | GCA938031325_01776 | gene | open | 23304-24302 | cas1 | ||
| 3666 | CALHHZ010000041.1 | GCA938031325_01777 | gene | open | 28112-29788 | ilvD | ||
| 3667 | CALHHZ010000041.1 | GCA938031325_01778 | gene | open | 29835-30818 | |||
| 3668 | CALHHZ010000041.1 | GCA938031325_01779 | gene | open | 31238-33118 | thrS | ||
| 3669 | CALHHZ010000041.1 | GCA938031325_01780 | gene | open | 33239-35017 | |||
| 3670 | CALHHZ010000041.1 | GCA938031325_01781 | gene | open | 35120-35572 | |||
| 3671 | CALHHZ010000041.1 | GCA938031325_01782 | gene | open | 35670-36953 | |||
| 3672 | CALHHZ010000041.1 | GCA938031325_01783 | gene | open | 37261-39696 | |||
| 3673 | CALHHZ010000041.1 | GCA938031325_01784 | gene | open | 40169-41371 | |||
| 3674 | CALHHZ010000041.1 | GCA938031325_01785 | gene | open | 41554-42918 | |||
| 3675 | CALHHZ010000041.1 | GCA938031325_01786 | gene | open | 43003-43899 | |||
| 3676 | CALHHZ010000041.1 | GCA938031325_01787 | gene | open | 43945-44853 | |||
| 3677 | CALHHZ010000041.1 | GCA938031325_01788 | gene | open | 44884-46218 | |||
| 3678 | CALHHZ010000041.1 | GCA938031325_01789 | gene | open | 46477-47613 | |||
| 3679 | CALHHZ010000041.1 | GCA938031325_01790 | gene | open | 47802-48164 | |||
| 3680 | CALHHZ010000041.1 | GCA938031325_01791 | gene | open | 48246-49919 | recG | ||
| 3681 | CALHHZ010000041.1 | GCA938031325_01792 | gene | open | 50381-51517 | |||
| 3682 | CALHHZ010000041.1 | GCA938031325_01793 | gene | open | 51693-52430 | |||
| 3683 | CALHHZ010000041.1 | GCA938031325_01794 | gene | open | 52442-52606 | |||
| 3684 | CALHHZ010000041.1 | GCA938031325_01795 | gene | open | 52709-54073 | |||
| 3685 | CALHHZ010000041.1 | GCA938031325_01796 | gene | open | 54221-55261 | lacI | ||
| 3686 | CALHHZ010000041.1 | GCA938031325_01797 | gene | open | 55325-56194 | |||
| 3687 | CALHHZ010000041.1 | GCA938031325_01798 | gene | open | 56527-57003 | |||
| 3688 | CALHHZ010000041.1 | GCA938031325_01799 | gene | open | 57097-58236 | |||
| 3689 | CALHHZ010000041.1 | GCA938031325_01800 | gene | open | 58389-59402 | |||
| 3690 | CALHHZ010000041.1 | GCA938031325_01801 | gene | open | 59399-60409 | rbsC | ||
| 3691 | CALHHZ010000041.1 | GCA938031325_01802 | gene | open | 60413-61906 | |||
| 3692 | CALHHZ010000041.1 | GCA938031325_01803 | gene | open | 62055-63146 | |||
| 3693 | CALHHZ010000041.1 | GCA938031325_01804 | gene | open | 63310-64332 | iolG | ||
| 3694 | CALHHZ010000041.1 | GCA938031325_01805 | gene | open | 64394-65290 | iolE | ||
| 3695 | CALHHZ010000041.1 | GCA938031325_01806 | gene | open | 65526-66311 | iolB | ||
| 3696 | CALHHZ010000041.1 | GCA938031325_01807 | gene | open | 66328-68259 | iolD | ||
| 3697 | CALHHZ010000041.1 | GCA938031325_01808 | gene | open | 68252-69298 | |||
| 3698 | CALHHZ010000041.1 | GCA938031325_01809 | gene | open | 69316-70170 | |||
| 3699 | CALHHZ010000041.1 | GCA938031325_01810 | gene | open | 70357-71157 | iolR | ||
| 3700 | CALHHZ010000041.1 | GCA938031325_01811 | gene | open | 71402-73105 | |||
| 3701 | CALHHZ010000041.1 | GCA938031325_01813 | gene | open | 75482-75961 | |||
| 3702 | CALHHZ010000041.1 | GCA938031325_01814 | gene | open | 75987-76337 | |||
| 3703 | CALHHZ010000041.1 | GCA938031325_01815 | gene | open | 76492-76695 | |||
| 3704 | CALHHZ010000041.1 | GCA938031325_01816 | gene | open | 76817-77338 | |||
| 3705 | CALHHZ010000041.1 | GCA938031325_01817 | gene | open | 77448-77648 | |||
| 3706 | CALHHZ010000041.1 | GCA938031325_01818 | gene | open | 77666-77923 | |||
| 3707 | CALHHZ010000041.1 | GCA938031325_01819 | gene | open | 78013-78660 | |||
| 3708 | CALHHZ010000041.1 | GCA938031325_01820 | gene | open | 78657-79070 | |||
| 3709 | CALHHZ010000041.1 | GCA938031325_01821 | gene | open | 79060-80265 | |||
| 3710 | CALHHZ010000041.1 | GCA938031325_01822 | gene | open | 80332-80466 | |||
| 3711 | CALHHZ010000041.1 | GCA938031325_01823 | gene | open | 80453-80683 | |||
| 3712 | CALHHZ010000041.1 | GCA938031325_01824 | gene | open | 80698-81282 | |||
| 3713 | CALHHZ010000041.1 | GCA938031325_01825 | gene | open | 81263-83359 | |||
| 3714 | CALHHZ010000041.1 | GCA938031325_01826 | gene | open | 83364-83669 | |||
| 3715 | CALHHZ010000041.1 | GCA938031325_01827 | gene | open | 83666-83809 | |||
| 3716 | CALHHZ010000041.1 | GCA938031325_01828 | gene | open | 83821-84150 | |||
| 3717 | CALHHZ010000041.1 | GCA938031325_01829 | gene | open | 84147-84602 | |||
| 3718 | CALHHZ010000041.1 | GCA938031325_01830 | gene | open | 84652-87105 | |||
| 3719 | CALHHZ010000041.1 | GCA938031325_01831 | gene | open | 87395-87682 | |||
| 3720 | CALHHZ010000041.1 | GCA938031325_01832 | gene | open | 87679-87984 | |||
| 3721 | CALHHZ010000041.1 | GCA938031325_01833 | gene | open | 87981-88169 | |||
| 3722 | CALHHZ010000041.1 | GCA938031325_01834 | gene | open | 88139-89518 | |||
| 3723 | CALHHZ010000041.1 | GCA938031325_01835 | gene | open | 89520-89753 | |||
| 3724 | CALHHZ010000041.1 | GCA938031325_01836 | gene | open | 89774-89980 | |||
| 3725 | CALHHZ010000041.1 | GCA938031325_01837 | gene | open | 89983-90516 | |||
| 3726 | CALHHZ010000041.1 | GCA938031325_01838 | gene | open | 90506-90934 | |||
| 3727 | CALHHZ010000041.1 | GCA938031325_01839 | gene | open | 91141-91548 | |||
| 3728 | CALHHZ010000041.1 | GCA938031325_01840 | gene | open | 91664-92137 | |||
| 3729 | CALHHZ010000041.1 | GCA938031325_01841 | gene | open | 92134-93885 | |||
| 3730 | CALHHZ010000041.1 | GCA938031325_01842 | gene | open | 93885-95165 | |||
| 3731 | CALHHZ010000041.1 | GCA938031325_01843 | gene | open | 95162-95884 | |||
| 3732 | CALHHZ010000041.1 | GCA938031325_01844 | gene | open | 95905-97227 | |||
| 3733 | CALHHZ010000041.1 | GCA938031325_01845 | gene | open | 97240-97425 | |||
| 3734 | CALHHZ010000041.1 | GCA938031325_01846 | gene | open | 97439-97795 | |||
| 3735 | CALHHZ010000041.1 | GCA938031325_01847 | gene | open | 97792-98154 | |||
| 3736 | CALHHZ010000041.1 | GCA938031325_01848 | gene | open | 98147-98575 | |||
| 3737 | CALHHZ010000041.1 | GCA938031325_01849 | gene | open | 98572-99015 | |||
| 3738 | CALHHZ010000041.1 | GCA938031325_01850 | gene | open | 99033-100151 | |||
| 3739 | CALHHZ010000041.1 | GCA938031325_01851 | gene | open | 100164-100601 | xkdM | ||
| 3740 | CALHHZ010000041.1 | GCA938031325_01852 | gene | open | 100616-101017 | |||
| 3741 | CALHHZ010000041.1 | GCA938031325_01853 | gene | open | 101044-101175 | |||
| 3742 | CALHHZ010000041.1 | GCA938031325_01854 | gene | open | 101168-103381 | |||
| 3743 | CALHHZ010000041.1 | GCA938031325_01855 | gene | open | 103365-104060 | lysM | ||
| 3744 | CALHHZ010000041.1 | GCA938031325_01856 | gene | open | 104060-105058 | |||
| 3745 | CALHHZ010000041.1 | GCA938031325_01857 | gene | open | 105055-105378 | |||
| 3746 | CALHHZ010000041.1 | GCA938031325_01858 | gene | open | 105375-105815 | |||
| 3747 | CALHHZ010000041.1 | GCA938031325_01859 | gene | open | 105799-106869 | |||
| 3748 | CALHHZ010000041.1 | GCA938031325_01860 | gene | open | 106880-107452 | |||
| 3749 | CALHHZ010000041.1 | GCA938031325_01861 | gene | open | 107449-107715 | |||
| 3750 | CALHHZ010000041.1 | GCA938031325_01862 | gene | open | 107734-108585 | |||
| 3751 | CALHHZ010000041.1 | GCA938031325_01863 | gene | open | 108637-109167 | |||
| 3752 | CALHHZ010000041.1 | GCA938031325_01864 | gene | open | 109233-109460 | |||
| 3753 | CALHHZ010000041.1 | GCA938031325_01865 | gene | open | 109474-109599 | |||
| 3754 | CALHHZ010000041.1 | GCA938031325_01866 | gene | open | 109648-110142 | |||
| 3755 | CALHHZ010000041.1 | GCA938031325_01867 | gene | open | 110108-110362 | |||
| 3756 | CALHHZ010000041.1 | GCA938031325_01868 | gene | open | 110372-111655 | |||
| 3757 | CALHHZ010000041.1 | GCA938031325_01869 | gene | open | 112138-112575 | |||
| 3758 | CALHHZ010000041.1 | GCA938031325_01870 | gene | open | 112623-112793 | |||
| 3759 | CALHHZ010000041.1 | GCA938031325_01871 | gene | open | 112999-113664 | |||
| 3760 | CALHHZ010000041.1 | GCA938031325_01872 | gene | open | 113695-113850 | |||
| 3761 | CALHHZ010000041.1 | GCA938031325_01873 | gene | open | 113883-114152 | |||
| 3762 | CALHHZ010000041.1 | GCA938031325_01874 | gene | open | 114287-114457 | |||
| 3763 | CALHHZ010000041.1 | GCA938031325_01875 | gene | open | 114600-115100 | |||
| 3764 | CALHHZ010000041.1 | GCA938031325_01876 | gene | open | 115171-115395 | |||
| 3765 | CALHHZ010000042.1 | GCA938031325_01929 | gene | open | 56943-57286 | RNaseP_bact_a | ||
| 3766 | CALHHZ010000042.1 | GCA938031325_01929 | ncRNA | open | 56943-57286 | Bacterial RNase P class A | ||
| 3767 | CALHHZ010000042.1 | regulatory_region | open | 27650-27687 | Selenocysteine insertion sequence 4 | |||
| 3768 | CALHHZ010000042.1 | GCA938031325_01877 | CDS | open | 119-1756 | _na 545_aa | DUF5722 domain-containing protein | |
| 3769 | CALHHZ010000042.1 | GCA938031325_01878 | CDS | open | 1991-2572 | _na 193_aa | hypothetical protein | |
| 3770 | CALHHZ010000042.1 | GCA938031325_01879 | CDS | open | 2704-3936 | _na 410_aa | tyrS | tyrosine--tRNA ligase |
| 3771 | CALHHZ010000042.1 | GCA938031325_01880 | CDS | open | 4000-5040 | _na 346_aa | 3-deoxy-7-phosphoheptulonate synthase | |
| 3772 | CALHHZ010000042.1 | GCA938031325_01881 | CDS | open | 5368-6036 | _na 222_aa | Endonuclease III | |
| 3773 | CALHHZ010000042.1 | GCA938031325_01882 | CDS | open | 6054-6215 | _na 53_aa | hypothetical protein | |
| 3774 | CALHHZ010000042.1 | GCA938031325_01883 | CDS | open | 6258-6968 | _na 236_aa | Cupin domain protein | |
| 3775 | CALHHZ010000042.1 | GCA938031325_01884 | CDS | open | 7249-8202 | _na 317_aa | L-lactate dehydrogenase | |
| 3776 | CALHHZ010000042.1 | GCA938031325_01885 | CDS | open | 8367-10112 | _na 581_aa | Bacterial capsule synthesis protein | |
| 3777 | CALHHZ010000042.1 | GCA938031325_01886 | CDS | open | 10109-12763 | _na 884_aa | Tetratricopeptide repeat protein | |
| 3778 | CALHHZ010000042.1 | GCA938031325_01887 | CDS | open | 12741-14348 | _na 535_aa | hemZ | coproporphyrinogen dehydrogenase HemZ |
| 3779 | CALHHZ010000042.1 | GCA938031325_01888 | CDS | open | 14379-15119 | _na 246_aa | Metallo-beta-lactamase domain protein | |
| 3780 | CALHHZ010000042.1 | GCA938031325_01889 | CDS | open | 15355-17616 | _na 753_aa | GTP diphosphokinase | |
| 3781 | CALHHZ010000042.1 | GCA938031325_01890 | CDS | open | 17824-18294 | _na 156_aa | CBS domain protein | |
| 3782 | CALHHZ010000042.1 | GCA938031325_01891 | CDS | open | 18451-18954 | _na 167_aa | greA | Transcription elongation factor GreA |
| 3783 | CALHHZ010000042.1 | GCA938031325_01892 | CDS | open | 19010-19510 | _na 166_aa | adenine phosphoribosyltransferase | |
| 3784 | CALHHZ010000042.1 | GCA938031325_01893 | CDS | open | 19710-20273 | _na 187_aa | Hydrolase%2C NUDIX family | |
| 3785 | CALHHZ010000042.1 | GCA938031325_01894 | CDS | open | 20304-20672 | _na 122_aa | Heavy metal-associated domain protein | |
| 3786 | CALHHZ010000042.1 | GCA938031325_01895 | CDS | open | 20948-22306 | _na 452_aa | CBS domain protein | |
| 3787 | CALHHZ010000042.1 | GCA938031325_01896 | CDS | open | 22702-23259 | _na 185_aa | DUF3841 domain-containing protein | |
| 3788 | CALHHZ010000042.1 | GCA938031325_01897 | CDS | open | 23228-23848 | _na 206_aa | DUF3841 domain-containing protein | |
| 3789 | CALHHZ010000042.1 | GCA938031325_01898 | CDS | open | 24119-24595 | _na 158_aa | Transposase | |
| 3790 | CALHHZ010000042.1 | GCA938031325_01899 | CDS | open | 25066-25716 | _na 216_aa | tetR | Transcriptional regulator%2C TetR family |
| 3791 | CALHHZ010000042.1 | GCA938031325_01900 | CDS | open | 25797-27320 | _na 507_aa | Transporter%2C betaine/carnitine/choline family | |
| 3792 | CALHHZ010000042.1 | GCA938031325_01901 | CDS | open | 27427-28728 | _na 433_aa | Betaine reductase complex component B subunit beta | |
| 3793 | CALHHZ010000042.1 | GCA938031325_01902 | CDS | open | 28746-30071 | _na 441_aa | Betaine reductase complex component B subunit alpha | |
| 3794 | CALHHZ010000042.1 | GCA938031325_01903 | CDS | open | 30494-31366 | _na 290_aa | AP endonuclease%2C family 2 | |
| 3795 | CALHHZ010000042.1 | GCA938031325_01904 | CDS | open | 31363-32340 | _na 325_aa | araC | Transcriptional regulator%2C AraC family |
| 3796 | CALHHZ010000042.1 | GCA938031325_01905 | CDS | open | 32294-33046 | _na 250_aa | Manganese transport regulator | |
| 3797 | CALHHZ010000042.1 | GCA938031325_01906 | CDS | open | 33107-34183 | _na 358_aa | ABC 3 transport family protein | |
| 3798 | CALHHZ010000042.1 | GCA938031325_01907 | CDS | open | 34176-35057 | _na 293_aa | ABC 3 transport family protein | |
| 3799 | CALHHZ010000042.1 | GCA938031325_01908 | CDS | open | 35054-35857 | _na 267_aa | mntA | Putative manganese transport system ATP-binding protein MntA |
| 3800 | CALHHZ010000042.1 | GCA938031325_01909 | CDS | open | 35920-36942 | _na 340_aa | ABC transporter%2C substrate-binding protein | |
| 3801 | CALHHZ010000042.1 | GCA938031325_01910 | CDS | open | 37317-38477 | _na 386_aa | Glycosyl hydrolase%2C family 88 | |
| 3802 | CALHHZ010000042.1 | GCA938031325_01911 | CDS | open | 38515-39372 | _na 285_aa | ABC transporter%2C permease protein | |
| 3803 | CALHHZ010000042.1 | GCA938031325_01912 | CDS | open | 39374-40276 | _na 300_aa | ABC transporter%2C permease protein | |
| 3804 | CALHHZ010000042.1 | GCA938031325_01913 | CDS | open | 40308-41681 | _na 457_aa | ABC transporter%2C solute-binding protein | |
| 3805 | CALHHZ010000042.1 | GCA938031325_01914 | CDS | open | 41700-43280 | _na 526_aa | Polygalacturonase | |
| 3806 | CALHHZ010000042.1 | GCA938031325_01915 | CDS | open | 43635-44303 | _na 222_aa | HTH cro/C1-type domain-containing protein | |
| 3807 | CALHHZ010000042.1 | GCA938031325_01916 | CDS | open | 44313-45047 | _na 244_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 3808 | CALHHZ010000042.1 | GCA938031325_01917 | CDS | open | 45214-45762 | _na 182_aa | hypothetical protein | |
| 3809 | CALHHZ010000042.1 | GCA938031325_01918 | CDS | open | 46042-46674 | _na 210_aa | hypothetical protein | |
| 3810 | CALHHZ010000042.1 | GCA938031325_01919 | CDS | open | 46746-47345 | _na 199_aa | hypothetical protein | |
| 3811 | CALHHZ010000042.1 | GCA938031325_01920 | CDS | open | 47528-47923 | _na 131_aa | hypothetical protein | |
| 3812 | CALHHZ010000042.1 | GCA938031325_01921 | CDS | open | 47928-48419 | _na 163_aa | nimB | Putative 5-nitroimidazole antibiotic resistance protein NimB |
| 3813 | CALHHZ010000042.1 | GCA938031325_01922 | CDS | open | 48616-49926 | _na 436_aa | Transporter gate domain protein | |
| 3814 | CALHHZ010000042.1 | GCA938031325_01923 | CDS | open | 50031-51359 | _na 442_aa | Transporter gate domain protein | |
| 3815 | CALHHZ010000042.1 | GCA938031325_01924 | CDS | open | 51361-52221 | _na 286_aa | FAD binding domain in molybdopterin dehydrogenase | |
| 3816 | CALHHZ010000042.1 | GCA938031325_01925 | CDS | open | 52222-52686 | _na 154_aa | Putative carbon monoxide dehydrogenase%2C small subunit | |
| 3817 | CALHHZ010000042.1 | GCA938031325_01926 | CDS | open | 52692-54959 | _na 755_aa | Aldehyde oxidase and xanthine dehydrogenase%2C molybdopterin binding domain protein | |
| 3818 | CALHHZ010000042.1 | GCA938031325_01927 | CDS | open | 55321-55983 | _na 220_aa | Metallo-beta-lactamase domain protein | |
| 3819 | CALHHZ010000042.1 | GCA938031325_01928 | CDS | open | 56027-56839 | _na 270_aa | gntR | Transcriptional regulator%2C GntR family |
| 3820 | CALHHZ010000042.1 | GCA938031325_01930 | CDS | open | 57436-59091 | _na 551_aa | Phosphoribulokinase/uridine kinase family protein | |
| 3821 | CALHHZ010000042.1 | GCA938031325_01931 | CDS | open | 59200-60018 | _na 272_aa | Nif3-like dinuclear metal center hexameric protein | |
| 3822 | CALHHZ010000042.1 | GCA938031325_01932 | CDS | open | 60008-60676 | _na 222_aa | SAM-dependent methyltransferase | |
| 3823 | CALHHZ010000042.1 | GCA938031325_01933 | CDS | open | 60692-62446 | _na 584_aa | DNA primase | |
| 3824 | CALHHZ010000042.1 | GCA938031325_01934 | CDS | open | 62491-63552 | _na 353_aa | deoxyguanosinetriphosphate triphosphohydrolase | |
| 3825 | CALHHZ010000042.1 | GCA938031325_01935 | CDS | open | 63635-64984 | _na 449_aa | Transporter | |
| 3826 | CALHHZ010000042.1 | GCA938031325_01936 | CDS | open | 65253-65717 | _na 154_aa | Acetyltransferase%2C GNAT family | |
| 3827 | CALHHZ010000042.1 | GCA938031325_01938 | CDS | open | 66235-66846 | _na 203_aa | Vacuolar family H+-ATPase subunit H | |
| 3828 | CALHHZ010000042.1 | GCA938031325_01939 | CDS | open | 66867-67361 | _na 164_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 3829 | CALHHZ010000042.1 | GCA938031325_01940 | CDS | open | 67358-67894 | _na 178_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 3830 | CALHHZ010000042.1 | GCA938031325_01941 | CDS | open | 68042-70096 | _na 684_aa | recG | ATP-dependent DNA helicase RecG |
| 3831 | CALHHZ010000042.1 | GCA938031325_01942 | CDS | open | 70355-72052 | _na 565_aa | yloV | DAK2 domain fusion protein YloV |
| 3832 | CALHHZ010000042.1 | GCA938031325_01943 | CDS | open | 72075-72434 | _na 119_aa | Asp23/Gls24 family envelope stress response protein | |
| 3833 | CALHHZ010000042.1 | GCA938031325_01944 | CDS | open | 72573-72779 | _na 68_aa | rpmB | 50S ribosomal protein L28 |
| 3834 | CALHHZ010000042.1 | GCA938031325_01945 | CDS | open | 72952-73380 | _na 142_aa | ytfJ | Sporulation protein YtfJ |
| 3835 | CALHHZ010000042.1 | GCA938031325_01946 | CDS | open | 73370-74377 | _na 335_aa | DUF2953 domain-containing protein | |
| 3836 | CALHHZ010000042.1 | GCA938031325_01947 | CDS | open | 74420-74695 | _na 91_aa | hypothetical protein | |
| 3837 | CALHHZ010000042.1 | GCA938031325_01948 | CDS | open | 74699-75232 | _na 177_aa | cinA | Competence/damage-inducible protein CinA domain protein |
| 3838 | CALHHZ010000042.1 | GCA938031325_01949 | CDS | open | 75237-75779 | _na 180_aa | pgsA | CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase |
| 3839 | CALHHZ010000042.1 | GCA938031325_01950 | CDS | open | 75763-77043 | _na 426_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 3840 | CALHHZ010000042.1 | GCA938031325_01951 | CDS | open | 77043-77462 | _na 139_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 3841 | CALHHZ010000042.1 | GCA938031325_01952 | CDS | open | 77440-78081 | _na 213_aa | gmk | guanylate kinase |
| 3842 | CALHHZ010000042.1 | GCA938031325_01953 | CDS | open | 78147-79028 | _na 293_aa | TIGR00255 family protein | |
| 3843 | CALHHZ010000042.1 | GCA938031325_01954 | CDS | open | 79148-80965 | _na 605_aa | rqcH | Rqc2-like protein RqcH |
| 3844 | CALHHZ010000042.1 | GCA938031325_01955 | CDS | open | 80990-81730 | _na 246_aa | YebC/PmpR family DNA-binding transcriptional regulator | |
| 3845 | CALHHZ010000042.1 | GCA938031325_01956 | CDS | open | 81808-83094 | _na 428_aa | alr | alanine racemase |
| 3846 | CALHHZ010000042.1 | GCA938031325_01957 | CDS | open | 83152-84063 | _na 303_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 3847 | CALHHZ010000042.1 | GCA938031325_01958 | CDS | open | 84079-84396 | _na 105_aa | Holo-[acyl-carrier-protein] synthase | |
| 3848 | CALHHZ010000042.1 | GCA938031325_01959 | CDS | open | 84435-85070 | _na 211_aa | redox-sensing transcriptional repressor Rex | |
| 3849 | CALHHZ010000042.1 | GCA938031325_01960 | CDS | open | 85084-86370 | _na 428_aa | adenylosuccinate synthase | |
| 3850 | CALHHZ010000042.1 | GCA938031325_01961 | CDS | open | 86411-86599 | _na 62_aa | Cardiolipin synthase N-terminal domain-containing protein | |
| 3851 | CALHHZ010000042.1 | GCA938031325_01962 | CDS | open | 86700-88136 | _na 478_aa | purB | adenylosuccinate lyase |
| 3852 | CALHHZ010000042.1 | GCA938031325_01963 | CDS | open | 88168-88932 | _na 254_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 3853 | CALHHZ010000042.1 | GCA938031325_01964 | CDS | open | 88944-89849 | _na 301_aa | dapA | 4-hydroxy-tetrahydrodipicolinate synthase |
| 3854 | CALHHZ010000042.1 | GCA938031325_01965 | CDS | open | 89931-91769 | _na 612_aa | typA | translational GTPase TypA |
| 3855 | CALHHZ010000042.1 | GCA938031325_01966 | CDS | open | 91845-92459 | _na 204_aa | yigZ | YigZ family protein |
| 3856 | CALHHZ010000042.1 | GCA938031325_01967 | CDS | open | 92463-95315 | _na 950_aa | Penicillin-binding protein 1A | |
| 3857 | CALHHZ010000042.1 | GCA938031325_01968 | CDS | open | 95495-96502 | _na 335_aa | asnA | aspartate--ammonia ligase |
| 3858 | CALHHZ010000042.1 | GCA938031325_01969 | CDS | open | 96588-96920 | _na 110_aa | hypothetical protein | |
| 3859 | CALHHZ010000042.1 | GCA938031325_01970 | CDS | open | 96932-97771 | _na 279_aa | pgeF | peptidoglycan editing factor PgeF |
| 3860 | CALHHZ010000042.1 | GCA938031325_01971 | CDS | open | 97996-98457 | _na 153_aa | sufU | Fe-S cluster assembly sulfur transfer protein SufU |
| 3861 | CALHHZ010000042.1 | GCA938031325_01972 | CDS | open | 98447-99694 | _na 415_aa | Cysteine desulfurase | |
| 3862 | CALHHZ010000042.1 | GCA938031325_01973 | CDS | open | 99691-100761 | _na 356_aa | SufB/sufD domain protein | |
| 3863 | CALHHZ010000042.1 | GCA938031325_01974 | CDS | open | 100777-102192 | _na 471_aa | sufB | Fe-S cluster assembly protein SufB |
| 3864 | CALHHZ010000042.1 | GCA938031325_01975 | CDS | open | 102339-103094 | _na 251_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 3865 | CALHHZ010000042.1 | GCA938031325_01976 | CDS | open | 103545-104042 | _na 165_aa | Peptidyl-prolyl cis-trans isomerase | |
| 3866 | CALHHZ010000042.1 | GCA938031325_01977 | CDS | open | 104206-104982 | _na 258_aa | DUF4097 domain-containing protein | |
| 3867 | CALHHZ010000042.1 | GCA938031325_01978 | CDS | open | 105021-106073 | _na 350_aa | DUF1700 domain-containing protein | |
| 3868 | CALHHZ010000042.1 | GCA938031325_01979 | CDS | open | 106300-106641 | _na 113_aa | padR | Transcriptional regulator%2C PadR family |
| 3869 | CALHHZ010000042.1 | GCA938031325_01980 | CDS | open | 106745-107620 | _na 291_aa | araC | Transcriptional regulator%2C AraC family |
| 3870 | CALHHZ010000042.1 | GCA938031325_01981 | CDS | open | 107783-110071 | _na 762_aa | Alpha-galactosidase | |
| 3871 | CALHHZ010000042.1 | GCA938031325_01982 | CDS | open | 110128-110967 | _na 279_aa | ABC transporter%2C permease protein | |
| 3872 | CALHHZ010000042.1 | GCA938031325_01983 | CDS | open | 110977-111873 | _na 298_aa | ABC transporter%2C permease protein | |
| 3873 | CALHHZ010000042.1 | GCA938031325_01984 | CDS | open | 111958-113298 | _na 446_aa | ABC transporter%2C solute-binding protein | |
| 3874 | CALHHZ010000042.1 | GCA938031325_01985 | CDS | open | 114127-115773 | _na 548_aa | Phosphoenolpyruvate-protein phosphotransferase | |
| 3875 | CALHHZ010000042.1 | GCA938031325_01986 | CDS | open | 115960-116217 | _na 85_aa | Putative phosphocarrier protein HPr | |
| 3876 | CALHHZ010000042.1 | GCA938031325_01987 | CDS | open | 116255-118138 | _na 627_aa | PTS system%2C glucose-like IIB component | |
| 3877 | CALHHZ010000042.1 | GCA938031325_01988 | CDS | open | 118324-119151 | _na 275_aa | Cof-like hydrolase | |
| 3878 | CALHHZ010000042.1 | GCA938031325_01989 | CDS | open | 119215-121092 | _na 625_aa | Alpha amylase%2C catalytic domain protein | |
| 3879 | CALHHZ010000042.1 | GCA938031325_01990 | CDS | open | 121792-122685 | _na 297_aa | fructokinase | |
| 3880 | CALHHZ010000042.1 | GCA938031325_01991 | CDS | open | 123109-124398 | _na 429_aa | Chloride transporter%2C ClC family | |
| 3881 | CALHHZ010000042.1 | GCA938031325_01992 | CDS | open | 124385-124609 | _na 74_aa | hypothetical protein | |
| 3882 | CALHHZ010000042.1 | GCA938031325_01993 | CDS | open | 124678-124923 | _na 81_aa | Glutaredoxin domain-containing protein | |
| 3883 | CALHHZ010000042.1 | GCA938031325_01994 | CDS | open | 125218-126015 | _na 265_aa | Dinitrogenase iron-molybdenum cofactor | |
| 3884 | CALHHZ010000042.1 | GCA938031325_01995 | CDS | open | 126003-126242 | _na 79_aa | Nucleotidyl transferase AbiEii/AbiGii toxin family protein | |
| 3885 | CALHHZ010000042.1 | GCA938031325_01996 | CDS | open | 126239-126979 | _na 246_aa | DUF6577 domain-containing protein | |
| 3886 | CALHHZ010000042.1 | GCA938031325_01997 | CDS | open | 127276-128325 | _na 349_aa | Oxidoreductase%2C FAD/FMN-binding protein | |
| 3887 | CALHHZ010000042.1 | GCA938031325_01998 | CDS | open | 128439-128768 | _na 109_aa | hxlR | HTH-type transcriptional activator HxlR family protein |
| 3888 | CALHHZ010000042.1 | GCA938031325_01999 | CDS | open | 128876-129445 | _na 189_aa | Serine hydrolase | |
| 3889 | CALHHZ010000042.1 | GCA938031325_02000 | CDS | open | 129943-130890 | _na 315_aa | Site-specific recombinase%2C phage integrase family | |
| 3890 | CALHHZ010000042.1 | GCA938031325_02001 | CDS | open | 130939-134145 | _na 1068_aa | Type I restriction enzyme endonuclease subunit | |
| 3891 | CALHHZ010000042.1 | GCA938031325_01877 | gene | open | 119-1756 | |||
| 3892 | CALHHZ010000042.1 | GCA938031325_01878 | gene | open | 1991-2572 | |||
| 3893 | CALHHZ010000042.1 | GCA938031325_01879 | gene | open | 2704-3936 | tyrS | ||
| 3894 | CALHHZ010000042.1 | GCA938031325_01880 | gene | open | 4000-5040 | |||
| 3895 | CALHHZ010000042.1 | GCA938031325_01881 | gene | open | 5368-6036 | |||
| 3896 | CALHHZ010000042.1 | GCA938031325_01882 | gene | open | 6054-6215 | |||
| 3897 | CALHHZ010000042.1 | GCA938031325_01883 | gene | open | 6258-6968 | |||
| 3898 | CALHHZ010000042.1 | GCA938031325_01884 | gene | open | 7249-8202 | |||
| 3899 | CALHHZ010000042.1 | GCA938031325_01885 | gene | open | 8367-10112 | |||
| 3900 | CALHHZ010000042.1 | GCA938031325_01886 | gene | open | 10109-12763 | |||
| 3901 | CALHHZ010000042.1 | GCA938031325_01887 | gene | open | 12741-14348 | hemZ | ||
| 3902 | CALHHZ010000042.1 | GCA938031325_01888 | gene | open | 14379-15119 | |||
| 3903 | CALHHZ010000042.1 | GCA938031325_01889 | gene | open | 15355-17616 | |||
| 3904 | CALHHZ010000042.1 | GCA938031325_01890 | gene | open | 17824-18294 | |||
| 3905 | CALHHZ010000042.1 | GCA938031325_01891 | gene | open | 18451-18954 | greA | ||
| 3906 | CALHHZ010000042.1 | GCA938031325_01892 | gene | open | 19010-19510 | |||
| 3907 | CALHHZ010000042.1 | GCA938031325_01893 | gene | open | 19710-20273 | |||
| 3908 | CALHHZ010000042.1 | GCA938031325_01894 | gene | open | 20304-20672 | |||
| 3909 | CALHHZ010000042.1 | GCA938031325_01895 | gene | open | 20948-22306 | |||
| 3910 | CALHHZ010000042.1 | GCA938031325_01896 | gene | open | 22702-23259 | |||
| 3911 | CALHHZ010000042.1 | GCA938031325_01897 | gene | open | 23228-23848 | |||
| 3912 | CALHHZ010000042.1 | GCA938031325_01898 | gene | open | 24119-24595 | |||
| 3913 | CALHHZ010000042.1 | GCA938031325_01899 | gene | open | 25066-25716 | tetR | ||
| 3914 | CALHHZ010000042.1 | GCA938031325_01900 | gene | open | 25797-27320 | |||
| 3915 | CALHHZ010000042.1 | GCA938031325_01901 | gene | open | 27427-28728 | |||
| 3916 | CALHHZ010000042.1 | GCA938031325_01902 | gene | open | 28746-30071 | |||
| 3917 | CALHHZ010000042.1 | GCA938031325_01903 | gene | open | 30494-31366 | |||
| 3918 | CALHHZ010000042.1 | GCA938031325_01904 | gene | open | 31363-32340 | araC | ||
| 3919 | CALHHZ010000042.1 | GCA938031325_01905 | gene | open | 32294-33046 | |||
| 3920 | CALHHZ010000042.1 | GCA938031325_01906 | gene | open | 33107-34183 | |||
| 3921 | CALHHZ010000042.1 | GCA938031325_01907 | gene | open | 34176-35057 | |||
| 3922 | CALHHZ010000042.1 | GCA938031325_01908 | gene | open | 35054-35857 | mntA | ||
| 3923 | CALHHZ010000042.1 | GCA938031325_01909 | gene | open | 35920-36942 | |||
| 3924 | CALHHZ010000042.1 | GCA938031325_01910 | gene | open | 37317-38477 | |||
| 3925 | CALHHZ010000042.1 | GCA938031325_01911 | gene | open | 38515-39372 | |||
| 3926 | CALHHZ010000042.1 | GCA938031325_01912 | gene | open | 39374-40276 | |||
| 3927 | CALHHZ010000042.1 | GCA938031325_01913 | gene | open | 40308-41681 | |||
| 3928 | CALHHZ010000042.1 | GCA938031325_01914 | gene | open | 41700-43280 | |||
| 3929 | CALHHZ010000042.1 | GCA938031325_01915 | gene | open | 43635-44303 | |||
| 3930 | CALHHZ010000042.1 | GCA938031325_01916 | gene | open | 44313-45047 | |||
| 3931 | CALHHZ010000042.1 | GCA938031325_01917 | gene | open | 45214-45762 | |||
| 3932 | CALHHZ010000042.1 | GCA938031325_01918 | gene | open | 46042-46674 | |||
| 3933 | CALHHZ010000042.1 | GCA938031325_01919 | gene | open | 46746-47345 | |||
| 3934 | CALHHZ010000042.1 | GCA938031325_01920 | gene | open | 47528-47923 | |||
| 3935 | CALHHZ010000042.1 | GCA938031325_01921 | gene | open | 47928-48419 | nimB | ||
| 3936 | CALHHZ010000042.1 | GCA938031325_01922 | gene | open | 48616-49926 | |||
| 3937 | CALHHZ010000042.1 | GCA938031325_01923 | gene | open | 50031-51359 | |||
| 3938 | CALHHZ010000042.1 | GCA938031325_01924 | gene | open | 51361-52221 | |||
| 3939 | CALHHZ010000042.1 | GCA938031325_01925 | gene | open | 52222-52686 | |||
| 3940 | CALHHZ010000042.1 | GCA938031325_01926 | gene | open | 52692-54959 | |||
| 3941 | CALHHZ010000042.1 | GCA938031325_01927 | gene | open | 55321-55983 | |||
| 3942 | CALHHZ010000042.1 | GCA938031325_01928 | gene | open | 56027-56839 | gntR | ||
| 3943 | CALHHZ010000042.1 | GCA938031325_01930 | gene | open | 57436-59091 | |||
| 3944 | CALHHZ010000042.1 | GCA938031325_01931 | gene | open | 59200-60018 | |||
| 3945 | CALHHZ010000042.1 | GCA938031325_01932 | gene | open | 60008-60676 | |||
| 3946 | CALHHZ010000042.1 | GCA938031325_01933 | gene | open | 60692-62446 | |||
| 3947 | CALHHZ010000042.1 | GCA938031325_01934 | gene | open | 62491-63552 | |||
| 3948 | CALHHZ010000042.1 | GCA938031325_01935 | gene | open | 63635-64984 | |||
| 3949 | CALHHZ010000042.1 | GCA938031325_01936 | gene | open | 65253-65717 | |||
| 3950 | CALHHZ010000042.1 | GCA938031325_01938 | gene | open | 66235-66846 | |||
| 3951 | CALHHZ010000042.1 | GCA938031325_01939 | gene | open | 66867-67361 | coaD | ||
| 3952 | CALHHZ010000042.1 | GCA938031325_01940 | gene | open | 67358-67894 | rsmD | ||
| 3953 | CALHHZ010000042.1 | GCA938031325_01941 | gene | open | 68042-70096 | recG | ||
| 3954 | CALHHZ010000042.1 | GCA938031325_01942 | gene | open | 70355-72052 | yloV | ||
| 3955 | CALHHZ010000042.1 | GCA938031325_01943 | gene | open | 72075-72434 | |||
| 3956 | CALHHZ010000042.1 | GCA938031325_01944 | gene | open | 72573-72779 | rpmB | ||
| 3957 | CALHHZ010000042.1 | GCA938031325_01945 | gene | open | 72952-73380 | ytfJ | ||
| 3958 | CALHHZ010000042.1 | GCA938031325_01946 | gene | open | 73370-74377 | |||
| 3959 | CALHHZ010000042.1 | GCA938031325_01947 | gene | open | 74420-74695 | |||
| 3960 | CALHHZ010000042.1 | GCA938031325_01948 | gene | open | 74699-75232 | cinA | ||
| 3961 | CALHHZ010000042.1 | GCA938031325_01949 | gene | open | 75237-75779 | pgsA | ||
| 3962 | CALHHZ010000042.1 | GCA938031325_01950 | gene | open | 75763-77043 | rimO | ||
| 3963 | CALHHZ010000042.1 | GCA938031325_01951 | gene | open | 77043-77462 | rpoZ | ||
| 3964 | CALHHZ010000042.1 | GCA938031325_01952 | gene | open | 77440-78081 | gmk | ||
| 3965 | CALHHZ010000042.1 | GCA938031325_01953 | gene | open | 78147-79028 | |||
| 3966 | CALHHZ010000042.1 | GCA938031325_01954 | gene | open | 79148-80965 | rqcH | ||
| 3967 | CALHHZ010000042.1 | GCA938031325_01955 | gene | open | 80990-81730 | |||
| 3968 | CALHHZ010000042.1 | GCA938031325_01956 | gene | open | 81808-83094 | alr | ||
| 3969 | CALHHZ010000042.1 | GCA938031325_01957 | gene | open | 83152-84063 | |||
| 3970 | CALHHZ010000042.1 | GCA938031325_01958 | gene | open | 84079-84396 | |||
| 3971 | CALHHZ010000042.1 | GCA938031325_01959 | gene | open | 84435-85070 | |||
| 3972 | CALHHZ010000042.1 | GCA938031325_01960 | gene | open | 85084-86370 | |||
| 3973 | CALHHZ010000042.1 | GCA938031325_01961 | gene | open | 86411-86599 | |||
| 3974 | CALHHZ010000042.1 | GCA938031325_01962 | gene | open | 86700-88136 | purB | ||
| 3975 | CALHHZ010000042.1 | GCA938031325_01963 | gene | open | 88168-88932 | dapB | ||
| 3976 | CALHHZ010000042.1 | GCA938031325_01964 | gene | open | 88944-89849 | dapA | ||
| 3977 | CALHHZ010000042.1 | GCA938031325_01965 | gene | open | 89931-91769 | typA | ||
| 3978 | CALHHZ010000042.1 | GCA938031325_01966 | gene | open | 91845-92459 | yigZ | ||
| 3979 | CALHHZ010000042.1 | GCA938031325_01967 | gene | open | 92463-95315 | |||
| 3980 | CALHHZ010000042.1 | GCA938031325_01968 | gene | open | 95495-96502 | asnA | ||
| 3981 | CALHHZ010000042.1 | GCA938031325_01969 | gene | open | 96588-96920 | |||
| 3982 | CALHHZ010000042.1 | GCA938031325_01970 | gene | open | 96932-97771 | pgeF | ||
| 3983 | CALHHZ010000042.1 | GCA938031325_01971 | gene | open | 97996-98457 | sufU | ||
| 3984 | CALHHZ010000042.1 | GCA938031325_01972 | gene | open | 98447-99694 | |||
| 3985 | CALHHZ010000042.1 | GCA938031325_01973 | gene | open | 99691-100761 | |||
| 3986 | CALHHZ010000042.1 | GCA938031325_01974 | gene | open | 100777-102192 | sufB | ||
| 3987 | CALHHZ010000042.1 | GCA938031325_01975 | gene | open | 102339-103094 | sufC | ||
| 3988 | CALHHZ010000042.1 | GCA938031325_01976 | gene | open | 103545-104042 | |||
| 3989 | CALHHZ010000042.1 | GCA938031325_01977 | gene | open | 104206-104982 | |||
| 3990 | CALHHZ010000042.1 | GCA938031325_01978 | gene | open | 105021-106073 | |||
| 3991 | CALHHZ010000042.1 | GCA938031325_01979 | gene | open | 106300-106641 | padR | ||
| 3992 | CALHHZ010000042.1 | GCA938031325_01980 | gene | open | 106745-107620 | araC | ||
| 3993 | CALHHZ010000042.1 | GCA938031325_01981 | gene | open | 107783-110071 | |||
| 3994 | CALHHZ010000042.1 | GCA938031325_01982 | gene | open | 110128-110967 | |||
| 3995 | CALHHZ010000042.1 | GCA938031325_01983 | gene | open | 110977-111873 | |||
| 3996 | CALHHZ010000042.1 | GCA938031325_01984 | gene | open | 111958-113298 | |||
| 3997 | CALHHZ010000042.1 | GCA938031325_01985 | gene | open | 114127-115773 | |||
| 3998 | CALHHZ010000042.1 | GCA938031325_01986 | gene | open | 115960-116217 | |||
| 3999 | CALHHZ010000042.1 | GCA938031325_01987 | gene | open | 116255-118138 | |||
| 4000 | CALHHZ010000042.1 | GCA938031325_01988 | gene | open | 118324-119151 |

