BAKTAGenome Explorer: Porphyromonas pasteri (GCA_946222795.1)
Select a Genome:
|
BAKTA Annotations for GCA_946222795.1
|
Search & Sort all 3380 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | CAMIKB010000033.1 | GCA946222795_00745 | gene | open | 2948-3694 | fabG | ||
| 1502 | CAMIKB010000033.1 | GCA946222795_00746 | gene | open | 3706-4320 | tetR | ||
| 1503 | CAMIKB010000033.1 | GCA946222795_00747 | gene | open | 5039-11539 | |||
| 1504 | CAMIKB010000033.1 | GCA946222795_00748 | gene | open | 12271-12825 | aaxB | ||
| 1505 | CAMIKB010000033.1 | GCA946222795_00749 | gene | open | 12966-13853 | |||
| 1506 | CAMIKB010000033.1 | GCA946222795_00750 | gene | open | 13933-14586 | |||
| 1507 | CAMIKB010000033.1 | GCA946222795_00751 | gene | open | 14866-15495 | |||
| 1508 | CAMIKB010000033.1 | GCA946222795_00752 | gene | open | 15770-17128 | |||
| 1509 | CAMIKB010000033.1 | GCA946222795_00753 | gene | open | 17212-17991 | |||
| 1510 | CAMIKB010000033.1 | GCA946222795_00754 | gene | open | 17997-19775 | |||
| 1511 | CAMIKB010000033.1 | GCA946222795_00755 | gene | open | 19820-20683 | |||
| 1512 | CAMIKB010000034.1 | GCA946222795_00756 | CDS | open | 604-1947 | _na 447_aa | Leucine-rich repeat domain-containing protein | |
| 1513 | CAMIKB010000034.1 | GCA946222795_00757 | CDS | open | 1983-3377 | _na 464_aa | DUF5074 domain-containing protein | |
| 1514 | CAMIKB010000034.1 | GCA946222795_00758 | CDS | open | 3398-4429 | _na 343_aa | PKD domain-containing protein | |
| 1515 | CAMIKB010000034.1 | GCA946222795_00759 | CDS | open | 4440-5606 | _na 388_aa | PQQ enzyme repeat protein | |
| 1516 | CAMIKB010000034.1 | GCA946222795_00760 | CDS | open | 5603-7618 | _na 671_aa | TonB-dependent receptor | |
| 1517 | CAMIKB010000034.1 | GCA946222795_00761 | CDS | open | 8489-10165 | _na 558_aa | Starch synthase | |
| 1518 | CAMIKB010000034.1 | GCA946222795_00762 | CDS | open | 10229-10648 | _na 139_aa | S4 domain protein | |
| 1519 | CAMIKB010000034.1 | GCA946222795_00763 | CDS | open | 10690-10956 | _na 88_aa | pqqD | PqqD family protein |
| 1520 | CAMIKB010000034.1 | GCA946222795_00764 | CDS | open | 10953-12095 | _na 380_aa | Nucleotidyltransferase family protein | |
| 1521 | CAMIKB010000034.1 | GCA946222795_00765 | CDS | open | 12092-13702 | _na 536_aa | ABC transporter%2C ATP-binding protein | |
| 1522 | CAMIKB010000034.1 | GCA946222795_00766 | CDS | open | 13775-14104 | _na 109_aa | Putative FeS assembly SUF system protein | |
| 1523 | CAMIKB010000034.1 | GCA946222795_00767 | CDS | open | 14110-14907 | _na 265_aa | Ser/Thr phosphatase family protein | |
| 1524 | CAMIKB010000034.1 | GCA946222795_00768 | CDS | open | 15029-16723 | _na 564_aa | WG repeat-containing protein | |
| 1525 | CAMIKB010000034.1 | GCA946222795_00769 | CDS | open | 16757-16942 | _na 61_aa | hypothetical protein | |
| 1526 | CAMIKB010000034.1 | GCA946222795_00770 | CDS | open | 16986-18107 | _na 373_aa | Lipoprotein | |
| 1527 | CAMIKB010000034.1 | GCA946222795_00771 | CDS | open | 18136-18258 | _na 40_aa | hypothetical protein | |
| 1528 | CAMIKB010000034.1 | GCA946222795_00756 | gene | open | 604-1947 | |||
| 1529 | CAMIKB010000034.1 | GCA946222795_00757 | gene | open | 1983-3377 | |||
| 1530 | CAMIKB010000034.1 | GCA946222795_00758 | gene | open | 3398-4429 | |||
| 1531 | CAMIKB010000034.1 | GCA946222795_00759 | gene | open | 4440-5606 | |||
| 1532 | CAMIKB010000034.1 | GCA946222795_00760 | gene | open | 5603-7618 | |||
| 1533 | CAMIKB010000034.1 | GCA946222795_00761 | gene | open | 8489-10165 | |||
| 1534 | CAMIKB010000034.1 | GCA946222795_00762 | gene | open | 10229-10648 | |||
| 1535 | CAMIKB010000034.1 | GCA946222795_00763 | gene | open | 10690-10956 | pqqD | ||
| 1536 | CAMIKB010000034.1 | GCA946222795_00764 | gene | open | 10953-12095 | |||
| 1537 | CAMIKB010000034.1 | GCA946222795_00765 | gene | open | 12092-13702 | |||
| 1538 | CAMIKB010000034.1 | GCA946222795_00766 | gene | open | 13775-14104 | |||
| 1539 | CAMIKB010000034.1 | GCA946222795_00767 | gene | open | 14110-14907 | |||
| 1540 | CAMIKB010000034.1 | GCA946222795_00768 | gene | open | 15029-16723 | |||
| 1541 | CAMIKB010000034.1 | GCA946222795_00769 | gene | open | 16757-16942 | |||
| 1542 | CAMIKB010000034.1 | GCA946222795_00770 | gene | open | 16986-18107 | |||
| 1543 | CAMIKB010000034.1 | GCA946222795_00771 | gene | open | 18136-18258 | |||
| 1544 | CAMIKB010000035.1 | GCA946222795_00772 | CDS | open | 149-991 | _na 280_aa | murI | glutamate racemase |
| 1545 | CAMIKB010000035.1 | GCA946222795_00773 | CDS | open | 1017-1604 | _na 195_aa | Chromate transport protein | |
| 1546 | CAMIKB010000035.1 | GCA946222795_00774 | CDS | open | 1601-2086 | _na 161_aa | Chromate transport protein | |
| 1547 | CAMIKB010000035.1 | GCA946222795_00775 | CDS | open | 2319-4433 | _na 704_aa | Peptidase family M13 | |
| 1548 | CAMIKB010000035.1 | GCA946222795_00776 | CDS | open | 5374-7503 | _na 709_aa | Dipeptidyl-peptidase | |
| 1549 | CAMIKB010000035.1 | GCA946222795_00777 | CDS | open | 7813-8403 | _na 196_aa | ATP synthase%2C subunit E | |
| 1550 | CAMIKB010000035.1 | GCA946222795_00778 | CDS | open | 8432-9412 | _na 326_aa | DUF2764 domain-containing protein | |
| 1551 | CAMIKB010000035.1 | GCA946222795_00779 | CDS | open | 9475-11253 | _na 592_aa | V-type ATP synthase alpha chain | |
| 1552 | CAMIKB010000035.1 | GCA946222795_00780 | CDS | open | 11222-12583 | _na 453_aa | V-type ATP synthase subunit B | |
| 1553 | CAMIKB010000035.1 | GCA946222795_00781 | CDS | open | 12765-13319 | _na 184_aa | Peptidase family S51 | |
| 1554 | CAMIKB010000035.1 | GCA946222795_00782 | CDS | open | 13402-13965 | _na 187_aa | V-type ATP synthase subunit D | |
| 1555 | CAMIKB010000035.1 | GCA946222795_00783 | CDS | open | 13962-15791 | _na 609_aa | V-type ATP synthase subunit I | |
| 1556 | CAMIKB010000035.1 | GCA946222795_00784 | CDS | open | 15831-16289 | _na 152_aa | ATP synthase subunit C | |
| 1557 | CAMIKB010000035.1 | GCA946222795_00785 | CDS | open | 16375-16869 | _na 164_aa | N-acetyltransferase | |
| 1558 | CAMIKB010000035.1 | GCA946222795_00786 | CDS | open | 16972-18396 | _na 474_aa | omlA | SmpA / OmlA family protein |
| 1559 | CAMIKB010000035.1 | GCA946222795_00787 | CDS | open | 18512-19228 | _na 238_aa | DUF4476 domain-containing protein | |
| 1560 | CAMIKB010000035.1 | GCA946222795_00772 | gene | open | 149-991 | murI | ||
| 1561 | CAMIKB010000035.1 | GCA946222795_00773 | gene | open | 1017-1604 | |||
| 1562 | CAMIKB010000035.1 | GCA946222795_00774 | gene | open | 1601-2086 | |||
| 1563 | CAMIKB010000035.1 | GCA946222795_00775 | gene | open | 2319-4433 | |||
| 1564 | CAMIKB010000035.1 | GCA946222795_00776 | gene | open | 5374-7503 | |||
| 1565 | CAMIKB010000035.1 | GCA946222795_00777 | gene | open | 7813-8403 | |||
| 1566 | CAMIKB010000035.1 | GCA946222795_00778 | gene | open | 8432-9412 | |||
| 1567 | CAMIKB010000035.1 | GCA946222795_00779 | gene | open | 9475-11253 | |||
| 1568 | CAMIKB010000035.1 | GCA946222795_00780 | gene | open | 11222-12583 | |||
| 1569 | CAMIKB010000035.1 | GCA946222795_00781 | gene | open | 12765-13319 | |||
| 1570 | CAMIKB010000035.1 | GCA946222795_00782 | gene | open | 13402-13965 | |||
| 1571 | CAMIKB010000035.1 | GCA946222795_00783 | gene | open | 13962-15791 | |||
| 1572 | CAMIKB010000035.1 | GCA946222795_00784 | gene | open | 15831-16289 | |||
| 1573 | CAMIKB010000035.1 | GCA946222795_00785 | gene | open | 16375-16869 | |||
| 1574 | CAMIKB010000035.1 | GCA946222795_00786 | gene | open | 16972-18396 | omlA | ||
| 1575 | CAMIKB010000035.1 | GCA946222795_00787 | gene | open | 18512-19228 | |||
| 1576 | CAMIKB010000036.1 | GCA946222795_00788 | CDS | open | 5-244 | _na 79_aa | hypothetical protein | |
| 1577 | CAMIKB010000036.1 | GCA946222795_00789 | CDS | open | 479-1597 | _na 372_aa | thiH | 2-iminoacetate synthase ThiH |
| 1578 | CAMIKB010000036.1 | GCA946222795_00790 | CDS | open | 1594-2370 | _na 258_aa | Thiazole synthase | |
| 1579 | CAMIKB010000036.1 | GCA946222795_00791 | CDS | open | 2385-4319 | _na 644_aa | Thiamine-phosphate synthase | |
| 1580 | CAMIKB010000036.1 | GCA946222795_00792 | CDS | open | 4325-6136 | _na 603_aa | thiC | phosphomethylpyrimidine synthase ThiC |
| 1581 | CAMIKB010000036.1 | GCA946222795_00793 | CDS | open | 6176-6379 | _na 67_aa | thiS | Thiamine biosynthesis protein ThiS |
| 1582 | CAMIKB010000036.1 | GCA946222795_00794 | CDS | open | 7080-8291 | _na 403_aa | DNA/RNA non-specific endonuclease | |
| 1583 | CAMIKB010000036.1 | GCA946222795_00795 | CDS | open | 8304-10058 | _na 584_aa | LTD domain-containing protein | |
| 1584 | CAMIKB010000036.1 | GCA946222795_00796 | CDS | open | 10105-10920 | _na 271_aa | DUF5689 domain-containing protein | |
| 1585 | CAMIKB010000036.1 | GCA946222795_00797 | CDS | open | 10942-13716 | _na 924_aa | TonB-dependent receptor | |
| 1586 | CAMIKB010000036.1 | GCA946222795_00798 | CDS | open | 13940-14986 | _na 348_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 1587 | CAMIKB010000036.1 | GCA946222795_00799 | CDS | open | 15149-15361 | _na 70_aa | hypothetical protein | |
| 1588 | CAMIKB010000036.1 | GCA946222795_00800 | CDS | open | 15260-15970 | _na 236_aa | comF | ComF family protein |
| 1589 | CAMIKB010000036.1 | GCA946222795_00801 | CDS | open | 15951-16466 | _na 171_aa | recX | Regulatory protein RecX |
| 1590 | CAMIKB010000036.1 | GCA946222795_00802 | CDS | open | 16463-17365 | _na 300_aa | peptide chain release factor N(5)-glutamine methyltransferase | |
| 1591 | CAMIKB010000036.1 | GCA946222795_00803 | CDS | open | 17410-18393 | _na 327_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 1592 | CAMIKB010000036.1 | GCA946222795_00788 | gene | open | 5-244 | |||
| 1593 | CAMIKB010000036.1 | GCA946222795_00789 | gene | open | 479-1597 | thiH | ||
| 1594 | CAMIKB010000036.1 | GCA946222795_00790 | gene | open | 1594-2370 | |||
| 1595 | CAMIKB010000036.1 | GCA946222795_00791 | gene | open | 2385-4319 | |||
| 1596 | CAMIKB010000036.1 | GCA946222795_00792 | gene | open | 4325-6136 | thiC | ||
| 1597 | CAMIKB010000036.1 | GCA946222795_00793 | gene | open | 6176-6379 | thiS | ||
| 1598 | CAMIKB010000036.1 | GCA946222795_00794 | gene | open | 7080-8291 | |||
| 1599 | CAMIKB010000036.1 | GCA946222795_00795 | gene | open | 8304-10058 | |||
| 1600 | CAMIKB010000036.1 | GCA946222795_00796 | gene | open | 10105-10920 | |||
| 1601 | CAMIKB010000036.1 | GCA946222795_00797 | gene | open | 10942-13716 | |||
| 1602 | CAMIKB010000036.1 | GCA946222795_00798 | gene | open | 13940-14986 | |||
| 1603 | CAMIKB010000036.1 | GCA946222795_00799 | gene | open | 15149-15361 | |||
| 1604 | CAMIKB010000036.1 | GCA946222795_00800 | gene | open | 15260-15970 | comF | ||
| 1605 | CAMIKB010000036.1 | GCA946222795_00801 | gene | open | 15951-16466 | recX | ||
| 1606 | CAMIKB010000036.1 | GCA946222795_00802 | gene | open | 16463-17365 | |||
| 1607 | CAMIKB010000036.1 | GCA946222795_00803 | gene | open | 17410-18393 | ribD | ||
| 1608 | CAMIKB010000037.1 | GCA946222795_00804 | CDS | open | 9-1154 | _na 381_aa | Phosphoribosylamine--glycine ligase | |
| 1609 | CAMIKB010000037.1 | GCA946222795_00805 | CDS | open | 1277-2281 | _na 334_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 1610 | CAMIKB010000037.1 | GCA946222795_00806 | CDS | open | 2351-3418 | _na 355_aa | Smr domain-containing protein | |
| 1611 | CAMIKB010000037.1 | GCA946222795_00807 | CDS | open | 3428-3883 | _na 151_aa | Adenylate cyclase | |
| 1612 | CAMIKB010000037.1 | GCA946222795_00808 | CDS | open | 3974-4549 | _na 191_aa | Superoxide dismutase | |
| 1613 | CAMIKB010000037.1 | GCA946222795_00809 | CDS | open | 4646-4894 | _na 82_aa | hypothetical protein | |
| 1614 | CAMIKB010000037.1 | GCA946222795_00810 | CDS | open | 5020-6114 | _na 364_aa | gcvT | glycine cleavage system aminomethyltransferase GcvT |
| 1615 | CAMIKB010000037.1 | GCA946222795_00811 | CDS | open | 7017-7217 | _na 66_aa | hypothetical protein | |
| 1616 | CAMIKB010000037.1 | GCA946222795_00812 | CDS | open | 7857-10136 | _na 759_aa | Carboxypeptidase regulatory-like domain protein | |
| 1617 | CAMIKB010000037.1 | GCA946222795_00813 | CDS | open | 10603-12495 | _na 630_aa | Cadmium-exporting ATPase | |
| 1618 | CAMIKB010000037.1 | GCA946222795_00814 | CDS | open | 12870-13922 | _na 350_aa | DUF4595 domain-containing protein | |
| 1619 | CAMIKB010000037.1 | GCA946222795_00815 | CDS | open | 13968-14663 | _na 231_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 1620 | CAMIKB010000037.1 | GCA946222795_00816 | CDS | open | 14803-16302 | _na 499_aa | Succinate CoA transferase | |
| 1621 | CAMIKB010000037.1 | GCA946222795_00817 | CDS | open | 16428-17354 | _na 308_aa | Amidinotransferase | |
| 1622 | CAMIKB010000037.1 | GCA946222795_00804 | gene | open | 9-1154 | |||
| 1623 | CAMIKB010000037.1 | GCA946222795_00805 | gene | open | 1277-2281 | |||
| 1624 | CAMIKB010000037.1 | GCA946222795_00806 | gene | open | 2351-3418 | |||
| 1625 | CAMIKB010000037.1 | GCA946222795_00807 | gene | open | 3428-3883 | |||
| 1626 | CAMIKB010000037.1 | GCA946222795_00808 | gene | open | 3974-4549 | |||
| 1627 | CAMIKB010000037.1 | GCA946222795_00809 | gene | open | 4646-4894 | |||
| 1628 | CAMIKB010000037.1 | GCA946222795_00810 | gene | open | 5020-6114 | gcvT | ||
| 1629 | CAMIKB010000037.1 | GCA946222795_00811 | gene | open | 7017-7217 | |||
| 1630 | CAMIKB010000037.1 | GCA946222795_00812 | gene | open | 7857-10136 | |||
| 1631 | CAMIKB010000037.1 | GCA946222795_00813 | gene | open | 10603-12495 | |||
| 1632 | CAMIKB010000037.1 | GCA946222795_00814 | gene | open | 12870-13922 | |||
| 1633 | CAMIKB010000037.1 | GCA946222795_00815 | gene | open | 13968-14663 | trmD | ||
| 1634 | CAMIKB010000037.1 | GCA946222795_00816 | gene | open | 14803-16302 | |||
| 1635 | CAMIKB010000037.1 | GCA946222795_00817 | gene | open | 16428-17354 | |||
| 1636 | CAMIKB010000038.1 | GCA946222795_00818 | CDS | open | 176-613 | _na 145_aa | rpiB | ribose 5-phosphate isomerase B |
| 1637 | CAMIKB010000038.1 | GCA946222795_00819 | CDS | open | 665-1855 | _na 396_aa | ATP synthase F0%2C A subunit | |
| 1638 | CAMIKB010000038.1 | GCA946222795_00820 | CDS | open | 1856-3112 | _na 418_aa | Efflux ABC transporter%2C permease protein | |
| 1639 | CAMIKB010000038.1 | GCA946222795_00821 | CDS | open | 3215-3925 | _na 236_aa | 6-phosphogluconolactonase | |
| 1640 | CAMIKB010000038.1 | GCA946222795_00822 | CDS | open | 3922-5556 | _na 544_aa | zwf | glucose-6-phosphate dehydrogenase |
| 1641 | CAMIKB010000038.1 | GCA946222795_00823 | CDS | open | 5501-6928 | _na 475_aa | gnd | decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase |
| 1642 | CAMIKB010000038.1 | GCA946222795_00824 | CDS | open | 6870-7334 | _na 154_aa | hypothetical protein | |
| 1643 | CAMIKB010000038.1 | GCA946222795_00825 | CDS | open | 7551-9488 | _na 645_aa | TonB-dependent receptor plug domain protein | |
| 1644 | CAMIKB010000038.1 | GCA946222795_00826 | CDS | open | 9539-10723 | _na 394_aa | ATP-grasp domain-containing protein | |
| 1645 | CAMIKB010000038.1 | GCA946222795_00827 | CDS | open | 10801-12240 | _na 479_aa | Putative lipoprotein | |
| 1646 | CAMIKB010000038.1 | GCA946222795_00828 | CDS | open | 12285-12923 | _na 212_aa | Response regulatory domain-containing protein | |
| 1647 | CAMIKB010000038.1 | GCA946222795_00829 | CDS | open | 12930-13577 | _na 215_aa | Glycerophosphoryl diester phosphodiesterase membrane domain-containing protein | |
| 1648 | CAMIKB010000038.1 | GCA946222795_00830 | CDS | open | 14074-14523 | _na 149_aa | DUF2141 domain-containing protein | |
| 1649 | CAMIKB010000038.1 | GCA946222795_00831 | CDS | open | 14563-16695 | _na 710_aa | TonB-dependent receptor-like beta-barrel domain-containing protein | |
| 1650 | CAMIKB010000038.1 | GCA946222795_00832 | CDS | open | 16731-17147 | _na 138_aa | DUF2141 domain-containing protein | |
| 1651 | CAMIKB010000038.1 | GCA946222795_00818 | gene | open | 176-613 | rpiB | ||
| 1652 | CAMIKB010000038.1 | GCA946222795_00819 | gene | open | 665-1855 | |||
| 1653 | CAMIKB010000038.1 | GCA946222795_00820 | gene | open | 1856-3112 | |||
| 1654 | CAMIKB010000038.1 | GCA946222795_00821 | gene | open | 3215-3925 | |||
| 1655 | CAMIKB010000038.1 | GCA946222795_00822 | gene | open | 3922-5556 | zwf | ||
| 1656 | CAMIKB010000038.1 | GCA946222795_00823 | gene | open | 5501-6928 | gnd | ||
| 1657 | CAMIKB010000038.1 | GCA946222795_00824 | gene | open | 6870-7334 | |||
| 1658 | CAMIKB010000038.1 | GCA946222795_00825 | gene | open | 7551-9488 | |||
| 1659 | CAMIKB010000038.1 | GCA946222795_00826 | gene | open | 9539-10723 | |||
| 1660 | CAMIKB010000038.1 | GCA946222795_00827 | gene | open | 10801-12240 | |||
| 1661 | CAMIKB010000038.1 | GCA946222795_00828 | gene | open | 12285-12923 | |||
| 1662 | CAMIKB010000038.1 | GCA946222795_00829 | gene | open | 12930-13577 | |||
| 1663 | CAMIKB010000038.1 | GCA946222795_00830 | gene | open | 14074-14523 | |||
| 1664 | CAMIKB010000038.1 | GCA946222795_00831 | gene | open | 14563-16695 | |||
| 1665 | CAMIKB010000038.1 | GCA946222795_00832 | gene | open | 16731-17147 | |||
| 1666 | CAMIKB010000039.1 | GCA946222795_00833 | CDS | open | 607-2244 | _na 545_aa | groL | chaperonin GroEL |
| 1667 | CAMIKB010000039.1 | GCA946222795_00834 | CDS | open | 2285-2554 | _na 89_aa | Co-chaperonin GroES | |
| 1668 | CAMIKB010000039.1 | GCA946222795_00835 | CDS | open | 3183-4034 | _na 283_aa | dinD | DNA damage-inducible protein D |
| 1669 | CAMIKB010000039.1 | GCA946222795_00836 | CDS | open | 4176-4508 | _na 110_aa | Tat pathway signal sequence domain protein | |
| 1670 | CAMIKB010000039.1 | GCA946222795_00837 | CDS | open | 4889-7048 | _na 719_aa | TonB-dependent receptor | |
| 1671 | CAMIKB010000039.1 | GCA946222795_00838 | CDS | open | 7093-7878 | _na 261_aa | Lipoprotein | |
| 1672 | CAMIKB010000039.1 | GCA946222795_00839 | CDS | open | 7898-8998 | _na 366_aa | Lipoprotein | |
| 1673 | CAMIKB010000039.1 | GCA946222795_00840 | CDS | open | 9549-10673 | _na 374_aa | Fe/B12 periplasmic-binding domain-containing protein | |
| 1674 | CAMIKB010000039.1 | GCA946222795_00841 | CDS | open | 10677-11711 | _na 344_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 1675 | CAMIKB010000039.1 | GCA946222795_00842 | CDS | open | 11698-12732 | _na 344_aa | fhuC | Ferrichrome ABC transporter%2C ATP-binding protein FhuC family protein |
| 1676 | CAMIKB010000039.1 | GCA946222795_00843 | CDS | open | 12748-14853 | _na 701_aa | TonB-dependent heme/hemoglobin receptor family protein | |
| 1677 | CAMIKB010000039.1 | GCA946222795_00844 | CDS | open | 14944-16425 | _na 493_aa | PepSY domain protein | |
| 1678 | CAMIKB010000039.1 | GCA946222795_00845 | CDS | open | 16538-16858 | _na 106_aa | hypothetical protein | |
| 1679 | CAMIKB010000039.1 | GCA946222795_00833 | gene | open | 607-2244 | groL | ||
| 1680 | CAMIKB010000039.1 | GCA946222795_00834 | gene | open | 2285-2554 | |||
| 1681 | CAMIKB010000039.1 | GCA946222795_00835 | gene | open | 3183-4034 | dinD | ||
| 1682 | CAMIKB010000039.1 | GCA946222795_00836 | gene | open | 4176-4508 | |||
| 1683 | CAMIKB010000039.1 | GCA946222795_00837 | gene | open | 4889-7048 | |||
| 1684 | CAMIKB010000039.1 | GCA946222795_00838 | gene | open | 7093-7878 | |||
| 1685 | CAMIKB010000039.1 | GCA946222795_00839 | gene | open | 7898-8998 | |||
| 1686 | CAMIKB010000039.1 | GCA946222795_00840 | gene | open | 9549-10673 | |||
| 1687 | CAMIKB010000039.1 | GCA946222795_00841 | gene | open | 10677-11711 | |||
| 1688 | CAMIKB010000039.1 | GCA946222795_00842 | gene | open | 11698-12732 | fhuC | ||
| 1689 | CAMIKB010000039.1 | GCA946222795_00843 | gene | open | 12748-14853 | |||
| 1690 | CAMIKB010000039.1 | GCA946222795_00844 | gene | open | 14944-16425 | |||
| 1691 | CAMIKB010000039.1 | GCA946222795_00845 | gene | open | 16538-16858 | |||
| 1692 | CAMIKB010000040.1 | GCA946222795_00859 | gene | open | 15384-16622 | rrs | ||
| 1693 | CAMIKB010000040.1 | GCA946222795_00859 | rRNA | open | 15384-16622 | rrs | 16S ribosomal RNA | |
| 1694 | CAMIKB010000040.1 | GCA946222795_00846 | CDS | open | 295-1158 | _na 287_aa | Peptidase%2C S9A/B/C family%2C catalytic domain protein | |
| 1695 | CAMIKB010000040.1 | GCA946222795_00847 | CDS | open | 1258-1839 | _na 193_aa | Outer membrane protein beta-barrel domain protein | |
| 1696 | CAMIKB010000040.1 | GCA946222795_00848 | CDS | open | 1945-4248 | _na 767_aa | Putative alpha-1%2C2-mannosidase | |
| 1697 | CAMIKB010000040.1 | GCA946222795_00849 | CDS | open | 4270-4692 | _na 140_aa | Fe-S metabolism associated domain protein | |
| 1698 | CAMIKB010000040.1 | GCA946222795_00850 | CDS | open | 4711-5703 | _na 330_aa | Peptidase%2C M28 family | |
| 1699 | CAMIKB010000040.1 | GCA946222795_00851 | CDS | open | 5744-6343 | _na 199_aa | Nitroreductase family protein | |
| 1700 | CAMIKB010000040.1 | GCA946222795_00852 | CDS | open | 6357-7136 | _na 259_aa | tatD | Hydrolase%2C TatD family |
| 1701 | CAMIKB010000040.1 | GCA946222795_00853 | CDS | open | 7138-8136 | _na 332_aa | Geranyltranstransferase family protein | |
| 1702 | CAMIKB010000040.1 | GCA946222795_00854 | CDS | open | 8302-9021 | _na 239_aa | TonB-dependent receptor | |
| 1703 | CAMIKB010000040.1 | GCA946222795_00855 | CDS | open | 9274-10599 | _na 441_aa | Peptidase C10 family protein | |
| 1704 | CAMIKB010000040.1 | GCA946222795_00856 | CDS | open | 10624-10920 | _na 98_aa | carboxypeptidase-like regulatory domain-containing protein | |
| 1705 | CAMIKB010000040.1 | GCA946222795_00857 | CDS | open | 11569-12702 | _na 377_aa | HNH endonuclease domain protein | |
| 1706 | CAMIKB010000040.1 | GCA946222795_00858 | CDS | open | 12712-13656 | _na 314_aa | adenine-specific methyltransferase EcoRI family protein | |
| 1707 | CAMIKB010000040.1 | GCA946222795_00846 | gene | open | 295-1158 | |||
| 1708 | CAMIKB010000040.1 | GCA946222795_00847 | gene | open | 1258-1839 | |||
| 1709 | CAMIKB010000040.1 | GCA946222795_00848 | gene | open | 1945-4248 | |||
| 1710 | CAMIKB010000040.1 | GCA946222795_00849 | gene | open | 4270-4692 | |||
| 1711 | CAMIKB010000040.1 | GCA946222795_00850 | gene | open | 4711-5703 | |||
| 1712 | CAMIKB010000040.1 | GCA946222795_00851 | gene | open | 5744-6343 | |||
| 1713 | CAMIKB010000040.1 | GCA946222795_00852 | gene | open | 6357-7136 | tatD | ||
| 1714 | CAMIKB010000040.1 | GCA946222795_00853 | gene | open | 7138-8136 | |||
| 1715 | CAMIKB010000040.1 | GCA946222795_00854 | gene | open | 8302-9021 | |||
| 1716 | CAMIKB010000040.1 | GCA946222795_00855 | gene | open | 9274-10599 | |||
| 1717 | CAMIKB010000040.1 | GCA946222795_00856 | gene | open | 10624-10920 | |||
| 1718 | CAMIKB010000040.1 | GCA946222795_00857 | gene | open | 11569-12702 | |||
| 1719 | CAMIKB010000040.1 | GCA946222795_00858 | gene | open | 12712-13656 | |||
| 1720 | CAMIKB010000041.1 | GCA946222795_00860 | CDS | open | 256-939 | _na 227_aa | Phosphohexomutase | |
| 1721 | CAMIKB010000041.1 | GCA946222795_00861 | CDS | open | 952-1272 | _na 106_aa | merR | Transcriptional regulator%2C MerR family |
| 1722 | CAMIKB010000041.1 | GCA946222795_00862 | CDS | open | 1373-2572 | _na 399_aa | Efflux ABC transporter%2C permease protein | |
| 1723 | CAMIKB010000041.1 | GCA946222795_00863 | CDS | open | 2577-3221 | _na 214_aa | ABC transporter%2C ATP-binding protein | |
| 1724 | CAMIKB010000041.1 | GCA946222795_00864 | CDS | open | 3715-5040 | _na 441_aa | mcrC | McrC family protein |
| 1725 | CAMIKB010000041.1 | GCA946222795_00865 | CDS | open | 5040-6461 | _na 473_aa | mcrB | McrB family protein |
| 1726 | CAMIKB010000041.1 | GCA946222795_00866 | CDS | open | 7062-8273 | _na 403_aa | ABC-2 type transporter | |
| 1727 | CAMIKB010000041.1 | GCA946222795_00867 | CDS | open | 8254-9426 | _na 390_aa | ABC-2 type transporter | |
| 1728 | CAMIKB010000041.1 | GCA946222795_00868 | CDS | open | 9428-10465 | _na 345_aa | Auxiliary transport protein%2C membrane fusion protein family protein | |
| 1729 | CAMIKB010000041.1 | GCA946222795_00869 | CDS | open | 10470-11840 | _na 456_aa | Outer membrane efflux protein | |
| 1730 | CAMIKB010000041.1 | GCA946222795_00870 | CDS | open | 11863-12258 | _na 131_aa | Putative DNA-binding protein | |
| 1731 | CAMIKB010000041.1 | GCA946222795_00871 | CDS | open | 13149-13499 | _na 116_aa | marR | MarR family winged helix-turn-helix transcriptional regulator |
| 1732 | CAMIKB010000041.1 | GCA946222795_00872 | CDS | open | 13608-15548 | _na 646_aa | Class II glutamine amidotransferase | |
| 1733 | CAMIKB010000041.1 | GCA946222795_00873 | CDS | open | 15614-15961 | _na 115_aa | Membrane protein insertase | |
| 1734 | CAMIKB010000041.1 | GCA946222795_00860 | gene | open | 256-939 | |||
| 1735 | CAMIKB010000041.1 | GCA946222795_00861 | gene | open | 952-1272 | merR | ||
| 1736 | CAMIKB010000041.1 | GCA946222795_00862 | gene | open | 1373-2572 | |||
| 1737 | CAMIKB010000041.1 | GCA946222795_00863 | gene | open | 2577-3221 | |||
| 1738 | CAMIKB010000041.1 | GCA946222795_00864 | gene | open | 3715-5040 | mcrC | ||
| 1739 | CAMIKB010000041.1 | GCA946222795_00865 | gene | open | 5040-6461 | mcrB | ||
| 1740 | CAMIKB010000041.1 | GCA946222795_00866 | gene | open | 7062-8273 | |||
| 1741 | CAMIKB010000041.1 | GCA946222795_00867 | gene | open | 8254-9426 | |||
| 1742 | CAMIKB010000041.1 | GCA946222795_00868 | gene | open | 9428-10465 | |||
| 1743 | CAMIKB010000041.1 | GCA946222795_00869 | gene | open | 10470-11840 | |||
| 1744 | CAMIKB010000041.1 | GCA946222795_00870 | gene | open | 11863-12258 | |||
| 1745 | CAMIKB010000041.1 | GCA946222795_00871 | gene | open | 13149-13499 | marR | ||
| 1746 | CAMIKB010000041.1 | GCA946222795_00872 | gene | open | 13608-15548 | |||
| 1747 | CAMIKB010000041.1 | GCA946222795_00873 | gene | open | 15614-15961 | |||
| 1748 | CAMIKB010000042.1 | GCA946222795_00874 | CDS | open | 335-1840 | _na 501_aa | uroporphyrinogen-III C-methyltransferase | |
| 1749 | CAMIKB010000042.1 | GCA946222795_00875 | CDS | open | 1837-2733 | _na 298_aa | hemC | hydroxymethylbilane synthase |
| 1750 | CAMIKB010000042.1 | GCA946222795_00876 | CDS | open | 2723-3994 | _na 423_aa | hemA | glutamyl-tRNA reductase |
| 1751 | CAMIKB010000042.1 | GCA946222795_00877 | CDS | open | 3978-6053 | _na 691_aa | cbiQ | Cobalt ECF transporter T component CbiQ |
| 1752 | CAMIKB010000042.1 | GCA946222795_00878 | CDS | open | 6053-7093 | _na 346_aa | energy-coupling factor ABC transporter permease | |
| 1753 | CAMIKB010000042.1 | GCA946222795_00879 | CDS | open | 7139-8032 | _na 297_aa | cbiK | Cobalt chelatase CbiK |
| 1754 | CAMIKB010000042.1 | GCA946222795_00880 | CDS | open | 8453-9667 | _na 404_aa | Aminopeptidase | |
| 1755 | CAMIKB010000042.1 | GCA946222795_00881 | CDS | open | 9837-10490 | _na 217_aa | Metallo-beta-lactamase domain protein | |
| 1756 | CAMIKB010000042.1 | GCA946222795_00882 | CDS | open | 10538-12622 | _na 694_aa | recQ | ATP-dependent DNA helicase RecQ |
| 1757 | CAMIKB010000042.1 | GCA946222795_00883 | CDS | open | 12641-14410 | _na 589_aa | recJ | single-stranded-DNA-specific exonuclease RecJ |
| 1758 | CAMIKB010000042.1 | GCA946222795_00884 | CDS | open | 14435-15067 | _na 210_aa | DUF4919 domain-containing protein | |
| 1759 | CAMIKB010000042.1 | GCA946222795_00885 | CDS | open | 15529-15627 | _na 32_aa | hypothetical protein | |
| 1760 | CAMIKB010000042.1 | GCA946222795_00874 | gene | open | 335-1840 | |||
| 1761 | CAMIKB010000042.1 | GCA946222795_00875 | gene | open | 1837-2733 | hemC | ||
| 1762 | CAMIKB010000042.1 | GCA946222795_00876 | gene | open | 2723-3994 | hemA | ||
| 1763 | CAMIKB010000042.1 | GCA946222795_00877 | gene | open | 3978-6053 | cbiQ | ||
| 1764 | CAMIKB010000042.1 | GCA946222795_00878 | gene | open | 6053-7093 | |||
| 1765 | CAMIKB010000042.1 | GCA946222795_00879 | gene | open | 7139-8032 | cbiK | ||
| 1766 | CAMIKB010000042.1 | GCA946222795_00880 | gene | open | 8453-9667 | |||
| 1767 | CAMIKB010000042.1 | GCA946222795_00881 | gene | open | 9837-10490 | |||
| 1768 | CAMIKB010000042.1 | GCA946222795_00882 | gene | open | 10538-12622 | recQ | ||
| 1769 | CAMIKB010000042.1 | GCA946222795_00883 | gene | open | 12641-14410 | recJ | ||
| 1770 | CAMIKB010000042.1 | GCA946222795_00884 | gene | open | 14435-15067 | |||
| 1771 | CAMIKB010000042.1 | GCA946222795_00885 | gene | open | 15529-15627 | |||
| 1772 | CAMIKB010000043.1 | GCA946222795_00886 | CDS | open | 146-484 | _na 112_aa | L-serine ammonia-lyase | |
| 1773 | CAMIKB010000043.1 | GCA946222795_00887 | CDS | open | 509-1117 | _na 202_aa | DUF4294 domain-containing protein | |
| 1774 | CAMIKB010000043.1 | GCA946222795_00888 | CDS | open | 1068-3242 | _na 724_aa | PF03629 domain protein | |
| 1775 | CAMIKB010000043.1 | GCA946222795_00889 | CDS | open | 3229-3930 | _na 233_aa | Lipoprotein | |
| 1776 | CAMIKB010000043.1 | GCA946222795_00890 | CDS | open | 3979-5520 | _na 513_aa | Mg chelatase-like protein | |
| 1777 | CAMIKB010000043.1 | GCA946222795_00891 | CDS | open | 5986-6207 | _na 73_aa | PF11387 family protein | |
| 1778 | CAMIKB010000043.1 | GCA946222795_00892 | CDS | open | 6237-7184 | _na 315_aa | Bacteroidetes-specific putative membrane protein | |
| 1779 | CAMIKB010000043.1 | GCA946222795_00893 | CDS | open | 7298-8635 | _na 445_aa | gldK | Putative gliding motility-associated lipoprotein GldK |
| 1780 | CAMIKB010000043.1 | GCA946222795_00894 | CDS | open | 8668-9306 | _na 212_aa | gldL | Gliding motility-associated protein GldL |
| 1781 | CAMIKB010000043.1 | GCA946222795_00895 | CDS | open | 9318-10856 | _na 512_aa | gldM | Gliding motility-associated protein GldM |
| 1782 | CAMIKB010000043.1 | GCA946222795_00896 | CDS | open | 10884-11900 | _na 338_aa | gldN | Gliding motility-associated protein GldN |
| 1783 | CAMIKB010000043.1 | GCA946222795_00897 | CDS | open | 11987-13021 | _na 344_aa | Thiamine pyrophosphate enzyme%2C TPP binding domain protein | |
| 1784 | CAMIKB010000043.1 | GCA946222795_00898 | CDS | open | 13026-14885 | _na 619_aa | 2-oxoacid:acceptor oxidoreductase%2C alpha subunit | |
| 1785 | CAMIKB010000043.1 | GCA946222795_00886 | gene | open | 146-484 | |||
| 1786 | CAMIKB010000043.1 | GCA946222795_00887 | gene | open | 509-1117 | |||
| 1787 | CAMIKB010000043.1 | GCA946222795_00888 | gene | open | 1068-3242 | |||
| 1788 | CAMIKB010000043.1 | GCA946222795_00889 | gene | open | 3229-3930 | |||
| 1789 | CAMIKB010000043.1 | GCA946222795_00890 | gene | open | 3979-5520 | |||
| 1790 | CAMIKB010000043.1 | GCA946222795_00891 | gene | open | 5986-6207 | |||
| 1791 | CAMIKB010000043.1 | GCA946222795_00892 | gene | open | 6237-7184 | |||
| 1792 | CAMIKB010000043.1 | GCA946222795_00893 | gene | open | 7298-8635 | gldK | ||
| 1793 | CAMIKB010000043.1 | GCA946222795_00894 | gene | open | 8668-9306 | gldL | ||
| 1794 | CAMIKB010000043.1 | GCA946222795_00895 | gene | open | 9318-10856 | gldM | ||
| 1795 | CAMIKB010000043.1 | GCA946222795_00896 | gene | open | 10884-11900 | gldN | ||
| 1796 | CAMIKB010000043.1 | GCA946222795_00897 | gene | open | 11987-13021 | |||
| 1797 | CAMIKB010000043.1 | GCA946222795_00898 | gene | open | 13026-14885 | |||
| 1798 | CAMIKB010000044.1 | GCA946222795_00899 | CDS | open | 181-1203 | _na 340_aa | YbbR-like protein | |
| 1799 | CAMIKB010000044.1 | GCA946222795_00900 | CDS | open | 1181-1825 | _na 214_aa | coaE | dephospho-CoA kinase |
| 1800 | CAMIKB010000044.1 | GCA946222795_00901 | CDS | open | 1913-2317 | _na 134_aa | DUF5606 domain-containing protein | |
| 1801 | CAMIKB010000044.1 | GCA946222795_00902 | CDS | open | 3358-4326 | _na 322_aa | Putative TPP-dependent acetoin dehydrogenase complex%2C E1 component%2C alpha subunit | |
| 1802 | CAMIKB010000044.1 | GCA946222795_00903 | CDS | open | 4369-5373 | _na 334_aa | TPP-dependent acetoin dehydrogenase complex%2C E1 component%2C beta subunit | |
| 1803 | CAMIKB010000044.1 | GCA946222795_00904 | CDS | open | 5512-6576 | _na 354_aa | dihydrolipoamide acetyltransferase | |
| 1804 | CAMIKB010000044.1 | GCA946222795_00905 | CDS | open | 6634-8337 | _na 567_aa | lpdA | dihydrolipoyl dehydrogenase |
| 1805 | CAMIKB010000044.1 | GCA946222795_00906 | CDS | open | 8865-14561 | _na 1898_aa | DUF4011 domain-containing protein | |
| 1806 | CAMIKB010000044.1 | GCA946222795_00907 | CDS | open | 14643-15161 | _na 172_aa | nimB | Putative 5-nitroimidazole antibiotic resistance protein NimB |
| 1807 | CAMIKB010000044.1 | GCA946222795_00899 | gene | open | 181-1203 | |||
| 1808 | CAMIKB010000044.1 | GCA946222795_00900 | gene | open | 1181-1825 | coaE | ||
| 1809 | CAMIKB010000044.1 | GCA946222795_00901 | gene | open | 1913-2317 | |||
| 1810 | CAMIKB010000044.1 | GCA946222795_00902 | gene | open | 3358-4326 | |||
| 1811 | CAMIKB010000044.1 | GCA946222795_00903 | gene | open | 4369-5373 | |||
| 1812 | CAMIKB010000044.1 | GCA946222795_00904 | gene | open | 5512-6576 | |||
| 1813 | CAMIKB010000044.1 | GCA946222795_00905 | gene | open | 6634-8337 | lpdA | ||
| 1814 | CAMIKB010000044.1 | GCA946222795_00906 | gene | open | 8865-14561 | |||
| 1815 | CAMIKB010000044.1 | GCA946222795_00907 | gene | open | 14643-15161 | nimB | ||
| 1816 | CAMIKB010000045.1 | repeat_region | open | 16-463 | CRISPR array with 7 repeats of length 33%2C consensus sequence GTTTCAATTCACGCACCCCGGGAGGGGTGCGAC and spacer length 34 | |||
| 1817 | CAMIKB010000045.1 | GCA946222795_00908 | CDS | open | 713-1003 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1818 | CAMIKB010000045.1 | GCA946222795_00909 | CDS | open | 1011-2039 | _na 342_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 1819 | CAMIKB010000045.1 | GCA946222795_00910 | CDS | open | 2317-2967 | _na 216_aa | cas4 | CRISPR-associated protein Cas4 |
| 1820 | CAMIKB010000045.1 | GCA946222795_00911 | CDS | open | 2992-3855 | _na 287_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 1821 | CAMIKB010000045.1 | GCA946222795_00912 | CDS | open | 3879-5807 | _na 642_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 1822 | CAMIKB010000045.1 | GCA946222795_00913 | CDS | open | 5804-6493 | _na 229_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 1823 | CAMIKB010000045.1 | GCA946222795_00914 | CDS | open | 6524-8860 | _na 778_aa | CRISPR-associated helicase Cas3 | |
| 1824 | CAMIKB010000045.1 | GCA946222795_00915 | CDS | open | 9644-10831 | _na 395_aa | AAA domain-containing protein | |
| 1825 | CAMIKB010000045.1 | GCA946222795_00916 | CDS | open | 10870-11535 | _na 221_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 1826 | CAMIKB010000045.1 | GCA946222795_00917 | CDS | open | 11631-13316 | _na 561_aa | Hemerythrin HHE cation binding domain protein | |
| 1827 | CAMIKB010000045.1 | GCA946222795_00918 | CDS | open | 13331-13612 | _na 93_aa | Cupin domain protein | |
| 1828 | CAMIKB010000045.1 | GCA946222795_00919 | CDS | open | 13863-14789 | _na 308_aa | DUF3078 domain-containing protein | |
| 1829 | CAMIKB010000045.1 | GCA946222795_00908 | gene | open | 713-1003 | cas2 | ||
| 1830 | CAMIKB010000045.1 | GCA946222795_00909 | gene | open | 1011-2039 | cas1c | ||
| 1831 | CAMIKB010000045.1 | GCA946222795_00910 | gene | open | 2317-2967 | cas4 | ||
| 1832 | CAMIKB010000045.1 | GCA946222795_00911 | gene | open | 2992-3855 | cas7c | ||
| 1833 | CAMIKB010000045.1 | GCA946222795_00912 | gene | open | 3879-5807 | cas8c | ||
| 1834 | CAMIKB010000045.1 | GCA946222795_00913 | gene | open | 5804-6493 | cas5c | ||
| 1835 | CAMIKB010000045.1 | GCA946222795_00914 | gene | open | 6524-8860 | |||
| 1836 | CAMIKB010000045.1 | GCA946222795_00915 | gene | open | 9644-10831 | |||
| 1837 | CAMIKB010000045.1 | GCA946222795_00916 | gene | open | 10870-11535 | |||
| 1838 | CAMIKB010000045.1 | GCA946222795_00917 | gene | open | 11631-13316 | |||
| 1839 | CAMIKB010000045.1 | GCA946222795_00918 | gene | open | 13331-13612 | |||
| 1840 | CAMIKB010000045.1 | GCA946222795_00919 | gene | open | 13863-14789 | |||
| 1841 | CAMIKB010000046.1 | GCA946222795_00920 | CDS | open | 37-273 | _na 78_aa | hypothetical protein | |
| 1842 | CAMIKB010000046.1 | GCA946222795_00921 | CDS | open | 501-2600 | _na 699_aa | Peptidase%2C S9A/B/C family%2C catalytic domain protein | |
| 1843 | CAMIKB010000046.1 | GCA946222795_00922 | CDS | open | 2646-3308 | _na 220_aa | WbqC-like protein | |
| 1844 | CAMIKB010000046.1 | GCA946222795_00923 | CDS | open | 3305-3973 | _na 222_aa | lepB | signal peptidase I |
| 1845 | CAMIKB010000046.1 | GCA946222795_00924 | CDS | open | 3963-5423 | _na 486_aa | lepB | signal peptidase I |
| 1846 | CAMIKB010000046.1 | GCA946222795_00925 | CDS | open | 5477-6205 | _na 242_aa | 4-hydroxy-tetrahydrodipicolinate reductase | |
| 1847 | CAMIKB010000046.1 | GCA946222795_00926 | CDS | open | 7280-10063 | _na 927_aa | leuS | leucine--tRNA ligase |
| 1848 | CAMIKB010000046.1 | GCA946222795_00927 | CDS | open | 10109-11107 | _na 332_aa | DUF2179 domain-containing protein | |
| 1849 | CAMIKB010000046.1 | GCA946222795_00928 | CDS | open | 11267-12454 | _na 395_aa | pncB | nicotinate phosphoribosyltransferase |
| 1850 | CAMIKB010000046.1 | GCA946222795_00929 | CDS | open | 12460-13071 | _na 203_aa | putative nicotinate-nucleotide adenylyltransferase | |
| 1851 | CAMIKB010000046.1 | GCA946222795_00930 | CDS | open | 13083-14147 | _na 354_aa | Agmatine deiminase | |
| 1852 | CAMIKB010000046.1 | GCA946222795_00931 | CDS | open | 14153-15043 | _na 296_aa | Hydrolase%2C carbon-nitrogen family | |
| 1853 | CAMIKB010000046.1 | GCA946222795_00920 | gene | open | 37-273 | |||
| 1854 | CAMIKB010000046.1 | GCA946222795_00921 | gene | open | 501-2600 | |||
| 1855 | CAMIKB010000046.1 | GCA946222795_00922 | gene | open | 2646-3308 | |||
| 1856 | CAMIKB010000046.1 | GCA946222795_00923 | gene | open | 3305-3973 | lepB | ||
| 1857 | CAMIKB010000046.1 | GCA946222795_00924 | gene | open | 3963-5423 | lepB | ||
| 1858 | CAMIKB010000046.1 | GCA946222795_00925 | gene | open | 5477-6205 | |||
| 1859 | CAMIKB010000046.1 | GCA946222795_00926 | gene | open | 7280-10063 | leuS | ||
| 1860 | CAMIKB010000046.1 | GCA946222795_00927 | gene | open | 10109-11107 | |||
| 1861 | CAMIKB010000046.1 | GCA946222795_00928 | gene | open | 11267-12454 | pncB | ||
| 1862 | CAMIKB010000046.1 | GCA946222795_00929 | gene | open | 12460-13071 | |||
| 1863 | CAMIKB010000046.1 | GCA946222795_00930 | gene | open | 13083-14147 | |||
| 1864 | CAMIKB010000046.1 | GCA946222795_00931 | gene | open | 14153-15043 | |||
| 1865 | CAMIKB010000047.1 | GCA946222795_00932 | CDS | open | 208-1461 | _na 417_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 1866 | CAMIKB010000047.1 | GCA946222795_00933 | CDS | open | 1651-1815 | _na 54_aa | DUF3188 domain-containing protein | |
| 1867 | CAMIKB010000047.1 | GCA946222795_00934 | CDS | open | 1978-3012 | _na 344_aa | Serine aminopeptidase S33 domain-containing protein | |
| 1868 | CAMIKB010000047.1 | GCA946222795_00935 | CDS | open | 3017-4066 | _na 349_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 1869 | CAMIKB010000047.1 | GCA946222795_00936 | CDS | open | 4085-5587 | _na 500_aa | Polysaccharide biosynthesis protein | |
| 1870 | CAMIKB010000047.1 | GCA946222795_00937 | CDS | open | 5941-6696 | _na 251_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 1871 | CAMIKB010000047.1 | GCA946222795_00938 | CDS | open | 6735-7565 | _na 276_aa | Enoyl-[acyl-carrier-protein] reductase [NADH] | |
| 1872 | CAMIKB010000047.1 | GCA946222795_00939 | CDS | open | 7922-9775 | _na 617_aa | Putative leucine Rich repeat-containing domain protein | |
| 1873 | CAMIKB010000047.1 | GCA946222795_00940 | CDS | open | 10298-11695 | _na 465_aa | fumC | class II fumarate hydratase |
| 1874 | CAMIKB010000047.1 | GCA946222795_00941 | CDS | open | 11797-13311 | _na 504_aa | Bifunctional NAD(P)H-hydrate repair enzyme | |
| 1875 | CAMIKB010000047.1 | GCA946222795_00942 | CDS | open | 13361-14185 | _na 274_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 1876 | CAMIKB010000047.1 | GCA946222795_00943 | CDS | open | 14237-14962 | _na 241_aa | 3-hydroxyacyl-[acyl-carrier-protein] dehydratase | |
| 1877 | CAMIKB010000047.1 | GCA946222795_00932 | gene | open | 208-1461 | pnp | ||
| 1878 | CAMIKB010000047.1 | GCA946222795_00933 | gene | open | 1651-1815 | |||
| 1879 | CAMIKB010000047.1 | GCA946222795_00934 | gene | open | 1978-3012 | |||
| 1880 | CAMIKB010000047.1 | GCA946222795_00935 | gene | open | 3017-4066 | ruvB | ||
| 1881 | CAMIKB010000047.1 | GCA946222795_00936 | gene | open | 4085-5587 | |||
| 1882 | CAMIKB010000047.1 | GCA946222795_00937 | gene | open | 5941-6696 | lptB | ||
| 1883 | CAMIKB010000047.1 | GCA946222795_00938 | gene | open | 6735-7565 | |||
| 1884 | CAMIKB010000047.1 | GCA946222795_00939 | gene | open | 7922-9775 | |||
| 1885 | CAMIKB010000047.1 | GCA946222795_00940 | gene | open | 10298-11695 | fumC | ||
| 1886 | CAMIKB010000047.1 | GCA946222795_00941 | gene | open | 11797-13311 | |||
| 1887 | CAMIKB010000047.1 | GCA946222795_00942 | gene | open | 13361-14185 | lpxA | ||
| 1888 | CAMIKB010000047.1 | GCA946222795_00943 | gene | open | 14237-14962 | |||
| 1889 | CAMIKB010000048.1 | GCA946222795_00944 | CDS | open | 474-896 | _na 140_aa | hypothetical protein | |
| 1890 | CAMIKB010000048.1 | GCA946222795_00945 | CDS | open | 1140-1448 | _na 102_aa | hypothetical protein | |
| 1891 | CAMIKB010000048.1 | GCA946222795_00946 | CDS | open | 1546-3165 | _na 539_aa | CTP synthase | |
| 1892 | CAMIKB010000048.1 | GCA946222795_00947 | CDS | open | 3761-4531 | _na 256_aa | DUF3575 domain-containing protein | |
| 1893 | CAMIKB010000048.1 | GCA946222795_00948 | CDS | open | 4609-5400 | _na 263_aa | DUF3575 domain-containing protein | |
| 1894 | CAMIKB010000048.1 | GCA946222795_00949 | CDS | open | 6243-6650 | _na 135_aa | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase | |
| 1895 | CAMIKB010000048.1 | GCA946222795_00950 | CDS | open | 6653-7723 | _na 356_aa | Putative 3-deoxy-7-phosphoheptulonate synthase | |
| 1896 | CAMIKB010000048.1 | GCA946222795_00951 | CDS | open | 7748-9121 | _na 457_aa | DUF7033 domain-containing protein | |
| 1897 | CAMIKB010000048.1 | GCA946222795_00952 | CDS | open | 9132-10256 | _na 374_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 1898 | CAMIKB010000048.1 | GCA946222795_00953 | CDS | open | 10279-11058 | _na 259_aa | Peptidase%2C S54 family | |
| 1899 | CAMIKB010000048.1 | GCA946222795_00954 | CDS | open | 11066-11755 | _na 229_aa | Peptidase%2C S54 family | |
| 1900 | CAMIKB010000048.1 | GCA946222795_00955 | CDS | open | 11983-13263 | _na 426_aa | eno | phosphopyruvate hydratase |
| 1901 | CAMIKB010000048.1 | GCA946222795_00956 | CDS | open | 13514-14437 | _na 307_aa | hypothetical protein | |
| 1902 | CAMIKB010000048.1 | GCA946222795_00944 | gene | open | 474-896 | |||
| 1903 | CAMIKB010000048.1 | GCA946222795_00945 | gene | open | 1140-1448 | |||
| 1904 | CAMIKB010000048.1 | GCA946222795_00946 | gene | open | 1546-3165 | |||
| 1905 | CAMIKB010000048.1 | GCA946222795_00947 | gene | open | 3761-4531 | |||
| 1906 | CAMIKB010000048.1 | GCA946222795_00948 | gene | open | 4609-5400 | |||
| 1907 | CAMIKB010000048.1 | GCA946222795_00949 | gene | open | 6243-6650 | |||
| 1908 | CAMIKB010000048.1 | GCA946222795_00950 | gene | open | 6653-7723 | |||
| 1909 | CAMIKB010000048.1 | GCA946222795_00951 | gene | open | 7748-9121 | |||
| 1910 | CAMIKB010000048.1 | GCA946222795_00952 | gene | open | 9132-10256 | |||
| 1911 | CAMIKB010000048.1 | GCA946222795_00953 | gene | open | 10279-11058 | |||
| 1912 | CAMIKB010000048.1 | GCA946222795_00954 | gene | open | 11066-11755 | |||
| 1913 | CAMIKB010000048.1 | GCA946222795_00955 | gene | open | 11983-13263 | eno | ||
| 1914 | CAMIKB010000048.1 | GCA946222795_00956 | gene | open | 13514-14437 | |||
| 1915 | CAMIKB010000049.1 | GCA946222795_00959 | gene | open | 2209-2395 | Bacteroidales-1 | ||
| 1916 | CAMIKB010000049.1 | GCA946222795_00959 | ncRNA | open | 2209-2395 | Bacteroidales-1 6S-Bacteroidales RNA suggested | ||
| 1917 | CAMIKB010000049.1 | GCA946222795_00957 | CDS | open | 133-402 | _na 89_aa | hypothetical protein | |
| 1918 | CAMIKB010000049.1 | GCA946222795_00958 | CDS | open | 799-2133 | _na 444_aa | UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase | |
| 1919 | CAMIKB010000049.1 | GCA946222795_00960 | CDS | open | 2923-6612 | _na 1229_aa | dnaE | DNA polymerase III subunit alpha |
| 1920 | CAMIKB010000049.1 | GCA946222795_00961 | CDS | open | 6655-6969 | _na 104_aa | trxA | thioredoxin |
| 1921 | CAMIKB010000049.1 | GCA946222795_00962 | CDS | open | 7052-8095 | _na 347_aa | N-acetyltransferase domain-containing protein | |
| 1922 | CAMIKB010000049.1 | GCA946222795_00963 | CDS | open | 8073-8999 | _na 308_aa | Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein | |
| 1923 | CAMIKB010000049.1 | GCA946222795_00964 | CDS | open | 9296-9787 | _na 163_aa | thrE | Threonine/Serine exporter ThrE domain-containing protein |
| 1924 | CAMIKB010000049.1 | GCA946222795_00965 | CDS | open | 9827-10654 | _na 275_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 1925 | CAMIKB010000049.1 | GCA946222795_00967 | CDS | open | 11076-11972 | _na 298_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1926 | CAMIKB010000049.1 | GCA946222795_00968 | CDS | open | 12009-12815 | _na 268_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1927 | CAMIKB010000049.1 | GCA946222795_00969 | CDS | open | 12819-13409 | _na 196_aa | Peptidyl-prolyl cis-trans isomerase | |
| 1928 | CAMIKB010000049.1 | GCA946222795_00970 | CDS | open | 13862-14128 | _na 88_aa | Sugar efflux transporter for intercellular exchange | |
| 1929 | CAMIKB010000049.1 | GCA946222795_00971 | CDS | open | 14343-14600 | _na 85_aa | hypothetical protein | |
| 1930 | CAMIKB010000049.1 | GCA946222795_00957 | gene | open | 133-402 | |||
| 1931 | CAMIKB010000049.1 | GCA946222795_00958 | gene | open | 799-2133 | |||
| 1932 | CAMIKB010000049.1 | GCA946222795_00960 | gene | open | 2923-6612 | dnaE | ||
| 1933 | CAMIKB010000049.1 | GCA946222795_00961 | gene | open | 6655-6969 | trxA | ||
| 1934 | CAMIKB010000049.1 | GCA946222795_00962 | gene | open | 7052-8095 | |||
| 1935 | CAMIKB010000049.1 | GCA946222795_00963 | gene | open | 8073-8999 | |||
| 1936 | CAMIKB010000049.1 | GCA946222795_00964 | gene | open | 9296-9787 | thrE | ||
| 1937 | CAMIKB010000049.1 | GCA946222795_00965 | gene | open | 9827-10654 | |||
| 1938 | CAMIKB010000049.1 | GCA946222795_00967 | gene | open | 11076-11972 | |||
| 1939 | CAMIKB010000049.1 | GCA946222795_00968 | gene | open | 12009-12815 | |||
| 1940 | CAMIKB010000049.1 | GCA946222795_00969 | gene | open | 12819-13409 | |||
| 1941 | CAMIKB010000049.1 | GCA946222795_00970 | gene | open | 13862-14128 | |||
| 1942 | CAMIKB010000049.1 | GCA946222795_00971 | gene | open | 14343-14600 | |||
| 1943 | CAMIKB010000049.1 | GCA946222795_00966 | gene | open | 10760-10831 | trnfM | ||
| 1944 | CAMIKB010000049.1 | GCA946222795_00966 | tRNA | open | 10760-10831 | trnfM | tRNA-fMet(cat) | |
| 1945 | CAMIKB010000050.1 | GCA946222795_00972 | CDS | open | 457-1038 | _na 193_aa | Sigma-70 region 2 | |
| 1946 | CAMIKB010000050.1 | GCA946222795_00973 | CDS | open | 1084-1797 | _na 237_aa | porT | PorT family protein |
| 1947 | CAMIKB010000050.1 | GCA946222795_00974 | CDS | open | 1880-2263 | _na 127_aa | DUF1573 domain-containing protein | |
| 1948 | CAMIKB010000050.1 | GCA946222795_00975 | CDS | open | 2434-2955 | _na 173_aa | yrbI | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family |
| 1949 | CAMIKB010000050.1 | GCA946222795_00976 | CDS | open | 2971-3576 | _na 201_aa | dTTP/UTP pyrophosphatase | |
| 1950 | CAMIKB010000050.1 | GCA946222795_00977 | CDS | open | 3576-4745 | _na 389_aa | nagA | N-acetylglucosamine-6-phosphate deacetylase |
| 1951 | CAMIKB010000050.1 | GCA946222795_00978 | CDS | open | 4930-5757 | _na 275_aa | O-methyltransferase | |
| 1952 | CAMIKB010000050.1 | GCA946222795_00979 | CDS | open | 6016-7116 | _na 366_aa | yeiH | YeiH family sulfate export transporter |
| 1953 | CAMIKB010000050.1 | GCA946222795_00980 | CDS | open | 7381-7911 | _na 176_aa | DNA polymerase III%2C epsilon subunit domain protein | |
| 1954 | CAMIKB010000050.1 | GCA946222795_00981 | CDS | open | 7933-8829 | _na 298_aa | chaN | Haem-binding uptake Tiki superfamily ChaN domain-containing protein |
| 1955 | CAMIKB010000050.1 | GCA946222795_00982 | CDS | open | 8826-11669 | _na 947_aa | Peptidase M16 inactive domain protein | |
| 1956 | CAMIKB010000050.1 | GCA946222795_00983 | CDS | open | 11848-13857 | _na 669_aa | DNA topoisomerase | |
| 1957 | CAMIKB010000050.1 | GCA946222795_00972 | gene | open | 457-1038 | |||
| 1958 | CAMIKB010000050.1 | GCA946222795_00973 | gene | open | 1084-1797 | porT | ||
| 1959 | CAMIKB010000050.1 | GCA946222795_00974 | gene | open | 1880-2263 | |||
| 1960 | CAMIKB010000050.1 | GCA946222795_00975 | gene | open | 2434-2955 | yrbI | ||
| 1961 | CAMIKB010000050.1 | GCA946222795_00976 | gene | open | 2971-3576 | |||
| 1962 | CAMIKB010000050.1 | GCA946222795_00977 | gene | open | 3576-4745 | nagA | ||
| 1963 | CAMIKB010000050.1 | GCA946222795_00978 | gene | open | 4930-5757 | |||
| 1964 | CAMIKB010000050.1 | GCA946222795_00979 | gene | open | 6016-7116 | yeiH | ||
| 1965 | CAMIKB010000050.1 | GCA946222795_00980 | gene | open | 7381-7911 | |||
| 1966 | CAMIKB010000050.1 | GCA946222795_00981 | gene | open | 7933-8829 | chaN | ||
| 1967 | CAMIKB010000050.1 | GCA946222795_00982 | gene | open | 8826-11669 | |||
| 1968 | CAMIKB010000050.1 | GCA946222795_00983 | gene | open | 11848-13857 | |||
| 1969 | CAMIKB010000050.1 | GCA946222795_00984 | gene | open | 14095-14170 | trnG | ||
| 1970 | CAMIKB010000050.1 | GCA946222795_00984 | tRNA | open | 14095-14170 | trnG | tRNA-Gly(gcc) | |
| 1971 | CAMIKB010000051.1 | GCA946222795_00994 | gene | open | 12341-12735 | RNaseP_bact_a | ||
| 1972 | CAMIKB010000051.1 | GCA946222795_00994 | ncRNA | open | 12341-12735 | Bacterial RNase P class A | ||
| 1973 | CAMIKB010000051.1 | GCA946222795_00985 | CDS | open | 237-2813 | _na 858_aa | TonB-dependent receptor | |
| 1974 | CAMIKB010000051.1 | GCA946222795_00986 | CDS | open | 3148-3393 | _na 81_aa | Signal peptide protein%2C YSIRK family | |
| 1975 | CAMIKB010000051.1 | GCA946222795_00987 | CDS | open | 3414-4469 | _na 351_aa | SPFH domain-containing protein | |
| 1976 | CAMIKB010000051.1 | GCA946222795_00988 | CDS | open | 4505-5899 | _na 464_aa | C2H2-type domain-containing protein | |
| 1977 | CAMIKB010000051.1 | GCA946222795_00989 | CDS | open | 6047-6679 | _na 210_aa | Nitroreductase family protein | |
| 1978 | CAMIKB010000051.1 | GCA946222795_00990 | CDS | open | 7236-9482 | _na 748_aa | norZ | Nitric oxide reductase%2C NorZ |
| 1979 | CAMIKB010000051.1 | GCA946222795_00991 | CDS | open | 9763-10470 | _na 235_aa | TIGR00659 family protein | |
| 1980 | CAMIKB010000051.1 | GCA946222795_00992 | CDS | open | 10473-10820 | _na 115_aa | lrgA | LrgA family protein |
| 1981 | CAMIKB010000051.1 | GCA946222795_00993 | CDS | open | 10883-12232 | _na 449_aa | yihY | YihY family protein |
| 1982 | CAMIKB010000051.1 | GCA946222795_00995 | CDS | open | 12752-13864 | _na 370_aa | Iron-sulfur cluster carrier protein | |
| 1983 | CAMIKB010000051.1 | GCA946222795_00996 | CDS | open | 13875-14240 | _na 121_aa | hypothetical protein | |
| 1984 | CAMIKB010000051.1 | GCA946222795_00985 | gene | open | 237-2813 | |||
| 1985 | CAMIKB010000051.1 | GCA946222795_00986 | gene | open | 3148-3393 | |||
| 1986 | CAMIKB010000051.1 | GCA946222795_00987 | gene | open | 3414-4469 | |||
| 1987 | CAMIKB010000051.1 | GCA946222795_00988 | gene | open | 4505-5899 | |||
| 1988 | CAMIKB010000051.1 | GCA946222795_00989 | gene | open | 6047-6679 | |||
| 1989 | CAMIKB010000051.1 | GCA946222795_00990 | gene | open | 7236-9482 | norZ | ||
| 1990 | CAMIKB010000051.1 | GCA946222795_00991 | gene | open | 9763-10470 | |||
| 1991 | CAMIKB010000051.1 | GCA946222795_00992 | gene | open | 10473-10820 | lrgA | ||
| 1992 | CAMIKB010000051.1 | GCA946222795_00993 | gene | open | 10883-12232 | yihY | ||
| 1993 | CAMIKB010000051.1 | GCA946222795_00995 | gene | open | 12752-13864 | |||
| 1994 | CAMIKB010000051.1 | GCA946222795_00996 | gene | open | 13875-14240 | |||
| 1995 | CAMIKB010000052.1 | GCA946222795_00997 | CDS | open | 363-815 | _na 150_aa | Periplasmic heavy metal sensor | |
| 1996 | CAMIKB010000052.1 | GCA946222795_00998 | CDS | open | 830-1258 | _na 142_aa | hypothetical protein | |
| 1997 | CAMIKB010000052.1 | GCA946222795_00999 | CDS | open | 1309-1878 | _na 189_aa | RNA polymerase sigma factor | |
| 1998 | CAMIKB010000052.1 | GCA946222795_01000 | CDS | open | 1881-4547 | _na 888_aa | ATPase family protein | |
| 1999 | CAMIKB010000052.1 | GCA946222795_01001 | CDS | open | 4560-6416 | _na 618_aa | ABC transporter%2C ATP-binding protein | |
| 2000 | CAMIKB010000052.1 | GCA946222795_01002 | CDS | open | 6653-7609 | _na 318_aa | DUF4848 domain-containing protein |

