HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Propionibacterium acidifaciens (GCA_938034675.1)

Select a Genome:
BAKTA Annotations for GCA_938034675.1
Genome Selected: Propionibacterium acidifaciens
ContigsBases CDSrRNA tmRNAtRNA
121 2820612 2404 4 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4929 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4929 [10 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  10  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CALHML010000033.1 GCA938034675_00764 CDS open 40019-41923 _na     634_aa PDZ domain protein
1502 CALHML010000033.1 GCA938034675_00765 CDS open 42102-45500 _na     1132_aa PPi-type phosphoenolpyruvate carboxykinase
1503 CALHML010000033.1 GCA938034675_00766 CDS open 45554-46195 _na     213_aa aminodeoxychorismate/anthranilate synthase component II
1504 CALHML010000033.1 GCA938034675_00767 CDS open 46687-46974 _na     95_aa crgA Cell division protein CrgA
1505 CALHML010000033.1 GCA938034675_00768 CDS open 47223-48557 _na     444_aa 2-oxoacid dehydrogenase acyltransferase%2C catalytic domain protein
1506 CALHML010000033.1 GCA938034675_00769 CDS open 48587-49561 _na     324_aa Transketolase%2C pyridine binding domain protein
1507 CALHML010000033.1 GCA938034675_00770 CDS open 49558-50673 _na     371_aa 2-oxoisovalerate dehydrogenase subunit alpha
1508 CALHML010000033.1 GCA938034675_00771 CDS open 51100-52170 _na     356_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
1509 CALHML010000033.1 GCA938034675_00772 CDS open 52167-52988 _na     273_aa ABC transporter%2C ATP-binding protein
1510 CALHML010000033.1 GCA938034675_00773 CDS open 52985-54061 _na     358_aa Oligopeptide ABC transporter%2C oligopeptide-binding protein
1511 CALHML010000033.1 GCA938034675_00774 CDS open 54440-54787 _na     115_aa hypothetical protein
1512 CALHML010000033.1 GCA938034675_00775 CDS open 55031-55207 _na     58_aa hypothetical protein
1513 CALHML010000033.1 GCA938034675_00776 CDS open 55333-56934 _na     533_aa Transporter%2C major facilitator family protein
1514 CALHML010000033.1 GCA938034675_00777 CDS open 56945-57640 _na     231_aa tetR Transcriptional regulator%2C TetR family
1515 CALHML010000033.1 GCA938034675_00778 CDS open 57845-58048 _na     67_aa hypothetical protein
1516 CALHML010000033.1 GCA938034675_00732 gene open 57-302
1517 CALHML010000033.1 GCA938034675_00733 gene open 569-1525
1518 CALHML010000033.1 GCA938034675_00734 gene open 1763-3253
1519 CALHML010000033.1 GCA938034675_00735 gene open 3444-5942
1520 CALHML010000033.1 GCA938034675_00736 gene open 6056-6628
1521 CALHML010000033.1 GCA938034675_00737 gene open 6797-7603
1522 CALHML010000033.1 GCA938034675_00738 gene open 7563-7946
1523 CALHML010000033.1 GCA938034675_00739 gene open 8154-9122 galE
1524 CALHML010000033.1 GCA938034675_00740 gene open 9264-10025
1525 CALHML010000033.1 GCA938034675_00741 gene open 10012-10815
1526 CALHML010000033.1 GCA938034675_00742 gene open 10812-11813
1527 CALHML010000033.1 GCA938034675_00743 gene open 11845-12939
1528 CALHML010000033.1 GCA938034675_00744 gene open 13586-14971
1529 CALHML010000033.1 GCA938034675_00745 gene open 15154-15987
1530 CALHML010000033.1 GCA938034675_00746 gene open 15977-16927
1531 CALHML010000033.1 GCA938034675_00747 gene open 16929-17966
1532 CALHML010000033.1 GCA938034675_00748 gene open 17963-19351
1533 CALHML010000033.1 GCA938034675_00749 gene open 19530-19808 gatB
1534 CALHML010000033.1 GCA938034675_00750 gene open 19971-20438
1535 CALHML010000033.1 GCA938034675_00751 gene open 20435-21205 deoR
1536 CALHML010000033.1 GCA938034675_00752 gene open 21596-22339 ppgK
1537 CALHML010000033.1 GCA938034675_00753 gene open 22564-23559
1538 CALHML010000033.1 GCA938034675_00754 gene open 23654-24973 dcuA
1539 CALHML010000033.1 GCA938034675_00755 gene open 25176-26111
1540 CALHML010000033.1 GCA938034675_00756 gene open 27703-28395
1541 CALHML010000033.1 GCA938034675_00757 gene open 28395-30845
1542 CALHML010000033.1 GCA938034675_00758 gene open 31781-33208 larC
1543 CALHML010000033.1 GCA938034675_00759 gene open 33236-33961 larB
1544 CALHML010000033.1 GCA938034675_00760 gene open 33954-34823 larE
1545 CALHML010000033.1 GCA938034675_00761 gene open 34820-36454 argS
1546 CALHML010000033.1 GCA938034675_00762 gene open 36746-37405
1547 CALHML010000033.1 GCA938034675_00763 gene open 37759-39534
1548 CALHML010000033.1 GCA938034675_00764 gene open 40019-41923
1549 CALHML010000033.1 GCA938034675_00765 gene open 42102-45500
1550 CALHML010000033.1 GCA938034675_00766 gene open 45554-46195
1551 CALHML010000033.1 GCA938034675_00767 gene open 46687-46974 crgA
1552 CALHML010000033.1 GCA938034675_00768 gene open 47223-48557
1553 CALHML010000033.1 GCA938034675_00769 gene open 48587-49561
1554 CALHML010000033.1 GCA938034675_00770 gene open 49558-50673
1555 CALHML010000033.1 GCA938034675_00771 gene open 51100-52170
1556 CALHML010000033.1 GCA938034675_00772 gene open 52167-52988
1557 CALHML010000033.1 GCA938034675_00773 gene open 52985-54061
1558 CALHML010000033.1 GCA938034675_00774 gene open 54440-54787
1559 CALHML010000033.1 GCA938034675_00775 gene open 55031-55207
1560 CALHML010000033.1 GCA938034675_00776 gene open 55333-56934
1561 CALHML010000033.1 GCA938034675_00777 gene open 56945-57640 tetR
1562 CALHML010000033.1 GCA938034675_00778 gene open 57845-58048
1563 CALHML010000034.1 GCA938034675_00779 CDS open 150-1298 _na     382_aa glycosyltransferase family 4 protein
1564 CALHML010000034.1 GCA938034675_00780 CDS open 1298-2461 _na     387_aa Glycosyltransferase%2C group 1 family protein
1565 CALHML010000034.1 GCA938034675_00781 CDS open 2454-4259 _na     601_aa ABC transporter%2C ATP-binding protein
1566 CALHML010000034.1 GCA938034675_00779 gene open 150-1298
1567 CALHML010000034.1 GCA938034675_00780 gene open 1298-2461
1568 CALHML010000034.1 GCA938034675_00781 gene open 2454-4259
1569 CALHML010000035.1 GCA938034675_00783 CDS open 555-893 _na     112_aa DUF5318 domain-containing protein
1570 CALHML010000035.1 GCA938034675_00784 CDS open 886-3111 _na     741_aa peptidoglycan glycosyltransferase
1571 CALHML010000035.1 GCA938034675_00785 CDS open 3297-4733 _na     478_aa PF09594 family protein
1572 CALHML010000035.1 GCA938034675_00786 CDS open 4730-5929 _na     399_aa Mannosyltransferase PIG-V domain protein
1573 CALHML010000035.1 GCA938034675_00787 CDS open 6005-7255 _na     416_aa Alpha amylase%2C catalytic domain protein
1574 CALHML010000035.1 GCA938034675_00788 CDS open 7401-7679 _na     92_aa Carbohydrate-binding module 48
1575 CALHML010000035.1 GCA938034675_00789 CDS open 7903-8493 _na     196_aa Methyladenine glycosylase
1576 CALHML010000035.1 GCA938034675_00790 CDS open 8497-9105 _na     202_aa Methylated-DNA--[protein]-cysteine S-methyltransferase family protein
1577 CALHML010000035.1 GCA938034675_00791 CDS open 9102-10274 _na     390_aa AAA ATPase domain
1578 CALHML010000035.1 GCA938034675_00792 CDS open 10360-11559 _na     399_aa Transporter%2C major facilitator domain protein
1579 CALHML010000035.1 GCA938034675_00793 CDS open 11895-12275 _na     126_aa Rhodanese-like protein
1580 CALHML010000035.1 GCA938034675_00794 CDS open 12461-14185 _na     574_aa Glycerol-3-phosphate dehydrogenase
1581 CALHML010000035.1 GCA938034675_00795 CDS open 14673-14960 _na     95_aa rpsF 30S ribosomal protein S6
1582 CALHML010000035.1 GCA938034675_00796 CDS open 15148-15711 _na     187_aa Single-stranded DNA-binding protein
1583 CALHML010000035.1 GCA938034675_00797 CDS open 15839-16078 _na     79_aa rpsR 30S ribosomal protein S18
1584 CALHML010000035.1 GCA938034675_00798 CDS open 16096-16545 _na     149_aa rplI 50S ribosomal protein L9
1585 CALHML010000035.1 GCA938034675_00799 CDS open 16765-17439 _na     224_aa ABC transporter%2C permease protein
1586 CALHML010000035.1 GCA938034675_00800 CDS open 17436-18083 _na     215_aa ABC transporter%2C permease protein
1587 CALHML010000035.1 GCA938034675_00801 CDS open 18080-18949 _na     289_aa ABC transporter%2C ATP-binding protein
1588 CALHML010000035.1 GCA938034675_00802 CDS open 19029-19856 _na     275_aa KR domain protein
1589 CALHML010000035.1 GCA938034675_00803 CDS open 19879-20997 _na     372_aa Glycerate kinase
1590 CALHML010000035.1 GCA938034675_00804 CDS open 21274-21879 _na     201_aa Haloacid dehalogenase-like hydrolase
1591 CALHML010000035.1 GCA938034675_00805 CDS open 22238-23425 _na     395_aa DNA glycosylase
1592 CALHML010000035.1 GCA938034675_00806 CDS open 23556-24233 _na     225_aa TIGR00266 family protein
1593 CALHML010000035.1 GCA938034675_00807 CDS open 24230-25426 _na     398_aa MFS transporter family protein
1594 CALHML010000035.1 GCA938034675_00808 CDS open 25493-26929 _na     478_aa histidine kinase
1595 CALHML010000035.1 GCA938034675_00809 CDS open 26926-27618 _na     230_aa mprA Response regulator MprA
1596 CALHML010000035.1 GCA938034675_00810 CDS open 27609-28442 _na     277_aa Cyanophycinase
1597 CALHML010000035.1 GCA938034675_00811 CDS open 28548-29003 _na     151_aa protein-tyrosine-phosphatase
1598 CALHML010000035.1 GCA938034675_00812 CDS open 29000-29491 _na     163_aa whiB Transcriptional regulator WhiB
1599 CALHML010000035.1 GCA938034675_00813 CDS open 29759-30760 _na     333_aa argF ornithine carbamoyltransferase
1600 CALHML010000035.1 GCA938034675_00814 CDS open 31160-32290 _na     376_aa alr alanine racemase
1601 CALHML010000035.1 GCA938034675_00815 CDS open 32354-33067 _na     237_aa ecsC EcsC family protein
1602 CALHML010000035.1 GCA938034675_00816 CDS open 33448-34734 _na     428_aa citrate synthase
1603 CALHML010000035.1 GCA938034675_00817 CDS open 34978-35625 _na     215_aa Transglycosylase-like domain protein
1604 CALHML010000035.1 GCA938034675_00818 CDS open 35747-36217 _na     156_aa PF11239 family protein
1605 CALHML010000035.1 GCA938034675_00819 CDS open 36337-37137 _na     266_aa aat leucyl/phenylalanyl-tRNA--protein transferase
1606 CALHML010000035.1 GCA938034675_00820 CDS open 37246-38196 _na     316_aa pheA prephenate dehydratase
1607 CALHML010000035.1 GCA938034675_00821 CDS open 38112-39713 _na     533_aa Diacylglycerol kinase
1608 CALHML010000035.1 GCA938034675_00822 CDS open 39789-41060 _na     423_aa serS serine--tRNA ligase
1609 CALHML010000035.1 GCA938034675_00823 CDS open 41282-41965 _na     227_aa GPP34 family phosphoprotein
1610 CALHML010000035.1 GCA938034675_00824 CDS open 42041-44137 _na     698_aa PTS system mannose-specific eiibca component
1611 CALHML010000035.1 GCA938034675_00825 CDS open 45191-46330 _na     379_aa biotin--[acetyl-CoA-carboxylase] ligase
1612 CALHML010000035.1 GCA938034675_00826 CDS open 46364-47500 _na     378_aa Adenylate cyclase
1613 CALHML010000035.1 GCA938034675_00827 CDS open 47579-48244 _na     221_aa cheY Chemotaxis protein CheY
1614 CALHML010000035.1 GCA938034675_00828 CDS open 48358-48492 _na     44_aa hypothetical protein
1615 CALHML010000035.1 GCA938034675_00783 gene open 555-893
1616 CALHML010000035.1 GCA938034675_00784 gene open 886-3111
1617 CALHML010000035.1 GCA938034675_00785 gene open 3297-4733
1618 CALHML010000035.1 GCA938034675_00786 gene open 4730-5929
1619 CALHML010000035.1 GCA938034675_00787 gene open 6005-7255
1620 CALHML010000035.1 GCA938034675_00788 gene open 7401-7679
1621 CALHML010000035.1 GCA938034675_00789 gene open 7903-8493
1622 CALHML010000035.1 GCA938034675_00790 gene open 8497-9105
1623 CALHML010000035.1 GCA938034675_00791 gene open 9102-10274
1624 CALHML010000035.1 GCA938034675_00792 gene open 10360-11559
1625 CALHML010000035.1 GCA938034675_00793 gene open 11895-12275
1626 CALHML010000035.1 GCA938034675_00794 gene open 12461-14185
1627 CALHML010000035.1 GCA938034675_00795 gene open 14673-14960 rpsF
1628 CALHML010000035.1 GCA938034675_00796 gene open 15148-15711
1629 CALHML010000035.1 GCA938034675_00797 gene open 15839-16078 rpsR
1630 CALHML010000035.1 GCA938034675_00798 gene open 16096-16545 rplI
1631 CALHML010000035.1 GCA938034675_00799 gene open 16765-17439
1632 CALHML010000035.1 GCA938034675_00800 gene open 17436-18083
1633 CALHML010000035.1 GCA938034675_00801 gene open 18080-18949
1634 CALHML010000035.1 GCA938034675_00802 gene open 19029-19856
1635 CALHML010000035.1 GCA938034675_00803 gene open 19879-20997
1636 CALHML010000035.1 GCA938034675_00804 gene open 21274-21879
1637 CALHML010000035.1 GCA938034675_00805 gene open 22238-23425
1638 CALHML010000035.1 GCA938034675_00806 gene open 23556-24233
1639 CALHML010000035.1 GCA938034675_00807 gene open 24230-25426
1640 CALHML010000035.1 GCA938034675_00808 gene open 25493-26929
1641 CALHML010000035.1 GCA938034675_00809 gene open 26926-27618 mprA
1642 CALHML010000035.1 GCA938034675_00810 gene open 27609-28442
1643 CALHML010000035.1 GCA938034675_00811 gene open 28548-29003
1644 CALHML010000035.1 GCA938034675_00812 gene open 29000-29491 whiB
1645 CALHML010000035.1 GCA938034675_00813 gene open 29759-30760 argF
1646 CALHML010000035.1 GCA938034675_00814 gene open 31160-32290 alr
1647 CALHML010000035.1 GCA938034675_00815 gene open 32354-33067 ecsC
1648 CALHML010000035.1 GCA938034675_00816 gene open 33448-34734
1649 CALHML010000035.1 GCA938034675_00817 gene open 34978-35625
1650 CALHML010000035.1 GCA938034675_00818 gene open 35747-36217
1651 CALHML010000035.1 GCA938034675_00819 gene open 36337-37137 aat
1652 CALHML010000035.1 GCA938034675_00820 gene open 37246-38196 pheA
1653 CALHML010000035.1 GCA938034675_00821 gene open 38112-39713
1654 CALHML010000035.1 GCA938034675_00822 gene open 39789-41060 serS
1655 CALHML010000035.1 GCA938034675_00823 gene open 41282-41965
1656 CALHML010000035.1 GCA938034675_00824 gene open 42041-44137
1657 CALHML010000035.1 GCA938034675_00825 gene open 45191-46330
1658 CALHML010000035.1 GCA938034675_00826 gene open 46364-47500
1659 CALHML010000035.1 GCA938034675_00827 gene open 47579-48244 cheY
1660 CALHML010000035.1 GCA938034675_00828 gene open 48358-48492
1661 CALHML010000035.1 GCA938034675_00782 gene open 75-147 trnA
1662 CALHML010000035.1 GCA938034675_00782 tRNA open 75-147 trnA tRNA-Ala(tgc)
1663 CALHML010000036.1 GCA938034675_00829 CDS open 6-527 _na     173_aa hypothetical protein
1664 CALHML010000036.1 GCA938034675_00830 CDS open 1163-1879 _na     238_aa L-lysine exporter
1665 CALHML010000036.1 GCA938034675_00831 CDS open 2049-3404 _na     451_aa MFS transporter
1666 CALHML010000036.1 GCA938034675_00832 CDS open 3449-4792 _na     447_aa enolase C-terminal domain-like protein
1667 CALHML010000036.1 GCA938034675_00833 CDS open 5042-5833 _na     263_aa iclR IclR family transcriptional regulator
1668 CALHML010000036.1 GCA938034675_00834 CDS open 6052-6948 _na     298_aa SMP-30/gluconolactonase/LRE family protein
1669 CALHML010000036.1 GCA938034675_00835 CDS open 6982-8313 _na     443_aa MFS transporter
1670 CALHML010000036.1 GCA938034675_00836 CDS open 8608-9369 _na     253_aa SDR family oxidoreductase
1671 CALHML010000036.1 GCA938034675_00837 CDS open 9366-10394 _na     342_aa zinc-binding dehydrogenase
1672 CALHML010000036.1 GCA938034675_00838 CDS open 10884-11906 _na     340_aa fbaA class II fructose-bisphosphate aldolase
1673 CALHML010000036.1 GCA938034675_00839 CDS open 12086-12694 _na     202_aa PH domain-containing protein
1674 CALHML010000036.1 GCA938034675_00840 CDS open 12873-13613 _na     246_aa trmH RNA methyltransferase%2C TrmH family
1675 CALHML010000036.1 GCA938034675_00841 CDS open 13647-14363 _na     238_aa SNARE-like domain protein
1676 CALHML010000036.1 GCA938034675_00842 CDS open 14629-15387 _na     252_aa lemA LemA family protein
1677 CALHML010000036.1 GCA938034675_00843 CDS open 15389-15931 _na     180_aa orotate phosphoribosyltransferase
1678 CALHML010000036.1 GCA938034675_00844 CDS open 16404-17261 _na     285_aa merR MerR HTH family regulatory protein
1679 CALHML010000036.1 GCA938034675_00845 CDS open 17258-18172 _na     304_aa ABC transporter%2C ATP-binding protein
1680 CALHML010000036.1 GCA938034675_00846 CDS open 18169-19842 _na     557_aa Putative membrane protein
1681 CALHML010000036.1 GCA938034675_00847 CDS open 20035-21309 _na     424_aa Transporter%2C major facilitator family protein
1682 CALHML010000036.1 GCA938034675_00848 CDS open 21515-22243 _na     242_aa tetR Transcriptional regulator%2C TetR family
1683 CALHML010000036.1 GCA938034675_00829 gene open 6-527
1684 CALHML010000036.1 GCA938034675_00830 gene open 1163-1879
1685 CALHML010000036.1 GCA938034675_00831 gene open 2049-3404
1686 CALHML010000036.1 GCA938034675_00832 gene open 3449-4792
1687 CALHML010000036.1 GCA938034675_00833 gene open 5042-5833 iclR
1688 CALHML010000036.1 GCA938034675_00834 gene open 6052-6948
1689 CALHML010000036.1 GCA938034675_00835 gene open 6982-8313
1690 CALHML010000036.1 GCA938034675_00836 gene open 8608-9369
1691 CALHML010000036.1 GCA938034675_00837 gene open 9366-10394
1692 CALHML010000036.1 GCA938034675_00838 gene open 10884-11906 fbaA
1693 CALHML010000036.1 GCA938034675_00839 gene open 12086-12694
1694 CALHML010000036.1 GCA938034675_00840 gene open 12873-13613 trmH
1695 CALHML010000036.1 GCA938034675_00841 gene open 13647-14363
1696 CALHML010000036.1 GCA938034675_00842 gene open 14629-15387 lemA
1697 CALHML010000036.1 GCA938034675_00843 gene open 15389-15931
1698 CALHML010000036.1 GCA938034675_00844 gene open 16404-17261 merR
1699 CALHML010000036.1 GCA938034675_00845 gene open 17258-18172
1700 CALHML010000036.1 GCA938034675_00846 gene open 18169-19842
1701 CALHML010000036.1 GCA938034675_00847 gene open 20035-21309
1702 CALHML010000036.1 GCA938034675_00848 gene open 21515-22243 tetR
1703 CALHML010000037.1 GCA938034675_00849 CDS open 232-1725 _na     497_aa Penicillin binding protein transpeptidase domain protein
1704 CALHML010000037.1 GCA938034675_00850 CDS open 1722-2984 _na     420_aa non-specific serine/threonine protein kinase
1705 CALHML010000037.1 GCA938034675_00851 CDS open 2981-4843 _na     620_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
1706 CALHML010000037.1 GCA938034675_00852 CDS open 4809-6650 _na     613_aa DEAD/DEAH box helicase
1707 CALHML010000037.1 GCA938034675_00853 CDS open 6856-7731 _na     291_aa HAD hydrolase%2C family IIB
1708 CALHML010000037.1 GCA938034675_00854 CDS open 7748-8632 _na     294_aa tatC twin-arginine translocase subunit TatC
1709 CALHML010000037.1 GCA938034675_00855 CDS open 8649-8924 _na     91_aa tatA Sec-independent protein translocase protein TatA
1710 CALHML010000037.1 GCA938034675_00856 CDS open 9047-10060 _na     337_aa WYL domain protein
1711 CALHML010000037.1 GCA938034675_00857 CDS open 10057-11022 _na     321_aa WYL domain-containing protein
1712 CALHML010000037.1 GCA938034675_00858 CDS open 11060-11998 _na     312_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
1713 CALHML010000037.1 GCA938034675_00859 CDS open 12039-13109 _na     356_aa peptidylprolyl isomerase
1714 CALHML010000037.1 GCA938034675_00860 CDS open 13170-13919 _na     249_aa Pseudouridine synthase
1715 CALHML010000037.1 GCA938034675_00861 CDS open 13897-14625 _na     242_aa Putative segregation and condensation protein B
1716 CALHML010000037.1 GCA938034675_00862 CDS open 14618-15490 _na     290_aa Segregation and condensation protein A
1717 CALHML010000037.1 GCA938034675_00863 CDS open 15492-15827 _na     111_aa copG Ribbon-helix-helix protein%2C CopG family
1718 CALHML010000037.1 GCA938034675_00864 CDS open 15812-16699 _na     295_aa CobQ/CobB/MinD/ParA nucleotide binding domain protein
1719 CALHML010000037.1 GCA938034675_00865 CDS open 16854-18233 _na     459_aa ABC transporter%2C solute-binding protein
1720 CALHML010000037.1 GCA938034675_00866 CDS open 18053-19042 _na     329_aa hypothetical protein
1721 CALHML010000037.1 GCA938034675_00849 gene open 232-1725
1722 CALHML010000037.1 GCA938034675_00850 gene open 1722-2984
1723 CALHML010000037.1 GCA938034675_00851 gene open 2981-4843 pknB
1724 CALHML010000037.1 GCA938034675_00852 gene open 4809-6650
1725 CALHML010000037.1 GCA938034675_00853 gene open 6856-7731
1726 CALHML010000037.1 GCA938034675_00854 gene open 7748-8632 tatC
1727 CALHML010000037.1 GCA938034675_00855 gene open 8649-8924 tatA
1728 CALHML010000037.1 GCA938034675_00856 gene open 9047-10060
1729 CALHML010000037.1 GCA938034675_00857 gene open 10057-11022
1730 CALHML010000037.1 GCA938034675_00858 gene open 11060-11998 gluQRS
1731 CALHML010000037.1 GCA938034675_00859 gene open 12039-13109
1732 CALHML010000037.1 GCA938034675_00860 gene open 13170-13919
1733 CALHML010000037.1 GCA938034675_00861 gene open 13897-14625
1734 CALHML010000037.1 GCA938034675_00862 gene open 14618-15490
1735 CALHML010000037.1 GCA938034675_00863 gene open 15492-15827 copG
1736 CALHML010000037.1 GCA938034675_00864 gene open 15812-16699
1737 CALHML010000037.1 GCA938034675_00865 gene open 16854-18233
1738 CALHML010000037.1 GCA938034675_00866 gene open 18053-19042
1739 CALHML010000038.1 regulatory_region open 13289-13465 Cobalamin riboswitch aptamer
1740 CALHML010000038.1 GCA938034675_00867 CDS open 321-1394 _na     357_aa helix-turn-helix domain-containing protein
1741 CALHML010000038.1 GCA938034675_00868 CDS open 1414-1740 _na     108_aa Fic/DOC family protein
1742 CALHML010000038.1 GCA938034675_00869 CDS open 1737-2291 _na     184_aa Panacea domain-containing protein
1743 CALHML010000038.1 GCA938034675_00870 CDS open 3019-4575 _na     518_aa Putative membrane protein
1744 CALHML010000038.1 GCA938034675_00871 CDS open 4673-5509 _na     278_aa TIM-barrel signal transduction protein
1745 CALHML010000038.1 GCA938034675_00872 CDS open 5519-6751 _na     410_aa PF06792 family protein
1746 CALHML010000038.1 GCA938034675_00873 CDS open 6874-8280 _na     468_aa gntR Transcriptional regulator%2C GntR family
1747 CALHML010000038.1 GCA938034675_00874 CDS open 8507-9001 _na     164_aa hypothetical protein
1748 CALHML010000038.1 GCA938034675_00875 CDS open 9175-10008 _na     277_aa ABC transporter%2C ATP-binding protein
1749 CALHML010000038.1 GCA938034675_00876 CDS open 10005-11030 _na     341_aa Iron complex transport system permease protein
1750 CALHML010000038.1 GCA938034675_00877 CDS open 11042-12073 _na     343_aa Oligopeptide ABC transporter%2C oligopeptide-binding protein
1751 CALHML010000038.1 GCA938034675_00878 CDS open 12195-13232 _na     345_aa Oligopeptide ABC transporter%2C oligopeptide-binding protein
1752 CALHML010000038.1 GCA938034675_00879 CDS open 13256-14017 _na     253_aa hypothetical protein
1753 CALHML010000038.1 GCA938034675_00880 CDS open 13956-15224 _na     422_aa Endopeptidase-domain containing protein
1754 CALHML010000038.1 GCA938034675_00881 CDS open 15211-16149 _na     312_aa Serine hydrolase
1755 CALHML010000038.1 GCA938034675_00882 CDS open 16302-17006 _na     234_aa Zinc ribbon domain-containing protein
1756 CALHML010000038.1 GCA938034675_00883 CDS open 17391-18317 _na     308_aa mmuM homocysteine S-methyltransferase
1757 CALHML010000038.1 GCA938034675_00867 gene open 321-1394
1758 CALHML010000038.1 GCA938034675_00868 gene open 1414-1740
1759 CALHML010000038.1 GCA938034675_00869 gene open 1737-2291
1760 CALHML010000038.1 GCA938034675_00870 gene open 3019-4575
1761 CALHML010000038.1 GCA938034675_00871 gene open 4673-5509
1762 CALHML010000038.1 GCA938034675_00872 gene open 5519-6751
1763 CALHML010000038.1 GCA938034675_00873 gene open 6874-8280 gntR
1764 CALHML010000038.1 GCA938034675_00874 gene open 8507-9001
1765 CALHML010000038.1 GCA938034675_00875 gene open 9175-10008
1766 CALHML010000038.1 GCA938034675_00876 gene open 10005-11030
1767 CALHML010000038.1 GCA938034675_00877 gene open 11042-12073
1768 CALHML010000038.1 GCA938034675_00878 gene open 12195-13232
1769 CALHML010000038.1 GCA938034675_00879 gene open 13256-14017
1770 CALHML010000038.1 GCA938034675_00880 gene open 13956-15224
1771 CALHML010000038.1 GCA938034675_00881 gene open 15211-16149
1772 CALHML010000038.1 GCA938034675_00882 gene open 16302-17006
1773 CALHML010000038.1 GCA938034675_00883 gene open 17391-18317 mmuM
1774 CALHML010000039.1 GCA938034675_00884 CDS open 43-423 _na     126_aa hypothetical protein
1775 CALHML010000039.1 GCA938034675_00885 CDS open 927-1715 _na     262_aa Adenosinetriphosphatase
1776 CALHML010000039.1 GCA938034675_00886 CDS open 1748-2791 _na     347_aa Sodium Bile acid symporter family protein
1777 CALHML010000039.1 GCA938034675_00887 CDS open 3068-3898 _na     276_aa trmH RNA methyltransferase%2C TrmH family
1778 CALHML010000039.1 GCA938034675_00888 CDS open 3996-4190 _na     64_aa hypothetical protein
1779 CALHML010000039.1 GCA938034675_00889 CDS open 4147-4599 _na     150_aa Prokaryotic membrane lipoprotein lipid attachment site profile
1780 CALHML010000039.1 GCA938034675_00890 CDS open 4715-5044 _na     109_aa hypothetical protein
1781 CALHML010000039.1 GCA938034675_00891 CDS open 5302-6726 _na     474_aa MFS transporter
1782 CALHML010000039.1 GCA938034675_00892 CDS open 7289-7990 _na     233_aa hypothetical protein
1783 CALHML010000039.1 GCA938034675_00893 CDS open 8078-8383 _na     101_aa hypothetical protein
1784 CALHML010000039.1 GCA938034675_00894 CDS open 9073-9879 _na     268_aa DUF3387 domain-containing protein
1785 CALHML010000039.1 GCA938034675_00895 CDS open 10117-10878 _na     253_aa ecsC EcsC family protein
1786 CALHML010000039.1 GCA938034675_00896 CDS open 11112-11714 _na     200_aa def peptide deformylase
1787 CALHML010000039.1 GCA938034675_00897 CDS open 11744-12724 _na     326_aa xerC Tyrosine recombinase XerC
1788 CALHML010000039.1 GCA938034675_00898 CDS open 13005-14147 _na     380_aa Peptidase%2C M23 family
1789 CALHML010000039.1 GCA938034675_00884 gene open 43-423
1790 CALHML010000039.1 GCA938034675_00885 gene open 927-1715
1791 CALHML010000039.1 GCA938034675_00886 gene open 1748-2791
1792 CALHML010000039.1 GCA938034675_00887 gene open 3068-3898 trmH
1793 CALHML010000039.1 GCA938034675_00888 gene open 3996-4190
1794 CALHML010000039.1 GCA938034675_00889 gene open 4147-4599
1795 CALHML010000039.1 GCA938034675_00890 gene open 4715-5044
1796 CALHML010000039.1 GCA938034675_00891 gene open 5302-6726
1797 CALHML010000039.1 GCA938034675_00892 gene open 7289-7990
1798 CALHML010000039.1 GCA938034675_00893 gene open 8078-8383
1799 CALHML010000039.1 GCA938034675_00894 gene open 9073-9879
1800 CALHML010000039.1 GCA938034675_00895 gene open 10117-10878 ecsC
1801 CALHML010000039.1 GCA938034675_00896 gene open 11112-11714 def
1802 CALHML010000039.1 GCA938034675_00897 gene open 11744-12724 xerC
1803 CALHML010000039.1 GCA938034675_00898 gene open 13005-14147
1804 CALHML010000040.1 GCA938034675_00912 gene open 11263-11654 RNaseP_bact_a
1805 CALHML010000040.1 GCA938034675_00912 ncRNA open 11263-11654 Bacterial RNase P class A
1806 CALHML010000040.1 GCA938034675_00899 CDS open 13-630 _na     205_aa hypothetical protein
1807 CALHML010000040.1 GCA938034675_00900 CDS open 713-1381 _na     222_aa O-methyltransferase
1808 CALHML010000040.1 GCA938034675_00901 CDS open 1451-2332 _na     293_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
1809 CALHML010000040.1 GCA938034675_00902 CDS open 2443-2958 _na     171_aa sec-independent translocase
1810 CALHML010000040.1 GCA938034675_00903 CDS open 3030-4187 _na     385_aa Iron-sulfur cluster carrier protein
1811 CALHML010000040.1 GCA938034675_00904 CDS open 4349-4891 _na     180_aa PF06210 family protein
1812 CALHML010000040.1 GCA938034675_00905 CDS open 4891-6165 _na     424_aa mgtE MgtE intracellular N-terminal domain protein
1813 CALHML010000040.1 GCA938034675_00906 CDS open 6219-6356 _na     45_aa hypothetical protein
1814 CALHML010000040.1 GCA938034675_00907 CDS open 6353-7216 _na     287_aa HpcH/HpaI aldolase/citrate lyase family protein
1815 CALHML010000040.1 GCA938034675_00908 CDS open 7366-8130 _na     254_aa General stress protein 17M-like domain-containing protein
1816 CALHML010000040.1 GCA938034675_00909 CDS open 8144-9586 _na     480_aa Xaa-Pro aminopeptidase
1817 CALHML010000040.1 GCA938034675_00910 CDS open 9678-10364 _na     228_aa 4'-phosphopantetheinyl transferase family protein
1818 CALHML010000040.1 GCA938034675_00911 CDS open 10469-11212 _na     247_aa Zinc ribbon domain protein
1819 CALHML010000040.1 GCA938034675_00913 CDS open 11893-12330 _na     145_aa Putative lipoprotein
1820 CALHML010000040.1 GCA938034675_00914 CDS open 12548-13339 _na     263_aa hypothetical protein
1821 CALHML010000040.1 GCA938034675_00915 CDS open 13399-14298 _na     299_aa map type I methionyl aminopeptidase
1822 CALHML010000040.1 GCA938034675_00916 CDS open 14361-15248 _na     295_aa PF10708 family protein
1823 CALHML010000040.1 GCA938034675_00917 CDS open 15396-16730 _na     444_aa glnA type I glutamate--ammonia ligase
1824 CALHML010000040.1 GCA938034675_00918 CDS open 16751-17848 _na     365_aa Putative threonine synthase
1825 CALHML010000040.1 GCA938034675_00919 CDS open 17885-18619 _na     244_aa Bacterial SCP orthologue domain-containing protein
1826 CALHML010000040.1 GCA938034675_00920 CDS open 18721-20049 _na     442_aa gntR Transcriptional regulator%2C GntR family
1827 CALHML010000040.1 GCA938034675_00921 CDS open 20111-21283 _na     390_aa tRNA ligase class II core domain protein
1828 CALHML010000040.1 GCA938034675_00922 CDS open 23146-24579 _na     477_aa L-threonylcarbamoyladenylate synthase
1829 CALHML010000040.1 GCA938034675_00923 CDS open 24576-25550 _na     324_aa triphosphoribosyl-dephospho-CoA synthase
1830 CALHML010000040.1 GCA938034675_00924 CDS open 25892-27271 _na     459_aa Transporter%2C major facilitator family protein
1831 CALHML010000040.1 GCA938034675_00925 CDS open 27714-30680 _na     988_aa bifunctional [glutamine synthetase] adenylyltransferase/[glutamine synthetase]-adenylyl-L-tyrosine phosphorylase
1832 CALHML010000040.1 GCA938034675_00926 CDS open 30677-31552 _na     291_aa decaprenylphospho-beta-D-erythro-pentofuranosid-2-ulose 2-reductase
1833 CALHML010000040.1 GCA938034675_00927 CDS open 31634-32185 _na     183_aa Putative tetracycline repressor protein class E
1834 CALHML010000040.1 GCA938034675_00928 CDS open 32190-32717 _na     175_aa Putative lipoprotein
1835 CALHML010000040.1 GCA938034675_00929 CDS open 32872-33270 _na     132_aa DNA binding domain protein%2C excisionase family
1836 CALHML010000040.1 GCA938034675_00930 CDS open 33463-34884 _na     473_aa glnA type I glutamate--ammonia ligase
1837 CALHML010000040.1 GCA938034675_00931 CDS open 35083-36498 _na     471_aa ABC transporter%2C solute-binding protein
1838 CALHML010000040.1 GCA938034675_00932 CDS open 36508-37452 _na     314_aa ABC transporter%2C permease protein
1839 CALHML010000040.1 GCA938034675_00933 CDS open 37465-38370 _na     301_aa ABC transporter%2C permease protein
1840 CALHML010000040.1 GCA938034675_00934 CDS open 38367-39443 _na     358_aa alpha-galactosidase
1841 CALHML010000040.1 GCA938034675_00899 gene open 13-630
1842 CALHML010000040.1 GCA938034675_00900 gene open 713-1381
1843 CALHML010000040.1 GCA938034675_00901 gene open 1451-2332 dapA
1844 CALHML010000040.1 GCA938034675_00902 gene open 2443-2958
1845 CALHML010000040.1 GCA938034675_00903 gene open 3030-4187
1846 CALHML010000040.1 GCA938034675_00904 gene open 4349-4891
1847 CALHML010000040.1 GCA938034675_00905 gene open 4891-6165 mgtE
1848 CALHML010000040.1 GCA938034675_00906 gene open 6219-6356
1849 CALHML010000040.1 GCA938034675_00907 gene open 6353-7216
1850 CALHML010000040.1 GCA938034675_00908 gene open 7366-8130
1851 CALHML010000040.1 GCA938034675_00909 gene open 8144-9586
1852 CALHML010000040.1 GCA938034675_00910 gene open 9678-10364
1853 CALHML010000040.1 GCA938034675_00911 gene open 10469-11212
1854 CALHML010000040.1 GCA938034675_00913 gene open 11893-12330
1855 CALHML010000040.1 GCA938034675_00914 gene open 12548-13339
1856 CALHML010000040.1 GCA938034675_00915 gene open 13399-14298 map
1857 CALHML010000040.1 GCA938034675_00916 gene open 14361-15248
1858 CALHML010000040.1 GCA938034675_00917 gene open 15396-16730 glnA
1859 CALHML010000040.1 GCA938034675_00918 gene open 16751-17848
1860 CALHML010000040.1 GCA938034675_00919 gene open 17885-18619
1861 CALHML010000040.1 GCA938034675_00920 gene open 18721-20049 gntR
1862 CALHML010000040.1 GCA938034675_00921 gene open 20111-21283
1863 CALHML010000040.1 GCA938034675_00922 gene open 23146-24579
1864 CALHML010000040.1 GCA938034675_00923 gene open 24576-25550
1865 CALHML010000040.1 GCA938034675_00924 gene open 25892-27271
1866 CALHML010000040.1 GCA938034675_00925 gene open 27714-30680
1867 CALHML010000040.1 GCA938034675_00926 gene open 30677-31552
1868 CALHML010000040.1 GCA938034675_00927 gene open 31634-32185
1869 CALHML010000040.1 GCA938034675_00928 gene open 32190-32717
1870 CALHML010000040.1 GCA938034675_00929 gene open 32872-33270
1871 CALHML010000040.1 GCA938034675_00930 gene open 33463-34884 glnA
1872 CALHML010000040.1 GCA938034675_00931 gene open 35083-36498
1873 CALHML010000040.1 GCA938034675_00932 gene open 36508-37452
1874 CALHML010000040.1 GCA938034675_00933 gene open 37465-38370
1875 CALHML010000040.1 GCA938034675_00934 gene open 38367-39443
1876 CALHML010000041.1 GCA938034675_00935 CDS open 121-759 _na     212_aa hypothetical protein
1877 CALHML010000041.1 GCA938034675_00936 CDS open 745-888 _na     47_aa hypothetical protein
1878 CALHML010000041.1 GCA938034675_00937 CDS open 919-1980 _na     353_aa IS630 family transposase
1879 CALHML010000041.1 GCA938034675_00935 gene open 121-759
1880 CALHML010000041.1 GCA938034675_00936 gene open 745-888
1881 CALHML010000041.1 GCA938034675_00937 gene open 919-1980
1882 CALHML010000042.1 GCA938034675_00938 CDS open 409-1320 _na     303_aa ABC transporter%2C ATP-binding protein
1883 CALHML010000042.1 GCA938034675_00939 CDS open 1317-2171 _na     284_aa Transport permease protein
1884 CALHML010000042.1 GCA938034675_00938 gene open 409-1320
1885 CALHML010000042.1 GCA938034675_00939 gene open 1317-2171
1886 CALHML010000043.1 GCA938034675_00940 CDS open 54-695 _na     213_aa ATP-dependent helicase Lhr
1887 CALHML010000043.1 GCA938034675_00941 CDS open 793-1095 _na     100_aa DNA-binding helix-turn-helix protein
1888 CALHML010000043.1 GCA938034675_00942 CDS open 1243-1737 _na     164_aa cinA Competence/damage-inducible protein CinA
1889 CALHML010000043.1 GCA938034675_00943 CDS open 1750-2388 _na     212_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1890 CALHML010000043.1 GCA938034675_00944 CDS open 2375-3868 _na     497_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
1891 CALHML010000043.1 GCA938034675_00945 CDS open 3922-5430 _na     502_aa ftsK DNA translocase FtsK
1892 CALHML010000043.1 GCA938034675_00940 gene open 54-695
1893 CALHML010000043.1 GCA938034675_00941 gene open 793-1095
1894 CALHML010000043.1 GCA938034675_00942 gene open 1243-1737 cinA
1895 CALHML010000043.1 GCA938034675_00943 gene open 1750-2388 pgsA
1896 CALHML010000043.1 GCA938034675_00944 gene open 2375-3868 rimO
1897 CALHML010000043.1 GCA938034675_00945 gene open 3922-5430 ftsK
1898 CALHML010000044.1 GCA938034675_00946 CDS open 60-539 _na     159_aa Branched-chain amino acid ABC transporter%2C permease protein
1899 CALHML010000044.1 GCA938034675_00947 CDS open 560-2644 _na     694_aa Beta-galactosidase
1900 CALHML010000044.1 GCA938034675_00948 CDS open 2657-3430 _na     257_aa hypothetical protein
1901 CALHML010000044.1 GCA938034675_00949 CDS open 3603-5528 _na     641_aa malQ 4-alpha-glucanotransferase
1902 CALHML010000044.1 GCA938034675_00950 CDS open 5798-7621 _na     607_aa HSP90 family protein
1903 CALHML010000044.1 GCA938034675_00951 CDS open 7611-8621 _na     336_aa hypothetical protein
1904 CALHML010000044.1 GCA938034675_00952 CDS open 8618-11548 _na     976_aa Tetratricopeptide repeat protein
1905 CALHML010000044.1 GCA938034675_00953 CDS open 11866-12108 _na     80_aa hypothetical protein
1906 CALHML010000044.1 GCA938034675_00954 CDS open 12186-13262 _na     358_aa hypothetical protein
1907 CALHML010000044.1 GCA938034675_00955 CDS open 13160-14578 _na     472_aa hypothetical protein
1908 CALHML010000044.1 GCA938034675_00956 CDS open 14652-14930 _na     92_aa Acylphosphatase
1909 CALHML010000044.1 GCA938034675_00957 CDS open 15129-15863 _na     244_aa DNA-binding helix-turn-helix protein
1910 CALHML010000044.1 GCA938034675_00958 CDS open 15968-17548 _na     526_aa Major facilitator superfamily (MFS) profile domain-containing protein
1911 CALHML010000044.1 GCA938034675_00959 CDS open 17472-18701 _na     409_aa Putative 4-hydroxybutyrate coenzyme A transferase
1912 CALHML010000044.1 GCA938034675_00960 CDS open 18878-19015 _na     45_aa hypothetical protein
1913 CALHML010000044.1 GCA938034675_00961 CDS open 19051-19824 _na     257_aa cysE serine O-acetyltransferase
1914 CALHML010000044.1 GCA938034675_00962 CDS open 19854-20402 _na     182_aa Putative general stress protein 14
1915 CALHML010000044.1 GCA938034675_00963 CDS open 20723-22081 _na     452_aa dnaB replicative DNA helicase
1916 CALHML010000044.1 GCA938034675_00964 CDS open 22728-23132 _na     134_aa Metal-sensitive transcriptional repressor
1917 CALHML010000044.1 GCA938034675_00965 CDS open 23216-23431 _na     71_aa Heavy metal-associated domain protein
1918 CALHML010000044.1 GCA938034675_00966 CDS open 23477-25735 _na     752_aa E1-E2 ATPase
1919 CALHML010000044.1 GCA938034675_00967 CDS open 25820-26506 _na     228_aa Response regulator receiver domain protein
1920 CALHML010000044.1 GCA938034675_00968 CDS open 26759-27661 _na     300_aa bcrA Putative bacitracin ABC transporter%2C ATP-binding protein BcrA
1921 CALHML010000044.1 GCA938034675_00969 CDS open 27663-28487 _na     274_aa ABC-2 family transporter protein
1922 CALHML010000044.1 GCA938034675_00970 CDS open 28500-29426 _na     308_aa histidine kinase
1923 CALHML010000044.1 GCA938034675_00971 CDS open 29408-29752 _na     114_aa Cupin domain protein
1924 CALHML010000044.1 GCA938034675_00972 CDS open 29933-30658 _na     241_aa ADP-ribosylglycohydrolase
1925 CALHML010000044.1 GCA938034675_00973 CDS open 31017-31382 _na     121_aa hypothetical protein
1926 CALHML010000044.1 GCA938034675_00974 CDS open 31497-31910 _na     137_aa hypothetical protein
1927 CALHML010000044.1 GCA938034675_00975 CDS open 32460-32834 _na     124_aa Peptidyl-prolyl cis-trans isomerase
1928 CALHML010000044.1 GCA938034675_00976 CDS open 33173-34096 _na     307_aa hypothetical protein
1929 CALHML010000044.1 GCA938034675_00977 CDS open 34122-34265 _na     47_aa hypothetical protein
1930 CALHML010000044.1 GCA938034675_00946 gene open 60-539
1931 CALHML010000044.1 GCA938034675_00947 gene open 560-2644
1932 CALHML010000044.1 GCA938034675_00948 gene open 2657-3430
1933 CALHML010000044.1 GCA938034675_00949 gene open 3603-5528 malQ
1934 CALHML010000044.1 GCA938034675_00950 gene open 5798-7621
1935 CALHML010000044.1 GCA938034675_00951 gene open 7611-8621
1936 CALHML010000044.1 GCA938034675_00952 gene open 8618-11548
1937 CALHML010000044.1 GCA938034675_00953 gene open 11866-12108
1938 CALHML010000044.1 GCA938034675_00954 gene open 12186-13262
1939 CALHML010000044.1 GCA938034675_00955 gene open 13160-14578
1940 CALHML010000044.1 GCA938034675_00956 gene open 14652-14930
1941 CALHML010000044.1 GCA938034675_00957 gene open 15129-15863
1942 CALHML010000044.1 GCA938034675_00958 gene open 15968-17548
1943 CALHML010000044.1 GCA938034675_00959 gene open 17472-18701
1944 CALHML010000044.1 GCA938034675_00960 gene open 18878-19015
1945 CALHML010000044.1 GCA938034675_00961 gene open 19051-19824 cysE
1946 CALHML010000044.1 GCA938034675_00962 gene open 19854-20402
1947 CALHML010000044.1 GCA938034675_00963 gene open 20723-22081 dnaB
1948 CALHML010000044.1 GCA938034675_00964 gene open 22728-23132
1949 CALHML010000044.1 GCA938034675_00965 gene open 23216-23431
1950 CALHML010000044.1 GCA938034675_00966 gene open 23477-25735
1951 CALHML010000044.1 GCA938034675_00967 gene open 25820-26506
1952 CALHML010000044.1 GCA938034675_00968 gene open 26759-27661 bcrA
1953 CALHML010000044.1 GCA938034675_00969 gene open 27663-28487
1954 CALHML010000044.1 GCA938034675_00970 gene open 28500-29426
1955 CALHML010000044.1 GCA938034675_00971 gene open 29408-29752
1956 CALHML010000044.1 GCA938034675_00972 gene open 29933-30658
1957 CALHML010000044.1 GCA938034675_00973 gene open 31017-31382
1958 CALHML010000044.1 GCA938034675_00974 gene open 31497-31910
1959 CALHML010000044.1 GCA938034675_00975 gene open 32460-32834
1960 CALHML010000044.1 GCA938034675_00976 gene open 33173-34096
1961 CALHML010000044.1 GCA938034675_00977 gene open 34122-34265
1962 CALHML010000045.1 repeat_region open 13401-15758 CRISPR array with 33 repeats of length 36%2C consensus sequence ATCGCTTCCCCTTCTGGGGAAGCCCTTCATTGAGGC and spacer length 36
1963 CALHML010000045.1 repeat_region open 16149-16697 CRISPR array with 8 repeats of length 36%2C consensus sequence ATCGCTTCCCCTTCTGGGGAAGCCCTTCATTGAGGC and spacer length 35
1964 CALHML010000045.1 GCA938034675_00978 CDS open 103-942 _na     279_aa ABC transporter%2C permease protein
1965 CALHML010000045.1 GCA938034675_00979 CDS open 939-2162 _na     407_aa beta-fructofuranosidase
1966 CALHML010000045.1 GCA938034675_00980 CDS open 2169-3200 _na     343_aa Small molecule-binding regulator domain protein
1967 CALHML010000045.1 GCA938034675_00981 CDS open 3241-4890 _na     549_aa Mannitol dehydrogenase C-terminal domain protein
1968 CALHML010000045.1 GCA938034675_00982 CDS open 4939-6141 _na     400_aa type I-U CRISPR-associated protein Cas7
1969 CALHML010000045.1 GCA938034675_00983 CDS open 6143-7690 _na     515_aa csb2 type I-U CRISPR-associated protein Csb2
1970 CALHML010000045.1 GCA938034675_00984 CDS open 7687-10311 _na     874_aa cas3u type I-U CRISPR-associated helicase/endonuclease Cas3
1971 CALHML010000045.1 GCA938034675_00985 CDS open 10308-11327 _na     339_aa CRISPR-associated Csb3 family protein
1972 CALHML010000045.1 GCA938034675_00986 CDS open 11314-12921 _na     535_aa cas1 CRISPR-associated endonuclease Cas1
1973 CALHML010000045.1 GCA938034675_00987 CDS open 12918-13220 _na     100_aa cas2 CRISPR-associated endonuclease Cas2
1974 CALHML010000045.1 GCA938034675_00988 CDS open 16830-17411 _na     193_aa IS630 family transposase
1975 CALHML010000045.1 GCA938034675_00978 gene open 103-942
1976 CALHML010000045.1 GCA938034675_00979 gene open 939-2162
1977 CALHML010000045.1 GCA938034675_00980 gene open 2169-3200
1978 CALHML010000045.1 GCA938034675_00981 gene open 3241-4890
1979 CALHML010000045.1 GCA938034675_00982 gene open 4939-6141
1980 CALHML010000045.1 GCA938034675_00983 gene open 6143-7690 csb2
1981 CALHML010000045.1 GCA938034675_00984 gene open 7687-10311 cas3u
1982 CALHML010000045.1 GCA938034675_00985 gene open 10308-11327
1983 CALHML010000045.1 GCA938034675_00986 gene open 11314-12921 cas1
1984 CALHML010000045.1 GCA938034675_00987 gene open 12918-13220 cas2
1985 CALHML010000045.1 GCA938034675_00988 gene open 16830-17411
1986 CALHML010000046.1 regulatory_region open 22058-22116 msiK RNA
1987 CALHML010000046.1 GCA938034675_00989 CDS open 130-756 _na     208_aa thioesterase II family protein
1988 CALHML010000046.1 GCA938034675_00990 CDS open 744-2309 _na     521_aa AMP-binding enzyme
1989 CALHML010000046.1 GCA938034675_00991 CDS open 2473-3258 _na     261_aa drrB ABC transporter%2C permease protein%2C DrrB family
1990 CALHML010000046.1 GCA938034675_00992 CDS open 3255-4055 _na     266_aa Transport permease protein
1991 CALHML010000046.1 GCA938034675_00993 CDS open 4052-5086 _na     344_aa ABC transporter%2C ATP-binding protein
1992 CALHML010000046.1 GCA938034675_00994 CDS open 5113-6708 _na     531_aa AMP-binding enzyme
1993 CALHML010000046.1 GCA938034675_00995 CDS open 6705-8666 _na     653_aa Putative (2%2C3-dihydroxybenzoyl)adenylate synthase
1994 CALHML010000046.1 GCA938034675_00996 CDS open 8793-10082 _na     429_aa Transporter%2C major facilitator family protein
1995 CALHML010000046.1 GCA938034675_00997 CDS open 10329-10985 _na     218_aa Cobalt transport protein
1996 CALHML010000046.1 GCA938034675_00998 CDS open 10987-12453 _na     488_aa ccmA heme ABC exporter ATP-binding protein CcmA
1997 CALHML010000046.1 GCA938034675_00999 CDS open 12471-13115 _na     214_aa TIGR02185 family protein
1998 CALHML010000046.1 GCA938034675_01000 CDS open 13156-14934 _na     592_aa ABC transporter%2C ATP-binding protein
1999 CALHML010000046.1 GCA938034675_01001 CDS open 14927-16666 _na     579_aa ABC transporter%2C ATP-binding protein
2000 CALHML010000046.1 GCA938034675_01002 CDS open 16776-17963 _na     395_aa Amidohydrolase