HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Megasphaera lornae (GCA_946891365.1)

Select a Genome:
BAKTA Annotations for GCA_946891365.1
Genome Selected: Megasphaera lornae
ContigsBases CDSrRNA tmRNAtRNA
15 1588748 1449 0 1 49
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3029 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3029 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 CAMPMO010000001.1 GCA946891365_00120 gene open 122536-122666 SpR18_sRNA
2 CAMPMO010000001.1 GCA946891365_00120 ncRNA open 122536-122666 Streptococcus sRNA SpR18
3 CAMPMO010000001.1 regulatory_region open 7632-7727 SAM riboswitch aptamer (S box leader)
4 CAMPMO010000001.1 regulatory_region open 7891-8142 T-box leader
5 CAMPMO010000001.1 regulatory_region open 27844-27932 Glycine riboswitch aptamer
6 CAMPMO010000001.1 regulatory_region open 107384-107624 T-box leader
7 CAMPMO010000001.1 regulatory_region open 112836-113040 T-box leader
8 CAMPMO010000001.1 regulatory_region open 207045-207122 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
9 CAMPMO010000001.1 regulatory_region open 237072-237276 raiA RNA
10 CAMPMO010000001.1 regulatory_region open 279049-279165 FMN riboswitch aptamer (RFN element)
11 CAMPMO010000001.1 repeat_region open 135649-136089 CRISPR array with 7 repeats of length 36%2C consensus sequence GTTTGAGAGTAATGTAATTCTATAAATGTCTAAAAC and spacer length 30
12 CAMPMO010000001.1 GCA946891365_00001 CDS open 42-815 _na     257_aa hypothetical protein
13 CAMPMO010000001.1 GCA946891365_00002 CDS open 1367-5695 _na     1442_aa Trimeric autotransporter adhesin YadA-like C-terminal membrane anchor domain-containing protein
14 CAMPMO010000001.1 GCA946891365_00003 CDS open 5765-6622 _na     285_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
15 CAMPMO010000001.1 GCA946891365_00004 CDS open 6718-7542 _na     274_aa Lipoprotein
16 CAMPMO010000001.1 GCA946891365_00005 CDS open 8187-9002 _na     271_aa ABC transporter%2C ATP-binding protein
17 CAMPMO010000001.1 GCA946891365_00006 CDS open 8999-9682 _na     227_aa Cobalt transport protein
18 CAMPMO010000001.1 GCA946891365_00007 CDS open 9695-11170 _na     491_aa ABC transporter%2C ATP-binding protein
19 CAMPMO010000001.1 GCA946891365_00008 CDS open 11437-12168 _na     243_aa Aminotransferase%2C class IV
20 CAMPMO010000001.1 GCA946891365_00009 CDS open 12152-13534 _na     460_aa pabB aminodeoxychorismate synthase component I
21 CAMPMO010000001.1 GCA946891365_00010 CDS open 13531-14133 _na     200_aa Glutamine amidotransferase%2C class I
22 CAMPMO010000001.1 GCA946891365_00012 CDS open 14939-16105 _na     388_aa Alcohol dehydrogenase%2C iron-dependent
23 CAMPMO010000001.1 GCA946891365_00013 CDS open 16162-16674 _na     170_aa ybaK Cys-tRNA(Pro) deacylase
24 CAMPMO010000001.1 GCA946891365_00014 CDS open 16807-17592 _na     261_aa Hydrolase%2C carbon-nitrogen family
25 CAMPMO010000001.1 GCA946891365_00015 CDS open 17674-19023 _na     449_aa gdhA NADP-specific glutamate dehydrogenase
26 CAMPMO010000001.1 GCA946891365_00017 CDS open 19532-19765 _na     77_aa hypothetical protein
27 CAMPMO010000001.1 GCA946891365_00018 CDS open 19967-22003 _na     678_aa recG ATP-dependent DNA helicase RecG
28 CAMPMO010000001.1 GCA946891365_00019 CDS open 22132-23589 _na     485_aa guaB IMP dehydrogenase
29 CAMPMO010000001.1 GCA946891365_00020 CDS open 23609-24340 _na     243_aa Glycosyltransferase%2C WecB/TagA/CpsF family
30 CAMPMO010000001.1 GCA946891365_00021 CDS open 24350-24988 _na     212_aa phosphatidylserine decarboxylase
31 CAMPMO010000001.1 GCA946891365_00022 CDS open 24985-25668 _na     227_aa CDP-diacylglycerol-serine O-phosphatidyltransferase
32 CAMPMO010000001.1 GCA946891365_00023 CDS open 25688-26935 _na     415_aa Glycosyltransferase%2C group 2 family protein
33 CAMPMO010000001.1 GCA946891365_00024 CDS open 26950-27726 _na     258_aa surE 5'/3'-nucleotidase SurE
34 CAMPMO010000001.1 GCA946891365_00025 CDS open 28022-29410 _na     462_aa Amino acid carrier protein
35 CAMPMO010000001.1 GCA946891365_00026 CDS open 29640-31064 _na     474_aa aldehyde dehydrogenase (NAD(+))
36 CAMPMO010000001.1 GCA946891365_00028 CDS open 31999-32979 _na     326_aa cdiA tRNA nuclease CdiA C-terminal domain-containing protein
37 CAMPMO010000001.1 GCA946891365_00029 CDS open 33548-33709 _na     53_aa hypothetical protein
38 CAMPMO010000001.1 GCA946891365_00030 CDS open 33667-34041 _na     124_aa DUF695 domain-containing protein
39 CAMPMO010000001.1 GCA946891365_00031 CDS open 33989-34336 _na     115_aa hypothetical protein
40 CAMPMO010000001.1 GCA946891365_00032 CDS open 34443-37934 _na     1163_aa DNA polymerase III subunit alpha
41 CAMPMO010000001.1 GCA946891365_00033 CDS open 38141-38701 _na     186_aa hypothetical protein
42 CAMPMO010000001.1 GCA946891365_00034 CDS open 38765-40282 _na     505_aa L-lactate permease
43 CAMPMO010000001.1 GCA946891365_00035 CDS open 40522-41157 _na     211_aa LUD domain-containing protein
44 CAMPMO010000001.1 GCA946891365_00036 CDS open 41330-42097 _na     255_aa Transglycosylase
45 CAMPMO010000001.1 GCA946891365_00037 CDS open 42274-43503 _na     409_aa argininosuccinate synthase
46 CAMPMO010000001.1 GCA946891365_00038 CDS open 43525-44961 _na     478_aa argH argininosuccinate lyase
47 CAMPMO010000001.1 GCA946891365_00039 CDS open 45129-45968 _na     279_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
48 CAMPMO010000001.1 GCA946891365_00040 CDS open 45983-46426 _na     147_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
49 CAMPMO010000001.1 GCA946891365_00041 CDS open 46624-47433 _na     269_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
50 CAMPMO010000001.1 GCA946891365_00042 CDS open 47550-48365 _na     271_aa minC Septum site-determining protein MinC
51 CAMPMO010000001.1 GCA946891365_00043 CDS open 48374-49516 _na     380_aa lpxB lipid-A-disaccharide synthase
52 CAMPMO010000001.1 GCA946891365_00044 CDS open 49513-51267 _na     584_aa msbA Lipid A export permease/ATP-binding protein MsbA
53 CAMPMO010000001.1 GCA946891365_00045 CDS open 51280-52590 _na     436_aa 3-deoxy-D-manno-octulosonic acid transferase
54 CAMPMO010000001.1 GCA946891365_00046 CDS open 52574-53707 _na     377_aa lpxK tetraacyldisaccharide 4'-kinase
55 CAMPMO010000001.1 GCA946891365_00047 CDS open 53704-54441 _na     245_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
56 CAMPMO010000001.1 GCA946891365_00048 CDS open 54445-55290 _na     281_aa kdsA 3-deoxy-8-phosphooctulonate synthase
57 CAMPMO010000001.1 GCA946891365_00049 CDS open 55308-56279 _na     323_aa Sugar isomerase%2C KpsF/GutQ family
58 CAMPMO010000001.1 GCA946891365_00050 CDS open 56276-56812 _na     178_aa yrbI 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family
59 CAMPMO010000001.1 GCA946891365_00051 CDS open 56831-57763 _na     310_aa Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase
60 CAMPMO010000001.1 GCA946891365_00052 CDS open 57744-58295 _na     183_aa lptC LPS export ABC transporter periplasmic protein LptC
61 CAMPMO010000001.1 GCA946891365_00053 CDS open 58298-59026 _na     242_aa OstA-like protein
62 CAMPMO010000001.1 GCA946891365_00054 CDS open 59044-59763 _na     239_aa lptB LPS export ABC transporter ATP-binding protein
63 CAMPMO010000001.1 GCA946891365_00055 CDS open 59780-60868 _na     362_aa Permease%2C YjgP/YjgQ family
64 CAMPMO010000001.1 GCA946891365_00056 CDS open 60961-62244 _na     427_aa DUF3084 domain-containing protein
65 CAMPMO010000001.1 GCA946891365_00057 CDS open 62254-62670 _na     138_aa YqgF/RNase H-like domain-containing protein
66 CAMPMO010000001.1 GCA946891365_00058 CDS open 62667-63527 _na     286_aa DUF2179 domain-containing protein
67 CAMPMO010000001.1 GCA946891365_00059 CDS open 63644-63880 _na     78_aa Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein
68 CAMPMO010000001.1 GCA946891365_00060 CDS open 64028-64570 _na     180_aa fapR transcription factor FapR
69 CAMPMO010000001.1 GCA946891365_00061 CDS open 64586-65614 _na     342_aa plsX phosphate acyltransferase PlsX
70 CAMPMO010000001.1 GCA946891365_00062 CDS open 65586-66599 _na     337_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
71 CAMPMO010000001.1 GCA946891365_00063 CDS open 66617-67558 _na     313_aa fabD ACP S-malonyltransferase
72 CAMPMO010000001.1 GCA946891365_00064 CDS open 67560-68303 _na     247_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
73 CAMPMO010000001.1 GCA946891365_00065 CDS open 68348-68593 _na     81_aa acpP acyl carrier protein
74 CAMPMO010000001.1 GCA946891365_00066 CDS open 68661-69623 _na     320_aa 2-nitropropane dioxygenase
75 CAMPMO010000001.1 GCA946891365_00067 CDS open 69650-70906 _na     418_aa fabF beta-ketoacyl-ACP synthase II
76 CAMPMO010000001.1 GCA946891365_00068 CDS open 70869-71624 _na     251_aa rnc ribonuclease III
77 CAMPMO010000001.1 GCA946891365_00069 CDS open 71667-72743 _na     358_aa Radical SAM protein%2C TIGR01212 family
78 CAMPMO010000001.1 GCA946891365_00070 CDS open 72736-73491 _na     251_aa LytTr DNA-binding domain protein
79 CAMPMO010000001.1 GCA946891365_00071 CDS open 73645-75051 _na     468_aa Radical SAM domain protein
80 CAMPMO010000001.1 GCA946891365_00072 CDS open 75355-76734 _na     459_aa Pyruvate carboxylase subunit B
81 CAMPMO010000001.1 GCA946891365_00073 CDS open 76873-77685 _na     270_aa trmH RNA methyltransferase%2C TrmH family
82 CAMPMO010000001.1 GCA946891365_00074 CDS open 77694-78620 _na     308_aa Ribonuclease
83 CAMPMO010000001.1 GCA946891365_00075 CDS open 78628-79476 _na     282_aa hpnK Hopanoid biosynthesis associated protein HpnK
84 CAMPMO010000001.1 GCA946891365_00076 CDS open 79489-80418 _na     309_aa NAD dependent epimerase/dehydratase family protein
85 CAMPMO010000001.1 GCA946891365_00077 CDS open 80415-80864 _na     149_aa ACT domain-containing protein
86 CAMPMO010000001.1 GCA946891365_00078 CDS open 80884-82170 _na     428_aa Homoserine dehydrogenase
87 CAMPMO010000001.1 GCA946891365_00079 CDS open 82174-83097 _na     307_aa thrB homoserine kinase
88 CAMPMO010000001.1 GCA946891365_00080 CDS open 83276-84031 _na     251_aa deoC deoxyribose-phosphate aldolase
89 CAMPMO010000001.1 GCA946891365_00081 CDS open 84123-84779 _na     218_aa deoC deoxyribose-phosphate aldolase
90 CAMPMO010000001.1 GCA946891365_00082 CDS open 84769-85710 _na     313_aa Metallo-beta-lactamase domain protein
91 CAMPMO010000001.1 GCA946891365_00083 CDS open 85730-86839 _na     369_aa Trypsin
92 CAMPMO010000001.1 GCA946891365_00084 CDS open 86836-87315 _na     159_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
93 CAMPMO010000001.1 GCA946891365_00085 CDS open 87421-87891 _na     156_aa CBS domain protein
94 CAMPMO010000001.1 GCA946891365_00086 CDS open 88107-88670 _na     187_aa ahpC alkyl hydroperoxide reductase subunit C
95 CAMPMO010000001.1 GCA946891365_00087 CDS open 88682-90334 _na     550_aa Thioredoxin-disulfide reductase
96 CAMPMO010000001.1 GCA946891365_00089 CDS open 90580-93189 _na     869_aa DNA 3'-5' helicase
97 CAMPMO010000001.1 GCA946891365_00090 CDS open 93361-94557 _na     398_aa Type II/IV secretion system protein
98 CAMPMO010000001.1 GCA946891365_00091 CDS open 94520-95464 _na     314_aa Twitching motility protein
99 CAMPMO010000001.1 GCA946891365_00092 CDS open 95461-96660 _na     399_aa Bacterial type II secretion system protein F domain protein
100 CAMPMO010000001.1 GCA946891365_00093 CDS open 96677-97084 _na     135_aa General secretion pathway protein G
101 CAMPMO010000001.1 GCA946891365_00094 CDS open 97107-97550 _na     147_aa Prepilin type IV endopeptidase peptidase domain-containing protein
102 CAMPMO010000001.1 GCA946891365_00095 CDS open 97508-97975 _na     155_aa Prepilin-type cleavage/methylation protein
103 CAMPMO010000001.1 GCA946891365_00096 CDS open 97968-98324 _na     118_aa Prepilin-type cleavage/methylation protein
104 CAMPMO010000001.1 GCA946891365_00097 CDS open 98269-98823 _na     184_aa Prepilin-type cleavage/methylation protein
105 CAMPMO010000001.1 GCA946891365_00098 CDS open 98845-99288 _na     147_aa Prepilin-type cleavage/methylation protein
106 CAMPMO010000001.1 GCA946891365_00099 CDS open 99307-100071 _na     254_aa hypothetical protein
107 CAMPMO010000001.1 GCA946891365_00100 CDS open 100086-100667 _na     193_aa pilN Fimbrial assembly protein PilN
108 CAMPMO010000001.1 GCA946891365_00101 CDS open 100609-101079 _na     156_aa hypothetical protein
109 CAMPMO010000001.1 GCA946891365_00102 CDS open 101317-101928 _na     203_aa Transporter%2C MotA/TolQ/ExbB proton channel family protein
110 CAMPMO010000001.1 GCA946891365_00103 CDS open 101940-102344 _na     134_aa Transport energizing protein%2C ExbD/TolR family
111 CAMPMO010000001.1 GCA946891365_00104 CDS open 102352-103143 _na     263_aa tonB TonB family domain protein
112 CAMPMO010000001.1 GCA946891365_00105 CDS open 103288-103806 _na     172_aa Flavodoxin family protein
113 CAMPMO010000001.1 GCA946891365_00106 CDS open 103819-105498 _na     559_aa hutW heme anaerobic degradation radical SAM methyltransferase ChuW/HutW
114 CAMPMO010000001.1 GCA946891365_00107 CDS open 105877-107214 _na     445_aa nox H2O-forming NADH oxidase
115 CAMPMO010000001.1 GCA946891365_00108 CDS open 107722-108732 _na     336_aa ilvC ketol-acid reductoisomerase
116 CAMPMO010000001.1 GCA946891365_00109 CDS open 108821-110521 _na     566_aa ilvB biosynthetic-type acetolactate synthase large subunit
117 CAMPMO010000001.1 GCA946891365_00110 CDS open 110518-111018 _na     166_aa ilvN acetolactate synthase small subunit
118 CAMPMO010000001.1 GCA946891365_00111 CDS open 111039-112691 _na     550_aa ilvD dihydroxy-acid dehydratase
119 CAMPMO010000001.1 GCA946891365_00112 CDS open 113083-115743 _na     886_aa valine--tRNA ligase
120 CAMPMO010000001.1 GCA946891365_00113 CDS open 115756-117060 _na     434_aa tetrahydrofolate synthase
121 CAMPMO010000001.1 GCA946891365_00114 CDS open 117237-117620 _na     127_aa Toxin-antitoxin system%2C antitoxin component%2C Xre domain protein
122 CAMPMO010000001.1 GCA946891365_00115 CDS open 117760-119025 _na     421_aa O-antigen polymerase
123 CAMPMO010000001.1 GCA946891365_00116 CDS open 119108-119770 _na     220_aa rex redox-sensing transcriptional repressor Rex
124 CAMPMO010000001.1 GCA946891365_00117 CDS open 119910-120350 _na     146_aa rplM 50S ribosomal protein L13
125 CAMPMO010000001.1 GCA946891365_00118 CDS open 120369-120764 _na     131_aa rpsI 30S ribosomal protein S9
126 CAMPMO010000001.1 GCA946891365_00119 CDS open 120975-122510 _na     511_aa guaA glutamine-hydrolyzing GMP synthase
127 CAMPMO010000001.1 GCA946891365_00121 CDS open 122854-123213 _na     119_aa helix-turn-helix transcriptional regulator
128 CAMPMO010000001.1 GCA946891365_00122 CDS open 123263-123751 _na     162_aa ImmA/IrrE family metallo-endopeptidase
129 CAMPMO010000001.1 GCA946891365_00123 CDS open 123748-123900 _na     50_aa hypothetical protein
130 CAMPMO010000001.1 GCA946891365_00124 CDS open 123893-124543 _na     216_aa DUF4417 domain-containing protein
131 CAMPMO010000001.1 GCA946891365_00125 CDS open 124543-124956 _na     137_aa Phage-Barnase-EndoU-ColicinE5/D-RelE-like nuclease domain-containing protein
132 CAMPMO010000001.1 GCA946891365_00126 CDS open 124956-125288 _na     110_aa RNA helicase
133 CAMPMO010000001.1 GCA946891365_00127 CDS open 125566-125661 _na     31_aa hypothetical protein
134 CAMPMO010000001.1 GCA946891365_00128 CDS open 125774-126775 _na     333_aa Cytosine-specific methyltransferase
135 CAMPMO010000001.1 GCA946891365_00129 CDS open 127049-127930 _na     293_aa Abortive infection bacteriophage resistance protein
136 CAMPMO010000001.1 GCA946891365_00131 CDS open 129336-133376 _na     1346_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
137 CAMPMO010000001.1 GCA946891365_00132 CDS open 133389-134264 _na     291_aa cas1 type II CRISPR-associated endonuclease Cas1
138 CAMPMO010000001.1 GCA946891365_00133 CDS open 134269-134574 _na     101_aa cas2 CRISPR-associated endonuclease Cas2
139 CAMPMO010000001.1 GCA946891365_00134 CDS open 134571-135245 _na     224_aa csn2 type II-A CRISPR-associated protein Csn2
140 CAMPMO010000001.1 GCA946891365_00135 CDS open 136812-137102 _na     96_aa DNA-binding transcriptional regulator
141 CAMPMO010000001.1 GCA946891365_00136 CDS open 137771-138244 _na     157_aa tadA tRNA adenosine(34) deaminase TadA
142 CAMPMO010000001.1 GCA946891365_00137 CDS open 138363-139037 _na     224_aa Glycine transporter domain-containing protein
143 CAMPMO010000001.1 GCA946891365_00138 CDS open 139061-140893 _na     610_aa DUF4127 domain-containing protein
144 CAMPMO010000001.1 GCA946891365_00139 CDS open 141056-141235 _na     59_aa rpsU 30S ribosomal protein S21
145 CAMPMO010000001.1 GCA946891365_00140 CDS open 141261-141707 _na     148_aa YqeY-like protein
146 CAMPMO010000001.1 GCA946891365_00141 CDS open 141856-143757 _na     633_aa Glutamate--ammonia ligase%2C catalytic domain protein
147 CAMPMO010000001.1 GCA946891365_00142 CDS open 144025-145701 _na     558_aa formate--tetrahydrofolate ligase
148 CAMPMO010000001.1 GCA946891365_00143 CDS open 145701-146324 _na     207_aa Formiminotransferase-cyclodeaminase
149 CAMPMO010000001.1 GCA946891365_00144 CDS open 146525-146764 _na     79_aa hypothetical protein
150 CAMPMO010000001.1 GCA946891365_00145 CDS open 146709-147293 _na     194_aa hypothetical protein
151 CAMPMO010000001.1 GCA946891365_00146 CDS open 147501-147779 _na     92_aa XRE family transcriptional regulator
152 CAMPMO010000001.1 GCA946891365_00147 CDS open 147776-148144 _na     122_aa Type II toxin-antitoxin system RelE/ParE family toxin
153 CAMPMO010000001.1 GCA946891365_00148 CDS open 148257-148436 _na     59_aa hypothetical protein
154 CAMPMO010000001.1 GCA946891365_00149 CDS open 148558-151710 _na     1050_aa type I restriction endonuclease subunit R
155 CAMPMO010000001.1 GCA946891365_00150 CDS open 151700-152872 _na     390_aa DUF3800 domain-containing protein
156 CAMPMO010000001.1 GCA946891365_00151 CDS open 152875-154092 _na     405_aa restriction endonuclease subunit S
157 CAMPMO010000001.1 GCA946891365_00152 CDS open 154089-155909 _na     606_aa class I SAM-dependent DNA methyltransferase
158 CAMPMO010000001.1 GCA946891365_00153 CDS open 155902-156120 _na     72_aa helix-turn-helix transcriptional regulator
159 CAMPMO010000001.1 GCA946891365_00154 CDS open 156415-157521 _na     368_aa ychF redox-regulated ATPase YchF
160 CAMPMO010000001.1 GCA946891365_00155 CDS open 157535-158776 _na     413_aa LL-diaminopimelate aminotransferase
161 CAMPMO010000001.1 GCA946891365_00156 CDS open 158923-160140 _na     405_aa Efflux ABC transporter%2C permease protein
162 CAMPMO010000001.1 GCA946891365_00157 CDS open 160130-160837 _na     235_aa ABC transporter%2C ATP-binding protein
163 CAMPMO010000001.1 GCA946891365_00158 CDS open 160847-161947 _na     366_aa Efflux transporter%2C RND family%2C MFP subunit
164 CAMPMO010000001.1 GCA946891365_00159 CDS open 162123-163343 _na     406_aa cytX Hydroxymethylpyrimidine transporter CytX
165 CAMPMO010000001.1 GCA946891365_00160 CDS open 163401-165503 _na     700_aa peptidoglycan glycosyltransferase
166 CAMPMO010000001.1 GCA946891365_00161 CDS open 165793-168162 _na     789_aa ppsA phosphoenolpyruvate synthase
167 CAMPMO010000001.1 GCA946891365_00162 CDS open 168255-168899 _na     214_aa HTH domain protein
168 CAMPMO010000001.1 GCA946891365_00163 CDS open 168901-169722 _na     273_aa Putative pyruvate%2C phosphate dikinase regulatory protein
169 CAMPMO010000001.1 GCA946891365_00164 CDS open 170049-171956 _na     635_aa thrS threonine--tRNA ligase
170 CAMPMO010000001.1 GCA946891365_00165 CDS open 172511-173758 _na     415_aa Phage replisome organizer N-terminal domain protein
171 CAMPMO010000001.1 GCA946891365_00166 CDS open 173812-174060 _na     82_aa hypothetical protein
172 CAMPMO010000001.1 GCA946891365_00167 CDS open 174032-174565 _na     177_aa N-acetylmuramoyl-L-alanine amidase
173 CAMPMO010000001.1 GCA946891365_00168 CDS open 174590-174787 _na     65_aa DUF1659 domain-containing protein
174 CAMPMO010000001.1 GCA946891365_00169 CDS open 174820-175053 _na     77_aa DUF2922 domain-containing protein
175 CAMPMO010000001.1 GCA946891365_00170 CDS open 175242-175790 _na     182_aa RNA polymerase sigma factor%2C sigma-70 family
176 CAMPMO010000001.1 GCA946891365_00171 CDS open 176003-176437 _na     144_aa Very short patch repair endonuclease
177 CAMPMO010000001.1 GCA946891365_00172 CDS open 176517-176948 _na     143_aa Bacterial sensory transduction regulator
178 CAMPMO010000001.1 GCA946891365_00173 CDS open 177192-178157 _na     321_aa Periplasmic binding protein
179 CAMPMO010000001.1 GCA946891365_00174 CDS open 178154-179167 _na     337_aa Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein
180 CAMPMO010000001.1 GCA946891365_00175 CDS open 179160-179948 _na     262_aa fhuC Ferrichrome ABC transporter%2C ATP-binding protein FhuC
181 CAMPMO010000001.1 GCA946891365_00176 CDS open 179985-182522 _na     845_aa TonB-dependent siderophore receptor
182 CAMPMO010000001.1 GCA946891365_00177 CDS open 182647-184362 _na     571_aa ABC transporter%2C ATP-binding protein
183 CAMPMO010000001.1 GCA946891365_00178 CDS open 184800-185105 _na     101_aa DUF2325 domain-containing protein
184 CAMPMO010000001.1 GCA946891365_00179 CDS open 185459-186247 _na     262_aa Electron transfer flavoprotein small subunit
185 CAMPMO010000001.1 GCA946891365_00180 CDS open 186260-187261 _na     333_aa Electron transfer flavoprotein FAD-binding domain protein
186 CAMPMO010000001.1 GCA946891365_00181 CDS open 187448-187843 _na     131_aa DUF2116 domain-containing protein
187 CAMPMO010000001.1 GCA946891365_00182 CDS open 187855-190428 _na     857_aa polA DNA polymerase I
188 CAMPMO010000001.1 GCA946891365_00183 CDS open 190439-191281 _na     280_aa mutM bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase
189 CAMPMO010000001.1 GCA946891365_00184 CDS open 191274-191894 _na     206_aa coaE dephospho-CoA kinase
190 CAMPMO010000001.1 GCA946891365_00185 CDS open 191993-192472 _na     159_aa Transglycosylase SLT domain protein
191 CAMPMO010000001.1 GCA946891365_00187 CDS open 192583-193308 _na     241_aa DUF1828 domain-containing protein
192 CAMPMO010000001.1 GCA946891365_00188 CDS open 193384-193851 _na     155_aa rimP Ribosome maturation factor RimP
193 CAMPMO010000001.1 GCA946891365_00189 CDS open 193866-194984 _na     372_aa nusA Transcription termination/antitermination protein NusA
194 CAMPMO010000001.1 GCA946891365_00190 CDS open 194995-195255 _na     86_aa rnpM RNase P modulator RnpM
195 CAMPMO010000001.1 GCA946891365_00191 CDS open 195252-195566 _na     104_aa Ribosomal protein L7Ae
196 CAMPMO010000001.1 GCA946891365_00192 CDS open 195580-198006 _na     808_aa infB translation initiation factor IF-2
197 CAMPMO010000001.1 GCA946891365_00193 CDS open 198021-198368 _na     115_aa rbfA 30S ribosome-binding factor RbfA
198 CAMPMO010000001.1 GCA946891365_00194 CDS open 198372-199316 _na     314_aa DHHA1 domain protein
199 CAMPMO010000001.1 GCA946891365_00195 CDS open 199313-200191 _na     292_aa truB tRNA pseudouridine(55) synthase TruB
200 CAMPMO010000001.1 GCA946891365_00196 CDS open 200205-201167 _na     320_aa bifunctional riboflavin kinase/FAD synthetase
201 CAMPMO010000001.1 GCA946891365_00197 CDS open 201249-206747 _na     1832_aa TonB-dependent receptor plug domain protein
202 CAMPMO010000001.1 GCA946891365_00198 CDS open 207174-208349 _na     391_aa phosphoribosylaminoimidazolecarboxamide formyltransferase
203 CAMPMO010000001.1 GCA946891365_00199 CDS open 208541-209092 _na     183_aa yfcE phosphodiesterase
204 CAMPMO010000001.1 GCA946891365_00200 CDS open 209183-209701 _na     172_aa SMODS and SLOG-associating 2TM effector domain-containing protein
205 CAMPMO010000001.1 GCA946891365_00201 CDS open 209922-210593 _na     223_aa 5'-nucleotidase
206 CAMPMO010000001.1 GCA946891365_00202 CDS open 210593-213514 _na     973_aa Peptidase M16 inactive domain protein
207 CAMPMO010000001.1 GCA946891365_00203 CDS open 213528-214478 _na     316_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
208 CAMPMO010000001.1 GCA946891365_00204 CDS open 214639-215079 _na     146_aa mraZ division/cell wall cluster transcriptional repressor MraZ
209 CAMPMO010000001.1 GCA946891365_00205 CDS open 215088-216020 _na     310_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
210 CAMPMO010000001.1 GCA946891365_00206 CDS open 216060-216443 _na     127_aa ftsL Cell division protein FtsL
211 CAMPMO010000001.1 GCA946891365_00207 CDS open 216542-218041 _na     499_aa UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
212 CAMPMO010000001.1 GCA946891365_00208 CDS open 218044-219420 _na     458_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
213 CAMPMO010000001.1 GCA946891365_00209 CDS open 219426-220403 _na     325_aa mraY phospho-N-acetylmuramoyl-pentapeptide-transferase
214 CAMPMO010000001.1 GCA946891365_00210 CDS open 220432-221796 _na     454_aa murD UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase
215 CAMPMO010000001.1 GCA946891365_00211 CDS open 221828-222964 _na     378_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
216 CAMPMO010000001.1 GCA946891365_00212 CDS open 222961-224355 _na     464_aa murC UDP-N-acetylmuramate--L-alanine ligase
217 CAMPMO010000001.1 GCA946891365_00213 CDS open 224355-225296 _na     313_aa D-alanine--D-alanine ligase
218 CAMPMO010000001.1 GCA946891365_00214 CDS open 225324-226211 _na     295_aa POTRA domain protein%2C FtsQ-type
219 CAMPMO010000001.1 GCA946891365_00215 CDS open 226335-227360 _na     341_aa ftsZ cell division protein FtsZ
220 CAMPMO010000001.1 GCA946891365_00216 CDS open 227429-227902 _na     157_aa nrdR transcriptional regulator NrdR
221 CAMPMO010000001.1 GCA946891365_00217 CDS open 227920-229404 _na     494_aa hldE Bifunctional protein HldE
222 CAMPMO010000001.1 GCA946891365_00218 CDS open 229477-230007 _na     176_aa D%2CD-heptose 1%2C7-bisphosphate phosphatase
223 CAMPMO010000001.1 GCA946891365_00219 CDS open 229994-231025 _na     343_aa Lipopolysaccharide heptosyltransferase I
224 CAMPMO010000001.1 GCA946891365_00220 CDS open 231111-231695 _na     194_aa Outer membrane insertion signal domain protein
225 CAMPMO010000001.1 GCA946891365_00221 CDS open 231840-232997 _na     385_aa cysteine desulfurase
226 CAMPMO010000001.1 GCA946891365_00222 CDS open 232994-234082 _na     362_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
227 CAMPMO010000001.1 GCA946891365_00223 CDS open 234099-235901 _na     600_aa lepA translation elongation factor 4
228 CAMPMO010000001.1 GCA946891365_00224 CDS open 235898-237016 _na     372_aa hemW radical SAM family heme chaperone HemW
229 CAMPMO010000001.1 GCA946891365_00225 CDS open 237393-237806 _na     137_aa Thioesterase domain-containing protein
230 CAMPMO010000001.1 GCA946891365_00226 CDS open 237820-238245 _na     141_aa Thioesterase domain-containing protein
231 CAMPMO010000001.1 GCA946891365_00227 CDS open 238278-239420 _na     380_aa Acyl-CoA dehydrogenase
232 CAMPMO010000001.1 GCA946891365_00228 CDS open 239686-240711 _na     341_aa pheS phenylalanine--tRNA ligase subunit alpha
233 CAMPMO010000001.1 GCA946891365_00229 CDS open 240727-243159 _na     810_aa pheT phenylalanine--tRNA ligase subunit beta
234 CAMPMO010000001.1 GCA946891365_00230 CDS open 243440-244765 _na     441_aa tig trigger factor
235 CAMPMO010000001.1 GCA946891365_00231 CDS open 244784-245386 _na     200_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
236 CAMPMO010000001.1 GCA946891365_00232 CDS open 245398-246630 _na     410_aa clpX ATP-dependent Clp protease ATP-binding subunit ClpX
237 CAMPMO010000001.1 GCA946891365_00233 CDS open 246704-249019 _na     771_aa lon endopeptidase La
238 CAMPMO010000001.1 GCA946891365_00234 CDS open 249021-249641 _na     206_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
239 CAMPMO010000001.1 GCA946891365_00235 CDS open 250118-252523 _na     801_aa Formate C-acetyltransferase
240 CAMPMO010000001.1 GCA946891365_00236 CDS open 252549-253475 _na     308_aa Glycyl-radical enzyme activating protein family protein
241 CAMPMO010000001.1 GCA946891365_00237 CDS open 253658-254986 _na     442_aa Aminopeptidase
242 CAMPMO010000001.1 GCA946891365_00238 CDS open 255209-256249 _na     346_aa mreB Cell shape-determining protein MreB
243 CAMPMO010000001.1 GCA946891365_00239 CDS open 256252-257172 _na     306_aa mreC rod shape-determining protein MreC
244 CAMPMO010000001.1 GCA946891365_00240 CDS open 257169-257681 _na     170_aa mreD rod shape-determining protein MreD
245 CAMPMO010000001.1 GCA946891365_00241 CDS open 257699-259531 _na     610_aa mrdA penicillin-binding protein 2
246 CAMPMO010000001.1 GCA946891365_00242 CDS open 259546-260544 _na     332_aa CobQ/CobB/MinD/ParA nucleotide binding domain protein
247 CAMPMO010000001.1 GCA946891365_00243 CDS open 260555-261655 _na     366_aa rodA rod shape-determining protein RodA
248 CAMPMO010000001.1 GCA946891365_00244 CDS open 261708-263141 _na     477_aa S1 RNA binding domain protein
249 CAMPMO010000001.1 GCA946891365_00245 CDS open 263341-264303 _na     320_aa Lactate/malate dehydrogenase%2C NAD binding domain protein
250 CAMPMO010000001.1 GCA946891365_00246 CDS open 264386-265153 _na     255_aa exodeoxyribonuclease III
251 CAMPMO010000001.1 GCA946891365_00247 CDS open 265365-265637 _na     90_aa ACT domain-containing protein
252 CAMPMO010000001.1 GCA946891365_00248 CDS open 265650-267008 _na     452_aa UPF0210 protein HMPREF3033_01651
253 CAMPMO010000001.1 GCA946891365_00249 CDS open 267045-268088 _na     347_aa Glycosyltransferase%2C group 4 family
254 CAMPMO010000001.1 GCA946891365_00250 CDS open 268126-269280 _na     384_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
255 CAMPMO010000001.1 GCA946891365_00251 CDS open 269680-269964 _na     94_aa F0F1-ATPase subunit
256 CAMPMO010000001.1 GCA946891365_00252 CDS open 269974-270360 _na     128_aa ATP synthase I chain
257 CAMPMO010000001.1 GCA946891365_00253 CDS open 270364-271035 _na     223_aa atpB F0F1 ATP synthase subunit A
258 CAMPMO010000001.1 GCA946891365_00254 CDS open 271086-271343 _na     85_aa atpE F0F1 ATP synthase subunit C
259 CAMPMO010000001.1 GCA946891365_00255 CDS open 271392-271886 _na     164_aa atpF F0F1 ATP synthase subunit B
260 CAMPMO010000001.1 GCA946891365_00256 CDS open 271889-272455 _na     188_aa F0F1 ATP synthase subunit delta
261 CAMPMO010000001.1 GCA946891365_00257 CDS open 272455-273990 _na     511_aa atpA F0F1 ATP synthase subunit alpha
262 CAMPMO010000001.1 GCA946891365_00258 CDS open 273994-274854 _na     286_aa atpG ATP synthase F1 subunit gamma
263 CAMPMO010000001.1 GCA946891365_00259 CDS open 274894-276312 _na     472_aa atpD F0F1 ATP synthase subunit beta
264 CAMPMO010000001.1 GCA946891365_00260 CDS open 276316-276738 _na     140_aa F0F1 ATP synthase subunit epsilon
265 CAMPMO010000001.1 GCA946891365_00261 CDS open 276862-277167 _na     101_aa hypothetical protein
266 CAMPMO010000001.1 GCA946891365_00262 CDS open 277351-277626 _na     91_aa hypothetical protein
267 CAMPMO010000001.1 GCA946891365_00263 CDS open 277711-278928 _na     405_aa bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II
268 CAMPMO010000001.1 GCA946891365_00264 CDS open 278931-279362 _na     143_aa hypothetical protein
269 CAMPMO010000001.1 GCA946891365_00265 CDS open 279396-279734 _na     112_aa FAD-linked oxidase C-terminal domain-containing protein
270 CAMPMO010000001.1 GCA946891365_00001 gene open 42-815
271 CAMPMO010000001.1 GCA946891365_00002 gene open 1367-5695
272 CAMPMO010000001.1 GCA946891365_00003 gene open 5765-6622 metF
273 CAMPMO010000001.1 GCA946891365_00004 gene open 6718-7542
274 CAMPMO010000001.1 GCA946891365_00005 gene open 8187-9002
275 CAMPMO010000001.1 GCA946891365_00006 gene open 8999-9682
276 CAMPMO010000001.1 GCA946891365_00007 gene open 9695-11170
277 CAMPMO010000001.1 GCA946891365_00008 gene open 11437-12168
278 CAMPMO010000001.1 GCA946891365_00009 gene open 12152-13534 pabB
279 CAMPMO010000001.1 GCA946891365_00010 gene open 13531-14133
280 CAMPMO010000001.1 GCA946891365_00012 gene open 14939-16105
281 CAMPMO010000001.1 GCA946891365_00013 gene open 16162-16674 ybaK
282 CAMPMO010000001.1 GCA946891365_00014 gene open 16807-17592
283 CAMPMO010000001.1 GCA946891365_00015 gene open 17674-19023 gdhA
284 CAMPMO010000001.1 GCA946891365_00017 gene open 19532-19765
285 CAMPMO010000001.1 GCA946891365_00018 gene open 19967-22003 recG
286 CAMPMO010000001.1 GCA946891365_00019 gene open 22132-23589 guaB
287 CAMPMO010000001.1 GCA946891365_00020 gene open 23609-24340
288 CAMPMO010000001.1 GCA946891365_00021 gene open 24350-24988
289 CAMPMO010000001.1 GCA946891365_00022 gene open 24985-25668
290 CAMPMO010000001.1 GCA946891365_00023 gene open 25688-26935
291 CAMPMO010000001.1 GCA946891365_00024 gene open 26950-27726 surE
292 CAMPMO010000001.1 GCA946891365_00025 gene open 28022-29410
293 CAMPMO010000001.1 GCA946891365_00026 gene open 29640-31064
294 CAMPMO010000001.1 GCA946891365_00028 gene open 31999-32979 cdiA
295 CAMPMO010000001.1 GCA946891365_00029 gene open 33548-33709
296 CAMPMO010000001.1 GCA946891365_00030 gene open 33667-34041
297 CAMPMO010000001.1 GCA946891365_00031 gene open 33989-34336
298 CAMPMO010000001.1 GCA946891365_00032 gene open 34443-37934
299 CAMPMO010000001.1 GCA946891365_00033 gene open 38141-38701
300 CAMPMO010000001.1 GCA946891365_00034 gene open 38765-40282
301 CAMPMO010000001.1 GCA946891365_00035 gene open 40522-41157
302 CAMPMO010000001.1 GCA946891365_00036 gene open 41330-42097
303 CAMPMO010000001.1 GCA946891365_00037 gene open 42274-43503
304 CAMPMO010000001.1 GCA946891365_00038 gene open 43525-44961 argH
305 CAMPMO010000001.1 GCA946891365_00039 gene open 45129-45968 lpxC
306 CAMPMO010000001.1 GCA946891365_00040 gene open 45983-46426 fabZ
307 CAMPMO010000001.1 GCA946891365_00041 gene open 46624-47433 lpxA
308 CAMPMO010000001.1 GCA946891365_00042 gene open 47550-48365 minC
309 CAMPMO010000001.1 GCA946891365_00043 gene open 48374-49516 lpxB
310 CAMPMO010000001.1 GCA946891365_00044 gene open 49513-51267 msbA
311 CAMPMO010000001.1 GCA946891365_00045 gene open 51280-52590
312 CAMPMO010000001.1 GCA946891365_00046 gene open 52574-53707 lpxK
313 CAMPMO010000001.1 GCA946891365_00047 gene open 53704-54441 kdsB
314 CAMPMO010000001.1 GCA946891365_00048 gene open 54445-55290 kdsA
315 CAMPMO010000001.1 GCA946891365_00049 gene open 55308-56279
316 CAMPMO010000001.1 GCA946891365_00050 gene open 56276-56812 yrbI
317 CAMPMO010000001.1 GCA946891365_00051 gene open 56831-57763
318 CAMPMO010000001.1 GCA946891365_00052 gene open 57744-58295 lptC
319 CAMPMO010000001.1 GCA946891365_00053 gene open 58298-59026
320 CAMPMO010000001.1 GCA946891365_00054 gene open 59044-59763 lptB
321 CAMPMO010000001.1 GCA946891365_00055 gene open 59780-60868
322 CAMPMO010000001.1 GCA946891365_00056 gene open 60961-62244
323 CAMPMO010000001.1 GCA946891365_00057 gene open 62254-62670
324 CAMPMO010000001.1 GCA946891365_00058 gene open 62667-63527
325 CAMPMO010000001.1 GCA946891365_00059 gene open 63644-63880
326 CAMPMO010000001.1 GCA946891365_00060 gene open 64028-64570 fapR
327 CAMPMO010000001.1 GCA946891365_00061 gene open 64586-65614 plsX
328 CAMPMO010000001.1 GCA946891365_00062 gene open 65586-66599
329 CAMPMO010000001.1 GCA946891365_00063 gene open 66617-67558 fabD
330 CAMPMO010000001.1 GCA946891365_00064 gene open 67560-68303 fabG
331 CAMPMO010000001.1 GCA946891365_00065 gene open 68348-68593 acpP
332 CAMPMO010000001.1 GCA946891365_00066 gene open 68661-69623
333 CAMPMO010000001.1 GCA946891365_00067 gene open 69650-70906 fabF
334 CAMPMO010000001.1 GCA946891365_00068 gene open 70869-71624 rnc
335 CAMPMO010000001.1 GCA946891365_00069 gene open 71667-72743
336 CAMPMO010000001.1 GCA946891365_00070 gene open 72736-73491
337 CAMPMO010000001.1 GCA946891365_00071 gene open 73645-75051
338 CAMPMO010000001.1 GCA946891365_00072 gene open 75355-76734
339 CAMPMO010000001.1 GCA946891365_00073 gene open 76873-77685 trmH
340 CAMPMO010000001.1 GCA946891365_00074 gene open 77694-78620
341 CAMPMO010000001.1 GCA946891365_00075 gene open 78628-79476 hpnK
342 CAMPMO010000001.1 GCA946891365_00076 gene open 79489-80418
343 CAMPMO010000001.1 GCA946891365_00077 gene open 80415-80864
344 CAMPMO010000001.1 GCA946891365_00078 gene open 80884-82170
345 CAMPMO010000001.1 GCA946891365_00079 gene open 82174-83097 thrB
346 CAMPMO010000001.1 GCA946891365_00080 gene open 83276-84031 deoC
347 CAMPMO010000001.1 GCA946891365_00081 gene open 84123-84779 deoC
348 CAMPMO010000001.1 GCA946891365_00082 gene open 84769-85710
349 CAMPMO010000001.1 GCA946891365_00083 gene open 85730-86839
350 CAMPMO010000001.1 GCA946891365_00084 gene open 86836-87315 rlmH
351 CAMPMO010000001.1 GCA946891365_00085 gene open 87421-87891
352 CAMPMO010000001.1 GCA946891365_00086 gene open 88107-88670 ahpC
353 CAMPMO010000001.1 GCA946891365_00087 gene open 88682-90334
354 CAMPMO010000001.1 GCA946891365_00089 gene open 90580-93189
355 CAMPMO010000001.1 GCA946891365_00090 gene open 93361-94557
356 CAMPMO010000001.1 GCA946891365_00091 gene open 94520-95464
357 CAMPMO010000001.1 GCA946891365_00092 gene open 95461-96660
358 CAMPMO010000001.1 GCA946891365_00093 gene open 96677-97084
359 CAMPMO010000001.1 GCA946891365_00094 gene open 97107-97550
360 CAMPMO010000001.1 GCA946891365_00095 gene open 97508-97975
361 CAMPMO010000001.1 GCA946891365_00096 gene open 97968-98324
362 CAMPMO010000001.1 GCA946891365_00097 gene open 98269-98823
363 CAMPMO010000001.1 GCA946891365_00098 gene open 98845-99288
364 CAMPMO010000001.1 GCA946891365_00099 gene open 99307-100071
365 CAMPMO010000001.1 GCA946891365_00100 gene open 100086-100667 pilN
366 CAMPMO010000001.1 GCA946891365_00101 gene open 100609-101079
367 CAMPMO010000001.1 GCA946891365_00102 gene open 101317-101928
368 CAMPMO010000001.1 GCA946891365_00103 gene open 101940-102344
369 CAMPMO010000001.1 GCA946891365_00104 gene open 102352-103143 tonB
370 CAMPMO010000001.1 GCA946891365_00105 gene open 103288-103806
371 CAMPMO010000001.1 GCA946891365_00106 gene open 103819-105498 hutW
372 CAMPMO010000001.1 GCA946891365_00107 gene open 105877-107214 nox
373 CAMPMO010000001.1 GCA946891365_00108 gene open 107722-108732 ilvC
374 CAMPMO010000001.1 GCA946891365_00109 gene open 108821-110521 ilvB
375 CAMPMO010000001.1 GCA946891365_00110 gene open 110518-111018 ilvN
376 CAMPMO010000001.1 GCA946891365_00111 gene open 111039-112691 ilvD
377 CAMPMO010000001.1 GCA946891365_00112 gene open 113083-115743
378 CAMPMO010000001.1 GCA946891365_00113 gene open 115756-117060
379 CAMPMO010000001.1 GCA946891365_00114 gene open 117237-117620
380 CAMPMO010000001.1 GCA946891365_00115 gene open 117760-119025
381 CAMPMO010000001.1 GCA946891365_00116 gene open 119108-119770 rex
382 CAMPMO010000001.1 GCA946891365_00117 gene open 119910-120350 rplM
383 CAMPMO010000001.1 GCA946891365_00118 gene open 120369-120764 rpsI
384 CAMPMO010000001.1 GCA946891365_00119 gene open 120975-122510 guaA
385 CAMPMO010000001.1 GCA946891365_00121 gene open 122854-123213
386 CAMPMO010000001.1 GCA946891365_00122 gene open 123263-123751
387 CAMPMO010000001.1 GCA946891365_00123 gene open 123748-123900
388 CAMPMO010000001.1 GCA946891365_00124 gene open 123893-124543
389 CAMPMO010000001.1 GCA946891365_00125 gene open 124543-124956
390 CAMPMO010000001.1 GCA946891365_00126 gene open 124956-125288
391 CAMPMO010000001.1 GCA946891365_00127 gene open 125566-125661
392 CAMPMO010000001.1 GCA946891365_00128 gene open 125774-126775
393 CAMPMO010000001.1 GCA946891365_00129 gene open 127049-127930
394 CAMPMO010000001.1 GCA946891365_00131 gene open 129336-133376 cas9
395 CAMPMO010000001.1 GCA946891365_00132 gene open 133389-134264 cas1
396 CAMPMO010000001.1 GCA946891365_00133 gene open 134269-134574 cas2
397 CAMPMO010000001.1 GCA946891365_00134 gene open 134571-135245 csn2
398 CAMPMO010000001.1 GCA946891365_00135 gene open 136812-137102
399 CAMPMO010000001.1 GCA946891365_00136 gene open 137771-138244 tadA
400 CAMPMO010000001.1 GCA946891365_00137 gene open 138363-139037
401 CAMPMO010000001.1 GCA946891365_00138 gene open 139061-140893
402 CAMPMO010000001.1 GCA946891365_00139 gene open 141056-141235 rpsU
403 CAMPMO010000001.1 GCA946891365_00140 gene open 141261-141707
404 CAMPMO010000001.1 GCA946891365_00141 gene open 141856-143757
405 CAMPMO010000001.1 GCA946891365_00142 gene open 144025-145701
406 CAMPMO010000001.1 GCA946891365_00143 gene open 145701-146324
407 CAMPMO010000001.1 GCA946891365_00144 gene open 146525-146764
408 CAMPMO010000001.1 GCA946891365_00145 gene open 146709-147293
409 CAMPMO010000001.1 GCA946891365_00146 gene open 147501-147779
410 CAMPMO010000001.1 GCA946891365_00147 gene open 147776-148144
411 CAMPMO010000001.1 GCA946891365_00148 gene open 148257-148436
412 CAMPMO010000001.1 GCA946891365_00149 gene open 148558-151710
413 CAMPMO010000001.1 GCA946891365_00150 gene open 151700-152872
414 CAMPMO010000001.1 GCA946891365_00151 gene open 152875-154092
415 CAMPMO010000001.1 GCA946891365_00152 gene open 154089-155909
416 CAMPMO010000001.1 GCA946891365_00153 gene open 155902-156120
417 CAMPMO010000001.1 GCA946891365_00154 gene open 156415-157521 ychF
418 CAMPMO010000001.1 GCA946891365_00155 gene open 157535-158776
419 CAMPMO010000001.1 GCA946891365_00156 gene open 158923-160140
420 CAMPMO010000001.1 GCA946891365_00157 gene open 160130-160837
421 CAMPMO010000001.1 GCA946891365_00158 gene open 160847-161947
422 CAMPMO010000001.1 GCA946891365_00159 gene open 162123-163343 cytX
423 CAMPMO010000001.1 GCA946891365_00160 gene open 163401-165503
424 CAMPMO010000001.1 GCA946891365_00161 gene open 165793-168162 ppsA
425 CAMPMO010000001.1 GCA946891365_00162 gene open 168255-168899
426 CAMPMO010000001.1 GCA946891365_00163 gene open 168901-169722
427 CAMPMO010000001.1 GCA946891365_00164 gene open 170049-171956 thrS
428 CAMPMO010000001.1 GCA946891365_00165 gene open 172511-173758
429 CAMPMO010000001.1 GCA946891365_00166 gene open 173812-174060
430 CAMPMO010000001.1 GCA946891365_00167 gene open 174032-174565
431 CAMPMO010000001.1 GCA946891365_00168 gene open 174590-174787
432 CAMPMO010000001.1 GCA946891365_00169 gene open 174820-175053
433 CAMPMO010000001.1 GCA946891365_00170 gene open 175242-175790
434 CAMPMO010000001.1 GCA946891365_00171 gene open 176003-176437
435 CAMPMO010000001.1 GCA946891365_00172 gene open 176517-176948
436 CAMPMO010000001.1 GCA946891365_00173 gene open 177192-178157
437 CAMPMO010000001.1 GCA946891365_00174 gene open 178154-179167
438 CAMPMO010000001.1 GCA946891365_00175 gene open 179160-179948 fhuC
439 CAMPMO010000001.1 GCA946891365_00176 gene open 179985-182522
440 CAMPMO010000001.1 GCA946891365_00177 gene open 182647-184362
441 CAMPMO010000001.1 GCA946891365_00178 gene open 184800-185105
442 CAMPMO010000001.1 GCA946891365_00179 gene open 185459-186247
443 CAMPMO010000001.1 GCA946891365_00180 gene open 186260-187261
444 CAMPMO010000001.1 GCA946891365_00181 gene open 187448-187843
445 CAMPMO010000001.1 GCA946891365_00182 gene open 187855-190428 polA
446 CAMPMO010000001.1 GCA946891365_00183 gene open 190439-191281 mutM
447 CAMPMO010000001.1 GCA946891365_00184 gene open 191274-191894 coaE
448 CAMPMO010000001.1 GCA946891365_00185 gene open 191993-192472
449 CAMPMO010000001.1 GCA946891365_00187 gene open 192583-193308
450 CAMPMO010000001.1 GCA946891365_00188 gene open 193384-193851 rimP
451 CAMPMO010000001.1 GCA946891365_00189 gene open 193866-194984 nusA
452 CAMPMO010000001.1 GCA946891365_00190 gene open 194995-195255 rnpM
453 CAMPMO010000001.1 GCA946891365_00191 gene open 195252-195566
454 CAMPMO010000001.1 GCA946891365_00192 gene open 195580-198006 infB
455 CAMPMO010000001.1 GCA946891365_00193 gene open 198021-198368 rbfA
456 CAMPMO010000001.1 GCA946891365_00194 gene open 198372-199316
457 CAMPMO010000001.1 GCA946891365_00195 gene open 199313-200191 truB
458 CAMPMO010000001.1 GCA946891365_00196 gene open 200205-201167
459 CAMPMO010000001.1 GCA946891365_00197 gene open 201249-206747
460 CAMPMO010000001.1 GCA946891365_00198 gene open 207174-208349
461 CAMPMO010000001.1 GCA946891365_00199 gene open 208541-209092 yfcE
462 CAMPMO010000001.1 GCA946891365_00200 gene open 209183-209701
463 CAMPMO010000001.1 GCA946891365_00201 gene open 209922-210593
464 CAMPMO010000001.1 GCA946891365_00202 gene open 210593-213514
465 CAMPMO010000001.1 GCA946891365_00203 gene open 213528-214478 gluQRS
466 CAMPMO010000001.1 GCA946891365_00204 gene open 214639-215079 mraZ
467 CAMPMO010000001.1 GCA946891365_00205 gene open 215088-216020 rsmH
468 CAMPMO010000001.1 GCA946891365_00206 gene open 216060-216443 ftsL
469 CAMPMO010000001.1 GCA946891365_00207 gene open 216542-218041
470 CAMPMO010000001.1 GCA946891365_00208 gene open 218044-219420
471 CAMPMO010000001.1 GCA946891365_00209 gene open 219426-220403 mraY
472 CAMPMO010000001.1 GCA946891365_00210 gene open 220432-221796 murD
473 CAMPMO010000001.1 GCA946891365_00211 gene open 221828-222964 murG
474 CAMPMO010000001.1 GCA946891365_00212 gene open 222961-224355 murC
475 CAMPMO010000001.1 GCA946891365_00213 gene open 224355-225296
476 CAMPMO010000001.1 GCA946891365_00214 gene open 225324-226211
477 CAMPMO010000001.1 GCA946891365_00215 gene open 226335-227360 ftsZ
478 CAMPMO010000001.1 GCA946891365_00216 gene open 227429-227902 nrdR
479 CAMPMO010000001.1 GCA946891365_00217 gene open 227920-229404 hldE
480 CAMPMO010000001.1 GCA946891365_00218 gene open 229477-230007
481 CAMPMO010000001.1 GCA946891365_00219 gene open 229994-231025
482 CAMPMO010000001.1 GCA946891365_00220 gene open 231111-231695
483 CAMPMO010000001.1 GCA946891365_00221 gene open 231840-232997
484 CAMPMO010000001.1 GCA946891365_00222 gene open 232994-234082 mnmA
485 CAMPMO010000001.1 GCA946891365_00223 gene open 234099-235901 lepA
486 CAMPMO010000001.1 GCA946891365_00224 gene open 235898-237016 hemW
487 CAMPMO010000001.1 GCA946891365_00225 gene open 237393-237806
488 CAMPMO010000001.1 GCA946891365_00226 gene open 237820-238245
489 CAMPMO010000001.1 GCA946891365_00227 gene open 238278-239420
490 CAMPMO010000001.1 GCA946891365_00228 gene open 239686-240711 pheS
491 CAMPMO010000001.1 GCA946891365_00229 gene open 240727-243159 pheT
492 CAMPMO010000001.1 GCA946891365_00230 gene open 243440-244765 tig
493 CAMPMO010000001.1 GCA946891365_00231 gene open 244784-245386 clpP
494 CAMPMO010000001.1 GCA946891365_00232 gene open 245398-246630 clpX
495 CAMPMO010000001.1 GCA946891365_00233 gene open 246704-249019 lon
496 CAMPMO010000001.1 GCA946891365_00234 gene open 249021-249641 yihA
497 CAMPMO010000001.1 GCA946891365_00235 gene open 250118-252523
498 CAMPMO010000001.1 GCA946891365_00236 gene open 252549-253475
499 CAMPMO010000001.1 GCA946891365_00237 gene open 253658-254986
500 CAMPMO010000001.1 GCA946891365_00238 gene open 255209-256249 mreB