BAKTAGenome Explorer: Scardovia wiggsiae (GCA_938045375.1)
Select a Genome:
|
BAKTA Annotations for GCA_938045375.1
|
Search & Sort all 2549 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 2001 | CALIMP010000009.1 | GCA938045375_01084 | CDS | open | 196383-196793 | _na 136_aa | OsmC-like protein | |
| 2002 | CALIMP010000009.1 | GCA938045375_01085 | CDS | open | 196814-197890 | _na 358_aa | uspA | UspA domain-containing protein |
| 2003 | CALIMP010000009.1 | GCA938045375_01086 | CDS | open | 197993-199084 | _na 363_aa | Peptidase C51 domain-containing protein | |
| 2004 | CALIMP010000009.1 | GCA938045375_01087 | CDS | open | 199203-200483 | _na 426_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 2005 | CALIMP010000009.1 | GCA938045375_01088 | CDS | open | 200658-200924 | _na 88_aa | DUF2530 domain-containing protein | |
| 2006 | CALIMP010000009.1 | GCA938045375_01089 | CDS | open | 201199-201939 | _na 246_aa | gpmA | phosphoglyceromutase |
| 2007 | CALIMP010000009.1 | GCA938045375_01090 | CDS | open | 201981-203138 | _na 385_aa | menA | 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase |
| 2008 | CALIMP010000009.1 | GCA938045375_01091 | CDS | open | 203131-204867 | _na 578_aa | lysS | lysine--tRNA ligase |
| 2009 | CALIMP010000009.1 | GCA938045375_01092 | CDS | open | 205117-205482 | _na 121_aa | yhbY | YhbY family putative RNA-binding protein |
| 2010 | CALIMP010000009.1 | GCA938045375_00924 | gene | open | 354-566 | |||
| 2011 | CALIMP010000009.1 | GCA938045375_00925 | gene | open | 678-1514 | |||
| 2012 | CALIMP010000009.1 | GCA938045375_00926 | gene | open | 1678-2304 | rpsD | ||
| 2013 | CALIMP010000009.1 | GCA938045375_00927 | gene | open | 2622-4094 | |||
| 2014 | CALIMP010000009.1 | GCA938045375_00928 | gene | open | 4114-6840 | |||
| 2015 | CALIMP010000009.1 | GCA938045375_00929 | gene | open | 7103-7738 | |||
| 2016 | CALIMP010000009.1 | GCA938045375_00930 | gene | open | 7875-9326 | |||
| 2017 | CALIMP010000009.1 | GCA938045375_00931 | gene | open | 9440-10444 | |||
| 2018 | CALIMP010000009.1 | GCA938045375_00932 | gene | open | 10610-11377 | |||
| 2019 | CALIMP010000009.1 | GCA938045375_00933 | gene | open | 11457-12092 | |||
| 2020 | CALIMP010000009.1 | GCA938045375_00934 | gene | open | 12233-12748 | |||
| 2021 | CALIMP010000009.1 | GCA938045375_00935 | gene | open | 12907-13527 | |||
| 2022 | CALIMP010000009.1 | GCA938045375_00936 | gene | open | 13653-13883 | |||
| 2023 | CALIMP010000009.1 | GCA938045375_00937 | gene | open | 14306-15379 | |||
| 2024 | CALIMP010000009.1 | GCA938045375_00938 | gene | open | 15455-17017 | guaA | ||
| 2025 | CALIMP010000009.1 | GCA938045375_00939 | gene | open | 17381-18250 | |||
| 2026 | CALIMP010000009.1 | GCA938045375_00940 | gene | open | 18440-20917 | xFP | ||
| 2027 | CALIMP010000009.1 | GCA938045375_00941 | gene | open | 21198-22886 | pta | ||
| 2028 | CALIMP010000009.1 | GCA938045375_00942 | gene | open | 23142-23834 | |||
| 2029 | CALIMP010000009.1 | GCA938045375_00943 | gene | open | 23995-25221 | |||
| 2030 | CALIMP010000009.1 | GCA938045375_00944 | gene | open | 25294-25494 | |||
| 2031 | CALIMP010000009.1 | GCA938045375_00945 | gene | open | 26129-28378 | glgX | ||
| 2032 | CALIMP010000009.1 | GCA938045375_00946 | gene | open | 28393-29655 | |||
| 2033 | CALIMP010000009.1 | GCA938045375_00948 | gene | open | 29990-31213 | |||
| 2034 | CALIMP010000009.1 | GCA938045375_00949 | gene | open | 31494-31676 | |||
| 2035 | CALIMP010000009.1 | GCA938045375_00950 | gene | open | 32234-32467 | |||
| 2036 | CALIMP010000009.1 | GCA938045375_00951 | gene | open | 32628-33284 | |||
| 2037 | CALIMP010000009.1 | GCA938045375_00952 | gene | open | 33277-34806 | |||
| 2038 | CALIMP010000009.1 | GCA938045375_00953 | gene | open | 34799-37306 | |||
| 2039 | CALIMP010000009.1 | GCA938045375_00954 | gene | open | 37309-37434 | |||
| 2040 | CALIMP010000009.1 | GCA938045375_00955 | gene | open | 37958-38356 | |||
| 2041 | CALIMP010000009.1 | GCA938045375_00956 | gene | open | 38644-38850 | |||
| 2042 | CALIMP010000009.1 | GCA938045375_00957 | gene | open | 39467-40390 | |||
| 2043 | CALIMP010000009.1 | GCA938045375_00958 | gene | open | 40459-43572 | polA | ||
| 2044 | CALIMP010000009.1 | GCA938045375_00959 | gene | open | 43714-44418 | |||
| 2045 | CALIMP010000009.1 | GCA938045375_00961 | gene | open | 44776-45372 | |||
| 2046 | CALIMP010000009.1 | GCA938045375_00962 | gene | open | 45548-47017 | |||
| 2047 | CALIMP010000009.1 | GCA938045375_00963 | gene | open | 47113-48555 | pyk | ||
| 2048 | CALIMP010000009.1 | GCA938045375_00964 | gene | open | 48723-49685 | terC | ||
| 2049 | CALIMP010000009.1 | GCA938045375_00965 | gene | open | 49750-51882 | uvrB | ||
| 2050 | CALIMP010000009.1 | GCA938045375_00966 | gene | open | 51961-52593 | coaE | ||
| 2051 | CALIMP010000009.1 | GCA938045375_00967 | gene | open | 52730-54211 | rpsA | ||
| 2052 | CALIMP010000009.1 | GCA938045375_00968 | gene | open | 54447-55331 | |||
| 2053 | CALIMP010000009.1 | GCA938045375_00969 | gene | open | 55517-56527 | |||
| 2054 | CALIMP010000009.1 | GCA938045375_00970 | gene | open | 56600-57529 | |||
| 2055 | CALIMP010000009.1 | GCA938045375_00971 | gene | open | 57522-58364 | |||
| 2056 | CALIMP010000009.1 | GCA938045375_00972 | gene | open | 58383-59099 | |||
| 2057 | CALIMP010000009.1 | GCA938045375_00973 | gene | open | 59302-61548 | glgB | ||
| 2058 | CALIMP010000009.1 | GCA938045375_00974 | gene | open | 61667-62401 | |||
| 2059 | CALIMP010000009.1 | GCA938045375_00975 | gene | open | 62404-63642 | |||
| 2060 | CALIMP010000009.1 | GCA938045375_00976 | gene | open | 63745-64218 | |||
| 2061 | CALIMP010000009.1 | GCA938045375_00977 | gene | open | 64199-65524 | umuC | ||
| 2062 | CALIMP010000009.1 | GCA938045375_00978 | gene | open | 65709-66311 | |||
| 2063 | CALIMP010000009.1 | GCA938045375_00979 | gene | open | 66592-67428 | |||
| 2064 | CALIMP010000009.1 | GCA938045375_00980 | gene | open | 67505-68023 | |||
| 2065 | CALIMP010000009.1 | GCA938045375_00981 | gene | open | 68079-69779 | |||
| 2066 | CALIMP010000009.1 | GCA938045375_00982 | gene | open | 69779-72979 | |||
| 2067 | CALIMP010000009.1 | GCA938045375_00983 | gene | open | 73216-74649 | |||
| 2068 | CALIMP010000009.1 | GCA938045375_00984 | gene | open | 74676-76097 | |||
| 2069 | CALIMP010000009.1 | GCA938045375_00985 | gene | open | 76203-78359 | ftsK | ||
| 2070 | CALIMP010000009.1 | GCA938045375_00986 | gene | open | 78449-78718 | whiB | ||
| 2071 | CALIMP010000009.1 | GCA938045375_00987 | gene | open | 78761-80266 | |||
| 2072 | CALIMP010000009.1 | GCA938045375_00988 | gene | open | 80372-81307 | |||
| 2073 | CALIMP010000009.1 | GCA938045375_00989 | gene | open | 81362-81847 | greA | ||
| 2074 | CALIMP010000009.1 | GCA938045375_00990 | gene | open | 81984-82397 | |||
| 2075 | CALIMP010000009.1 | GCA938045375_00992 | gene | open | 82685-83680 | |||
| 2076 | CALIMP010000009.1 | GCA938045375_00993 | gene | open | 83774-84520 | |||
| 2077 | CALIMP010000009.1 | GCA938045375_00994 | gene | open | 84608-85354 | ftsL | ||
| 2078 | CALIMP010000009.1 | GCA938045375_00995 | gene | open | 85503-86798 | eno | ||
| 2079 | CALIMP010000009.1 | GCA938045375_00996 | gene | open | 86870-90541 | mfd | ||
| 2080 | CALIMP010000009.1 | GCA938045375_00997 | gene | open | 90528-91130 | pth | ||
| 2081 | CALIMP010000009.1 | GCA938045375_00998 | gene | open | 91518-92603 | ychF | ||
| 2082 | CALIMP010000009.1 | GCA938045375_00999 | gene | open | 92701-94131 | |||
| 2083 | CALIMP010000009.1 | GCA938045375_01001 | gene | open | 94350-95543 | |||
| 2084 | CALIMP010000009.1 | GCA938045375_01002 | gene | open | 95616-98150 | ccmA | ||
| 2085 | CALIMP010000009.1 | GCA938045375_01003 | gene | open | 98232-98909 | |||
| 2086 | CALIMP010000009.1 | GCA938045375_01004 | gene | open | 99184-99864 | |||
| 2087 | CALIMP010000009.1 | GCA938045375_01005 | gene | open | 99877-101403 | |||
| 2088 | CALIMP010000009.1 | GCA938045375_01006 | gene | open | 101468-102274 | |||
| 2089 | CALIMP010000009.1 | GCA938045375_01007 | gene | open | 102381-103817 | glnA | ||
| 2090 | CALIMP010000009.1 | GCA938045375_01008 | gene | open | 104612-106048 | |||
| 2091 | CALIMP010000009.1 | GCA938045375_01009 | gene | open | 106041-106658 | |||
| 2092 | CALIMP010000009.1 | GCA938045375_01010 | gene | open | 106859-108157 | |||
| 2093 | CALIMP010000009.1 | GCA938045375_01011 | gene | open | 108229-111171 | |||
| 2094 | CALIMP010000009.1 | GCA938045375_01012 | gene | open | 111168-112520 | |||
| 2095 | CALIMP010000009.1 | GCA938045375_01013 | gene | open | 112513-115116 | ligA | ||
| 2096 | CALIMP010000009.1 | GCA938045375_01014 | gene | open | 115208-118975 | |||
| 2097 | CALIMP010000009.1 | GCA938045375_01015 | gene | open | 119068-121521 | |||
| 2098 | CALIMP010000009.1 | GCA938045375_01016 | gene | open | 121518-122753 | |||
| 2099 | CALIMP010000009.1 | GCA938045375_01017 | gene | open | 122811-123581 | ppgK | ||
| 2100 | CALIMP010000009.1 | GCA938045375_01018 | gene | open | 123689-124528 | |||
| 2101 | CALIMP010000009.1 | GCA938045375_01019 | gene | open | 124702-125268 | |||
| 2102 | CALIMP010000009.1 | GCA938045375_01020 | gene | open | 125278-127857 | |||
| 2103 | CALIMP010000009.1 | GCA938045375_01021 | gene | open | 128129-128401 | |||
| 2104 | CALIMP010000009.1 | GCA938045375_01022 | gene | open | 128461-128688 | |||
| 2105 | CALIMP010000009.1 | GCA938045375_01023 | gene | open | 128915-129745 | |||
| 2106 | CALIMP010000009.1 | GCA938045375_01024 | gene | open | 129806-131551 | |||
| 2107 | CALIMP010000009.1 | GCA938045375_01025 | gene | open | 131625-132461 | |||
| 2108 | CALIMP010000009.1 | GCA938045375_01026 | gene | open | 132458-133492 | |||
| 2109 | CALIMP010000009.1 | GCA938045375_01027 | gene | open | 133516-135402 | glmS | ||
| 2110 | CALIMP010000009.1 | GCA938045375_01028 | gene | open | 135597-136169 | |||
| 2111 | CALIMP010000009.1 | GCA938045375_01029 | gene | open | 136299-136784 | smpB | ||
| 2112 | CALIMP010000009.1 | GCA938045375_01030 | gene | open | 136878-138332 | |||
| 2113 | CALIMP010000009.1 | GCA938045375_01031 | gene | open | 138524-139447 | ftsX | ||
| 2114 | CALIMP010000009.1 | GCA938045375_01032 | gene | open | 139447-140493 | ftsE | ||
| 2115 | CALIMP010000009.1 | GCA938045375_01033 | gene | open | 140542-141663 | prfB | ||
| 2116 | CALIMP010000009.1 | GCA938045375_01034 | gene | open | 141829-142626 | map | ||
| 2117 | CALIMP010000009.1 | GCA938045375_01035 | gene | open | 142774-144867 | |||
| 2118 | CALIMP010000009.1 | GCA938045375_01036 | gene | open | 144989-145558 | |||
| 2119 | CALIMP010000009.1 | GCA938045375_01037 | gene | open | 145811-147604 | |||
| 2120 | CALIMP010000009.1 | GCA938045375_01038 | gene | open | 147724-149118 | |||
| 2121 | CALIMP010000009.1 | GCA938045375_01039 | gene | open | 149230-149955 | orn | ||
| 2122 | CALIMP010000009.1 | GCA938045375_01040 | gene | open | 150170-151936 | |||
| 2123 | CALIMP010000009.1 | GCA938045375_01041 | gene | open | 151962-152495 | |||
| 2124 | CALIMP010000009.1 | GCA938045375_01042 | gene | open | 152608-154158 | guaB | ||
| 2125 | CALIMP010000009.1 | GCA938045375_01043 | gene | open | 154253-154807 | |||
| 2126 | CALIMP010000009.1 | GCA938045375_01044 | gene | open | 154791-156137 | |||
| 2127 | CALIMP010000009.1 | GCA938045375_01045 | gene | open | 156176-156874 | |||
| 2128 | CALIMP010000009.1 | GCA938045375_01046 | gene | open | 156939-157577 | |||
| 2129 | CALIMP010000009.1 | GCA938045375_01047 | gene | open | 157719-159044 | |||
| 2130 | CALIMP010000009.1 | GCA938045375_01048 | gene | open | 159247-160116 | |||
| 2131 | CALIMP010000009.1 | GCA938045375_01049 | gene | open | 160113-160967 | |||
| 2132 | CALIMP010000009.1 | GCA938045375_01050 | gene | open | 161086-161847 | |||
| 2133 | CALIMP010000009.1 | GCA938045375_01051 | gene | open | 161900-162928 | |||
| 2134 | CALIMP010000009.1 | GCA938045375_01052 | gene | open | 162943-163857 | |||
| 2135 | CALIMP010000009.1 | GCA938045375_01053 | gene | open | 163854-165260 | |||
| 2136 | CALIMP010000009.1 | GCA938045375_01054 | gene | open | 165382-166608 | |||
| 2137 | CALIMP010000009.1 | GCA938045375_01055 | gene | open | 166917-168638 | |||
| 2138 | CALIMP010000009.1 | GCA938045375_01056 | gene | open | 168657-169745 | prmC | ||
| 2139 | CALIMP010000009.1 | GCA938045375_01057 | gene | open | 169822-170916 | prfA | ||
| 2140 | CALIMP010000009.1 | GCA938045375_01058 | gene | open | 171136-171348 | rpmE | ||
| 2141 | CALIMP010000009.1 | GCA938045375_01059 | gene | open | 171422-171655 | |||
| 2142 | CALIMP010000009.1 | GCA938045375_01061 | gene | open | 172029-173522 | |||
| 2143 | CALIMP010000009.1 | GCA938045375_01062 | gene | open | 173577-174467 | |||
| 2144 | CALIMP010000009.1 | GCA938045375_01063 | gene | open | 174752-175432 | |||
| 2145 | CALIMP010000009.1 | GCA938045375_01064 | gene | open | 175880-177559 | ettA | ||
| 2146 | CALIMP010000009.1 | GCA938045375_01065 | gene | open | 177652-178662 | |||
| 2147 | CALIMP010000009.1 | GCA938045375_01066 | gene | open | 178715-179644 | |||
| 2148 | CALIMP010000009.1 | GCA938045375_01067 | gene | open | 179645-180178 | |||
| 2149 | CALIMP010000009.1 | GCA938045375_01068 | gene | open | 180175-181230 | folK | ||
| 2150 | CALIMP010000009.1 | GCA938045375_01069 | gene | open | 181240-182199 | folP | ||
| 2151 | CALIMP010000009.1 | GCA938045375_01070 | gene | open | 182263-184863 | ftsH | ||
| 2152 | CALIMP010000009.1 | GCA938045375_01071 | gene | open | 184860-185426 | hpt | ||
| 2153 | CALIMP010000009.1 | GCA938045375_01072 | gene | open | 185484-186749 | |||
| 2154 | CALIMP010000009.1 | GCA938045375_01073 | gene | open | 186756-188006 | |||
| 2155 | CALIMP010000009.1 | GCA938045375_01074 | gene | open | 188006-189832 | |||
| 2156 | CALIMP010000009.1 | GCA938045375_01075 | gene | open | 189846-190754 | |||
| 2157 | CALIMP010000009.1 | GCA938045375_01077 | gene | open | 191106-191972 | trmB | ||
| 2158 | CALIMP010000009.1 | GCA938045375_01078 | gene | open | 192083-193093 | galE | ||
| 2159 | CALIMP010000009.1 | GCA938045375_01081 | gene | open | 193828-194355 | |||
| 2160 | CALIMP010000009.1 | GCA938045375_01082 | gene | open | 194518-195213 | |||
| 2161 | CALIMP010000009.1 | GCA938045375_01083 | gene | open | 195302-196297 | |||
| 2162 | CALIMP010000009.1 | GCA938045375_01084 | gene | open | 196383-196793 | |||
| 2163 | CALIMP010000009.1 | GCA938045375_01085 | gene | open | 196814-197890 | uspA | ||
| 2164 | CALIMP010000009.1 | GCA938045375_01086 | gene | open | 197993-199084 | |||
| 2165 | CALIMP010000009.1 | GCA938045375_01087 | gene | open | 199203-200483 | manA | ||
| 2166 | CALIMP010000009.1 | GCA938045375_01088 | gene | open | 200658-200924 | |||
| 2167 | CALIMP010000009.1 | GCA938045375_01089 | gene | open | 201199-201939 | gpmA | ||
| 2168 | CALIMP010000009.1 | GCA938045375_01090 | gene | open | 201981-203138 | menA | ||
| 2169 | CALIMP010000009.1 | GCA938045375_01091 | gene | open | 203131-204867 | lysS | ||
| 2170 | CALIMP010000009.1 | GCA938045375_01092 | gene | open | 205117-205482 | yhbY | ||
| 2171 | CALIMP010000009.1 | GCA938045375_00947 | gene | open | 29805-29878 | trnP | ||
| 2172 | CALIMP010000009.1 | GCA938045375_00960 | gene | open | 44523-44596 | trnL | ||
| 2173 | CALIMP010000009.1 | GCA938045375_00991 | gene | open | 82544-82630 | trnL | ||
| 2174 | CALIMP010000009.1 | GCA938045375_01000 | gene | open | 94245-94318 | trnR | ||
| 2175 | CALIMP010000009.1 | GCA938045375_01060 | gene | open | 171788-171861 | trnI | ||
| 2176 | CALIMP010000009.1 | GCA938045375_01076 | gene | open | 190903-190974 | trnE | ||
| 2177 | CALIMP010000009.1 | GCA938045375_01079 | gene | open | 193172-193245 | trnD | ||
| 2178 | CALIMP010000009.1 | GCA938045375_01080 | gene | open | 193290-193362 | trnF | ||
| 2179 | CALIMP010000009.1 | GCA938045375_00947 | tRNA | open | 29805-29878 | trnP | tRNA-Pro(tgg) | |
| 2180 | CALIMP010000009.1 | GCA938045375_00960 | tRNA | open | 44523-44596 | trnL | tRNA-Leu(caa) | |
| 2181 | CALIMP010000009.1 | GCA938045375_00991 | tRNA | open | 82544-82630 | trnL | tRNA-Leu(taa) | |
| 2182 | CALIMP010000009.1 | GCA938045375_01000 | tRNA | open | 94245-94318 | trnR | tRNA-Arg(tct) | |
| 2183 | CALIMP010000009.1 | GCA938045375_01060 | tRNA | open | 171788-171861 | trnI | tRNA-Ile2(cat) | |
| 2184 | CALIMP010000009.1 | GCA938045375_01076 | tRNA | open | 190903-190974 | trnE | tRNA-Glu(ttc) | |
| 2185 | CALIMP010000009.1 | GCA938045375_01079 | tRNA | open | 193172-193245 | trnD | tRNA-Asp(gtc) | |
| 2186 | CALIMP010000009.1 | GCA938045375_01080 | tRNA | open | 193290-193362 | trnF | tRNA-Phe(gaa) | |
| 2187 | CALIMP010000010.1 | repeat_region | open | 37771-44267 | CRISPR array with 97 repeats of length 33%2C consensus sequence ATTTCAATCCACGCTCCCCTCGCGGGGAGCGAC and spacer length 34 | |||
| 2188 | CALIMP010000010.1 | GCA938045375_01093 | CDS | open | 272-550 | _na 92_aa | hypothetical protein | |
| 2189 | CALIMP010000010.1 | GCA938045375_01094 | CDS | open | 547-5505 | _na 1652_aa | essC | type VII secretion protein EssC |
| 2190 | CALIMP010000010.1 | GCA938045375_01095 | CDS | open | 5687-5980 | _na 97_aa | ESAT-6-like protein | |
| 2191 | CALIMP010000010.1 | GCA938045375_01096 | CDS | open | 6298-6432 | _na 44_aa | hypothetical protein | |
| 2192 | CALIMP010000010.1 | GCA938045375_01097 | CDS | open | 6442-7677 | _na 411_aa | ycxB | YcxB family protein |
| 2193 | CALIMP010000010.1 | GCA938045375_01098 | CDS | open | 7674-8912 | _na 412_aa | YcxB-like C-terminal domain-containing protein | |
| 2194 | CALIMP010000010.1 | GCA938045375_01099 | CDS | open | 8909-10147 | _na 412_aa | YcxB-like protein domain-containing protein | |
| 2195 | CALIMP010000010.1 | GCA938045375_01100 | CDS | open | 10208-10729 | _na 173_aa | DUF1795 domain-containing protein | |
| 2196 | CALIMP010000010.1 | GCA938045375_01101 | CDS | open | 11053-12336 | _na 427_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 2197 | CALIMP010000010.1 | GCA938045375_01103 | CDS | open | 12690-12980 | _na 96_aa | DUF308 domain-containing protein | |
| 2198 | CALIMP010000010.1 | GCA938045375_01104 | CDS | open | 12932-13273 | _na 113_aa | DUF308 domain-containing protein | |
| 2199 | CALIMP010000010.1 | GCA938045375_01105 | CDS | open | 13376-15664 | _na 762_aa | YhgE/Pip domain-containing protein | |
| 2200 | CALIMP010000010.1 | GCA938045375_01106 | CDS | open | 15661-18348 | _na 895_aa | YhgE/Pip domain-containing protein | |
| 2201 | CALIMP010000010.1 | GCA938045375_01107 | CDS | open | 18603-18911 | _na 102_aa | Antitoxin | |
| 2202 | CALIMP010000010.1 | GCA938045375_01108 | CDS | open | 18908-19258 | _na 116_aa | RelE/StbE family addiction module toxin | |
| 2203 | CALIMP010000010.1 | GCA938045375_01109 | CDS | open | 19348-20472 | _na 374_aa | Serine aminopeptidase S33 domain-containing protein | |
| 2204 | CALIMP010000010.1 | GCA938045375_01110 | CDS | open | 20924-22402 | _na 492_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 2205 | CALIMP010000010.1 | GCA938045375_01111 | CDS | open | 22529-23188 | _na 219_aa | Nudix hydrolase domain-containing protein | |
| 2206 | CALIMP010000010.1 | GCA938045375_01112 | CDS | open | 23309-24010 | _na 233_aa | fHA | FHA domain-containing protein |
| 2207 | CALIMP010000010.1 | GCA938045375_01113 | CDS | open | 24131-24697 | _na 188_aa | FHA domain-containing protein | |
| 2208 | CALIMP010000010.1 | GCA938045375_01114 | CDS | open | 24705-26270 | _na 521_aa | PPM-type phosphatase domain-containing protein | |
| 2209 | CALIMP010000010.1 | GCA938045375_01115 | CDS | open | 26270-27943 | _na 557_aa | ftsW | Cell division protein FtsW |
| 2210 | CALIMP010000010.1 | GCA938045375_01116 | CDS | open | 27940-29418 | _na 492_aa | ftsI | peptidoglycan D%2CD-transpeptidase FtsI family protein |
| 2211 | CALIMP010000010.1 | GCA938045375_01117 | CDS | open | 29405-30490 | _na 361_aa | non-specific serine/threonine protein kinase | |
| 2212 | CALIMP010000010.1 | GCA938045375_01118 | CDS | open | 30487-32523 | _na 678_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 2213 | CALIMP010000010.1 | GCA938045375_01119 | CDS | open | 32543-33772 | _na 409_aa | Sortase | |
| 2214 | CALIMP010000010.1 | GCA938045375_01120 | CDS | open | 33797-34609 | _na 270_aa | DUF881 domain-containing protein | |
| 2215 | CALIMP010000010.1 | GCA938045375_01121 | CDS | open | 34779-35414 | _na 211_aa | crgA | Cell division protein CrgA |
| 2216 | CALIMP010000010.1 | GCA938045375_01122 | CDS | open | 35418-35861 | _na 147_aa | VOC domain-containing protein | |
| 2217 | CALIMP010000010.1 | GCA938045375_01123 | CDS | open | 35915-36646 | _na 243_aa | hypothetical protein | |
| 2218 | CALIMP010000010.1 | GCA938045375_01124 | CDS | open | 36934-37395 | _na 153_aa | Galactoside symporter | |
| 2219 | CALIMP010000010.1 | GCA938045375_01125 | CDS | open | 44451-44741 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 2220 | CALIMP010000010.1 | GCA938045375_01126 | CDS | open | 44749-45780 | _na 343_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 2221 | CALIMP010000010.1 | GCA938045375_01127 | CDS | open | 45780-46469 | _na 229_aa | cas4 | CRISPR-associated protein Cas4 |
| 2222 | CALIMP010000010.1 | GCA938045375_01128 | CDS | open | 46478-47422 | _na 314_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 2223 | CALIMP010000010.1 | GCA938045375_01129 | CDS | open | 47415-49238 | _na 607_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 2224 | CALIMP010000010.1 | GCA938045375_01130 | CDS | open | 49235-49888 | _na 217_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 2225 | CALIMP010000010.1 | GCA938045375_01131 | CDS | open | 49961-52324 | _na 787_aa | CRISPR-associated helicase Cas3' | |
| 2226 | CALIMP010000010.1 | GCA938045375_01132 | CDS | open | 52382-53290 | _na 302_aa | Peptidase S54 rhomboid domain-containing protein | |
| 2227 | CALIMP010000010.1 | GCA938045375_01133 | CDS | open | 53637-53855 | _na 72_aa | DUF4366 domain-containing protein | |
| 2228 | CALIMP010000010.1 | GCA938045375_01134 | CDS | open | 54158-56650 | _na 830_aa | Alpha-1%2C4 glucan phosphorylase | |
| 2229 | CALIMP010000010.1 | GCA938045375_01135 | CDS | open | 56934-57365 | _na 143_aa | Bacterial SCP orthologue domain-containing protein | |
| 2230 | CALIMP010000010.1 | GCA938045375_01136 | CDS | open | 57739-58575 | _na 278_aa | Serine acetyltransferase | |
| 2231 | CALIMP010000010.1 | GCA938045375_01137 | CDS | open | 58807-59763 | _na 318_aa | cysK | cysteine synthase A |
| 2232 | CALIMP010000010.1 | GCA938045375_01138 | CDS | open | 59805-59942 | _na 45_aa | hypothetical protein | |
| 2233 | CALIMP010000010.1 | GCA938045375_01139 | CDS | open | 59997-60950 | _na 317_aa | Phospholipid/glycerol acyltransferase domain-containing protein | |
| 2234 | CALIMP010000010.1 | GCA938045375_01140 | CDS | open | 60952-61725 | _na 257_aa | Phospholipid/glycerol acyltransferase domain-containing protein | |
| 2235 | CALIMP010000010.1 | GCA938045375_01141 | CDS | open | 61722-62555 | _na 277_aa | glycosyltransferase | |
| 2236 | CALIMP010000010.1 | GCA938045375_01142 | CDS | open | 62955-64940 | _na 661_aa | Methionine--tRNA ligase | |
| 2237 | CALIMP010000010.1 | GCA938045375_01143 | CDS | open | 65160-66047 | _na 295_aa | OmpA-like domain-containing protein | |
| 2238 | CALIMP010000010.1 | GCA938045375_01144 | CDS | open | 66022-66282 | _na 86_aa | hypothetical protein | |
| 2239 | CALIMP010000010.1 | GCA938045375_01145 | CDS | open | 66273-67343 | _na 356_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 2240 | CALIMP010000010.1 | GCA938045375_01146 | CDS | open | 67435-69078 | _na 547_aa | hypothetical protein | |
| 2241 | CALIMP010000010.1 | GCA938045375_01147 | CDS | open | 69195-69785 | _na 196_aa | hypothetical protein | |
| 2242 | CALIMP010000010.1 | GCA938045375_01148 | CDS | open | 70117-71886 | _na 589_aa | Dolichyl-phosphate-mannose--protein mannosyltransferase | |
| 2243 | CALIMP010000010.1 | GCA938045375_01149 | CDS | open | 72077-72796 | _na 239_aa | VTT domain-containing protein | |
| 2244 | CALIMP010000010.1 | GCA938045375_01093 | gene | open | 272-550 | |||
| 2245 | CALIMP010000010.1 | GCA938045375_01094 | gene | open | 547-5505 | essC | ||
| 2246 | CALIMP010000010.1 | GCA938045375_01095 | gene | open | 5687-5980 | |||
| 2247 | CALIMP010000010.1 | GCA938045375_01096 | gene | open | 6298-6432 | |||
| 2248 | CALIMP010000010.1 | GCA938045375_01097 | gene | open | 6442-7677 | ycxB | ||
| 2249 | CALIMP010000010.1 | GCA938045375_01098 | gene | open | 7674-8912 | |||
| 2250 | CALIMP010000010.1 | GCA938045375_01099 | gene | open | 8909-10147 | |||
| 2251 | CALIMP010000010.1 | GCA938045375_01100 | gene | open | 10208-10729 | |||
| 2252 | CALIMP010000010.1 | GCA938045375_01101 | gene | open | 11053-12336 | tgt | ||
| 2253 | CALIMP010000010.1 | GCA938045375_01103 | gene | open | 12690-12980 | |||
| 2254 | CALIMP010000010.1 | GCA938045375_01104 | gene | open | 12932-13273 | |||
| 2255 | CALIMP010000010.1 | GCA938045375_01105 | gene | open | 13376-15664 | |||
| 2256 | CALIMP010000010.1 | GCA938045375_01106 | gene | open | 15661-18348 | |||
| 2257 | CALIMP010000010.1 | GCA938045375_01107 | gene | open | 18603-18911 | |||
| 2258 | CALIMP010000010.1 | GCA938045375_01108 | gene | open | 18908-19258 | |||
| 2259 | CALIMP010000010.1 | GCA938045375_01109 | gene | open | 19348-20472 | |||
| 2260 | CALIMP010000010.1 | GCA938045375_01110 | gene | open | 20924-22402 | abc-f | ||
| 2261 | CALIMP010000010.1 | GCA938045375_01111 | gene | open | 22529-23188 | |||
| 2262 | CALIMP010000010.1 | GCA938045375_01112 | gene | open | 23309-24010 | fHA | ||
| 2263 | CALIMP010000010.1 | GCA938045375_01113 | gene | open | 24131-24697 | |||
| 2264 | CALIMP010000010.1 | GCA938045375_01114 | gene | open | 24705-26270 | |||
| 2265 | CALIMP010000010.1 | GCA938045375_01115 | gene | open | 26270-27943 | ftsW | ||
| 2266 | CALIMP010000010.1 | GCA938045375_01116 | gene | open | 27940-29418 | ftsI | ||
| 2267 | CALIMP010000010.1 | GCA938045375_01117 | gene | open | 29405-30490 | |||
| 2268 | CALIMP010000010.1 | GCA938045375_01118 | gene | open | 30487-32523 | pknB | ||
| 2269 | CALIMP010000010.1 | GCA938045375_01119 | gene | open | 32543-33772 | |||
| 2270 | CALIMP010000010.1 | GCA938045375_01120 | gene | open | 33797-34609 | |||
| 2271 | CALIMP010000010.1 | GCA938045375_01121 | gene | open | 34779-35414 | crgA | ||
| 2272 | CALIMP010000010.1 | GCA938045375_01122 | gene | open | 35418-35861 | |||
| 2273 | CALIMP010000010.1 | GCA938045375_01123 | gene | open | 35915-36646 | |||
| 2274 | CALIMP010000010.1 | GCA938045375_01124 | gene | open | 36934-37395 | |||
| 2275 | CALIMP010000010.1 | GCA938045375_01125 | gene | open | 44451-44741 | cas2 | ||
| 2276 | CALIMP010000010.1 | GCA938045375_01126 | gene | open | 44749-45780 | cas1c | ||
| 2277 | CALIMP010000010.1 | GCA938045375_01127 | gene | open | 45780-46469 | cas4 | ||
| 2278 | CALIMP010000010.1 | GCA938045375_01128 | gene | open | 46478-47422 | cas7c | ||
| 2279 | CALIMP010000010.1 | GCA938045375_01129 | gene | open | 47415-49238 | cas8c | ||
| 2280 | CALIMP010000010.1 | GCA938045375_01130 | gene | open | 49235-49888 | cas5c | ||
| 2281 | CALIMP010000010.1 | GCA938045375_01131 | gene | open | 49961-52324 | |||
| 2282 | CALIMP010000010.1 | GCA938045375_01132 | gene | open | 52382-53290 | |||
| 2283 | CALIMP010000010.1 | GCA938045375_01133 | gene | open | 53637-53855 | |||
| 2284 | CALIMP010000010.1 | GCA938045375_01134 | gene | open | 54158-56650 | |||
| 2285 | CALIMP010000010.1 | GCA938045375_01135 | gene | open | 56934-57365 | |||
| 2286 | CALIMP010000010.1 | GCA938045375_01136 | gene | open | 57739-58575 | |||
| 2287 | CALIMP010000010.1 | GCA938045375_01137 | gene | open | 58807-59763 | cysK | ||
| 2288 | CALIMP010000010.1 | GCA938045375_01138 | gene | open | 59805-59942 | |||
| 2289 | CALIMP010000010.1 | GCA938045375_01139 | gene | open | 59997-60950 | |||
| 2290 | CALIMP010000010.1 | GCA938045375_01140 | gene | open | 60952-61725 | |||
| 2291 | CALIMP010000010.1 | GCA938045375_01141 | gene | open | 61722-62555 | |||
| 2292 | CALIMP010000010.1 | GCA938045375_01142 | gene | open | 62955-64940 | |||
| 2293 | CALIMP010000010.1 | GCA938045375_01143 | gene | open | 65160-66047 | |||
| 2294 | CALIMP010000010.1 | GCA938045375_01144 | gene | open | 66022-66282 | |||
| 2295 | CALIMP010000010.1 | GCA938045375_01145 | gene | open | 66273-67343 | rsmI | ||
| 2296 | CALIMP010000010.1 | GCA938045375_01146 | gene | open | 67435-69078 | |||
| 2297 | CALIMP010000010.1 | GCA938045375_01147 | gene | open | 69195-69785 | |||
| 2298 | CALIMP010000010.1 | GCA938045375_01148 | gene | open | 70117-71886 | |||
| 2299 | CALIMP010000010.1 | GCA938045375_01149 | gene | open | 72077-72796 | |||
| 2300 | CALIMP010000010.1 | GCA938045375_01102 | gene | open | 12438-12524 | trnL | ||
| 2301 | CALIMP010000010.1 | GCA938045375_01150 | gene | open | 72919-72994 | trnA | ||
| 2302 | CALIMP010000010.1 | GCA938045375_01102 | tRNA | open | 12438-12524 | trnL | tRNA-Leu(cag) | |
| 2303 | CALIMP010000010.1 | GCA938045375_01150 | tRNA | open | 72919-72994 | trnA | tRNA-Ala(cgc) | |
| 2304 | CALIMP010000011.1 | GCA938045375_01151 | CDS | open | 357-614 | _na 85_aa | hypothetical protein | |
| 2305 | CALIMP010000011.1 | GCA938045375_01152 | CDS | open | 714-2402 | _na 562_aa | DNA 3'-5' helicase | |
| 2306 | CALIMP010000011.1 | GCA938045375_01153 | CDS | open | 2404-4008 | _na 534_aa | ATP-dependent endonuclease | |
| 2307 | CALIMP010000011.1 | GCA938045375_01154 | CDS | open | 4012-5193 | _na 393_aa | HTH cro/C1-type domain-containing protein | |
| 2308 | CALIMP010000011.1 | GCA938045375_01155 | CDS | open | 5441-5899 | _na 152_aa | hypothetical protein | |
| 2309 | CALIMP010000011.1 | GCA938045375_01156 | CDS | open | 6261-6524 | _na 87_aa | hypothetical protein | |
| 2310 | CALIMP010000011.1 | GCA938045375_01157 | CDS | open | 6526-7395 | _na 289_aa | hypothetical protein | |
| 2311 | CALIMP010000011.1 | GCA938045375_01158 | CDS | open | 7538-7930 | _na 130_aa | hypothetical protein | |
| 2312 | CALIMP010000011.1 | GCA938045375_01159 | CDS | open | 8006-8215 | _na 69_aa | hypothetical protein | |
| 2313 | CALIMP010000011.1 | GCA938045375_01160 | CDS | open | 8295-8858 | _na 187_aa | hypothetical protein | |
| 2314 | CALIMP010000011.1 | GCA938045375_01161 | CDS | open | 8904-9104 | _na 66_aa | hypothetical protein | |
| 2315 | CALIMP010000011.1 | GCA938045375_01162 | CDS | open | 9500-9748 | _na 82_aa | hypothetical protein | |
| 2316 | CALIMP010000011.1 | GCA938045375_01163 | CDS | open | 10316-10894 | _na 192_aa | Helix-turn-helix domain-containing protein | |
| 2317 | CALIMP010000011.1 | GCA938045375_01164 | CDS | open | 10915-11385 | _na 156_aa | N-acetyltransferase domain-containing protein | |
| 2318 | CALIMP010000011.1 | GCA938045375_01165 | CDS | open | 11732-14044 | _na 770_aa | DUF4037 domain-containing protein | |
| 2319 | CALIMP010000011.1 | GCA938045375_01166 | CDS | open | 14046-14735 | _na 229_aa | DUF4125 domain-containing protein | |
| 2320 | CALIMP010000011.1 | GCA938045375_01167 | CDS | open | 14905-15708 | _na 267_aa | amidohydrolase family protein | |
| 2321 | CALIMP010000011.1 | GCA938045375_01168 | CDS | open | 15996-17345 | _na 449_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 2322 | CALIMP010000011.1 | GCA938045375_01169 | CDS | open | 17405-17701 | _na 98_aa | hypothetical protein | |
| 2323 | CALIMP010000011.1 | GCA938045375_01170 | CDS | open | 17694-18035 | _na 113_aa | hypothetical protein | |
| 2324 | CALIMP010000011.1 | GCA938045375_01171 | CDS | open | 18032-18670 | _na 212_aa | hypothetical protein | |
| 2325 | CALIMP010000011.1 | GCA938045375_01172 | CDS | open | 18664-19287 | _na 207_aa | hypothetical protein | |
| 2326 | CALIMP010000011.1 | GCA938045375_01173 | CDS | open | 19278-19925 | _na 215_aa | hypothetical protein | |
| 2327 | CALIMP010000011.1 | GCA938045375_01174 | CDS | open | 19916-22024 | _na 702_aa | LXG domain-containing protein | |
| 2328 | CALIMP010000011.1 | GCA938045375_01175 | CDS | open | 22098-23309 | _na 403_aa | hydroxymethylglutaryl-CoA synthase | |
| 2329 | CALIMP010000011.1 | GCA938045375_01176 | CDS | open | 23309-24928 | _na 539_aa | hydroxymethylglutaryl-CoA reductase%2C degradative | |
| 2330 | CALIMP010000011.1 | GCA938045375_01177 | CDS | open | 24928-26277 | _na 449_aa | acetyl-CoA C-acetyltransferase | |
| 2331 | CALIMP010000011.1 | GCA938045375_01178 | CDS | open | 26485-27537 | _na 350_aa | NADP-dependent oxidoreductase domain-containing protein | |
| 2332 | CALIMP010000011.1 | GCA938045375_01179 | CDS | open | 27557-28867 | _na 436_aa | NADPH-dependent FMN reductase-like domain-containing protein | |
| 2333 | CALIMP010000011.1 | GCA938045375_01180 | CDS | open | 28973-29638 | _na 221_aa | NADPH-dependent FMN reductase-like domain-containing protein | |
| 2334 | CALIMP010000011.1 | GCA938045375_01181 | CDS | open | 29741-30742 | _na 333_aa | FAD:protein FMN transferase | |
| 2335 | CALIMP010000011.1 | GCA938045375_01182 | CDS | open | 30773-30931 | _na 52_aa | hypothetical protein | |
| 2336 | CALIMP010000011.1 | GCA938045375_01183 | CDS | open | 30928-31137 | _na 69_aa | hypothetical protein | |
| 2337 | CALIMP010000011.1 | GCA938045375_01184 | CDS | open | 31796-34042 | _na 748_aa | LPXTG-domain-containing protein cell wall anchor domain | |
| 2338 | CALIMP010000011.1 | GCA938045375_01185 | CDS | open | 34859-35965 | _na 368_aa | Excalibur calcium-binding domain-containing protein | |
| 2339 | CALIMP010000011.1 | GCA938045375_01186 | CDS | open | 36202-37011 | _na 269_aa | AB hydrolase-1 domain-containing protein | |
| 2340 | CALIMP010000011.1 | GCA938045375_01187 | CDS | open | 37247-38533 | _na 428_aa | serS | serine--tRNA ligase |
| 2341 | CALIMP010000011.1 | GCA938045375_01189 | CDS | open | 38771-38932 | _na 53_aa | hypothetical protein | |
| 2342 | CALIMP010000011.1 | GCA938045375_01190 | CDS | open | 39039-40328 | _na 429_aa | DAGKc domain-containing protein | |
| 2343 | CALIMP010000011.1 | GCA938045375_01191 | CDS | open | 40402-42078 | _na 558_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 2344 | CALIMP010000011.1 | GCA938045375_01192 | CDS | open | 42280-42849 | _na 189_aa | NAD-dependent epimerase/dehydratase domain-containing protein | |
| 2345 | CALIMP010000011.1 | GCA938045375_01193 | CDS | open | 42854-43306 | _na 150_aa | Coenzyme Q-binding protein COQ10 START domain-containing protein | |
| 2346 | CALIMP010000011.1 | GCA938045375_01194 | CDS | open | 43303-43788 | _na 161_aa | Rrf2 family protein | |
| 2347 | CALIMP010000011.1 | GCA938045375_01195 | CDS | open | 43916-46570 | _na 884_aa | polyribonucleotide nucleotidyltransferase | |
| 2348 | CALIMP010000011.1 | GCA938045375_01196 | CDS | open | 46743-47012 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 2349 | CALIMP010000011.1 | GCA938045375_01197 | CDS | open | 47145-47570 | _na 141_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 2350 | CALIMP010000011.1 | GCA938045375_01198 | CDS | open | 47701-48318 | _na 205_aa | Yip1 domain-containing protein | |
| 2351 | CALIMP010000011.1 | GCA938045375_01200 | CDS | open | 48561-50705 | _na 714_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 2352 | CALIMP010000011.1 | GCA938045375_01201 | CDS | open | 50863-51693 | _na 276_aa | ribonuclease HII | |
| 2353 | CALIMP010000011.1 | GCA938045375_01202 | CDS | open | 51707-52612 | _na 301_aa | lepB | signal peptidase I |
| 2354 | CALIMP010000011.1 | GCA938045375_01203 | CDS | open | 52664-53047 | _na 127_aa | rplS | 50S ribosomal protein L19 |
| 2355 | CALIMP010000011.1 | GCA938045375_01204 | CDS | open | 53337-54926 | _na 529_aa | Amine oxidase domain-containing protein | |
| 2356 | CALIMP010000011.1 | GCA938045375_01205 | CDS | open | 55011-55322 | _na 103_aa | Protein often found in actinomycetes clustered with signal peptidase and/or RNaseHII | |
| 2357 | CALIMP010000011.1 | GCA938045375_01206 | CDS | open | 55435-56850 | _na 471_aa | N-acetyltransferase domain-containing protein | |
| 2358 | CALIMP010000011.1 | GCA938045375_01207 | CDS | open | 56896-58395 | _na 499_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 2359 | CALIMP010000011.1 | GCA938045375_01208 | CDS | open | 58421-59989 | _na 522_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 2360 | CALIMP010000011.1 | GCA938045375_01209 | CDS | open | 60010-60303 | _na 97_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 2361 | CALIMP010000011.1 | GCA938045375_01210 | CDS | open | 60410-61102 | _na 230_aa | spoU | tRNA/rRNA methyltransferase SpoU type domain-containing protein |
| 2362 | CALIMP010000011.1 | GCA938045375_01211 | CDS | open | 61180-62103 | _na 307_aa | Orotate phosphoribosyltransferase | |
| 2363 | CALIMP010000011.1 | GCA938045375_01212 | CDS | open | 62229-63257 | _na 342_aa | DUF559 domain-containing protein | |
| 2364 | CALIMP010000011.1 | GCA938045375_01213 | CDS | open | 63675-66242 | _na 855_aa | HAD ATPase%2C P-type%2C family IC | |
| 2365 | CALIMP010000011.1 | GCA938045375_01214 | CDS | open | 66455-67621 | _na 388_aa | ltrA | Low temperature requirement protein LtrA |
| 2366 | CALIMP010000011.1 | GCA938045375_01215 | CDS | open | 67730-68203 | _na 157_aa | Flavodoxin-like domain-containing protein | |
| 2367 | CALIMP010000011.1 | GCA938045375_01216 | CDS | open | 68239-68481 | _na 80_aa | ABM domain-containing protein | |
| 2368 | CALIMP010000011.1 | GCA938045375_01217 | CDS | open | 68609-69157 | _na 182_aa | Flavodoxin-like fold domain-containing protein | |
| 2369 | CALIMP010000011.1 | GCA938045375_01218 | CDS | open | 69380-70420 | _na 346_aa | Enoyl reductase (ER) domain-containing protein | |
| 2370 | CALIMP010000011.1 | GCA938045375_01219 | CDS | open | 70473-73139 | _na 888_aa | clpB | ATP-dependent chaperone ClpB |
| 2371 | CALIMP010000011.1 | GCA938045375_01220 | CDS | open | 73296-74333 | _na 345_aa | Inosine/uridine-preferring nucleoside hydrolase domain-containing protein | |
| 2372 | CALIMP010000011.1 | GCA938045375_01221 | CDS | open | 74361-75485 | _na 374_aa | SsuA/THI5-like domain-containing protein | |
| 2373 | CALIMP010000011.1 | GCA938045375_01222 | CDS | open | 75730-77526 | _na 598_aa | argS | arginine--tRNA ligase |
| 2374 | CALIMP010000011.1 | GCA938045375_01224 | CDS | open | 77798-78505 | _na 235_aa | ABC transporter domain-containing protein | |
| 2375 | CALIMP010000011.1 | GCA938045375_01225 | CDS | open | 78507-79172 | _na 221_aa | ABC3 transporter permease protein domain-containing protein | |
| 2376 | CALIMP010000011.1 | GCA938045375_01226 | CDS | open | 79138-79575 | _na 145_aa | hypothetical protein | |
| 2377 | CALIMP010000011.1 | GCA938045375_01227 | CDS | open | 79797-80426 | _na 209_aa | CYTH domain-containing protein | |
| 2378 | CALIMP010000011.1 | GCA938045375_01228 | CDS | open | 80496-81518 | _na 340_aa | Thioredoxin domain-containing protein | |
| 2379 | CALIMP010000011.1 | GCA938045375_01229 | CDS | open | 81629-82696 | _na 355_aa | Lipoprotein | |
| 2380 | CALIMP010000011.1 | GCA938045375_01230 | CDS | open | 82689-84380 | _na 563_aa | hypothetical protein | |
| 2381 | CALIMP010000011.1 | GCA938045375_01231 | CDS | open | 84551-85516 | _na 321_aa | peptidylprolyl isomerase | |
| 2382 | CALIMP010000011.1 | GCA938045375_01232 | CDS | open | 85656-86606 | _na 316_aa | AEC family transporter | |
| 2383 | CALIMP010000011.1 | GCA938045375_01233 | CDS | open | 86657-88300 | _na 547_aa | malolactic enzyme | |
| 2384 | CALIMP010000011.1 | GCA938045375_01234 | CDS | open | 88447-89352 | _na 301_aa | HTH lysR-type domain-containing protein | |
| 2385 | CALIMP010000011.1 | GCA938045375_01235 | CDS | open | 89368-90153 | _na 261_aa | nucS | endonuclease NucS |
| 2386 | CALIMP010000011.1 | GCA938045375_01236 | CDS | open | 90166-93135 | _na 989_aa | ABC3 transporter permease protein domain-containing protein | |
| 2387 | CALIMP010000011.1 | GCA938045375_01237 | CDS | open | 93154-94023 | _na 289_aa | ABC transporter domain-containing protein | |
| 2388 | CALIMP010000011.1 | GCA938045375_01238 | CDS | open | 94380-98177 | _na 1265_aa | cydD | thiol reductant ABC exporter subunit CydD |
| 2389 | CALIMP010000011.1 | GCA938045375_01239 | CDS | open | 98201-99517 | _na 438_aa | Aminopeptidase | |
| 2390 | CALIMP010000011.1 | GCA938045375_01240 | CDS | open | 99913-101058 | _na 381_aa | Exo-1%2C3-beta-glucanase D | |
| 2391 | CALIMP010000011.1 | GCA938045375_01241 | CDS | open | 101148-104717 | _na 1189_aa | dnaE | DNA polymerase III subunit alpha |
| 2392 | CALIMP010000011.1 | GCA938045375_01242 | CDS | open | 104760-105707 | _na 315_aa | Pseudouridine synthase | |
| 2393 | CALIMP010000011.1 | GCA938045375_01243 | CDS | open | 105707-106267 | _na 186_aa | Lipoprotein signal peptidase | |
| 2394 | CALIMP010000011.1 | GCA938045375_01244 | CDS | open | 106284-107669 | _na 461_aa | Cell wall synthesis protein Wag31 | |
| 2395 | CALIMP010000011.1 | GCA938045375_01245 | CDS | open | 107854-108144 | _na 96_aa | yggT | YggT family protein |
| 2396 | CALIMP010000011.1 | GCA938045375_01246 | CDS | open | 108255-108731 | _na 158_aa | sepF | Cell division protein SepF |
| 2397 | CALIMP010000011.1 | GCA938045375_01247 | CDS | open | 108759-110069 | _na 436_aa | ftsZ | cell division protein FtsZ |
| 2398 | CALIMP010000011.1 | GCA938045375_01248 | CDS | open | 110311-111480 | _na 389_aa | dusB | tRNA dihydrouridine synthase DusB |
| 2399 | CALIMP010000011.1 | GCA938045375_01249 | CDS | open | 111494-112924 | _na 476_aa | gRS1 | glycine--tRNA ligase |
| 2400 | CALIMP010000011.1 | GCA938045375_01250 | CDS | open | 112979-114259 | _na 426_aa | Glutamate--cysteine ligase | |
| 2401 | CALIMP010000011.1 | GCA938045375_01251 | CDS | open | 114374-116449 | _na 691_aa | Arylsulfotransferase N-terminal domain-containing protein | |
| 2402 | CALIMP010000011.1 | GCA938045375_01252 | CDS | open | 116482-117165 | _na 227_aa | Peptide deformylase | |
| 2403 | CALIMP010000011.1 | GCA938045375_01253 | CDS | open | 117257-118651 | _na 464_aa | glmM | phosphoglucosamine mutase |
| 2404 | CALIMP010000011.1 | GCA938045375_01254 | CDS | open | 118692-121307 | _na 871_aa | pepN | aminopeptidase N |
| 2405 | CALIMP010000011.1 | GCA938045375_01255 | CDS | open | 121395-123089 | _na 564_aa | Ribonuclease J | |
| 2406 | CALIMP010000011.1 | GCA938045375_01256 | CDS | open | 123370-124734 | _na 454_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 2407 | CALIMP010000011.1 | GCA938045375_01257 | CDS | open | 124715-125527 | _na 270_aa | N-acetyltransferase domain-containing protein | |
| 2408 | CALIMP010000011.1 | GCA938045375_01258 | CDS | open | 125661-130292 | _na 1543_aa | DNA 3'-5' helicase | |
| 2409 | CALIMP010000011.1 | GCA938045375_01259 | CDS | open | 130324-135186 | _na 1620_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 2410 | CALIMP010000011.1 | GCA938045375_01260 | CDS | open | 135657-136697 | _na 346_aa | Putative hydrolase or acyltransferase | |
| 2411 | CALIMP010000011.1 | GCA938045375_01261 | CDS | open | 137061-137483 | _na 140_aa | PIN domain-containing protein | |
| 2412 | CALIMP010000011.1 | GCA938045375_01262 | CDS | open | 137480-137695 | _na 71_aa | Prevent-host-death family protein | |
| 2413 | CALIMP010000011.1 | GCA938045375_01263 | CDS | open | 137941-139041 | _na 366_aa | Glycerol dehydrogenase | |
| 2414 | CALIMP010000011.1 | GCA938045375_01264 | CDS | open | 139227-140543 | _na 438_aa | pucR | PucR C-terminal helix-turn-helix domain-containing protein |
| 2415 | CALIMP010000011.1 | GCA938045375_01265 | CDS | open | 140497-141135 | _na 212_aa | gmk | guanylate kinase |
| 2416 | CALIMP010000011.1 | GCA938045375_01266 | CDS | open | 141135-142136 | _na 333_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 2417 | CALIMP010000011.1 | GCA938045375_01267 | CDS | open | 142184-142816 | _na 210_aa | nusB | transcription antitermination factor NusB |
| 2418 | CALIMP010000011.1 | GCA938045375_01268 | CDS | open | 142831-143394 | _na 187_aa | efp | elongation factor P |
| 2419 | CALIMP010000011.1 | GCA938045375_01269 | CDS | open | 143446-144660 | _na 404_aa | Amidohydrolase | |
| 2420 | CALIMP010000011.1 | GCA938045375_01270 | CDS | open | 144665-145393 | _na 242_aa | ABC transmembrane type-1 domain-containing protein | |
| 2421 | CALIMP010000011.1 | GCA938045375_01271 | CDS | open | 145408-146613 | _na 401_aa | ABC transporter domain-containing protein | |
| 2422 | CALIMP010000011.1 | GCA938045375_01272 | CDS | open | 146739-147800 | _na 353_aa | yaeC | YaeC family lipoprotein |
| 2423 | CALIMP010000011.1 | GCA938045375_01273 | CDS | open | 148116-149183 | _na 355_aa | NlpC/P60 domain-containing protein | |
| 2424 | CALIMP010000011.1 | GCA938045375_01151 | gene | open | 357-614 | |||
| 2425 | CALIMP010000011.1 | GCA938045375_01152 | gene | open | 714-2402 | |||
| 2426 | CALIMP010000011.1 | GCA938045375_01153 | gene | open | 2404-4008 | |||
| 2427 | CALIMP010000011.1 | GCA938045375_01154 | gene | open | 4012-5193 | |||
| 2428 | CALIMP010000011.1 | GCA938045375_01155 | gene | open | 5441-5899 | |||
| 2429 | CALIMP010000011.1 | GCA938045375_01156 | gene | open | 6261-6524 | |||
| 2430 | CALIMP010000011.1 | GCA938045375_01157 | gene | open | 6526-7395 | |||
| 2431 | CALIMP010000011.1 | GCA938045375_01158 | gene | open | 7538-7930 | |||
| 2432 | CALIMP010000011.1 | GCA938045375_01159 | gene | open | 8006-8215 | |||
| 2433 | CALIMP010000011.1 | GCA938045375_01160 | gene | open | 8295-8858 | |||
| 2434 | CALIMP010000011.1 | GCA938045375_01161 | gene | open | 8904-9104 | |||
| 2435 | CALIMP010000011.1 | GCA938045375_01162 | gene | open | 9500-9748 | |||
| 2436 | CALIMP010000011.1 | GCA938045375_01163 | gene | open | 10316-10894 | |||
| 2437 | CALIMP010000011.1 | GCA938045375_01164 | gene | open | 10915-11385 | |||
| 2438 | CALIMP010000011.1 | GCA938045375_01165 | gene | open | 11732-14044 | |||
| 2439 | CALIMP010000011.1 | GCA938045375_01166 | gene | open | 14046-14735 | |||
| 2440 | CALIMP010000011.1 | GCA938045375_01167 | gene | open | 14905-15708 | |||
| 2441 | CALIMP010000011.1 | GCA938045375_01168 | gene | open | 15996-17345 | gdhA | ||
| 2442 | CALIMP010000011.1 | GCA938045375_01169 | gene | open | 17405-17701 | |||
| 2443 | CALIMP010000011.1 | GCA938045375_01170 | gene | open | 17694-18035 | |||
| 2444 | CALIMP010000011.1 | GCA938045375_01171 | gene | open | 18032-18670 | |||
| 2445 | CALIMP010000011.1 | GCA938045375_01172 | gene | open | 18664-19287 | |||
| 2446 | CALIMP010000011.1 | GCA938045375_01173 | gene | open | 19278-19925 | |||
| 2447 | CALIMP010000011.1 | GCA938045375_01174 | gene | open | 19916-22024 | |||
| 2448 | CALIMP010000011.1 | GCA938045375_01175 | gene | open | 22098-23309 | |||
| 2449 | CALIMP010000011.1 | GCA938045375_01176 | gene | open | 23309-24928 | |||
| 2450 | CALIMP010000011.1 | GCA938045375_01177 | gene | open | 24928-26277 | |||
| 2451 | CALIMP010000011.1 | GCA938045375_01178 | gene | open | 26485-27537 | |||
| 2452 | CALIMP010000011.1 | GCA938045375_01179 | gene | open | 27557-28867 | |||
| 2453 | CALIMP010000011.1 | GCA938045375_01180 | gene | open | 28973-29638 | |||
| 2454 | CALIMP010000011.1 | GCA938045375_01181 | gene | open | 29741-30742 | |||
| 2455 | CALIMP010000011.1 | GCA938045375_01182 | gene | open | 30773-30931 | |||
| 2456 | CALIMP010000011.1 | GCA938045375_01183 | gene | open | 30928-31137 | |||
| 2457 | CALIMP010000011.1 | GCA938045375_01184 | gene | open | 31796-34042 | |||
| 2458 | CALIMP010000011.1 | GCA938045375_01185 | gene | open | 34859-35965 | |||
| 2459 | CALIMP010000011.1 | GCA938045375_01186 | gene | open | 36202-37011 | |||
| 2460 | CALIMP010000011.1 | GCA938045375_01187 | gene | open | 37247-38533 | serS | ||
| 2461 | CALIMP010000011.1 | GCA938045375_01189 | gene | open | 38771-38932 | |||
| 2462 | CALIMP010000011.1 | GCA938045375_01190 | gene | open | 39039-40328 | |||
| 2463 | CALIMP010000011.1 | GCA938045375_01191 | gene | open | 40402-42078 | pgm | ||
| 2464 | CALIMP010000011.1 | GCA938045375_01192 | gene | open | 42280-42849 | |||
| 2465 | CALIMP010000011.1 | GCA938045375_01193 | gene | open | 42854-43306 | |||
| 2466 | CALIMP010000011.1 | GCA938045375_01194 | gene | open | 43303-43788 | |||
| 2467 | CALIMP010000011.1 | GCA938045375_01195 | gene | open | 43916-46570 | |||
| 2468 | CALIMP010000011.1 | GCA938045375_01196 | gene | open | 46743-47012 | rpsO | ||
| 2469 | CALIMP010000011.1 | GCA938045375_01197 | gene | open | 47145-47570 | mscL | ||
| 2470 | CALIMP010000011.1 | GCA938045375_01198 | gene | open | 47701-48318 | |||
| 2471 | CALIMP010000011.1 | GCA938045375_01200 | gene | open | 48561-50705 | |||
| 2472 | CALIMP010000011.1 | GCA938045375_01201 | gene | open | 50863-51693 | |||
| 2473 | CALIMP010000011.1 | GCA938045375_01202 | gene | open | 51707-52612 | lepB | ||
| 2474 | CALIMP010000011.1 | GCA938045375_01203 | gene | open | 52664-53047 | rplS | ||
| 2475 | CALIMP010000011.1 | GCA938045375_01204 | gene | open | 53337-54926 | |||
| 2476 | CALIMP010000011.1 | GCA938045375_01205 | gene | open | 55011-55322 | |||
| 2477 | CALIMP010000011.1 | GCA938045375_01206 | gene | open | 55435-56850 | |||
| 2478 | CALIMP010000011.1 | GCA938045375_01207 | gene | open | 56896-58395 | gatB | ||
| 2479 | CALIMP010000011.1 | GCA938045375_01208 | gene | open | 58421-59989 | gatA | ||
| 2480 | CALIMP010000011.1 | GCA938045375_01209 | gene | open | 60010-60303 | gatC | ||
| 2481 | CALIMP010000011.1 | GCA938045375_01210 | gene | open | 60410-61102 | spoU | ||
| 2482 | CALIMP010000011.1 | GCA938045375_01211 | gene | open | 61180-62103 | |||
| 2483 | CALIMP010000011.1 | GCA938045375_01212 | gene | open | 62229-63257 | |||
| 2484 | CALIMP010000011.1 | GCA938045375_01213 | gene | open | 63675-66242 | |||
| 2485 | CALIMP010000011.1 | GCA938045375_01214 | gene | open | 66455-67621 | ltrA | ||
| 2486 | CALIMP010000011.1 | GCA938045375_01215 | gene | open | 67730-68203 | |||
| 2487 | CALIMP010000011.1 | GCA938045375_01216 | gene | open | 68239-68481 | |||
| 2488 | CALIMP010000011.1 | GCA938045375_01217 | gene | open | 68609-69157 | |||
| 2489 | CALIMP010000011.1 | GCA938045375_01218 | gene | open | 69380-70420 | |||
| 2490 | CALIMP010000011.1 | GCA938045375_01219 | gene | open | 70473-73139 | clpB | ||
| 2491 | CALIMP010000011.1 | GCA938045375_01220 | gene | open | 73296-74333 | |||
| 2492 | CALIMP010000011.1 | GCA938045375_01221 | gene | open | 74361-75485 | |||
| 2493 | CALIMP010000011.1 | GCA938045375_01222 | gene | open | 75730-77526 | argS | ||
| 2494 | CALIMP010000011.1 | GCA938045375_01224 | gene | open | 77798-78505 | |||
| 2495 | CALIMP010000011.1 | GCA938045375_01225 | gene | open | 78507-79172 | |||
| 2496 | CALIMP010000011.1 | GCA938045375_01226 | gene | open | 79138-79575 | |||
| 2497 | CALIMP010000011.1 | GCA938045375_01227 | gene | open | 79797-80426 | |||
| 2498 | CALIMP010000011.1 | GCA938045375_01228 | gene | open | 80496-81518 | |||
| 2499 | CALIMP010000011.1 | GCA938045375_01229 | gene | open | 81629-82696 | |||
| 2500 | CALIMP010000011.1 | GCA938045375_01230 | gene | open | 82689-84380 |

