BAKTAGenome Explorer: Prevotella melaninogenica (GCA_946223055.1)
Select a Genome:
|
BAKTA Annotations for GCA_946223055.1
|
Search & Sort all 5343 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | CAMIDF010000024.1 | GCA946223055_01504 | CDS | open | 8257-8682 | _na 141_aa | hypothetical protein | |
| 3002 | CAMIDF010000024.1 | GCA946223055_01505 | CDS | open | 9577-11589 | _na 670_aa | fbpC | Fructose-1%2C6-bisphosphatase class 3 |
| 3003 | CAMIDF010000024.1 | GCA946223055_01506 | CDS | open | 11593-12750 | _na 385_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 3004 | CAMIDF010000024.1 | GCA946223055_01507 | CDS | open | 12751-13989 | _na 412_aa | Glycosyltransferase | |
| 3005 | CAMIDF010000024.1 | GCA946223055_01508 | CDS | open | 14009-15166 | _na 385_aa | lysA | diaminopimelate decarboxylase |
| 3006 | CAMIDF010000024.1 | GCA946223055_01509 | CDS | open | 15312-16628 | _na 438_aa | metL1 | Aspartokinase |
| 3007 | CAMIDF010000024.1 | GCA946223055_01510 | CDS | open | 16675-17421 | _na 248_aa | ftsE | Putative cell division ATP-binding protein FtsE |
| 3008 | CAMIDF010000024.1 | GCA946223055_01511 | CDS | open | 17679-18413 | _na 244_aa | Bacterial Pleckstrin-like y domain-containing protein | |
| 3009 | CAMIDF010000024.1 | GCA946223055_01512 | CDS | open | 18927-20834 | _na 635_aa | hypothetical protein | |
| 3010 | CAMIDF010000024.1 | GCA946223055_01513 | CDS | open | 21016-22662 | _na 548_aa | ttdA | Fumarate hydratase class I |
| 3011 | CAMIDF010000024.1 | GCA946223055_01514 | CDS | open | 22759-25689 | _na 976_aa | pqqL | Insulinase family protein |
| 3012 | CAMIDF010000024.1 | GCA946223055_01515 | CDS | open | 25737-27590 | _na 617_aa | glgC | DUF6819 domain-containing protein |
| 3013 | CAMIDF010000024.1 | GCA946223055_01516 | CDS | open | 27666-28916 | _na 416_aa | hflX | GTPase HflX |
| 3014 | CAMIDF010000024.1 | GCA946223055_01517 | CDS | open | 29719-30549 | _na 276_aa | Beta-lactamase family protein | |
| 3015 | CAMIDF010000024.1 | GCA946223055_01518 | CDS | open | 30833-31843 | _na 336_aa | murB | UDP-N-acetylmuramate dehydrogenase |
| 3016 | CAMIDF010000024.1 | GCA946223055_01519 | CDS | open | 31994-32851 | _na 285_aa | DUF4348 domain-containing protein | |
| 3017 | CAMIDF010000024.1 | GCA946223055_01520 | CDS | open | 32993-34030 | _na 345_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 3018 | CAMIDF010000024.1 | GCA946223055_01521 | CDS | open | 34667-35158 | _na 163_aa | dnaQ | DNA polymerase III%2C epsilon subunit domain protein |
| 3019 | CAMIDF010000024.1 | GCA946223055_01522 | CDS | open | 35332-36348 | _na 338_aa | acyltransferase | |
| 3020 | CAMIDF010000024.1 | GCA946223055_01523 | CDS | open | 36735-39425 | _na 896_aa | polC | DNA 3'-5' helicase |
| 3021 | CAMIDF010000024.1 | GCA946223055_01524 | CDS | open | 39616-39876 | _na 86_aa | MtN3/saliva family protein | |
| 3022 | CAMIDF010000024.1 | GCA946223055_01525 | CDS | open | 40041-40610 | _na 189_aa | Lipoprotein | |
| 3023 | CAMIDF010000024.1 | GCA946223055_01526 | CDS | open | 40620-41132 | _na 170_aa | Lipoprotein | |
| 3024 | CAMIDF010000024.1 | GCA946223055_01527 | CDS | open | 41491-41865 | _na 124_aa | Lipocalin-like domain-containing protein | |
| 3025 | CAMIDF010000024.1 | GCA946223055_01496 | gene | open | 280-1629 | nqrA | ||
| 3026 | CAMIDF010000024.1 | GCA946223055_01497 | gene | open | 1757-2908 | nqrB | ||
| 3027 | CAMIDF010000024.1 | GCA946223055_01498 | gene | open | 2926-3639 | nqrC | ||
| 3028 | CAMIDF010000024.1 | GCA946223055_01499 | gene | open | 3667-4296 | nqrD | ||
| 3029 | CAMIDF010000024.1 | GCA946223055_01500 | gene | open | 4299-4925 | nqrE | ||
| 3030 | CAMIDF010000024.1 | GCA946223055_01501 | gene | open | 4933-6201 | nqrF | ||
| 3031 | CAMIDF010000024.1 | GCA946223055_01502 | gene | open | 6215-6580 | |||
| 3032 | CAMIDF010000024.1 | GCA946223055_01503 | gene | open | 7253-8074 | |||
| 3033 | CAMIDF010000024.1 | GCA946223055_01504 | gene | open | 8257-8682 | |||
| 3034 | CAMIDF010000024.1 | GCA946223055_01505 | gene | open | 9577-11589 | fbpC | ||
| 3035 | CAMIDF010000024.1 | GCA946223055_01506 | gene | open | 11593-12750 | |||
| 3036 | CAMIDF010000024.1 | GCA946223055_01507 | gene | open | 12751-13989 | |||
| 3037 | CAMIDF010000024.1 | GCA946223055_01508 | gene | open | 14009-15166 | lysA | ||
| 3038 | CAMIDF010000024.1 | GCA946223055_01509 | gene | open | 15312-16628 | metL1 | ||
| 3039 | CAMIDF010000024.1 | GCA946223055_01510 | gene | open | 16675-17421 | ftsE | ||
| 3040 | CAMIDF010000024.1 | GCA946223055_01511 | gene | open | 17679-18413 | |||
| 3041 | CAMIDF010000024.1 | GCA946223055_01512 | gene | open | 18927-20834 | |||
| 3042 | CAMIDF010000024.1 | GCA946223055_01513 | gene | open | 21016-22662 | ttdA | ||
| 3043 | CAMIDF010000024.1 | GCA946223055_01514 | gene | open | 22759-25689 | pqqL | ||
| 3044 | CAMIDF010000024.1 | GCA946223055_01515 | gene | open | 25737-27590 | glgC | ||
| 3045 | CAMIDF010000024.1 | GCA946223055_01516 | gene | open | 27666-28916 | hflX | ||
| 3046 | CAMIDF010000024.1 | GCA946223055_01517 | gene | open | 29719-30549 | |||
| 3047 | CAMIDF010000024.1 | GCA946223055_01518 | gene | open | 30833-31843 | murB | ||
| 3048 | CAMIDF010000024.1 | GCA946223055_01519 | gene | open | 31994-32851 | |||
| 3049 | CAMIDF010000024.1 | GCA946223055_01520 | gene | open | 32993-34030 | pheS | ||
| 3050 | CAMIDF010000024.1 | GCA946223055_01521 | gene | open | 34667-35158 | dnaQ | ||
| 3051 | CAMIDF010000024.1 | GCA946223055_01522 | gene | open | 35332-36348 | |||
| 3052 | CAMIDF010000024.1 | GCA946223055_01523 | gene | open | 36735-39425 | polC | ||
| 3053 | CAMIDF010000024.1 | GCA946223055_01524 | gene | open | 39616-39876 | |||
| 3054 | CAMIDF010000024.1 | GCA946223055_01525 | gene | open | 40041-40610 | |||
| 3055 | CAMIDF010000024.1 | GCA946223055_01526 | gene | open | 40620-41132 | |||
| 3056 | CAMIDF010000024.1 | GCA946223055_01527 | gene | open | 41491-41865 | |||
| 3057 | CAMIDF010000025.1 | GCA946223055_01528 | CDS | open | 481-1473 | _na 330_aa | mdh | Malate dehydrogenase |
| 3058 | CAMIDF010000025.1 | GCA946223055_01529 | CDS | open | 1774-3561 | _na 595_aa | pepP | Metallopeptidase family M24 |
| 3059 | CAMIDF010000025.1 | GCA946223055_01530 | CDS | open | 3806-3997 | _na 63_aa | rpsU | 30S ribosomal protein S21 |
| 3060 | CAMIDF010000025.1 | GCA946223055_01531 | CDS | open | 4069-4953 | _na 294_aa | xerC | Tyrosine recombinase XerC |
| 3061 | CAMIDF010000025.1 | GCA946223055_01532 | CDS | open | 4976-5275 | _na 99_aa | hpf | ribosome hibernation-promoting factor%2C HPF/YfiA family |
| 3062 | CAMIDF010000025.1 | GCA946223055_01537 | CDS | open | 5795-6991 | _na 398_aa | tuf | elongation factor Tu |
| 3063 | CAMIDF010000025.1 | GCA946223055_01539 | CDS | open | 7145-7336 | _na 63_aa | secE | preprotein translocase subunit SecE |
| 3064 | CAMIDF010000025.1 | GCA946223055_01540 | CDS | open | 7348-7896 | _na 182_aa | nusG | transcription termination/antitermination protein NusG |
| 3065 | CAMIDF010000025.1 | GCA946223055_01541 | CDS | open | 7952-8392 | _na 146_aa | rplK | 50S ribosomal protein L11 |
| 3066 | CAMIDF010000025.1 | GCA946223055_01542 | CDS | open | 8414-9106 | _na 230_aa | rplA | 50S ribosomal protein L1 |
| 3067 | CAMIDF010000025.1 | GCA946223055_01543 | CDS | open | 9125-9643 | _na 172_aa | rplJ | 50S ribosomal protein L10 |
| 3068 | CAMIDF010000025.1 | GCA946223055_01544 | CDS | open | 9708-10085 | _na 125_aa | rplL | 50S ribosomal protein L7/L12 |
| 3069 | CAMIDF010000025.1 | GCA946223055_01545 | CDS | open | 10235-14044 | _na 1269_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 3070 | CAMIDF010000025.1 | GCA946223055_01546 | CDS | open | 14073-18443 | _na 1456_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 3071 | CAMIDF010000025.1 | GCA946223055_01547 | CDS | open | 18654-18983 | _na 109_aa | DUF3467 domain-containing protein | |
| 3072 | CAMIDF010000025.1 | GCA946223055_01548 | CDS | open | 19494-20780 | _na 428_aa | Lipoprotein | |
| 3073 | CAMIDF010000025.1 | GCA946223055_01549 | CDS | open | 20796-23615 | _na 939_aa | btuB | TonB-dependent receptor plug domain-containing protein |
| 3074 | CAMIDF010000025.1 | GCA946223055_01550 | CDS | open | 24212-24316 | _na 34_aa | hypothetical protein | |
| 3075 | CAMIDF010000025.1 | GCA946223055_01551 | CDS | open | 24334-24492 | _na 52_aa | hypothetical protein | |
| 3076 | CAMIDF010000025.1 | GCA946223055_01552 | CDS | open | 24510-24893 | _na 127_aa | rpsL | 30S ribosomal protein S12 |
| 3077 | CAMIDF010000025.1 | GCA946223055_01553 | CDS | open | 25112-25588 | _na 158_aa | rpsG | 30S ribosomal protein S7 |
| 3078 | CAMIDF010000025.1 | GCA946223055_01554 | CDS | open | 25616-27733 | _na 705_aa | fusA | elongation factor G |
| 3079 | CAMIDF010000025.1 | GCA946223055_01555 | CDS | open | 27822-28127 | _na 101_aa | rpsJ | 30S ribosomal protein S10 |
| 3080 | CAMIDF010000025.1 | GCA946223055_01556 | CDS | open | 28199-28813 | _na 204_aa | rplC | 50S ribosomal protein L3 |
| 3081 | CAMIDF010000025.1 | GCA946223055_01557 | CDS | open | 28813-29442 | _na 209_aa | rplD | 50S ribosomal protein L4 |
| 3082 | CAMIDF010000025.1 | GCA946223055_01558 | CDS | open | 29465-29809 | _na 114_aa | rplW | 50S ribosomal protein L23 |
| 3083 | CAMIDF010000025.1 | GCA946223055_01559 | CDS | open | 29817-30644 | _na 275_aa | rplB | 50S ribosomal protein L2 |
| 3084 | CAMIDF010000025.1 | GCA946223055_01560 | CDS | open | 30667-30936 | _na 89_aa | rpsS | 30S ribosomal protein S19 |
| 3085 | CAMIDF010000025.1 | GCA946223055_01561 | CDS | open | 30973-31386 | _na 137_aa | rplV | 50S ribosomal protein L22 |
| 3086 | CAMIDF010000025.1 | GCA946223055_01562 | CDS | open | 31395-32123 | _na 242_aa | rpsC | 30S ribosomal protein S3 |
| 3087 | CAMIDF010000025.1 | GCA946223055_01563 | CDS | open | 32138-32566 | _na 142_aa | rplP | 50S ribosomal protein L16 |
| 3088 | CAMIDF010000025.1 | GCA946223055_01564 | CDS | open | 32572-32766 | _na 64_aa | rpmC | 50S ribosomal protein L29 |
| 3089 | CAMIDF010000025.1 | GCA946223055_01565 | CDS | open | 32778-33035 | _na 85_aa | rpsQ | 30S ribosomal protein S17 |
| 3090 | CAMIDF010000025.1 | GCA946223055_01566 | CDS | open | 33038-33403 | _na 121_aa | rplN | 50S ribosomal protein L14 |
| 3091 | CAMIDF010000025.1 | GCA946223055_01567 | CDS | open | 33424-33741 | _na 105_aa | rplX | 50S ribosomal protein L24 |
| 3092 | CAMIDF010000025.1 | GCA946223055_01568 | CDS | open | 33741-34295 | _na 184_aa | rplE | 50S ribosomal protein L5 |
| 3093 | CAMIDF010000025.1 | GCA946223055_01569 | CDS | open | 34301-34603 | _na 100_aa | rpsN | 30S ribosomal protein S14 |
| 3094 | CAMIDF010000025.1 | GCA946223055_01570 | CDS | open | 34729-35124 | _na 131_aa | rpsH | 30S ribosomal protein S8 |
| 3095 | CAMIDF010000025.1 | GCA946223055_01571 | CDS | open | 35139-35705 | _na 188_aa | rplF | 50S ribosomal protein L6 |
| 3096 | CAMIDF010000025.1 | GCA946223055_01572 | CDS | open | 35727-36071 | _na 114_aa | rplR | 50S ribosomal protein L18 |
| 3097 | CAMIDF010000025.1 | GCA946223055_01573 | CDS | open | 36078-36590 | _na 170_aa | rpsE | 30S ribosomal protein S5 |
| 3098 | CAMIDF010000025.1 | GCA946223055_01574 | CDS | open | 36610-36786 | _na 58_aa | rpmD | 50S ribosomal protein L30 |
| 3099 | CAMIDF010000025.1 | GCA946223055_01575 | CDS | open | 36813-37259 | _na 148_aa | rplO | 50S ribosomal protein L15 |
| 3100 | CAMIDF010000025.1 | GCA946223055_01576 | CDS | open | 37264-38604 | _na 446_aa | secY | preprotein translocase subunit SecY |
| 3101 | CAMIDF010000025.1 | GCA946223055_01577 | CDS | open | 38621-39421 | _na 266_aa | map | type I methionyl aminopeptidase |
| 3102 | CAMIDF010000025.1 | GCA946223055_01578 | CDS | open | 39429-39647 | _na 72_aa | infA | translation initiation factor IF-1 |
| 3103 | CAMIDF010000025.1 | GCA946223055_01579 | CDS | open | 39661-39777 | _na 38_aa | ykgO | type B 50S ribosomal protein L36 |
| 3104 | CAMIDF010000025.1 | GCA946223055_01580 | CDS | open | 39815-40255 | _na 146_aa | rpsM | 30S ribosomal protein S13 |
| 3105 | CAMIDF010000025.1 | GCA946223055_01581 | CDS | open | 40276-40665 | _na 129_aa | rpsK | 30S ribosomal protein S11 |
| 3106 | CAMIDF010000025.1 | GCA946223055_01582 | CDS | open | 40703-41311 | _na 202_aa | rpsD | 30S ribosomal protein S4 |
| 3107 | CAMIDF010000025.1 | GCA946223055_01528 | gene | open | 481-1473 | mdh | ||
| 3108 | CAMIDF010000025.1 | GCA946223055_01529 | gene | open | 1774-3561 | pepP | ||
| 3109 | CAMIDF010000025.1 | GCA946223055_01530 | gene | open | 3806-3997 | rpsU | ||
| 3110 | CAMIDF010000025.1 | GCA946223055_01531 | gene | open | 4069-4953 | xerC | ||
| 3111 | CAMIDF010000025.1 | GCA946223055_01532 | gene | open | 4976-5275 | hpf | ||
| 3112 | CAMIDF010000025.1 | GCA946223055_01537 | gene | open | 5795-6991 | tuf | ||
| 3113 | CAMIDF010000025.1 | GCA946223055_01539 | gene | open | 7145-7336 | secE | ||
| 3114 | CAMIDF010000025.1 | GCA946223055_01540 | gene | open | 7348-7896 | nusG | ||
| 3115 | CAMIDF010000025.1 | GCA946223055_01541 | gene | open | 7952-8392 | rplK | ||
| 3116 | CAMIDF010000025.1 | GCA946223055_01542 | gene | open | 8414-9106 | rplA | ||
| 3117 | CAMIDF010000025.1 | GCA946223055_01543 | gene | open | 9125-9643 | rplJ | ||
| 3118 | CAMIDF010000025.1 | GCA946223055_01544 | gene | open | 9708-10085 | rplL | ||
| 3119 | CAMIDF010000025.1 | GCA946223055_01545 | gene | open | 10235-14044 | rpoB | ||
| 3120 | CAMIDF010000025.1 | GCA946223055_01546 | gene | open | 14073-18443 | rpoC | ||
| 3121 | CAMIDF010000025.1 | GCA946223055_01547 | gene | open | 18654-18983 | |||
| 3122 | CAMIDF010000025.1 | GCA946223055_01548 | gene | open | 19494-20780 | |||
| 3123 | CAMIDF010000025.1 | GCA946223055_01549 | gene | open | 20796-23615 | btuB | ||
| 3124 | CAMIDF010000025.1 | GCA946223055_01550 | gene | open | 24212-24316 | |||
| 3125 | CAMIDF010000025.1 | GCA946223055_01551 | gene | open | 24334-24492 | |||
| 3126 | CAMIDF010000025.1 | GCA946223055_01552 | gene | open | 24510-24893 | rpsL | ||
| 3127 | CAMIDF010000025.1 | GCA946223055_01553 | gene | open | 25112-25588 | rpsG | ||
| 3128 | CAMIDF010000025.1 | GCA946223055_01554 | gene | open | 25616-27733 | fusA | ||
| 3129 | CAMIDF010000025.1 | GCA946223055_01555 | gene | open | 27822-28127 | rpsJ | ||
| 3130 | CAMIDF010000025.1 | GCA946223055_01556 | gene | open | 28199-28813 | rplC | ||
| 3131 | CAMIDF010000025.1 | GCA946223055_01557 | gene | open | 28813-29442 | rplD | ||
| 3132 | CAMIDF010000025.1 | GCA946223055_01558 | gene | open | 29465-29809 | rplW | ||
| 3133 | CAMIDF010000025.1 | GCA946223055_01559 | gene | open | 29817-30644 | rplB | ||
| 3134 | CAMIDF010000025.1 | GCA946223055_01560 | gene | open | 30667-30936 | rpsS | ||
| 3135 | CAMIDF010000025.1 | GCA946223055_01561 | gene | open | 30973-31386 | rplV | ||
| 3136 | CAMIDF010000025.1 | GCA946223055_01562 | gene | open | 31395-32123 | rpsC | ||
| 3137 | CAMIDF010000025.1 | GCA946223055_01563 | gene | open | 32138-32566 | rplP | ||
| 3138 | CAMIDF010000025.1 | GCA946223055_01564 | gene | open | 32572-32766 | rpmC | ||
| 3139 | CAMIDF010000025.1 | GCA946223055_01565 | gene | open | 32778-33035 | rpsQ | ||
| 3140 | CAMIDF010000025.1 | GCA946223055_01566 | gene | open | 33038-33403 | rplN | ||
| 3141 | CAMIDF010000025.1 | GCA946223055_01567 | gene | open | 33424-33741 | rplX | ||
| 3142 | CAMIDF010000025.1 | GCA946223055_01568 | gene | open | 33741-34295 | rplE | ||
| 3143 | CAMIDF010000025.1 | GCA946223055_01569 | gene | open | 34301-34603 | rpsN | ||
| 3144 | CAMIDF010000025.1 | GCA946223055_01570 | gene | open | 34729-35124 | rpsH | ||
| 3145 | CAMIDF010000025.1 | GCA946223055_01571 | gene | open | 35139-35705 | rplF | ||
| 3146 | CAMIDF010000025.1 | GCA946223055_01572 | gene | open | 35727-36071 | rplR | ||
| 3147 | CAMIDF010000025.1 | GCA946223055_01573 | gene | open | 36078-36590 | rpsE | ||
| 3148 | CAMIDF010000025.1 | GCA946223055_01574 | gene | open | 36610-36786 | rpmD | ||
| 3149 | CAMIDF010000025.1 | GCA946223055_01575 | gene | open | 36813-37259 | rplO | ||
| 3150 | CAMIDF010000025.1 | GCA946223055_01576 | gene | open | 37264-38604 | secY | ||
| 3151 | CAMIDF010000025.1 | GCA946223055_01577 | gene | open | 38621-39421 | map | ||
| 3152 | CAMIDF010000025.1 | GCA946223055_01578 | gene | open | 39429-39647 | infA | ||
| 3153 | CAMIDF010000025.1 | GCA946223055_01579 | gene | open | 39661-39777 | ykgO | ||
| 3154 | CAMIDF010000025.1 | GCA946223055_01580 | gene | open | 39815-40255 | rpsM | ||
| 3155 | CAMIDF010000025.1 | GCA946223055_01581 | gene | open | 40276-40665 | rpsK | ||
| 3156 | CAMIDF010000025.1 | GCA946223055_01582 | gene | open | 40703-41311 | rpsD | ||
| 3157 | CAMIDF010000025.1 | GCA946223055_01533 | gene | open | 5364-5437 | trnT | ||
| 3158 | CAMIDF010000025.1 | GCA946223055_01534 | gene | open | 5467-5548 | trnY | ||
| 3159 | CAMIDF010000025.1 | GCA946223055_01535 | gene | open | 5567-5639 | trnG | ||
| 3160 | CAMIDF010000025.1 | GCA946223055_01536 | gene | open | 5650-5721 | trnT | ||
| 3161 | CAMIDF010000025.1 | GCA946223055_01538 | gene | open | 7055-7127 | trnW | ||
| 3162 | CAMIDF010000025.1 | GCA946223055_01533 | tRNA | open | 5364-5437 | trnT | tRNA-Thr(tgt) | |
| 3163 | CAMIDF010000025.1 | GCA946223055_01534 | tRNA | open | 5467-5548 | trnY | tRNA-Tyr(gta) | |
| 3164 | CAMIDF010000025.1 | GCA946223055_01535 | tRNA | open | 5567-5639 | trnG | tRNA-Gly(tcc) | |
| 3165 | CAMIDF010000025.1 | GCA946223055_01536 | tRNA | open | 5650-5721 | trnT | tRNA-Thr(ggt) | |
| 3166 | CAMIDF010000025.1 | GCA946223055_01538 | tRNA | open | 7055-7127 | trnW | tRNA-Trp(cca) | |
| 3167 | CAMIDF010000026.1 | GCA946223055_01583 | CDS | open | 194-2629 | _na 811_aa | Spi protease inhibitor domain-containing protein | |
| 3168 | CAMIDF010000026.1 | GCA946223055_01584 | CDS | open | 2742-3098 | _na 118_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 3169 | CAMIDF010000026.1 | GCA946223055_01585 | CDS | open | 3154-4338 | _na 394_aa | queA | Putative S-adenosylmethionine:tRNA ribosyltransferase-isomerase |
| 3170 | CAMIDF010000026.1 | GCA946223055_01586 | CDS | open | 4335-5057 | _na 240_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 3171 | CAMIDF010000026.1 | GCA946223055_01587 | CDS | open | 5079-5939 | _na 286_aa | uppP | undecaprenyl-diphosphate phosphatase |
| 3172 | CAMIDF010000026.1 | GCA946223055_01588 | CDS | open | 5939-6181 | _na 80_aa | Signal peptide protein%2C YSIRK family | |
| 3173 | CAMIDF010000026.1 | GCA946223055_01589 | CDS | open | 6314-7192 | _na 292_aa | ftsX | Cell division protein FtsX |
| 3174 | CAMIDF010000026.1 | GCA946223055_01590 | CDS | open | 7467-7562 | _na 31_aa | hypothetical protein | |
| 3175 | CAMIDF010000026.1 | GCA946223055_01591 | CDS | open | 7825-8508 | _na 227_aa | porT | PorT family protein |
| 3176 | CAMIDF010000026.1 | GCA946223055_01592 | CDS | open | 8684-9982 | _na 432_aa | DUF3078 domain-containing protein | |
| 3177 | CAMIDF010000026.1 | GCA946223055_01593 | CDS | open | 9987-10088 | _na 33_aa | hypothetical protein | |
| 3178 | CAMIDF010000026.1 | GCA946223055_01594 | CDS | open | 10330-13815 | _na 1161_aa | cirA | TonB-dependent receptor plug domain-containing protein |
| 3179 | CAMIDF010000026.1 | GCA946223055_01595 | CDS | open | 13821-15368 | _na 515_aa | RagB/SusD domain-containing protein | |
| 3180 | CAMIDF010000026.1 | GCA946223055_01596 | CDS | open | 15410-16042 | _na 210_aa | fasciclin domain-containing protein | |
| 3181 | CAMIDF010000026.1 | GCA946223055_01597 | CDS | open | 16054-16518 | _na 154_aa | Lipoprotein | |
| 3182 | CAMIDF010000026.1 | GCA946223055_01598 | CDS | open | 16541-16657 | _na 38_aa | hypothetical protein | |
| 3183 | CAMIDF010000026.1 | GCA946223055_01599 | CDS | open | 16684-18012 | _na 442_aa | dsbD | Thioredoxin domain-containing protein |
| 3184 | CAMIDF010000026.1 | GCA946223055_01600 | CDS | open | 18055-20874 | _na 939_aa | pqqL | Peptidase M16 C-terminal domain-containing protein |
| 3185 | CAMIDF010000026.1 | GCA946223055_01601 | CDS | open | 20988-21602 | _na 204_aa | DNA alkylation repair enzyme | |
| 3186 | CAMIDF010000026.1 | GCA946223055_01602 | CDS | open | 22391-23320 | _na 309_aa | fieF | Cation efflux protein cytoplasmic domain-containing protein |
| 3187 | CAMIDF010000026.1 | GCA946223055_01603 | CDS | open | 23355-24176 | _na 273_aa | DUF4595 domain-containing protein | |
| 3188 | CAMIDF010000026.1 | GCA946223055_01604 | CDS | open | 24322-24699 | _na 125_aa | hypothetical protein | |
| 3189 | CAMIDF010000026.1 | GCA946223055_01605 | CDS | open | 24840-28589 | _na 1249_aa | aPA2 | SpoIID/LytB domain protein |
| 3190 | CAMIDF010000026.1 | GCA946223055_01606 | CDS | open | 28601-29914 | _na 437_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3191 | CAMIDF010000026.1 | GCA946223055_01607 | CDS | open | 30048-30947 | _na 299_aa | bepA | Peptidase M48 domain-containing protein |
| 3192 | CAMIDF010000026.1 | GCA946223055_01608 | CDS | open | 31521-31970 | _na 149_aa | ybbJ | Nodulation efficiency protein NfeD |
| 3193 | CAMIDF010000026.1 | GCA946223055_01609 | CDS | open | 32074-33021 | _na 315_aa | hflC | Band 7 domain-containing protein |
| 3194 | CAMIDF010000026.1 | GCA946223055_01610 | CDS | open | 33138-34262 | _na 374_aa | wecB | UDP-N-acetylglucosamine 2-epimerase |
| 3195 | CAMIDF010000026.1 | GCA946223055_01611 | CDS | open | 34821-36185 | _na 454_aa | norM | Multidrug export protein MepA |
| 3196 | CAMIDF010000026.1 | GCA946223055_01612 | CDS | open | 36182-36745 | _na 187_aa | copZ | HTH araC/xylS-type domain-containing protein |
| 3197 | CAMIDF010000026.1 | GCA946223055_01613 | CDS | open | 37312-37524 | _na 70_aa | copZ | HMA domain-containing protein |
| 3198 | CAMIDF010000026.1 | GCA946223055_01614 | CDS | open | 37622-39541 | _na 639_aa | zntA | HMA domain-containing protein |
| 3199 | CAMIDF010000026.1 | GCA946223055_01615 | CDS | open | 39644-40513 | _na 289_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3200 | CAMIDF010000026.1 | GCA946223055_01616 | CDS | open | 40633-41583 | _na 316_aa | galM | Aldose 1-epimerase |
| 3201 | CAMIDF010000026.1 | GCA946223055_01583 | gene | open | 194-2629 | |||
| 3202 | CAMIDF010000026.1 | GCA946223055_01584 | gene | open | 2742-3098 | folK | ||
| 3203 | CAMIDF010000026.1 | GCA946223055_01585 | gene | open | 3154-4338 | queA | ||
| 3204 | CAMIDF010000026.1 | GCA946223055_01586 | gene | open | 4335-5057 | truB | ||
| 3205 | CAMIDF010000026.1 | GCA946223055_01587 | gene | open | 5079-5939 | uppP | ||
| 3206 | CAMIDF010000026.1 | GCA946223055_01588 | gene | open | 5939-6181 | |||
| 3207 | CAMIDF010000026.1 | GCA946223055_01589 | gene | open | 6314-7192 | ftsX | ||
| 3208 | CAMIDF010000026.1 | GCA946223055_01590 | gene | open | 7467-7562 | |||
| 3209 | CAMIDF010000026.1 | GCA946223055_01591 | gene | open | 7825-8508 | porT | ||
| 3210 | CAMIDF010000026.1 | GCA946223055_01592 | gene | open | 8684-9982 | |||
| 3211 | CAMIDF010000026.1 | GCA946223055_01593 | gene | open | 9987-10088 | |||
| 3212 | CAMIDF010000026.1 | GCA946223055_01594 | gene | open | 10330-13815 | cirA | ||
| 3213 | CAMIDF010000026.1 | GCA946223055_01595 | gene | open | 13821-15368 | |||
| 3214 | CAMIDF010000026.1 | GCA946223055_01596 | gene | open | 15410-16042 | |||
| 3215 | CAMIDF010000026.1 | GCA946223055_01597 | gene | open | 16054-16518 | |||
| 3216 | CAMIDF010000026.1 | GCA946223055_01598 | gene | open | 16541-16657 | |||
| 3217 | CAMIDF010000026.1 | GCA946223055_01599 | gene | open | 16684-18012 | dsbD | ||
| 3218 | CAMIDF010000026.1 | GCA946223055_01600 | gene | open | 18055-20874 | pqqL | ||
| 3219 | CAMIDF010000026.1 | GCA946223055_01601 | gene | open | 20988-21602 | |||
| 3220 | CAMIDF010000026.1 | GCA946223055_01602 | gene | open | 22391-23320 | fieF | ||
| 3221 | CAMIDF010000026.1 | GCA946223055_01603 | gene | open | 23355-24176 | |||
| 3222 | CAMIDF010000026.1 | GCA946223055_01604 | gene | open | 24322-24699 | |||
| 3223 | CAMIDF010000026.1 | GCA946223055_01605 | gene | open | 24840-28589 | aPA2 | ||
| 3224 | CAMIDF010000026.1 | GCA946223055_01606 | gene | open | 28601-29914 | |||
| 3225 | CAMIDF010000026.1 | GCA946223055_01607 | gene | open | 30048-30947 | bepA | ||
| 3226 | CAMIDF010000026.1 | GCA946223055_01608 | gene | open | 31521-31970 | ybbJ | ||
| 3227 | CAMIDF010000026.1 | GCA946223055_01609 | gene | open | 32074-33021 | hflC | ||
| 3228 | CAMIDF010000026.1 | GCA946223055_01610 | gene | open | 33138-34262 | wecB | ||
| 3229 | CAMIDF010000026.1 | GCA946223055_01611 | gene | open | 34821-36185 | norM | ||
| 3230 | CAMIDF010000026.1 | GCA946223055_01612 | gene | open | 36182-36745 | copZ | ||
| 3231 | CAMIDF010000026.1 | GCA946223055_01613 | gene | open | 37312-37524 | copZ | ||
| 3232 | CAMIDF010000026.1 | GCA946223055_01614 | gene | open | 37622-39541 | zntA | ||
| 3233 | CAMIDF010000026.1 | GCA946223055_01615 | gene | open | 39644-40513 | |||
| 3234 | CAMIDF010000026.1 | GCA946223055_01616 | gene | open | 40633-41583 | galM | ||
| 3235 | CAMIDF010000027.1 | repeat_region | open | 1-975 | CRISPR array with 13 repeats of length 47%2C consensus sequence GTTGTACGTGCTAATGCAAAGATACACATTTTGAAGCAATTCACAAC and spacer length 29 | |||
| 3236 | CAMIDF010000027.1 | GCA946223055_01617 | CDS | open | 1053-2471 | _na 472_aa | PepSY domain-containing protein | |
| 3237 | CAMIDF010000027.1 | GCA946223055_01618 | CDS | open | 3376-3993 | _na 205_aa | Lipocalin-like protein | |
| 3238 | CAMIDF010000027.1 | GCA946223055_01619 | CDS | open | 4180-6411 | _na 743_aa | Alpha-1%2C2-mannosidase | |
| 3239 | CAMIDF010000027.1 | GCA946223055_01620 | CDS | open | 6530-6961 | _na 143_aa | Lipoprotein | |
| 3240 | CAMIDF010000027.1 | GCA946223055_01621 | CDS | open | 7271-7636 | _na 121_aa | copY | Transcriptional regulator%2C BlaI/MecI/CopY family |
| 3241 | CAMIDF010000027.1 | GCA946223055_01622 | CDS | open | 7695-8933 | _na 412_aa | mecR1 | TonB protein%2C C-terminal domain protein |
| 3242 | CAMIDF010000027.1 | GCA946223055_01623 | CDS | open | 9678-10217 | _na 179_aa | cynT | Carbonate dehydratase |
| 3243 | CAMIDF010000027.1 | GCA946223055_01624 | CDS | open | 10228-10818 | _na 196_aa | DKNYY domain-containing protein | |
| 3244 | CAMIDF010000027.1 | GCA946223055_01625 | CDS | open | 11054-12844 | _na 596_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 3245 | CAMIDF010000027.1 | GCA946223055_01626 | CDS | open | 12854-13327 | _na 157_aa | engB | putative GTP-binding protein EngB |
| 3246 | CAMIDF010000027.1 | GCA946223055_01627 | CDS | open | 13512-13619 | _na 35_aa | hypothetical protein | |
| 3247 | CAMIDF010000027.1 | GCA946223055_01628 | CDS | open | 13627-14610 | _na 327_aa | mviM | Gfo/Idh/MocA-like oxidoreductase N-terminal domain-containing protein |
| 3248 | CAMIDF010000027.1 | GCA946223055_01629 | CDS | open | 14652-15866 | _na 404_aa | DUF4421 domain-containing protein | |
| 3249 | CAMIDF010000027.1 | GCA946223055_01630 | CDS | open | 15903-16919 | _na 338_aa | Xylanase | |
| 3250 | CAMIDF010000027.1 | GCA946223055_01631 | CDS | open | 17228-18331 | _na 367_aa | msrB | bifunctional methionine sulfoxide reductase B/A protein |
| 3251 | CAMIDF010000027.1 | GCA946223055_01632 | CDS | open | 18441-19373 | _na 310_aa | trxB | thioredoxin-disulfide reductase |
| 3252 | CAMIDF010000027.1 | GCA946223055_01633 | CDS | open | 19487-20107 | _na 206_aa | dck | Deoxyadenosine/deoxycytidine kinase |
| 3253 | CAMIDF010000027.1 | GCA946223055_01634 | CDS | open | 20275-20889 | _na 204_aa | dck | Deoxynucleoside kinase |
| 3254 | CAMIDF010000027.1 | GCA946223055_01635 | CDS | open | 20971-22440 | _na 489_aa | ataC | Alkaline phosphatase family protein |
| 3255 | CAMIDF010000027.1 | GCA946223055_01636 | CDS | open | 22553-23197 | _na 214_aa | citB | Transcriptional regulator%2C LuxR family |
| 3256 | CAMIDF010000027.1 | GCA946223055_01637 | CDS | open | 23676-25670 | _na 664_aa | oPT | OPT family oligopeptide transporter |
| 3257 | CAMIDF010000027.1 | GCA946223055_01638 | CDS | open | 25756-26418 | _na 220_aa | tsaA | tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO |
| 3258 | CAMIDF010000027.1 | GCA946223055_01639 | CDS | open | 26513-26836 | _na 107_aa | DUF4157 domain-containing protein | |
| 3259 | CAMIDF010000027.1 | GCA946223055_01640 | CDS | open | 26836-27336 | _na 166_aa | Zinc ribbon domain-containing protein | |
| 3260 | CAMIDF010000027.1 | GCA946223055_01641 | CDS | open | 27390-28100 | _na 236_aa | DUF3256 domain-containing protein | |
| 3261 | CAMIDF010000027.1 | GCA946223055_01642 | CDS | open | 28175-29437 | _na 420_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 3262 | CAMIDF010000027.1 | GCA946223055_01643 | CDS | open | 29466-30014 | _na 182_aa | BFN domain-containing protein | |
| 3263 | CAMIDF010000027.1 | GCA946223055_01644 | CDS | open | 30093-30827 | _na 244_aa | rsmE | Ribosomal RNA small subunit methyltransferase E |
| 3264 | CAMIDF010000027.1 | GCA946223055_01645 | CDS | open | 31209-34469 | _na 1086_aa | fepA | TonB-dependent receptor plug domain-containing protein |
| 3265 | CAMIDF010000027.1 | GCA946223055_01646 | CDS | open | 34628-34960 | _na 110_aa | qdoI | Cupin type-2 domain-containing protein |
| 3266 | CAMIDF010000027.1 | GCA946223055_01647 | CDS | open | 35061-35210 | _na 49_aa | hypothetical protein | |
| 3267 | CAMIDF010000027.1 | GCA946223055_01648 | CDS | open | 35269-36345 | _na 358_aa | nanM | Cyclically-permuted mutarotase family protein |
| 3268 | CAMIDF010000027.1 | GCA946223055_01649 | CDS | open | 36465-37691 | _na 408_aa | uhpC | Major facilitator superfamily (MFS) profile domain-containing protein |
| 3269 | CAMIDF010000027.1 | GCA946223055_01650 | CDS | open | 37784-38707 | _na 307_aa | dapA | Dihydrodipicolinate synthetase family |
| 3270 | CAMIDF010000027.1 | GCA946223055_01651 | CDS | open | 38827-39867 | _na 346_aa | ansA | asparaginase |
| 3271 | CAMIDF010000027.1 | GCA946223055_01652 | CDS | open | 39949-40089 | _na 46_aa | hypothetical protein | |
| 3272 | CAMIDF010000027.1 | GCA946223055_01617 | gene | open | 1053-2471 | |||
| 3273 | CAMIDF010000027.1 | GCA946223055_01618 | gene | open | 3376-3993 | |||
| 3274 | CAMIDF010000027.1 | GCA946223055_01619 | gene | open | 4180-6411 | |||
| 3275 | CAMIDF010000027.1 | GCA946223055_01620 | gene | open | 6530-6961 | |||
| 3276 | CAMIDF010000027.1 | GCA946223055_01621 | gene | open | 7271-7636 | copY | ||
| 3277 | CAMIDF010000027.1 | GCA946223055_01622 | gene | open | 7695-8933 | mecR1 | ||
| 3278 | CAMIDF010000027.1 | GCA946223055_01623 | gene | open | 9678-10217 | cynT | ||
| 3279 | CAMIDF010000027.1 | GCA946223055_01624 | gene | open | 10228-10818 | |||
| 3280 | CAMIDF010000027.1 | GCA946223055_01625 | gene | open | 11054-12844 | abc-f | ||
| 3281 | CAMIDF010000027.1 | GCA946223055_01626 | gene | open | 12854-13327 | engB | ||
| 3282 | CAMIDF010000027.1 | GCA946223055_01627 | gene | open | 13512-13619 | |||
| 3283 | CAMIDF010000027.1 | GCA946223055_01628 | gene | open | 13627-14610 | mviM | ||
| 3284 | CAMIDF010000027.1 | GCA946223055_01629 | gene | open | 14652-15866 | |||
| 3285 | CAMIDF010000027.1 | GCA946223055_01630 | gene | open | 15903-16919 | |||
| 3286 | CAMIDF010000027.1 | GCA946223055_01631 | gene | open | 17228-18331 | msrB | ||
| 3287 | CAMIDF010000027.1 | GCA946223055_01632 | gene | open | 18441-19373 | trxB | ||
| 3288 | CAMIDF010000027.1 | GCA946223055_01633 | gene | open | 19487-20107 | dck | ||
| 3289 | CAMIDF010000027.1 | GCA946223055_01634 | gene | open | 20275-20889 | dck | ||
| 3290 | CAMIDF010000027.1 | GCA946223055_01635 | gene | open | 20971-22440 | ataC | ||
| 3291 | CAMIDF010000027.1 | GCA946223055_01636 | gene | open | 22553-23197 | citB | ||
| 3292 | CAMIDF010000027.1 | GCA946223055_01637 | gene | open | 23676-25670 | oPT | ||
| 3293 | CAMIDF010000027.1 | GCA946223055_01638 | gene | open | 25756-26418 | tsaA | ||
| 3294 | CAMIDF010000027.1 | GCA946223055_01639 | gene | open | 26513-26836 | |||
| 3295 | CAMIDF010000027.1 | GCA946223055_01640 | gene | open | 26836-27336 | |||
| 3296 | CAMIDF010000027.1 | GCA946223055_01641 | gene | open | 27390-28100 | |||
| 3297 | CAMIDF010000027.1 | GCA946223055_01642 | gene | open | 28175-29437 | |||
| 3298 | CAMIDF010000027.1 | GCA946223055_01643 | gene | open | 29466-30014 | |||
| 3299 | CAMIDF010000027.1 | GCA946223055_01644 | gene | open | 30093-30827 | rsmE | ||
| 3300 | CAMIDF010000027.1 | GCA946223055_01645 | gene | open | 31209-34469 | fepA | ||
| 3301 | CAMIDF010000027.1 | GCA946223055_01646 | gene | open | 34628-34960 | qdoI | ||
| 3302 | CAMIDF010000027.1 | GCA946223055_01647 | gene | open | 35061-35210 | |||
| 3303 | CAMIDF010000027.1 | GCA946223055_01648 | gene | open | 35269-36345 | nanM | ||
| 3304 | CAMIDF010000027.1 | GCA946223055_01649 | gene | open | 36465-37691 | uhpC | ||
| 3305 | CAMIDF010000027.1 | GCA946223055_01650 | gene | open | 37784-38707 | dapA | ||
| 3306 | CAMIDF010000027.1 | GCA946223055_01651 | gene | open | 38827-39867 | ansA | ||
| 3307 | CAMIDF010000027.1 | GCA946223055_01652 | gene | open | 39949-40089 | |||
| 3308 | CAMIDF010000028.1 | GCA946223055_01653 | CDS | open | 207-1352 | _na 381_aa | BT-3987-like N-terminal domain-containing protein | |
| 3309 | CAMIDF010000028.1 | GCA946223055_01654 | CDS | open | 1393-2511 | _na 372_aa | Endoglycosidase | |
| 3310 | CAMIDF010000028.1 | GCA946223055_01655 | CDS | open | 2529-4154 | _na 541_aa | SusD/RagB family nutrient-binding outer membrane lipoprotein | |
| 3311 | CAMIDF010000028.1 | GCA946223055_01656 | CDS | open | 4161-7271 | _na 1036_aa | cirA | TonB-dependent receptor plug domain-containing protein |
| 3312 | CAMIDF010000028.1 | GCA946223055_01657 | CDS | open | 7335-7445 | _na 36_aa | hypothetical protein | |
| 3313 | CAMIDF010000028.1 | GCA946223055_01658 | CDS | open | 7624-8727 | _na 367_aa | mrp | Iron-sulfur cluster carrier protein |
| 3314 | CAMIDF010000028.1 | GCA946223055_01659 | CDS | open | 8858-9235 | _na 125_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 3315 | CAMIDF010000028.1 | GCA946223055_01660 | CDS | open | 10146-10424 | _na 92_aa | hypothetical protein | |
| 3316 | CAMIDF010000028.1 | GCA946223055_01661 | CDS | open | 10948-11151 | _na 67_aa | hypothetical protein | |
| 3317 | CAMIDF010000028.1 | GCA946223055_01662 | CDS | open | 11333-11740 | _na 135_aa | Lipoprotein | |
| 3318 | CAMIDF010000028.1 | GCA946223055_01663 | CDS | open | 11700-12098 | _na 132_aa | hypothetical protein | |
| 3319 | CAMIDF010000028.1 | GCA946223055_01664 | CDS | open | 12148-12549 | _na 133_aa | hypothetical protein | |
| 3320 | CAMIDF010000028.1 | GCA946223055_01665 | CDS | open | 12647-12901 | _na 84_aa | RHS Repeat | |
| 3321 | CAMIDF010000028.1 | GCA946223055_01666 | CDS | open | 14027-14398 | _na 123_aa | hypothetical protein | |
| 3322 | CAMIDF010000028.1 | GCA946223055_01667 | CDS | open | 14376-14843 | _na 155_aa | hypothetical protein | |
| 3323 | CAMIDF010000028.1 | GCA946223055_01668 | CDS | open | 15107-15310 | _na 67_aa | hypothetical protein | |
| 3324 | CAMIDF010000028.1 | GCA946223055_01669 | CDS | open | 15374-15859 | _na 161_aa | MORN repeat protein | |
| 3325 | CAMIDF010000028.1 | GCA946223055_01670 | CDS | open | 16388-16687 | _na 99_aa | DUF3592 domain-containing protein | |
| 3326 | CAMIDF010000028.1 | GCA946223055_01671 | CDS | open | 16695-17039 | _na 114_aa | Phage protein | |
| 3327 | CAMIDF010000028.1 | GCA946223055_01672 | CDS | open | 17174-17482 | _na 102_aa | hypothetical protein | |
| 3328 | CAMIDF010000028.1 | GCA946223055_01673 | CDS | open | 17625-17726 | _na 33_aa | hypothetical protein | |
| 3329 | CAMIDF010000028.1 | GCA946223055_01674 | CDS | open | 17906-18433 | _na 175_aa | DUF4263 domain-containing protein | |
| 3330 | CAMIDF010000028.1 | GCA946223055_01675 | CDS | open | 18399-18824 | _na 141_aa | hypothetical protein | |
| 3331 | CAMIDF010000028.1 | GCA946223055_01676 | CDS | open | 18970-19242 | _na 90_aa | hypothetical protein | |
| 3332 | CAMIDF010000028.1 | GCA946223055_01677 | CDS | open | 19314-20183 | _na 289_aa | PD-(D/E)XK motif protein | |
| 3333 | CAMIDF010000028.1 | GCA946223055_01678 | CDS | open | 20210-20857 | _na 215_aa | PF12158 family protein | |
| 3334 | CAMIDF010000028.1 | GCA946223055_01679 | CDS | open | 21238-22788 | _na 516_aa | type VI secretion system Vgr family protein | |
| 3335 | CAMIDF010000028.1 | GCA946223055_01680 | CDS | open | 23008-23934 | _na 308_aa | DUF2931 domain-containing protein | |
| 3336 | CAMIDF010000028.1 | GCA946223055_01681 | CDS | open | 23969-24556 | _na 195_aa | Putative lipoprotein | |
| 3337 | CAMIDF010000028.1 | GCA946223055_01682 | CDS | open | 25596-26114 | _na 172_aa | hypothetical protein | |
| 3338 | CAMIDF010000028.1 | GCA946223055_01683 | CDS | open | 26210-26728 | _na 172_aa | hypothetical protein | |
| 3339 | CAMIDF010000028.1 | GCA946223055_01684 | CDS | open | 26819-27337 | _na 172_aa | hypothetical protein | |
| 3340 | CAMIDF010000028.1 | GCA946223055_01685 | CDS | open | 27420-27983 | _na 187_aa | DUF3592 domain-containing protein | |
| 3341 | CAMIDF010000028.1 | GCA946223055_01686 | CDS | open | 28000-28131 | _na 43_aa | hypothetical protein | |
| 3342 | CAMIDF010000028.1 | GCA946223055_01687 | CDS | open | 28372-29088 | _na 238_aa | DUF5043 domain-containing protein | |
| 3343 | CAMIDF010000028.1 | GCA946223055_01688 | CDS | open | 29103-29825 | _na 240_aa | DUF5043 domain-containing protein | |
| 3344 | CAMIDF010000028.1 | GCA946223055_01689 | CDS | open | 29939-30535 | _na 198_aa | Lipoprotein | |
| 3345 | CAMIDF010000028.1 | GCA946223055_01690 | CDS | open | 30891-31661 | _na 256_aa | DUF2931 domain-containing protein | |
| 3346 | CAMIDF010000028.1 | GCA946223055_01691 | CDS | open | 32135-32902 | _na 255_aa | SH3b domain-containing protein | |
| 3347 | CAMIDF010000028.1 | GCA946223055_01692 | CDS | open | 32969-33469 | _na 166_aa | hypothetical protein | |
| 3348 | CAMIDF010000028.1 | GCA946223055_01693 | CDS | open | 33628-34146 | _na 172_aa | Lipoprotein | |
| 3349 | CAMIDF010000028.1 | GCA946223055_01694 | CDS | open | 35014-36183 | _na 389_aa | Lipoprotein | |
| 3350 | CAMIDF010000028.1 | GCA946223055_01695 | CDS | open | 36261-37454 | _na 397_aa | Lipoprotein | |
| 3351 | CAMIDF010000028.1 | GCA946223055_01696 | CDS | open | 37547-38749 | _na 400_aa | Lipoprotein | |
| 3352 | CAMIDF010000028.1 | GCA946223055_01697 | CDS | open | 38907-39554 | _na 215_aa | ankyrin repeat domain-containing protein | |
| 3353 | CAMIDF010000028.1 | GCA946223055_01653 | gene | open | 207-1352 | |||
| 3354 | CAMIDF010000028.1 | GCA946223055_01654 | gene | open | 1393-2511 | |||
| 3355 | CAMIDF010000028.1 | GCA946223055_01655 | gene | open | 2529-4154 | |||
| 3356 | CAMIDF010000028.1 | GCA946223055_01656 | gene | open | 4161-7271 | cirA | ||
| 3357 | CAMIDF010000028.1 | GCA946223055_01657 | gene | open | 7335-7445 | |||
| 3358 | CAMIDF010000028.1 | GCA946223055_01658 | gene | open | 7624-8727 | mrp | ||
| 3359 | CAMIDF010000028.1 | GCA946223055_01659 | gene | open | 8858-9235 | |||
| 3360 | CAMIDF010000028.1 | GCA946223055_01660 | gene | open | 10146-10424 | |||
| 3361 | CAMIDF010000028.1 | GCA946223055_01661 | gene | open | 10948-11151 | |||
| 3362 | CAMIDF010000028.1 | GCA946223055_01662 | gene | open | 11333-11740 | |||
| 3363 | CAMIDF010000028.1 | GCA946223055_01663 | gene | open | 11700-12098 | |||
| 3364 | CAMIDF010000028.1 | GCA946223055_01664 | gene | open | 12148-12549 | |||
| 3365 | CAMIDF010000028.1 | GCA946223055_01665 | gene | open | 12647-12901 | |||
| 3366 | CAMIDF010000028.1 | GCA946223055_01666 | gene | open | 14027-14398 | |||
| 3367 | CAMIDF010000028.1 | GCA946223055_01667 | gene | open | 14376-14843 | |||
| 3368 | CAMIDF010000028.1 | GCA946223055_01668 | gene | open | 15107-15310 | |||
| 3369 | CAMIDF010000028.1 | GCA946223055_01669 | gene | open | 15374-15859 | |||
| 3370 | CAMIDF010000028.1 | GCA946223055_01670 | gene | open | 16388-16687 | |||
| 3371 | CAMIDF010000028.1 | GCA946223055_01671 | gene | open | 16695-17039 | |||
| 3372 | CAMIDF010000028.1 | GCA946223055_01672 | gene | open | 17174-17482 | |||
| 3373 | CAMIDF010000028.1 | GCA946223055_01673 | gene | open | 17625-17726 | |||
| 3374 | CAMIDF010000028.1 | GCA946223055_01674 | gene | open | 17906-18433 | |||
| 3375 | CAMIDF010000028.1 | GCA946223055_01675 | gene | open | 18399-18824 | |||
| 3376 | CAMIDF010000028.1 | GCA946223055_01676 | gene | open | 18970-19242 | |||
| 3377 | CAMIDF010000028.1 | GCA946223055_01677 | gene | open | 19314-20183 | |||
| 3378 | CAMIDF010000028.1 | GCA946223055_01678 | gene | open | 20210-20857 | |||
| 3379 | CAMIDF010000028.1 | GCA946223055_01679 | gene | open | 21238-22788 | |||
| 3380 | CAMIDF010000028.1 | GCA946223055_01680 | gene | open | 23008-23934 | |||
| 3381 | CAMIDF010000028.1 | GCA946223055_01681 | gene | open | 23969-24556 | |||
| 3382 | CAMIDF010000028.1 | GCA946223055_01682 | gene | open | 25596-26114 | |||
| 3383 | CAMIDF010000028.1 | GCA946223055_01683 | gene | open | 26210-26728 | |||
| 3384 | CAMIDF010000028.1 | GCA946223055_01684 | gene | open | 26819-27337 | |||
| 3385 | CAMIDF010000028.1 | GCA946223055_01685 | gene | open | 27420-27983 | |||
| 3386 | CAMIDF010000028.1 | GCA946223055_01686 | gene | open | 28000-28131 | |||
| 3387 | CAMIDF010000028.1 | GCA946223055_01687 | gene | open | 28372-29088 | |||
| 3388 | CAMIDF010000028.1 | GCA946223055_01688 | gene | open | 29103-29825 | |||
| 3389 | CAMIDF010000028.1 | GCA946223055_01689 | gene | open | 29939-30535 | |||
| 3390 | CAMIDF010000028.1 | GCA946223055_01690 | gene | open | 30891-31661 | |||
| 3391 | CAMIDF010000028.1 | GCA946223055_01691 | gene | open | 32135-32902 | |||
| 3392 | CAMIDF010000028.1 | GCA946223055_01692 | gene | open | 32969-33469 | |||
| 3393 | CAMIDF010000028.1 | GCA946223055_01693 | gene | open | 33628-34146 | |||
| 3394 | CAMIDF010000028.1 | GCA946223055_01694 | gene | open | 35014-36183 | |||
| 3395 | CAMIDF010000028.1 | GCA946223055_01695 | gene | open | 36261-37454 | |||
| 3396 | CAMIDF010000028.1 | GCA946223055_01696 | gene | open | 37547-38749 | |||
| 3397 | CAMIDF010000028.1 | GCA946223055_01697 | gene | open | 38907-39554 | |||
| 3398 | CAMIDF010000029.1 | GCA946223055_01698 | CDS | open | 1245-1841 | _na 198_aa | DUF4136 domain-containing protein | |
| 3399 | CAMIDF010000029.1 | GCA946223055_01699 | CDS | open | 2696-4030 | _na 444_aa | Cytosine-specific methyltransferase | |
| 3400 | CAMIDF010000029.1 | GCA946223055_01700 | CDS | open | 4051-5133 | _na 360_aa | HpaII family restriction endonuclease | |
| 3401 | CAMIDF010000029.1 | GCA946223055_01701 | CDS | open | 5308-6387 | _na 359_aa | DUF4876 domain-containing protein | |
| 3402 | CAMIDF010000029.1 | GCA946223055_01702 | CDS | open | 6520-7926 | _na 468_aa | Lipoprotein | |
| 3403 | CAMIDF010000029.1 | GCA946223055_01703 | CDS | open | 7942-9399 | _na 485_aa | XRE family transcriptional regulator | |
| 3404 | CAMIDF010000029.1 | GCA946223055_01704 | CDS | open | 9416-11839 | _na 807_aa | btuB | TonB-dependent receptor plug domain-containing protein |
| 3405 | CAMIDF010000029.1 | GCA946223055_01705 | CDS | open | 12357-12464 | _na 35_aa | hypothetical protein | |
| 3406 | CAMIDF010000029.1 | GCA946223055_01706 | CDS | open | 12701-16240 | _na 1179_aa | kdpD | histidine kinase |
| 3407 | CAMIDF010000029.1 | GCA946223055_01707 | CDS | open | 16267-16992 | _na 241_aa | citB | Response regulatory domain-containing protein |
| 3408 | CAMIDF010000029.1 | GCA946223055_01708 | CDS | open | 16982-17626 | _na 214_aa | ABC transporter permease | |
| 3409 | CAMIDF010000029.1 | GCA946223055_01709 | CDS | open | 19072-21873 | _na 933_aa | Fimbrillin family protein | |
| 3410 | CAMIDF010000029.1 | GCA946223055_01710 | CDS | open | 22133-23743 | _na 536_aa | chb | beta-N-acetylhexosaminidase |
| 3411 | CAMIDF010000029.1 | GCA946223055_01711 | CDS | open | 23837-24028 | _na 63_aa | hypothetical protein | |
| 3412 | CAMIDF010000029.1 | GCA946223055_01712 | CDS | open | 24126-24965 | _na 279_aa | DUF4393 domain-containing protein | |
| 3413 | CAMIDF010000029.1 | GCA946223055_01713 | CDS | open | 25068-26351 | _na 427_aa | nhaC | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein |
| 3414 | CAMIDF010000029.1 | GCA946223055_01714 | CDS | open | 26789-27853 | _na 354_aa | purR | HTH lacI-type domain-containing protein |
| 3415 | CAMIDF010000029.1 | GCA946223055_01715 | CDS | open | 28038-28979 | _na 313_aa | gph | HAD hydrolase%2C family IA%2C variant 3 |
| 3416 | CAMIDF010000029.1 | GCA946223055_01717 | CDS | open | 29570-29674 | _na 34_aa | hypothetical protein | |
| 3417 | CAMIDF010000029.1 | GCA946223055_01718 | CDS | open | 29719-31449 | _na 576_aa | Glycosyl hydrolase family 25 | |
| 3418 | CAMIDF010000029.1 | GCA946223055_01719 | CDS | open | 32049-34097 | _na 682_aa | fepA | TonB-dependent receptor-like beta-barrel domain-containing protein |
| 3419 | CAMIDF010000029.1 | GCA946223055_01720 | CDS | open | 34213-34521 | _na 102_aa | copZ | HMA domain-containing protein |
| 3420 | CAMIDF010000029.1 | GCA946223055_01721 | CDS | open | 34799-35626 | _na 275_aa | CAAX protease self-immunity | |
| 3421 | CAMIDF010000029.1 | GCA946223055_01722 | CDS | open | 35638-36609 | _na 323_aa | ribF | bifunctional riboflavin kinase/FAD synthetase |
| 3422 | CAMIDF010000029.1 | GCA946223055_01724 | CDS | open | 37245-38477 | _na 410_aa | xerD | Tyr recombinase domain-containing protein |
| 3423 | CAMIDF010000029.1 | GCA946223055_01698 | gene | open | 1245-1841 | |||
| 3424 | CAMIDF010000029.1 | GCA946223055_01699 | gene | open | 2696-4030 | |||
| 3425 | CAMIDF010000029.1 | GCA946223055_01700 | gene | open | 4051-5133 | |||
| 3426 | CAMIDF010000029.1 | GCA946223055_01701 | gene | open | 5308-6387 | |||
| 3427 | CAMIDF010000029.1 | GCA946223055_01702 | gene | open | 6520-7926 | |||
| 3428 | CAMIDF010000029.1 | GCA946223055_01703 | gene | open | 7942-9399 | |||
| 3429 | CAMIDF010000029.1 | GCA946223055_01704 | gene | open | 9416-11839 | btuB | ||
| 3430 | CAMIDF010000029.1 | GCA946223055_01705 | gene | open | 12357-12464 | |||
| 3431 | CAMIDF010000029.1 | GCA946223055_01706 | gene | open | 12701-16240 | kdpD | ||
| 3432 | CAMIDF010000029.1 | GCA946223055_01707 | gene | open | 16267-16992 | citB | ||
| 3433 | CAMIDF010000029.1 | GCA946223055_01708 | gene | open | 16982-17626 | |||
| 3434 | CAMIDF010000029.1 | GCA946223055_01709 | gene | open | 19072-21873 | |||
| 3435 | CAMIDF010000029.1 | GCA946223055_01710 | gene | open | 22133-23743 | chb | ||
| 3436 | CAMIDF010000029.1 | GCA946223055_01711 | gene | open | 23837-24028 | |||
| 3437 | CAMIDF010000029.1 | GCA946223055_01712 | gene | open | 24126-24965 | |||
| 3438 | CAMIDF010000029.1 | GCA946223055_01713 | gene | open | 25068-26351 | nhaC | ||
| 3439 | CAMIDF010000029.1 | GCA946223055_01714 | gene | open | 26789-27853 | purR | ||
| 3440 | CAMIDF010000029.1 | GCA946223055_01715 | gene | open | 28038-28979 | gph | ||
| 3441 | CAMIDF010000029.1 | GCA946223055_01717 | gene | open | 29570-29674 | |||
| 3442 | CAMIDF010000029.1 | GCA946223055_01718 | gene | open | 29719-31449 | |||
| 3443 | CAMIDF010000029.1 | GCA946223055_01719 | gene | open | 32049-34097 | fepA | ||
| 3444 | CAMIDF010000029.1 | GCA946223055_01720 | gene | open | 34213-34521 | copZ | ||
| 3445 | CAMIDF010000029.1 | GCA946223055_01721 | gene | open | 34799-35626 | |||
| 3446 | CAMIDF010000029.1 | GCA946223055_01722 | gene | open | 35638-36609 | ribF | ||
| 3447 | CAMIDF010000029.1 | GCA946223055_01724 | gene | open | 37245-38477 | xerD | ||
| 3448 | CAMIDF010000029.1 | GCA946223055_01716 | gene | open | 29082-29154 | trnfM | ||
| 3449 | CAMIDF010000029.1 | GCA946223055_01723 | gene | open | 36861-36934 | trnI | ||
| 3450 | CAMIDF010000029.1 | GCA946223055_01716 | tRNA | open | 29082-29154 | trnfM | tRNA-fMet(cat) | |
| 3451 | CAMIDF010000029.1 | GCA946223055_01723 | tRNA | open | 36861-36934 | trnI | tRNA-Ile2(cat) | |
| 3452 | CAMIDF010000030.1 | GCA946223055_01725 | CDS | open | 201-1448 | _na 415_aa | Lipoprotein | |
| 3453 | CAMIDF010000030.1 | GCA946223055_01726 | CDS | open | 1557-3731 | _na 724_aa | TonB-dependent receptor plug domain-containing protein | |
| 3454 | CAMIDF010000030.1 | GCA946223055_01727 | CDS | open | 4164-5753 | _na 529_aa | nanU | SusD family outer membrane lipoprotein NanU |
| 3455 | CAMIDF010000030.1 | GCA946223055_01728 | CDS | open | 5773-9129 | _na 1118_aa | cirA | TonB-dependent receptor plug domain-containing protein |
| 3456 | CAMIDF010000030.1 | GCA946223055_01729 | CDS | open | 9979-11067 | _na 362_aa | trpS | tryptophan--tRNA ligase |
| 3457 | CAMIDF010000030.1 | GCA946223055_01730 | CDS | open | 11108-11596 | _na 162_aa | Viral beta C/D like family protein | |
| 3458 | CAMIDF010000030.1 | GCA946223055_01731 | CDS | open | 11593-12828 | _na 411_aa | kdtA | 3-deoxy-D-manno-octulosonic acid transferase |
| 3459 | CAMIDF010000030.1 | GCA946223055_01732 | CDS | open | 12862-14379 | _na 505_aa | gltX | glutamate--tRNA ligase |
| 3460 | CAMIDF010000030.1 | GCA946223055_01733 | CDS | open | 14521-16572 | _na 683_aa | pgpH | HD domain-containing protein |
| 3461 | CAMIDF010000030.1 | GCA946223055_01734 | CDS | open | 17446-19131 | _na 561_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3462 | CAMIDF010000030.1 | GCA946223055_01735 | CDS | open | 19282-19488 | _na 68_aa | ABC transporter ATP-binding protein | |
| 3463 | CAMIDF010000030.1 | GCA946223055_01736 | CDS | open | 19463-20032 | _na 189_aa | hypothetical protein | |
| 3464 | CAMIDF010000030.1 | GCA946223055_01737 | CDS | open | 20530-22836 | _na 768_aa | priA | primosomal protein N' |
| 3465 | CAMIDF010000030.1 | GCA946223055_01738 | CDS | open | 23059-23688 | _na 209_aa | Outer membrane protein beta-barrel domain protein | |
| 3466 | CAMIDF010000030.1 | GCA946223055_01739 | CDS | open | 24540-25583 | _na 347_aa | gldN | Gliding motility protein GldN |
| 3467 | CAMIDF010000030.1 | GCA946223055_01740 | CDS | open | 25702-27291 | _na 529_aa | gldM | Gliding motility-associated protein GldM |
| 3468 | CAMIDF010000030.1 | GCA946223055_01741 | CDS | open | 27356-28153 | _na 265_aa | gldL | Gliding motility protein GldL-like N-terminal domain-containing protein |
| 3469 | CAMIDF010000030.1 | GCA946223055_01742 | CDS | open | 28154-29629 | _na 491_aa | gldK | Serine/threonine-protein kinase pkn1 |
| 3470 | CAMIDF010000030.1 | GCA946223055_01743 | CDS | open | 29645-30487 | _na 280_aa | Bacteroidetes-specific membrane protein | |
| 3471 | CAMIDF010000030.1 | GCA946223055_01744 | CDS | open | 31180-31401 | _na 73_aa | DUF2795 domain-containing protein | |
| 3472 | CAMIDF010000030.1 | GCA946223055_01745 | CDS | open | 31455-32027 | _na 190_aa | pduO | Corrinoid adenosyltransferase |
| 3473 | CAMIDF010000030.1 | GCA946223055_01746 | CDS | open | 32064-32672 | _na 202_aa | Methyltransferase | |
| 3474 | CAMIDF010000030.1 | GCA946223055_01747 | CDS | open | 33062-33247 | _na 61_aa | hypothetical protein | |
| 3475 | CAMIDF010000030.1 | GCA946223055_01748 | CDS | open | 33294-35978 | _na 894_aa | Putative lipoprotein | |
| 3476 | CAMIDF010000030.1 | GCA946223055_01725 | gene | open | 201-1448 | |||
| 3477 | CAMIDF010000030.1 | GCA946223055_01726 | gene | open | 1557-3731 | |||
| 3478 | CAMIDF010000030.1 | GCA946223055_01727 | gene | open | 4164-5753 | nanU | ||
| 3479 | CAMIDF010000030.1 | GCA946223055_01728 | gene | open | 5773-9129 | cirA | ||
| 3480 | CAMIDF010000030.1 | GCA946223055_01729 | gene | open | 9979-11067 | trpS | ||
| 3481 | CAMIDF010000030.1 | GCA946223055_01730 | gene | open | 11108-11596 | |||
| 3482 | CAMIDF010000030.1 | GCA946223055_01731 | gene | open | 11593-12828 | kdtA | ||
| 3483 | CAMIDF010000030.1 | GCA946223055_01732 | gene | open | 12862-14379 | gltX | ||
| 3484 | CAMIDF010000030.1 | GCA946223055_01733 | gene | open | 14521-16572 | pgpH | ||
| 3485 | CAMIDF010000030.1 | GCA946223055_01734 | gene | open | 17446-19131 | |||
| 3486 | CAMIDF010000030.1 | GCA946223055_01735 | gene | open | 19282-19488 | |||
| 3487 | CAMIDF010000030.1 | GCA946223055_01736 | gene | open | 19463-20032 | |||
| 3488 | CAMIDF010000030.1 | GCA946223055_01737 | gene | open | 20530-22836 | priA | ||
| 3489 | CAMIDF010000030.1 | GCA946223055_01738 | gene | open | 23059-23688 | |||
| 3490 | CAMIDF010000030.1 | GCA946223055_01739 | gene | open | 24540-25583 | gldN | ||
| 3491 | CAMIDF010000030.1 | GCA946223055_01740 | gene | open | 25702-27291 | gldM | ||
| 3492 | CAMIDF010000030.1 | GCA946223055_01741 | gene | open | 27356-28153 | gldL | ||
| 3493 | CAMIDF010000030.1 | GCA946223055_01742 | gene | open | 28154-29629 | gldK | ||
| 3494 | CAMIDF010000030.1 | GCA946223055_01743 | gene | open | 29645-30487 | |||
| 3495 | CAMIDF010000030.1 | GCA946223055_01744 | gene | open | 31180-31401 | |||
| 3496 | CAMIDF010000030.1 | GCA946223055_01745 | gene | open | 31455-32027 | pduO | ||
| 3497 | CAMIDF010000030.1 | GCA946223055_01746 | gene | open | 32064-32672 | |||
| 3498 | CAMIDF010000030.1 | GCA946223055_01747 | gene | open | 33062-33247 | |||
| 3499 | CAMIDF010000030.1 | GCA946223055_01748 | gene | open | 33294-35978 | |||
| 3500 | CAMIDF010000031.1 | GCA946223055_01750 | CDS | open | 228-1031 | _na 267_aa | draG | ADP-ribosylglycohydrolase |

