BAKTAGenome Explorer: Leptotrichia sp. HMT-417 (GCA_938041155.1)
Select a Genome:
|
BAKTA Annotations for GCA_938041155.1
|
Search & Sort all 4356 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CALHZS010000001.1 | GCA938041155_00001 | CDS | open | 42-209 | _na 55_aa | hypothetical protein | |
| 2 | CALHZS010000001.1 | GCA938041155_00002 | CDS | open | 458-2284 | _na 608_aa | Cell wall-binding repeat protein | |
| 3 | CALHZS010000001.1 | GCA938041155_00003 | CDS | open | 2339-5536 | _na 1065_aa | DKNYY domain-containing protein | |
| 4 | CALHZS010000001.1 | GCA938041155_00004 | CDS | open | 5631-6602 | _na 323_aa | DUF1963 domain-containing protein | |
| 5 | CALHZS010000001.1 | GCA938041155_00005 | CDS | open | 6728-6910 | _na 60_aa | dnaK | DnaK family protein |
| 6 | CALHZS010000001.1 | GCA938041155_00006 | CDS | open | 6950-7171 | _na 73_aa | hypothetical protein | |
| 7 | CALHZS010000001.1 | GCA938041155_00007 | CDS | open | 7240-8313 | _na 357_aa | DKNYY family protein | |
| 8 | CALHZS010000001.1 | GCA938041155_00008 | CDS | open | 8400-10214 | _na 604_aa | dnaK | DnaK family protein |
| 9 | CALHZS010000001.1 | GCA938041155_00009 | CDS | open | 10385-11695 | _na 436_aa | dnaJ | DnaJ domain protein |
| 10 | CALHZS010000001.1 | GCA938041155_00010 | CDS | open | 11715-13109 | _na 464_aa | Curved DNA-binding protein | |
| 11 | CALHZS010000001.1 | GCA938041155_00011 | CDS | open | 13179-13841 | _na 220_aa | Sakacin A production response regulator | |
| 12 | CALHZS010000001.1 | GCA938041155_00012 | CDS | open | 14185-14730 | _na 181_aa | gspO | Prepilin-type cleavage/methylation protein |
| 13 | CALHZS010000001.1 | GCA938041155_00013 | CDS | open | 14732-16375 | _na 547_aa | ComEC/Rec2-like protein | |
| 14 | CALHZS010000001.1 | GCA938041155_00014 | CDS | open | 16481-16816 | _na 111_aa | phnA | Alkylphosphonate utilization operon protein PhnA |
| 15 | CALHZS010000001.1 | GCA938041155_00015 | CDS | open | 16837-17718 | _na 293_aa | era | GTPase Era |
| 16 | CALHZS010000001.1 | GCA938041155_00016 | CDS | open | 18009-19982 | _na 657_aa | uvrB | excinuclease ABC subunit UvrB |
| 17 | CALHZS010000001.1 | GCA938041155_00017 | CDS | open | 20060-20491 | _na 143_aa | hypothetical protein | |
| 18 | CALHZS010000001.1 | GCA938041155_00018 | CDS | open | 20574-20927 | _na 117_aa | arsC | ArsC family protein |
| 19 | CALHZS010000001.1 | GCA938041155_00019 | CDS | open | 21141-21491 | _na 116_aa | rplS | 50S ribosomal protein L19 |
| 20 | CALHZS010000001.1 | GCA938041155_00020 | CDS | open | 21733-23409 | _na 558_aa | lepB | signal peptidase I |
| 21 | CALHZS010000001.1 | GCA938041155_00021 | CDS | open | 23509-24087 | _na 192_aa | N-acetyltransferase GCN5 | |
| 22 | CALHZS010000001.1 | GCA938041155_00022 | CDS | open | 24121-27657 | _na 1178_aa | Non-specific serine/threonine protein kinase | |
| 23 | CALHZS010000001.1 | GCA938041155_00001 | gene | open | 42-209 | |||
| 24 | CALHZS010000001.1 | GCA938041155_00002 | gene | open | 458-2284 | |||
| 25 | CALHZS010000001.1 | GCA938041155_00003 | gene | open | 2339-5536 | |||
| 26 | CALHZS010000001.1 | GCA938041155_00004 | gene | open | 5631-6602 | |||
| 27 | CALHZS010000001.1 | GCA938041155_00005 | gene | open | 6728-6910 | dnaK | ||
| 28 | CALHZS010000001.1 | GCA938041155_00006 | gene | open | 6950-7171 | |||
| 29 | CALHZS010000001.1 | GCA938041155_00007 | gene | open | 7240-8313 | |||
| 30 | CALHZS010000001.1 | GCA938041155_00008 | gene | open | 8400-10214 | dnaK | ||
| 31 | CALHZS010000001.1 | GCA938041155_00009 | gene | open | 10385-11695 | dnaJ | ||
| 32 | CALHZS010000001.1 | GCA938041155_00010 | gene | open | 11715-13109 | |||
| 33 | CALHZS010000001.1 | GCA938041155_00011 | gene | open | 13179-13841 | |||
| 34 | CALHZS010000001.1 | GCA938041155_00012 | gene | open | 14185-14730 | gspO | ||
| 35 | CALHZS010000001.1 | GCA938041155_00013 | gene | open | 14732-16375 | |||
| 36 | CALHZS010000001.1 | GCA938041155_00014 | gene | open | 16481-16816 | phnA | ||
| 37 | CALHZS010000001.1 | GCA938041155_00015 | gene | open | 16837-17718 | era | ||
| 38 | CALHZS010000001.1 | GCA938041155_00016 | gene | open | 18009-19982 | uvrB | ||
| 39 | CALHZS010000001.1 | GCA938041155_00017 | gene | open | 20060-20491 | |||
| 40 | CALHZS010000001.1 | GCA938041155_00018 | gene | open | 20574-20927 | arsC | ||
| 41 | CALHZS010000001.1 | GCA938041155_00019 | gene | open | 21141-21491 | rplS | ||
| 42 | CALHZS010000001.1 | GCA938041155_00020 | gene | open | 21733-23409 | lepB | ||
| 43 | CALHZS010000001.1 | GCA938041155_00021 | gene | open | 23509-24087 | |||
| 44 | CALHZS010000001.1 | GCA938041155_00022 | gene | open | 24121-27657 | |||
| 45 | CALHZS010000002.1 | GCA938041155_00023 | CDS | open | 389-907 | _na 172_aa | D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase | |
| 46 | CALHZS010000002.1 | GCA938041155_00024 | CDS | open | 934-1386 | _na 150_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 47 | CALHZS010000002.1 | GCA938041155_00025 | CDS | open | 1509-2273 | _na 254_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 48 | CALHZS010000002.1 | GCA938041155_00026 | CDS | open | 2267-3526 | _na 419_aa | ftsY | signal recognition particle-docking protein FtsY |
| 49 | CALHZS010000002.1 | GCA938041155_00027 | CDS | open | 3471-4559 | _na 362_aa | pta | phosphate acetyltransferase |
| 50 | CALHZS010000002.1 | GCA938041155_00028 | CDS | open | 4706-5902 | _na 398_aa | ackA | Acetate kinase |
| 51 | CALHZS010000002.1 | GCA938041155_00029 | CDS | open | 6102-6524 | _na 140_aa | norV | flavodoxin |
| 52 | CALHZS010000002.1 | GCA938041155_00030 | CDS | open | 6621-7217 | _na 198_aa | DUF445 domain-containing protein | |
| 53 | CALHZS010000002.1 | GCA938041155_00031 | CDS | open | 7279-8289 | _na 336_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 54 | CALHZS010000002.1 | GCA938041155_00032 | CDS | open | 8524-9237 | _na 237_aa | rsmE | Ribosomal RNA small subunit methyltransferase E |
| 55 | CALHZS010000002.1 | GCA938041155_00033 | CDS | open | 9545-9895 | _na 116_aa | rsfS | ribosome silencing factor |
| 56 | CALHZS010000002.1 | GCA938041155_00034 | CDS | open | 9920-11896 | _na 658_aa | mrdA | penicillin-binding protein 2 |
| 57 | CALHZS010000002.1 | GCA938041155_00035 | CDS | open | 11918-13789 | _na 623_aa | rnjA | Ribonuclease J |
| 58 | CALHZS010000002.1 | GCA938041155_00036 | CDS | open | 13791-14126 | _na 111_aa | yhbY | ribosome assembly RNA-binding protein YhbY |
| 59 | CALHZS010000002.1 | GCA938041155_00037 | CDS | open | 14151-14612 | _na 153_aa | Acid phosphatase/vanadium-dependenthaloperoxidase-like protein | |
| 60 | CALHZS010000002.1 | GCA938041155_00038 | CDS | open | 14818-15477 | _na 219_aa | hisM | ABC transmembrane type-1 domain-containing protein |
| 61 | CALHZS010000002.1 | GCA938041155_00039 | CDS | open | 15458-16135 | _na 225_aa | hisM | ABC transmembrane type-1 domain-containing protein |
| 62 | CALHZS010000002.1 | GCA938041155_00040 | CDS | open | 16163-16945 | _na 260_aa | glnQ | ABC transporter domain-containing protein |
| 63 | CALHZS010000002.1 | GCA938041155_00041 | CDS | open | 17002-17850 | _na 282_aa | hisJ | Solute-binding protein family 3/N-terminal domain-containing protein |
| 64 | CALHZS010000002.1 | GCA938041155_00042 | CDS | open | 18395-20464 | _na 689_aa | recG | ATP-dependent DNA helicase RecG |
| 65 | CALHZS010000002.1 | GCA938041155_00043 | CDS | open | 20491-21375 | _na 294_aa | rhaT | EamA domain-containing protein |
| 66 | CALHZS010000002.1 | GCA938041155_00044 | CDS | open | 21446-21991 | _na 181_aa | def | peptide deformylase |
| 67 | CALHZS010000002.1 | GCA938041155_00045 | CDS | open | 22057-23007 | _na 316_aa | fmt | methionyl-tRNA formyltransferase |
| 68 | CALHZS010000002.1 | GCA938041155_00046 | CDS | open | 23123-23776 | _na 217_aa | redox-sensing transcriptional repressor Rex | |
| 69 | CALHZS010000002.1 | GCA938041155_00047 | CDS | open | 23873-24730 | _na 285_aa | folD | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD |
| 70 | CALHZS010000002.1 | GCA938041155_00048 | CDS | open | 24752-25231 | _na 159_aa | accB | acetyl-CoA carboxylase biotin carboxyl carrier protein |
| 71 | CALHZS010000002.1 | GCA938041155_00049 | CDS | open | 25271-26584 | _na 437_aa | CBS domain-containing protein | |
| 72 | CALHZS010000002.1 | GCA938041155_00050 | CDS | open | 26571-27023 | _na 150_aa | NUDIX hydrolase | |
| 73 | CALHZS010000002.1 | GCA938041155_00051 | CDS | open | 27072-27602 | _na 176_aa | adenine phosphoribosyltransferase | |
| 74 | CALHZS010000002.1 | GCA938041155_00023 | gene | open | 389-907 | |||
| 75 | CALHZS010000002.1 | GCA938041155_00024 | gene | open | 934-1386 | tsaE | ||
| 76 | CALHZS010000002.1 | GCA938041155_00025 | gene | open | 1509-2273 | tsaB | ||
| 77 | CALHZS010000002.1 | GCA938041155_00026 | gene | open | 2267-3526 | ftsY | ||
| 78 | CALHZS010000002.1 | GCA938041155_00027 | gene | open | 3471-4559 | pta | ||
| 79 | CALHZS010000002.1 | GCA938041155_00028 | gene | open | 4706-5902 | ackA | ||
| 80 | CALHZS010000002.1 | GCA938041155_00029 | gene | open | 6102-6524 | norV | ||
| 81 | CALHZS010000002.1 | GCA938041155_00030 | gene | open | 6621-7217 | |||
| 82 | CALHZS010000002.1 | GCA938041155_00031 | gene | open | 7279-8289 | ruvB | ||
| 83 | CALHZS010000002.1 | GCA938041155_00032 | gene | open | 8524-9237 | rsmE | ||
| 84 | CALHZS010000002.1 | GCA938041155_00033 | gene | open | 9545-9895 | rsfS | ||
| 85 | CALHZS010000002.1 | GCA938041155_00034 | gene | open | 9920-11896 | mrdA | ||
| 86 | CALHZS010000002.1 | GCA938041155_00035 | gene | open | 11918-13789 | rnjA | ||
| 87 | CALHZS010000002.1 | GCA938041155_00036 | gene | open | 13791-14126 | yhbY | ||
| 88 | CALHZS010000002.1 | GCA938041155_00037 | gene | open | 14151-14612 | |||
| 89 | CALHZS010000002.1 | GCA938041155_00038 | gene | open | 14818-15477 | hisM | ||
| 90 | CALHZS010000002.1 | GCA938041155_00039 | gene | open | 15458-16135 | hisM | ||
| 91 | CALHZS010000002.1 | GCA938041155_00040 | gene | open | 16163-16945 | glnQ | ||
| 92 | CALHZS010000002.1 | GCA938041155_00041 | gene | open | 17002-17850 | hisJ | ||
| 93 | CALHZS010000002.1 | GCA938041155_00042 | gene | open | 18395-20464 | recG | ||
| 94 | CALHZS010000002.1 | GCA938041155_00043 | gene | open | 20491-21375 | rhaT | ||
| 95 | CALHZS010000002.1 | GCA938041155_00044 | gene | open | 21446-21991 | def | ||
| 96 | CALHZS010000002.1 | GCA938041155_00045 | gene | open | 22057-23007 | fmt | ||
| 97 | CALHZS010000002.1 | GCA938041155_00046 | gene | open | 23123-23776 | |||
| 98 | CALHZS010000002.1 | GCA938041155_00047 | gene | open | 23873-24730 | folD | ||
| 99 | CALHZS010000002.1 | GCA938041155_00048 | gene | open | 24752-25231 | accB | ||
| 100 | CALHZS010000002.1 | GCA938041155_00049 | gene | open | 25271-26584 | |||
| 101 | CALHZS010000002.1 | GCA938041155_00050 | gene | open | 26571-27023 | |||
| 102 | CALHZS010000002.1 | GCA938041155_00051 | gene | open | 27072-27602 | |||
| 103 | CALHZS010000003.1 | GCA938041155_00052 | CDS | open | 260-1216 | _na 318_aa | replication initiation protein | |
| 104 | CALHZS010000003.1 | GCA938041155_00053 | CDS | open | 1897-2790 | _na 297_aa | Fic/DOC family protein | |
| 105 | CALHZS010000003.1 | GCA938041155_00054 | CDS | open | 3699-5684 | _na 661_aa | plasmid recombination protein | |
| 106 | CALHZS010000003.1 | GCA938041155_00055 | CDS | open | 5826-6080 | _na 84_aa | RelB/DinJ family addiction module antitoxin | |
| 107 | CALHZS010000003.1 | GCA938041155_00056 | CDS | open | 6073-6336 | _na 87_aa | Txe/YoeB family addiction module toxin | |
| 108 | CALHZS010000003.1 | GCA938041155_00057 | CDS | open | 6460-7500 | _na 346_aa | replication initiation protein | |
| 109 | CALHZS010000003.1 | GCA938041155_00058 | CDS | open | 8314-8976 | _na 220_aa | hypothetical protein | |
| 110 | CALHZS010000003.1 | GCA938041155_00052 | gene | open | 260-1216 | |||
| 111 | CALHZS010000003.1 | GCA938041155_00053 | gene | open | 1897-2790 | |||
| 112 | CALHZS010000003.1 | GCA938041155_00054 | gene | open | 3699-5684 | |||
| 113 | CALHZS010000003.1 | GCA938041155_00055 | gene | open | 5826-6080 | |||
| 114 | CALHZS010000003.1 | GCA938041155_00056 | gene | open | 6073-6336 | |||
| 115 | CALHZS010000003.1 | GCA938041155_00057 | gene | open | 6460-7500 | |||
| 116 | CALHZS010000003.1 | GCA938041155_00058 | gene | open | 8314-8976 | |||
| 117 | CALHZS010000004.1 | GCA938041155_00062 | CDS | open | 459-2627 | _na 722_aa | RNA binding S1 domain-containing protein | |
| 118 | CALHZS010000004.1 | GCA938041155_00063 | CDS | open | 3042-4604 | _na 520_aa | L-lactate permease | |
| 119 | CALHZS010000004.1 | GCA938041155_00064 | CDS | open | 4863-7652 | _na 929_aa | ileS | isoleucine--tRNA ligase |
| 120 | CALHZS010000004.1 | GCA938041155_00065 | CDS | open | 7756-8223 | _na 155_aa | lspA | signal peptidase II |
| 121 | CALHZS010000004.1 | GCA938041155_00066 | CDS | open | 8225-8959 | _na 244_aa | hypothetical protein | |
| 122 | CALHZS010000004.1 | GCA938041155_00067 | CDS | open | 8960-9835 | _na 291_aa | glyQ | glycine--tRNA ligase subunit alpha |
| 123 | CALHZS010000004.1 | GCA938041155_00068 | CDS | open | 9879-11111 | _na 410_aa | ATP-binding protein | |
| 124 | CALHZS010000004.1 | GCA938041155_00069 | CDS | open | 11101-11631 | _na 176_aa | NERD domain-containing protein | |
| 125 | CALHZS010000004.1 | GCA938041155_00070 | CDS | open | 11649-13715 | _na 688_aa | glyS | Glycine--tRNA ligase beta subunit |
| 126 | CALHZS010000004.1 | GCA938041155_00071 | CDS | open | 14151-15251 | _na 366_aa | OmpA/MotB domain-containing protein | |
| 127 | CALHZS010000004.1 | GCA938041155_00072 | CDS | open | 15687-16124 | _na 145_aa | CGGC domain protein | |
| 128 | CALHZS010000004.1 | GCA938041155_00073 | CDS | open | 16090-16467 | _na 125_aa | HPr family phosphocarrier protein | |
| 129 | CALHZS010000004.1 | GCA938041155_00074 | CDS | open | 16520-18322 | _na 600_aa | yugI | S1 domain-containing post-transcriptional regulator GSP13 |
| 130 | CALHZS010000004.1 | GCA938041155_00062 | gene | open | 459-2627 | |||
| 131 | CALHZS010000004.1 | GCA938041155_00063 | gene | open | 3042-4604 | |||
| 132 | CALHZS010000004.1 | GCA938041155_00064 | gene | open | 4863-7652 | ileS | ||
| 133 | CALHZS010000004.1 | GCA938041155_00065 | gene | open | 7756-8223 | lspA | ||
| 134 | CALHZS010000004.1 | GCA938041155_00066 | gene | open | 8225-8959 | |||
| 135 | CALHZS010000004.1 | GCA938041155_00067 | gene | open | 8960-9835 | glyQ | ||
| 136 | CALHZS010000004.1 | GCA938041155_00068 | gene | open | 9879-11111 | |||
| 137 | CALHZS010000004.1 | GCA938041155_00069 | gene | open | 11101-11631 | |||
| 138 | CALHZS010000004.1 | GCA938041155_00070 | gene | open | 11649-13715 | glyS | ||
| 139 | CALHZS010000004.1 | GCA938041155_00071 | gene | open | 14151-15251 | |||
| 140 | CALHZS010000004.1 | GCA938041155_00072 | gene | open | 15687-16124 | |||
| 141 | CALHZS010000004.1 | GCA938041155_00073 | gene | open | 16090-16467 | |||
| 142 | CALHZS010000004.1 | GCA938041155_00074 | gene | open | 16520-18322 | yugI | ||
| 143 | CALHZS010000004.1 | GCA938041155_00059 | gene | open | 5-80 | trnH | ||
| 144 | CALHZS010000004.1 | GCA938041155_00060 | gene | open | 87-162 | trnK | ||
| 145 | CALHZS010000004.1 | GCA938041155_00061 | gene | open | 185-268 | trnL | ||
| 146 | CALHZS010000004.1 | GCA938041155_00059 | tRNA | open | 5-80 | trnH | tRNA-His(gtg) | |
| 147 | CALHZS010000004.1 | GCA938041155_00060 | tRNA | open | 87-162 | trnK | tRNA-Lys(ttt) | |
| 148 | CALHZS010000004.1 | GCA938041155_00061 | tRNA | open | 185-268 | trnL | tRNA-Leu(tag) | |
| 149 | CALHZS010000005.1 | regulatory_region | open | 9161-9337 | glmS glucosamine-6-phosphate activated ribozyme aptamer | |||
| 150 | CALHZS010000005.1 | repeat_region | open | 11711-11981 | CRISPR array with 4 repeats of length 36%2C consensus sequence GTTAAAGTAGAGTATCCATTAAAATAAGGATTGAAA and spacer length 39 | |||
| 151 | CALHZS010000005.1 | GCA938041155_00075 | CDS | open | 122-655 | _na 177_aa | rplF | 50S ribosomal protein L6 |
| 152 | CALHZS010000005.1 | GCA938041155_00076 | CDS | open | 669-1031 | _na 120_aa | rplR | 50S ribosomal protein L18 |
| 153 | CALHZS010000005.1 | GCA938041155_00077 | CDS | open | 1050-1559 | _na 169_aa | rpsE | 30S ribosomal protein S5 |
| 154 | CALHZS010000005.1 | GCA938041155_00078 | CDS | open | 1580-1759 | _na 59_aa | rpmD | 50S ribosomal protein L30 |
| 155 | CALHZS010000005.1 | GCA938041155_00079 | CDS | open | 1766-2380 | _na 204_aa | rplO | 50S ribosomal protein L15 |
| 156 | CALHZS010000005.1 | GCA938041155_00080 | CDS | open | 2427-3734 | _na 435_aa | secY | preprotein translocase subunit SecY |
| 157 | CALHZS010000005.1 | GCA938041155_00081 | CDS | open | 3827-4633 | _na 268_aa | phnE | Putative phosphonate ABC transporter%2C permease protein PhnE |
| 158 | CALHZS010000005.1 | GCA938041155_00082 | CDS | open | 4708-5502 | _na 264_aa | phnE | Putative phosphonate ABC transporter%2C permease protein PhnE |
| 159 | CALHZS010000005.1 | GCA938041155_00083 | CDS | open | 5515-6264 | _na 249_aa | phnC | phosphonate ABC transporter ATP-binding protein |
| 160 | CALHZS010000005.1 | GCA938041155_00084 | CDS | open | 6361-7926 | _na 521_aa | hypothetical protein | |
| 161 | CALHZS010000005.1 | GCA938041155_00085 | CDS | open | 8089-8973 | _na 294_aa | peptidylprolyl isomerase | |
| 162 | CALHZS010000005.1 | GCA938041155_00086 | CDS | open | 9371-11200 | _na 609_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 163 | CALHZS010000005.1 | GCA938041155_00087 | CDS | open | 11250-11561 | _na 103_aa | Late embryogenesis abundant protein domain-containing protein | |
| 164 | CALHZS010000005.1 | GCA938041155_00088 | CDS | open | 12181-12945 | _na 254_aa | Peptidase%2C M50 family | |
| 165 | CALHZS010000005.1 | GCA938041155_00089 | CDS | open | 13059-13940 | _na 293_aa | Type I restriction-modificationenzyme 1%2C R subunit | |
| 166 | CALHZS010000005.1 | GCA938041155_00090 | CDS | open | 14038-15207 | _na 389_aa | TPR repeat-containing protein | |
| 167 | CALHZS010000005.1 | GCA938041155_00091 | CDS | open | 15322-15699 | _na 125_aa | Integral membrane protein | |
| 168 | CALHZS010000005.1 | GCA938041155_00092 | CDS | open | 15731-16504 | _na 257_aa | map | type I methionyl aminopeptidase |
| 169 | CALHZS010000005.1 | GCA938041155_00093 | CDS | open | 16580-17209 | _na 209_aa | adk | adenylate kinase |
| 170 | CALHZS010000005.1 | GCA938041155_00094 | CDS | open | 17511-17768 | _na 85_aa | hypothetical protein | |
| 171 | CALHZS010000005.1 | GCA938041155_00095 | CDS | open | 17989-19779 | _na 596_aa | nadN | NAD nucleotidase |
| 172 | CALHZS010000005.1 | GCA938041155_00075 | gene | open | 122-655 | rplF | ||
| 173 | CALHZS010000005.1 | GCA938041155_00076 | gene | open | 669-1031 | rplR | ||
| 174 | CALHZS010000005.1 | GCA938041155_00077 | gene | open | 1050-1559 | rpsE | ||
| 175 | CALHZS010000005.1 | GCA938041155_00078 | gene | open | 1580-1759 | rpmD | ||
| 176 | CALHZS010000005.1 | GCA938041155_00079 | gene | open | 1766-2380 | rplO | ||
| 177 | CALHZS010000005.1 | GCA938041155_00080 | gene | open | 2427-3734 | secY | ||
| 178 | CALHZS010000005.1 | GCA938041155_00081 | gene | open | 3827-4633 | phnE | ||
| 179 | CALHZS010000005.1 | GCA938041155_00082 | gene | open | 4708-5502 | phnE | ||
| 180 | CALHZS010000005.1 | GCA938041155_00083 | gene | open | 5515-6264 | phnC | ||
| 181 | CALHZS010000005.1 | GCA938041155_00084 | gene | open | 6361-7926 | |||
| 182 | CALHZS010000005.1 | GCA938041155_00085 | gene | open | 8089-8973 | |||
| 183 | CALHZS010000005.1 | GCA938041155_00086 | gene | open | 9371-11200 | glmS | ||
| 184 | CALHZS010000005.1 | GCA938041155_00087 | gene | open | 11250-11561 | |||
| 185 | CALHZS010000005.1 | GCA938041155_00088 | gene | open | 12181-12945 | |||
| 186 | CALHZS010000005.1 | GCA938041155_00089 | gene | open | 13059-13940 | |||
| 187 | CALHZS010000005.1 | GCA938041155_00090 | gene | open | 14038-15207 | |||
| 188 | CALHZS010000005.1 | GCA938041155_00091 | gene | open | 15322-15699 | |||
| 189 | CALHZS010000005.1 | GCA938041155_00092 | gene | open | 15731-16504 | map | ||
| 190 | CALHZS010000005.1 | GCA938041155_00093 | gene | open | 16580-17209 | adk | ||
| 191 | CALHZS010000005.1 | GCA938041155_00094 | gene | open | 17511-17768 | |||
| 192 | CALHZS010000005.1 | GCA938041155_00095 | gene | open | 17989-19779 | nadN | ||
| 193 | CALHZS010000006.1 | GCA938041155_00096 | CDS | open | 76-1182 | _na 368_aa | cbiD | cobalt-precorrin-5B (C(1))-methyltransferase CbiD |
| 194 | CALHZS010000006.1 | GCA938041155_00097 | CDS | open | 1242-1880 | _na 212_aa | cbiE | Precorrin-6y C5%2C15-methyltransferase (Decarboxylating) subunit CbiE |
| 195 | CALHZS010000006.1 | GCA938041155_00098 | CDS | open | 1947-2513 | _na 188_aa | cbiT | Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating) subunit CbiT |
| 196 | CALHZS010000006.1 | GCA938041155_00099 | CDS | open | 2841-3212 | _na 123_aa | Uroporphyrin-III C-methyltransferase | |
| 197 | CALHZS010000006.1 | GCA938041155_00100 | CDS | open | 3337-4062 | _na 241_aa | cobI | precorrin-2 C(20)-methyltransferase |
| 198 | CALHZS010000006.1 | GCA938041155_00101 | CDS | open | 4035-4898 | _na 287_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 199 | CALHZS010000006.1 | GCA938041155_00102 | CDS | open | 4945-5628 | _na 227_aa | GLPGLI family protein | |
| 200 | CALHZS010000006.1 | GCA938041155_00096 | gene | open | 76-1182 | cbiD | ||
| 201 | CALHZS010000006.1 | GCA938041155_00097 | gene | open | 1242-1880 | cbiE | ||
| 202 | CALHZS010000006.1 | GCA938041155_00098 | gene | open | 1947-2513 | cbiT | ||
| 203 | CALHZS010000006.1 | GCA938041155_00099 | gene | open | 2841-3212 | |||
| 204 | CALHZS010000006.1 | GCA938041155_00100 | gene | open | 3337-4062 | cobI | ||
| 205 | CALHZS010000006.1 | GCA938041155_00101 | gene | open | 4035-4898 | |||
| 206 | CALHZS010000006.1 | GCA938041155_00102 | gene | open | 4945-5628 | |||
| 207 | CALHZS010000007.1 | GCA938041155_00103 | CDS | open | 223-1797 | _na 524_aa | hypothetical protein | |
| 208 | CALHZS010000007.1 | GCA938041155_00104 | CDS | open | 1906-2595 | _na 229_aa | hypothetical protein | |
| 209 | CALHZS010000007.1 | GCA938041155_00103 | gene | open | 223-1797 | |||
| 210 | CALHZS010000007.1 | GCA938041155_00104 | gene | open | 1906-2595 | |||
| 211 | CALHZS010000008.1 | repeat_region | open | 10-503 | CRISPR array with 8 repeats of length 28%2C consensus sequence TTTACAATACAAAATGTTCCTATTAAAT and spacer length 37 | |||
| 212 | CALHZS010000008.1 | GCA938041155_00105 | CDS | open | 690-980 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 213 | CALHZS010000008.1 | GCA938041155_00106 | CDS | open | 971-1963 | _na 330_aa | cas1b | type I-B CRISPR-associated endonuclease Cas1b |
| 214 | CALHZS010000008.1 | GCA938041155_00107 | CDS | open | 2092-2580 | _na 162_aa | cas4 | CRISPR-associated protein Cas4 |
| 215 | CALHZS010000008.1 | GCA938041155_00108 | CDS | open | 2705-3226 | _na 173_aa | hypothetical protein | |
| 216 | CALHZS010000008.1 | GCA938041155_00109 | CDS | open | 3207-3491 | _na 94_aa | hypothetical protein | |
| 217 | CALHZS010000008.1 | GCA938041155_00110 | CDS | open | 3488-3889 | _na 133_aa | J domain-containing protein | |
| 218 | CALHZS010000008.1 | GCA938041155_00105 | gene | open | 690-980 | cas2 | ||
| 219 | CALHZS010000008.1 | GCA938041155_00106 | gene | open | 971-1963 | cas1b | ||
| 220 | CALHZS010000008.1 | GCA938041155_00107 | gene | open | 2092-2580 | cas4 | ||
| 221 | CALHZS010000008.1 | GCA938041155_00108 | gene | open | 2705-3226 | |||
| 222 | CALHZS010000008.1 | GCA938041155_00109 | gene | open | 3207-3491 | |||
| 223 | CALHZS010000008.1 | GCA938041155_00110 | gene | open | 3488-3889 | |||
| 224 | CALHZS010000009.1 | repeat_region | open | 107827-108023 | CRISPR array with 3 repeats of length 39%2C consensus sequence GTTTCAATCCTTATTCTACTGGATTCTCTTCTTTTATTC and spacer length 35 | |||
| 225 | CALHZS010000009.1 | GCA938041155_00111 | CDS | open | 101-682 | _na 193_aa | DUF4291 domain-containing protein | |
| 226 | CALHZS010000009.1 | GCA938041155_00112 | CDS | open | 851-2182 | _na 443_aa | fadH2 | NADH oxidase |
| 227 | CALHZS010000009.1 | GCA938041155_00113 | CDS | open | 2228-2770 | _na 180_aa | DUF5673 domain-containing protein | |
| 228 | CALHZS010000009.1 | GCA938041155_00114 | CDS | open | 2862-3293 | _na 143_aa | FMN-binding domain-containing protein | |
| 229 | CALHZS010000009.1 | GCA938041155_00115 | CDS | open | 3320-4225 | _na 301_aa | MORN repeat-containing protein | |
| 230 | CALHZS010000009.1 | GCA938041155_00116 | CDS | open | 4409-5302 | _na 297_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 231 | CALHZS010000009.1 | GCA938041155_00117 | CDS | open | 5317-6240 | _na 307_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 232 | CALHZS010000009.1 | GCA938041155_00118 | CDS | open | 6648-8633 | _na 661_aa | Tetratricopeptide repeat protein | |
| 233 | CALHZS010000009.1 | GCA938041155_00119 | CDS | open | 8637-9302 | _na 221_aa | Transporter | |
| 234 | CALHZS010000009.1 | GCA938041155_00120 | CDS | open | 9386-10354 | _na 322_aa | N-acetylmuramoyl-L-alanine amidase | |
| 235 | CALHZS010000009.1 | GCA938041155_00121 | CDS | open | 10378-11589 | _na 403_aa | aspB | Aminotransferase |
| 236 | CALHZS010000009.1 | GCA938041155_00122 | CDS | open | 11799-12515 | _na 238_aa | queH | Epoxyqueuosine reductase QueH |
| 237 | CALHZS010000009.1 | GCA938041155_00123 | CDS | open | 12604-13539 | _na 311_aa | Bis(5'-nucleosyl)-tetraphosphatase%2C symmetrical | |
| 238 | CALHZS010000009.1 | GCA938041155_00124 | CDS | open | 13551-14396 | _na 281_aa | hypothetical protein | |
| 239 | CALHZS010000009.1 | GCA938041155_00125 | CDS | open | 14389-15729 | _na 446_aa | hypothetical protein | |
| 240 | CALHZS010000009.1 | GCA938041155_00126 | CDS | open | 15759-16346 | _na 195_aa | GTPase domain-containing protein | |
| 241 | CALHZS010000009.1 | GCA938041155_00127 | CDS | open | 16415-16621 | _na 68_aa | hypothetical protein | |
| 242 | CALHZS010000009.1 | GCA938041155_00128 | CDS | open | 17099-18298 | _na 399_aa | ATP-grasp domain-containing protein | |
| 243 | CALHZS010000009.1 | GCA938041155_00129 | CDS | open | 18320-19057 | _na 245_aa | Esterase | |
| 244 | CALHZS010000009.1 | GCA938041155_00130 | CDS | open | 19295-21034 | _na 579_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 245 | CALHZS010000009.1 | GCA938041155_00131 | CDS | open | 21034-22932 | _na 632_aa | mdlB | ABC transporter%2C ATP-binding protein |
| 246 | CALHZS010000009.1 | GCA938041155_00132 | CDS | open | 23341-24222 | _na 293_aa | Phosphocarrier protein HPr | |
| 247 | CALHZS010000009.1 | GCA938041155_00133 | CDS | open | 24434-26173 | _na 579_aa | NERD domain-containing protein/DEAD/DEAH box helicase | |
| 248 | CALHZS010000009.1 | GCA938041155_00134 | CDS | open | 26387-27037 | _na 216_aa | DUF218 domain-containing protein | |
| 249 | CALHZS010000009.1 | GCA938041155_00135 | CDS | open | 27188-28984 | _na 598_aa | lepA | translation elongation factor 4 |
| 250 | CALHZS010000009.1 | GCA938041155_00136 | CDS | open | 29204-29842 | _na 212_aa | dnaQ | Exonuclease RNase T and DNA polymerase III |
| 251 | CALHZS010000009.1 | GCA938041155_00137 | CDS | open | 29894-33154 | _na 1086_aa | Helicase protein | |
| 252 | CALHZS010000009.1 | GCA938041155_00138 | CDS | open | 33324-34442 | _na 372_aa | Integrase family protein | |
| 253 | CALHZS010000009.1 | GCA938041155_00139 | CDS | open | 34794-35159 | _na 121_aa | Phage-Barnase-EndoU-ColicinE5/D-RelE like nuclease 3 domain-containing protein | |
| 254 | CALHZS010000009.1 | GCA938041155_00140 | CDS | open | 35164-36666 | _na 500_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 255 | CALHZS010000009.1 | GCA938041155_00141 | CDS | open | 36702-37412 | _na 236_aa | Segregation and condensation protein A | |
| 256 | CALHZS010000009.1 | GCA938041155_00142 | CDS | open | 37415-38416 | _na 333_aa | bifunctional riboflavin kinase/FAD synthetase | |
| 257 | CALHZS010000009.1 | GCA938041155_00143 | CDS | open | 38471-38626 | _na 51_aa | hypothetical protein | |
| 258 | CALHZS010000009.1 | GCA938041155_00144 | CDS | open | 38631-39134 | _na 167_aa | Polymer-forming cytoskeletal protein | |
| 259 | CALHZS010000009.1 | GCA938041155_00145 | CDS | open | 39338-39973 | _na 211_aa | hypothetical protein | |
| 260 | CALHZS010000009.1 | GCA938041155_00146 | CDS | open | 39999-41522 | _na 507_aa | Bifunctional NAD(P)H-hydrate repair enzyme | |
| 261 | CALHZS010000009.1 | GCA938041155_00147 | CDS | open | 41543-42394 | _na 283_aa | hisJ | histidinol-phosphatase HisJ |
| 262 | CALHZS010000009.1 | GCA938041155_00148 | CDS | open | 42437-42859 | _na 140_aa | hypothetical protein | |
| 263 | CALHZS010000009.1 | GCA938041155_00149 | CDS | open | 42891-43544 | _na 217_aa | hisIE | bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE |
| 264 | CALHZS010000009.1 | GCA938041155_00150 | CDS | open | 43573-43941 | _na 122_aa | Toxin-antitoxin system%2C antitoxin component domain protein | |
| 265 | CALHZS010000009.1 | GCA938041155_00151 | CDS | open | 43934-44254 | _na 106_aa | Polymerase nucleotidyl transferase domain-containing protein | |
| 266 | CALHZS010000009.1 | GCA938041155_00152 | CDS | open | 44303-45058 | _na 251_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 267 | CALHZS010000009.1 | GCA938041155_00153 | CDS | open | 45135-45851 | _na 238_aa | hisA | 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase |
| 268 | CALHZS010000009.1 | GCA938041155_00154 | CDS | open | 45987-46841 | _na 284_aa | Tetratricopeptide repeat protein | |
| 269 | CALHZS010000009.1 | GCA938041155_00155 | CDS | open | 46916-47551 | _na 211_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 270 | CALHZS010000009.1 | GCA938041155_00156 | CDS | open | 47927-51685 | _na 1252_aa | hypothetical protein | |
| 271 | CALHZS010000009.1 | GCA938041155_00157 | CDS | open | 51685-54072 | _na 795_aa | hypothetical protein | |
| 272 | CALHZS010000009.1 | GCA938041155_00158 | CDS | open | 54102-55388 | _na 428_aa | gntP | GntP family permease |
| 273 | CALHZS010000009.1 | GCA938041155_00159 | CDS | open | 55390-56139 | _na 249_aa | hypothetical protein | |
| 274 | CALHZS010000009.1 | GCA938041155_00160 | CDS | open | 56159-56974 | _na 271_aa | S4 domain-containing protein | |
| 275 | CALHZS010000009.1 | GCA938041155_00161 | CDS | open | 57076-58446 | _na 456_aa | radical SAM protein | |
| 276 | CALHZS010000009.1 | GCA938041155_00162 | CDS | open | 58424-59632 | _na 402_aa | aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme | |
| 277 | CALHZS010000009.1 | GCA938041155_00163 | CDS | open | 59634-60563 | _na 309_aa | sugar nucleotide-binding protein | |
| 278 | CALHZS010000009.1 | GCA938041155_00164 | CDS | open | 60560-61300 | _na 246_aa | hypothetical protein | |
| 279 | CALHZS010000009.1 | GCA938041155_00165 | CDS | open | 61310-63427 | _na 705_aa | hypothetical protein | |
| 280 | CALHZS010000009.1 | GCA938041155_00166 | CDS | open | 63417-66896 | _na 1159_aa | AAA domain-containing protein | |
| 281 | CALHZS010000009.1 | GCA938041155_00167 | CDS | open | 66893-68329 | _na 478_aa | protein kinase domain-containing protein | |
| 282 | CALHZS010000009.1 | GCA938041155_00168 | CDS | open | 68314-69015 | _na 233_aa | PP2C family serine/threonine-protein phosphatase | |
| 283 | CALHZS010000009.1 | GCA938041155_00169 | CDS | open | 69041-69463 | _na 140_aa | hypothetical protein | |
| 284 | CALHZS010000009.1 | GCA938041155_00170 | CDS | open | 69456-72104 | _na 882_aa | FtsK/SpoIIIE domain-containing protein | |
| 285 | CALHZS010000009.1 | GCA938041155_00171 | CDS | open | 72119-72325 | _na 68_aa | hypothetical protein | |
| 286 | CALHZS010000009.1 | GCA938041155_00172 | CDS | open | 72318-73475 | _na 385_aa | hypothetical protein | |
| 287 | CALHZS010000009.1 | GCA938041155_00173 | CDS | open | 73478-73759 | _na 93_aa | hypothetical protein | |
| 288 | CALHZS010000009.1 | GCA938041155_00174 | CDS | open | 73811-74506 | _na 231_aa | VWA domain-containing protein | |
| 289 | CALHZS010000009.1 | GCA938041155_00175 | CDS | open | 74659-77046 | _na 795_aa | Phospholipase D-like domain-containing protein | |
| 290 | CALHZS010000009.1 | GCA938041155_00176 | CDS | open | 77068-77880 | _na 270_aa | lprI | Lysozyme inhibitor LprI N-terminal domain-containing protein |
| 291 | CALHZS010000009.1 | GCA938041155_00177 | CDS | open | 77880-78575 | _na 231_aa | DNA alkylation repair protein | |
| 292 | CALHZS010000009.1 | GCA938041155_00178 | CDS | open | 78614-79279 | _na 221_aa | DUF5105 domain-containing protein | |
| 293 | CALHZS010000009.1 | GCA938041155_00179 | CDS | open | 79478-80068 | _na 196_aa | hisB | imidazoleglycerol-phosphate dehydratase HisB |
| 294 | CALHZS010000009.1 | GCA938041155_00180 | CDS | open | 80231-80626 | _na 131_aa | Phosphoribosylglycinamide formyltransferase-1 | |
| 295 | CALHZS010000009.1 | GCA938041155_00181 | CDS | open | 80798-81874 | _na 358_aa | hisC | histidinol-phosphate transaminase |
| 296 | CALHZS010000009.1 | GCA938041155_00182 | CDS | open | 82059-82787 | _na 242_aa | DUF5105 domain-containing protein | |
| 297 | CALHZS010000009.1 | GCA938041155_00183 | CDS | open | 83019-84299 | _na 426_aa | hisD | Histidinol dehydrogenase |
| 298 | CALHZS010000009.1 | GCA938041155_00184 | CDS | open | 84361-84978 | _na 205_aa | hisG | ATP phosphoribosyltransferase |
| 299 | CALHZS010000009.1 | GCA938041155_00185 | CDS | open | 84997-86136 | _na 379_aa | ATP phosphoribosyltransferase regulatory subunit | |
| 300 | CALHZS010000009.1 | GCA938041155_00186 | CDS | open | 86299-86823 | _na 174_aa | Putative DHNTP pyrophosphohydrolase | |
| 301 | CALHZS010000009.1 | GCA938041155_00187 | CDS | open | 86857-87042 | _na 61_aa | hypothetical protein | |
| 302 | CALHZS010000009.1 | GCA938041155_00188 | CDS | open | 87322-88179 | _na 285_aa | S4 domain protein | |
| 303 | CALHZS010000009.1 | GCA938041155_00189 | CDS | open | 88371-88868 | _na 165_aa | DUF1232 domain-containing protein | |
| 304 | CALHZS010000009.1 | GCA938041155_00190 | CDS | open | 89076-89567 | _na 163_aa | Signal peptide protein%2C YSIRK family | |
| 305 | CALHZS010000009.1 | GCA938041155_00191 | CDS | open | 90310-91827 | _na 505_aa | ABC transporter%2C substrate-binding protein%2C QAT family | |
| 306 | CALHZS010000009.1 | GCA938041155_00192 | CDS | open | 91820-92566 | _na 248_aa | ABC transporter%2C ATP-binding protein | |
| 307 | CALHZS010000009.1 | GCA938041155_00193 | CDS | open | 92642-93091 | _na 149_aa | marR | Transcriptional regulator%2C MarR family |
| 308 | CALHZS010000009.1 | GCA938041155_00194 | CDS | open | 93212-93481 | _na 89_aa | alcohol dehydrogenase catalytic domain-containing protein | |
| 309 | CALHZS010000009.1 | GCA938041155_00195 | CDS | open | 93453-94325 | _na 290_aa | zinc-binding dehydrogenase | |
| 310 | CALHZS010000009.1 | GCA938041155_00196 | CDS | open | 94481-94837 | _na 118_aa | fur | Transcriptional regulator%2C Fur family |
| 311 | CALHZS010000009.1 | GCA938041155_00197 | CDS | open | 94880-95266 | _na 128_aa | hypothetical protein | |
| 312 | CALHZS010000009.1 | GCA938041155_00198 | CDS | open | 95351-95794 | _na 147_aa | hypothetical protein | |
| 313 | CALHZS010000009.1 | GCA938041155_00199 | CDS | open | 95849-96547 | _na 232_aa | znuC | ABC transporter domain-containing protein |
| 314 | CALHZS010000009.1 | GCA938041155_00200 | CDS | open | 96584-97426 | _na 280_aa | znuB | ABC 3 transport family protein |
| 315 | CALHZS010000009.1 | GCA938041155_00201 | CDS | open | 97514-98521 | _na 335_aa | lacI | LacI family transcriptional regulator |
| 316 | CALHZS010000009.1 | GCA938041155_00202 | CDS | open | 98626-100032 | _na 468_aa | lacG | 6-phospho-beta-galactosidase |
| 317 | CALHZS010000009.1 | GCA938041155_00203 | CDS | open | 100092-101795 | _na 567_aa | celB | lactose-specific PTS transporter subunit EIIC |
| 318 | CALHZS010000009.1 | GCA938041155_00204 | CDS | open | 101795-102151 | _na 118_aa | celC | PTS system lactose-specific EIIA component |
| 319 | CALHZS010000009.1 | GCA938041155_00205 | CDS | open | 102267-103244 | _na 325_aa | lacD | tagatose-bisphosphate aldolase |
| 320 | CALHZS010000009.1 | GCA938041155_00206 | CDS | open | 103481-104419 | _na 312_aa | tagatose-6-phosphate kinase | |
| 321 | CALHZS010000009.1 | GCA938041155_00207 | CDS | open | 104539-105054 | _na 171_aa | lacB | galactose-6-phosphate isomerase subunit LacB |
| 322 | CALHZS010000009.1 | GCA938041155_00208 | CDS | open | 105112-105534 | _na 140_aa | lacA | galactose-6-phosphate isomerase subunit LacA |
| 323 | CALHZS010000009.1 | GCA938041155_00209 | CDS | open | 105852-106610 | _na 252_aa | deoR | Transcriptional regulator%2C DeoR family |
| 324 | CALHZS010000009.1 | GCA938041155_00210 | CDS | open | 106775-106966 | _na 63_aa | hypothetical protein | |
| 325 | CALHZS010000009.1 | GCA938041155_00211 | CDS | open | 107020-107751 | _na 243_aa | yaaA | UPF0246 protein Lebu_1077 |
| 326 | CALHZS010000009.1 | GCA938041155_00212 | CDS | open | 108289-108939 | _na 216_aa | DNA repair protein | |
| 327 | CALHZS010000009.1 | GCA938041155_00213 | CDS | open | 108959-111067 | _na 702_aa | TIGR03986 family CRISPR-associated RAMP protein | |
| 328 | CALHZS010000009.1 | GCA938041155_00214 | CDS | open | 111064-111480 | _na 138_aa | hypothetical protein | |
| 329 | CALHZS010000009.1 | GCA938041155_00215 | CDS | open | 111480-112385 | _na 301_aa | csm3 | CRISPR-associated RAMP protein%2C SSO1426 family |
| 330 | CALHZS010000009.1 | GCA938041155_00216 | CDS | open | 112396-113211 | _na 271_aa | csm3 | CRISPR-associated RAMP protein%2C SSO1426 family |
| 331 | CALHZS010000009.1 | GCA938041155_00217 | CDS | open | 113211-113744 | _na 177_aa | hypothetical protein | |
| 332 | CALHZS010000009.1 | GCA938041155_00218 | CDS | open | 113768-115624 | _na 618_aa | RAMP superfamily CRISPR-associated protein | |
| 333 | CALHZS010000009.1 | GCA938041155_00219 | CDS | open | 115614-117614 | _na 666_aa | Cas10/Cmr2 second palm domain-containing protein | |
| 334 | CALHZS010000009.1 | GCA938041155_00220 | CDS | open | 117697-118449 | _na 250_aa | CRISPR-associated protein Cas6 C-terminal domain-containing protein | |
| 335 | CALHZS010000009.1 | GCA938041155_00221 | CDS | open | 118479-119207 | _na 242_aa | hypothetical protein | |
| 336 | CALHZS010000009.1 | GCA938041155_00222 | CDS | open | 119201-119983 | _na 260_aa | moaA | Radical SAM domain protein |
| 337 | CALHZS010000009.1 | GCA938041155_00223 | CDS | open | 120355-120960 | _na 201_aa | coaE | dephospho-CoA kinase |
| 338 | CALHZS010000009.1 | GCA938041155_00224 | CDS | open | 120950-121972 | _na 340_aa | radical SAM/SPASM domain-containing protein | |
| 339 | CALHZS010000009.1 | GCA938041155_00225 | CDS | open | 121974-122198 | _na 74_aa | pqqD | PqqD family protein |
| 340 | CALHZS010000009.1 | GCA938041155_00226 | CDS | open | 122275-122397 | _na 40_aa | hypothetical protein | |
| 341 | CALHZS010000009.1 | GCA938041155_00111 | gene | open | 101-682 | |||
| 342 | CALHZS010000009.1 | GCA938041155_00112 | gene | open | 851-2182 | fadH2 | ||
| 343 | CALHZS010000009.1 | GCA938041155_00113 | gene | open | 2228-2770 | |||
| 344 | CALHZS010000009.1 | GCA938041155_00114 | gene | open | 2862-3293 | |||
| 345 | CALHZS010000009.1 | GCA938041155_00115 | gene | open | 3320-4225 | |||
| 346 | CALHZS010000009.1 | GCA938041155_00116 | gene | open | 4409-5302 | |||
| 347 | CALHZS010000009.1 | GCA938041155_00117 | gene | open | 5317-6240 | |||
| 348 | CALHZS010000009.1 | GCA938041155_00118 | gene | open | 6648-8633 | |||
| 349 | CALHZS010000009.1 | GCA938041155_00119 | gene | open | 8637-9302 | |||
| 350 | CALHZS010000009.1 | GCA938041155_00120 | gene | open | 9386-10354 | |||
| 351 | CALHZS010000009.1 | GCA938041155_00121 | gene | open | 10378-11589 | aspB | ||
| 352 | CALHZS010000009.1 | GCA938041155_00122 | gene | open | 11799-12515 | queH | ||
| 353 | CALHZS010000009.1 | GCA938041155_00123 | gene | open | 12604-13539 | |||
| 354 | CALHZS010000009.1 | GCA938041155_00124 | gene | open | 13551-14396 | |||
| 355 | CALHZS010000009.1 | GCA938041155_00125 | gene | open | 14389-15729 | |||
| 356 | CALHZS010000009.1 | GCA938041155_00126 | gene | open | 15759-16346 | |||
| 357 | CALHZS010000009.1 | GCA938041155_00127 | gene | open | 16415-16621 | |||
| 358 | CALHZS010000009.1 | GCA938041155_00128 | gene | open | 17099-18298 | |||
| 359 | CALHZS010000009.1 | GCA938041155_00129 | gene | open | 18320-19057 | |||
| 360 | CALHZS010000009.1 | GCA938041155_00130 | gene | open | 19295-21034 | mdlB | ||
| 361 | CALHZS010000009.1 | GCA938041155_00131 | gene | open | 21034-22932 | mdlB | ||
| 362 | CALHZS010000009.1 | GCA938041155_00132 | gene | open | 23341-24222 | |||
| 363 | CALHZS010000009.1 | GCA938041155_00133 | gene | open | 24434-26173 | |||
| 364 | CALHZS010000009.1 | GCA938041155_00134 | gene | open | 26387-27037 | |||
| 365 | CALHZS010000009.1 | GCA938041155_00135 | gene | open | 27188-28984 | lepA | ||
| 366 | CALHZS010000009.1 | GCA938041155_00136 | gene | open | 29204-29842 | dnaQ | ||
| 367 | CALHZS010000009.1 | GCA938041155_00137 | gene | open | 29894-33154 | |||
| 368 | CALHZS010000009.1 | GCA938041155_00138 | gene | open | 33324-34442 | |||
| 369 | CALHZS010000009.1 | GCA938041155_00139 | gene | open | 34794-35159 | |||
| 370 | CALHZS010000009.1 | GCA938041155_00140 | gene | open | 35164-36666 | murJ | ||
| 371 | CALHZS010000009.1 | GCA938041155_00141 | gene | open | 36702-37412 | |||
| 372 | CALHZS010000009.1 | GCA938041155_00142 | gene | open | 37415-38416 | |||
| 373 | CALHZS010000009.1 | GCA938041155_00143 | gene | open | 38471-38626 | |||
| 374 | CALHZS010000009.1 | GCA938041155_00144 | gene | open | 38631-39134 | |||
| 375 | CALHZS010000009.1 | GCA938041155_00145 | gene | open | 39338-39973 | |||
| 376 | CALHZS010000009.1 | GCA938041155_00146 | gene | open | 39999-41522 | |||
| 377 | CALHZS010000009.1 | GCA938041155_00147 | gene | open | 41543-42394 | hisJ | ||
| 378 | CALHZS010000009.1 | GCA938041155_00148 | gene | open | 42437-42859 | |||
| 379 | CALHZS010000009.1 | GCA938041155_00149 | gene | open | 42891-43544 | hisIE | ||
| 380 | CALHZS010000009.1 | GCA938041155_00150 | gene | open | 43573-43941 | |||
| 381 | CALHZS010000009.1 | GCA938041155_00151 | gene | open | 43934-44254 | |||
| 382 | CALHZS010000009.1 | GCA938041155_00152 | gene | open | 44303-45058 | hisF | ||
| 383 | CALHZS010000009.1 | GCA938041155_00153 | gene | open | 45135-45851 | hisA | ||
| 384 | CALHZS010000009.1 | GCA938041155_00154 | gene | open | 45987-46841 | |||
| 385 | CALHZS010000009.1 | GCA938041155_00155 | gene | open | 46916-47551 | hisH | ||
| 386 | CALHZS010000009.1 | GCA938041155_00156 | gene | open | 47927-51685 | |||
| 387 | CALHZS010000009.1 | GCA938041155_00157 | gene | open | 51685-54072 | |||
| 388 | CALHZS010000009.1 | GCA938041155_00158 | gene | open | 54102-55388 | gntP | ||
| 389 | CALHZS010000009.1 | GCA938041155_00159 | gene | open | 55390-56139 | |||
| 390 | CALHZS010000009.1 | GCA938041155_00160 | gene | open | 56159-56974 | |||
| 391 | CALHZS010000009.1 | GCA938041155_00161 | gene | open | 57076-58446 | |||
| 392 | CALHZS010000009.1 | GCA938041155_00162 | gene | open | 58424-59632 | |||
| 393 | CALHZS010000009.1 | GCA938041155_00163 | gene | open | 59634-60563 | |||
| 394 | CALHZS010000009.1 | GCA938041155_00164 | gene | open | 60560-61300 | |||
| 395 | CALHZS010000009.1 | GCA938041155_00165 | gene | open | 61310-63427 | |||
| 396 | CALHZS010000009.1 | GCA938041155_00166 | gene | open | 63417-66896 | |||
| 397 | CALHZS010000009.1 | GCA938041155_00167 | gene | open | 66893-68329 | |||
| 398 | CALHZS010000009.1 | GCA938041155_00168 | gene | open | 68314-69015 | |||
| 399 | CALHZS010000009.1 | GCA938041155_00169 | gene | open | 69041-69463 | |||
| 400 | CALHZS010000009.1 | GCA938041155_00170 | gene | open | 69456-72104 | |||
| 401 | CALHZS010000009.1 | GCA938041155_00171 | gene | open | 72119-72325 | |||
| 402 | CALHZS010000009.1 | GCA938041155_00172 | gene | open | 72318-73475 | |||
| 403 | CALHZS010000009.1 | GCA938041155_00173 | gene | open | 73478-73759 | |||
| 404 | CALHZS010000009.1 | GCA938041155_00174 | gene | open | 73811-74506 | |||
| 405 | CALHZS010000009.1 | GCA938041155_00175 | gene | open | 74659-77046 | |||
| 406 | CALHZS010000009.1 | GCA938041155_00176 | gene | open | 77068-77880 | lprI | ||
| 407 | CALHZS010000009.1 | GCA938041155_00177 | gene | open | 77880-78575 | |||
| 408 | CALHZS010000009.1 | GCA938041155_00178 | gene | open | 78614-79279 | |||
| 409 | CALHZS010000009.1 | GCA938041155_00179 | gene | open | 79478-80068 | hisB | ||
| 410 | CALHZS010000009.1 | GCA938041155_00180 | gene | open | 80231-80626 | |||
| 411 | CALHZS010000009.1 | GCA938041155_00181 | gene | open | 80798-81874 | hisC | ||
| 412 | CALHZS010000009.1 | GCA938041155_00182 | gene | open | 82059-82787 | |||
| 413 | CALHZS010000009.1 | GCA938041155_00183 | gene | open | 83019-84299 | hisD | ||
| 414 | CALHZS010000009.1 | GCA938041155_00184 | gene | open | 84361-84978 | hisG | ||
| 415 | CALHZS010000009.1 | GCA938041155_00185 | gene | open | 84997-86136 | |||
| 416 | CALHZS010000009.1 | GCA938041155_00186 | gene | open | 86299-86823 | |||
| 417 | CALHZS010000009.1 | GCA938041155_00187 | gene | open | 86857-87042 | |||
| 418 | CALHZS010000009.1 | GCA938041155_00188 | gene | open | 87322-88179 | |||
| 419 | CALHZS010000009.1 | GCA938041155_00189 | gene | open | 88371-88868 | |||
| 420 | CALHZS010000009.1 | GCA938041155_00190 | gene | open | 89076-89567 | |||
| 421 | CALHZS010000009.1 | GCA938041155_00191 | gene | open | 90310-91827 | |||
| 422 | CALHZS010000009.1 | GCA938041155_00192 | gene | open | 91820-92566 | |||
| 423 | CALHZS010000009.1 | GCA938041155_00193 | gene | open | 92642-93091 | marR | ||
| 424 | CALHZS010000009.1 | GCA938041155_00194 | gene | open | 93212-93481 | |||
| 425 | CALHZS010000009.1 | GCA938041155_00195 | gene | open | 93453-94325 | |||
| 426 | CALHZS010000009.1 | GCA938041155_00196 | gene | open | 94481-94837 | fur | ||
| 427 | CALHZS010000009.1 | GCA938041155_00197 | gene | open | 94880-95266 | |||
| 428 | CALHZS010000009.1 | GCA938041155_00198 | gene | open | 95351-95794 | |||
| 429 | CALHZS010000009.1 | GCA938041155_00199 | gene | open | 95849-96547 | znuC | ||
| 430 | CALHZS010000009.1 | GCA938041155_00200 | gene | open | 96584-97426 | znuB | ||
| 431 | CALHZS010000009.1 | GCA938041155_00201 | gene | open | 97514-98521 | lacI | ||
| 432 | CALHZS010000009.1 | GCA938041155_00202 | gene | open | 98626-100032 | lacG | ||
| 433 | CALHZS010000009.1 | GCA938041155_00203 | gene | open | 100092-101795 | celB | ||
| 434 | CALHZS010000009.1 | GCA938041155_00204 | gene | open | 101795-102151 | celC | ||
| 435 | CALHZS010000009.1 | GCA938041155_00205 | gene | open | 102267-103244 | lacD | ||
| 436 | CALHZS010000009.1 | GCA938041155_00206 | gene | open | 103481-104419 | |||
| 437 | CALHZS010000009.1 | GCA938041155_00207 | gene | open | 104539-105054 | lacB | ||
| 438 | CALHZS010000009.1 | GCA938041155_00208 | gene | open | 105112-105534 | lacA | ||
| 439 | CALHZS010000009.1 | GCA938041155_00209 | gene | open | 105852-106610 | deoR | ||
| 440 | CALHZS010000009.1 | GCA938041155_00210 | gene | open | 106775-106966 | |||
| 441 | CALHZS010000009.1 | GCA938041155_00211 | gene | open | 107020-107751 | yaaA | ||
| 442 | CALHZS010000009.1 | GCA938041155_00212 | gene | open | 108289-108939 | |||
| 443 | CALHZS010000009.1 | GCA938041155_00213 | gene | open | 108959-111067 | |||
| 444 | CALHZS010000009.1 | GCA938041155_00214 | gene | open | 111064-111480 | |||
| 445 | CALHZS010000009.1 | GCA938041155_00215 | gene | open | 111480-112385 | csm3 | ||
| 446 | CALHZS010000009.1 | GCA938041155_00216 | gene | open | 112396-113211 | csm3 | ||
| 447 | CALHZS010000009.1 | GCA938041155_00217 | gene | open | 113211-113744 | |||
| 448 | CALHZS010000009.1 | GCA938041155_00218 | gene | open | 113768-115624 | |||
| 449 | CALHZS010000009.1 | GCA938041155_00219 | gene | open | 115614-117614 | |||
| 450 | CALHZS010000009.1 | GCA938041155_00220 | gene | open | 117697-118449 | |||
| 451 | CALHZS010000009.1 | GCA938041155_00221 | gene | open | 118479-119207 | |||
| 452 | CALHZS010000009.1 | GCA938041155_00222 | gene | open | 119201-119983 | moaA | ||
| 453 | CALHZS010000009.1 | GCA938041155_00223 | gene | open | 120355-120960 | coaE | ||
| 454 | CALHZS010000009.1 | GCA938041155_00224 | gene | open | 120950-121972 | |||
| 455 | CALHZS010000009.1 | GCA938041155_00225 | gene | open | 121974-122198 | pqqD | ||
| 456 | CALHZS010000009.1 | GCA938041155_00226 | gene | open | 122275-122397 | |||
| 457 | CALHZS010000010.1 | GCA938041155_00227 | CDS | open | 53-1555 | _na 500_aa | cysN | sulfate adenylyltransferase |
| 458 | CALHZS010000010.1 | GCA938041155_00228 | CDS | open | 1593-2624 | _na 343_aa | sbp | Sulfate ABC transporter%2C periplasmic sulfate-binding protein |
| 459 | CALHZS010000010.1 | GCA938041155_00229 | CDS | open | 2657-3505 | _na 282_aa | cysT | sulfate ABC transporter permease subunit CysT |
| 460 | CALHZS010000010.1 | GCA938041155_00230 | CDS | open | 3520-4359 | _na 279_aa | cysW | Sulfate ABC transporter%2C inner membrane subunit |
| 461 | CALHZS010000010.1 | GCA938041155_00231 | CDS | open | 4563-4784 | _na 73_aa | hypothetical protein | |
| 462 | CALHZS010000010.1 | GCA938041155_00232 | CDS | open | 5993-6184 | _na 63_aa | hypothetical protein | |
| 463 | CALHZS010000010.1 | GCA938041155_00227 | gene | open | 53-1555 | cysN | ||
| 464 | CALHZS010000010.1 | GCA938041155_00228 | gene | open | 1593-2624 | sbp | ||
| 465 | CALHZS010000010.1 | GCA938041155_00229 | gene | open | 2657-3505 | cysT | ||
| 466 | CALHZS010000010.1 | GCA938041155_00230 | gene | open | 3520-4359 | cysW | ||
| 467 | CALHZS010000010.1 | GCA938041155_00231 | gene | open | 4563-4784 | |||
| 468 | CALHZS010000010.1 | GCA938041155_00232 | gene | open | 5993-6184 | |||
| 469 | CALHZS010000011.1 | regulatory_region | open | 4554-4619 | S4-Fusobacteriales ribosomal protein leader | |||
| 470 | CALHZS010000011.1 | GCA938041155_00233 | CDS | open | 15-1271 | _na 418_aa | proA | glutamate-5-semialdehyde dehydrogenase |
| 471 | CALHZS010000011.1 | GCA938041155_00234 | CDS | open | 1330-2202 | _na 290_aa | Photosystem I assembly protein Ycf3 | |
| 472 | CALHZS010000011.1 | GCA938041155_00235 | CDS | open | 2528-2776 | _na 82_aa | copZ | Heavy metal transport/detoxification protein |
| 473 | CALHZS010000011.1 | GCA938041155_00236 | CDS | open | 3264-3914 | _na 216_aa | Ribosomal RNA small subunit methyltransferase C | |
| 474 | CALHZS010000011.1 | GCA938041155_00237 | CDS | open | 4088-4306 | _na 72_aa | infA | translation initiation factor IF-1 |
| 475 | CALHZS010000011.1 | GCA938041155_00238 | CDS | open | 4535-5017 | _na 160_aa | Small ribosomal subunit protein uS13 | |
| 476 | CALHZS010000011.1 | GCA938041155_00239 | CDS | open | 5049-5438 | _na 129_aa | rpsK | 30S ribosomal protein S11 |
| 477 | CALHZS010000011.1 | GCA938041155_00240 | CDS | open | 5467-6054 | _na 195_aa | rpsD | 30S ribosomal protein S4 |
| 478 | CALHZS010000011.1 | GCA938041155_00241 | CDS | open | 6085-7059 | _na 324_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 479 | CALHZS010000011.1 | GCA938041155_00242 | CDS | open | 7114-7488 | _na 124_aa | rplQ | 50S ribosomal protein L17 |
| 480 | CALHZS010000011.1 | GCA938041155_00233 | gene | open | 15-1271 | proA | ||
| 481 | CALHZS010000011.1 | GCA938041155_00234 | gene | open | 1330-2202 | |||
| 482 | CALHZS010000011.1 | GCA938041155_00235 | gene | open | 2528-2776 | copZ | ||
| 483 | CALHZS010000011.1 | GCA938041155_00236 | gene | open | 3264-3914 | |||
| 484 | CALHZS010000011.1 | GCA938041155_00237 | gene | open | 4088-4306 | infA | ||
| 485 | CALHZS010000011.1 | GCA938041155_00238 | gene | open | 4535-5017 | |||
| 486 | CALHZS010000011.1 | GCA938041155_00239 | gene | open | 5049-5438 | rpsK | ||
| 487 | CALHZS010000011.1 | GCA938041155_00240 | gene | open | 5467-6054 | rpsD | ||
| 488 | CALHZS010000011.1 | GCA938041155_00241 | gene | open | 6085-7059 | rpoA | ||
| 489 | CALHZS010000011.1 | GCA938041155_00242 | gene | open | 7114-7488 | rplQ | ||
| 490 | CALHZS010000012.1 | GCA938041155_00243 | CDS | open | 97-1761 | _na 554_aa | autotransporter outer membrane beta-barrel domain-containing protein | |
| 491 | CALHZS010000012.1 | GCA938041155_00243 | gene | open | 97-1761 | |||
| 492 | CALHZS010000013.1 | GCA938041155_00244 | CDS | open | 887-1513 | _na 208_aa | MFS transporter | |
| 493 | CALHZS010000013.1 | GCA938041155_00245 | CDS | open | 1621-2292 | _na 223_aa | DUF1269 domain-containing protein | |
| 494 | CALHZS010000013.1 | GCA938041155_00246 | CDS | open | 2365-4008 | _na 547_aa | ABC1 family protein | |
| 495 | CALHZS010000013.1 | GCA938041155_00247 | CDS | open | 4092-5279 | _na 395_aa | rseP | RIP metalloprotease RseP |
| 496 | CALHZS010000013.1 | GCA938041155_00248 | CDS | open | 5394-5936 | _na 180_aa | sepF | Cell division protein SepF |
| 497 | CALHZS010000013.1 | GCA938041155_00249 | CDS | open | 5948-6631 | _na 227_aa | Pyridoxal phosphate homeostasis protein | |
| 498 | CALHZS010000013.1 | GCA938041155_00250 | CDS | open | 6766-8061 | _na 431_aa | hemW | radical SAM family heme chaperone HemW |
| 499 | CALHZS010000013.1 | GCA938041155_00251 | CDS | open | 8230-9948 | _na 572_aa | Phosphoglucomutase/phosphomannomutase alpha/beta/alpha domain I | |
| 500 | CALHZS010000013.1 | GCA938041155_00252 | CDS | open | 10416-13049 | _na 877_aa | ftsK | Cell division protein FtsK |

