HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Porphyromonas gingivalis (GCA_946891835.1)

Select a Genome:
BAKTA Annotations for GCA_946891835.1
Genome Selected: Porphyromonas gingivalis
ContigsBases CDSrRNA tmRNAtRNA
236 1684954 1380 0 1 28
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2831 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:6]    |    Number of Records Found: 2831 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2501 CAMPNM010000174.1 GCA946891835_01249 CDS open 2710-3723 _na     337_aa trpE aminodeoxychorismate synthase component I
2502 CAMPNM010000174.1 GCA946891835_01250 CDS open 3769-3993 _na     74_aa hypothetical protein
2503 CAMPNM010000174.1 GCA946891835_01246 gene open 119-421
2504 CAMPNM010000174.1 GCA946891835_01247 gene open 418-2061
2505 CAMPNM010000174.1 GCA946891835_01248 gene open 2104-2703 ilvE
2506 CAMPNM010000174.1 GCA946891835_01249 gene open 2710-3723 trpE
2507 CAMPNM010000174.1 GCA946891835_01250 gene open 3769-3993
2508 CAMPNM010000175.1 GCA946891835_01251 CDS open 186-998 _na     270_aa 3-keto-5-aminohexanoate cleavage protein
2509 CAMPNM010000175.1 GCA946891835_01252 CDS open 1040-2083 _na     347_aa qor Alcohol dehydrogenase%2C zinc-containing%2C putative
2510 CAMPNM010000175.1 GCA946891835_01253 CDS open 2170-3420 _na     416_aa ablA lysine 2%2C3-aminomutase
2511 CAMPNM010000175.1 GCA946891835_01251 gene open 186-998
2512 CAMPNM010000175.1 GCA946891835_01252 gene open 1040-2083 qor
2513 CAMPNM010000175.1 GCA946891835_01253 gene open 2170-3420 ablA
2514 CAMPNM010000176.1 GCA946891835_01254 CDS open 83-361 _na     92_aa hypothetical protein
2515 CAMPNM010000176.1 GCA946891835_01255 CDS open 462-1457 _na     331_aa mMP0363 ATPase%2C MoxR family
2516 CAMPNM010000176.1 GCA946891835_01256 CDS open 1579-2340 _na     253_aa mMP0362 DUF58 domain-containing protein
2517 CAMPNM010000176.1 GCA946891835_01257 CDS open 2337-3293 _na     318_aa batD Protein BatD
2518 CAMPNM010000176.1 GCA946891835_01254 gene open 83-361
2519 CAMPNM010000176.1 GCA946891835_01255 gene open 462-1457 mMP0363
2520 CAMPNM010000176.1 GCA946891835_01256 gene open 1579-2340 mMP0362
2521 CAMPNM010000176.1 GCA946891835_01257 gene open 2337-3293 batD
2522 CAMPNM010000177.1 GCA946891835_01258 CDS open 50-610 _na     186_aa aroK shikimate kinase
2523 CAMPNM010000177.1 GCA946891835_01259 CDS open 549-2084 _na     511_aa comEC ComEC/Rec2-related protein
2524 CAMPNM010000177.1 GCA946891835_01260 CDS open 2091-2747 _na     218_aa rpe ribulose-phosphate 3-epimerase
2525 CAMPNM010000177.1 GCA946891835_01258 gene open 50-610 aroK
2526 CAMPNM010000177.1 GCA946891835_01259 gene open 549-2084 comEC
2527 CAMPNM010000177.1 GCA946891835_01260 gene open 2091-2747 rpe
2528 CAMPNM010000178.1 GCA946891835_01261 CDS open 258-767 _na     169_aa cnoX Putative thioredoxin
2529 CAMPNM010000178.1 GCA946891835_01262 CDS open 905-2032 _na     375_aa N-acetyltransferase domain-containing protein
2530 CAMPNM010000178.1 GCA946891835_01263 CDS open 2123-3787 _na     554_aa udk Phosphoribulokinase family protein
2531 CAMPNM010000178.1 GCA946891835_01261 gene open 258-767 cnoX
2532 CAMPNM010000178.1 GCA946891835_01262 gene open 905-2032
2533 CAMPNM010000178.1 GCA946891835_01263 gene open 2123-3787 udk
2534 CAMPNM010000179.1 GCA946891835_01264 CDS open 383-1369 _na     328_aa GSCFA domain-containing protein
2535 CAMPNM010000179.1 GCA946891835_01265 CDS open 1405-3876 _na     823_aa alr bifunctional UDP-N-acetylmuramoyl-tripeptide:D-alanyl-D-alanine ligase/alanine racemase
2536 CAMPNM010000179.1 GCA946891835_01264 gene open 383-1369
2537 CAMPNM010000179.1 GCA946891835_01265 gene open 1405-3876 alr
2538 CAMPNM010000180.1 GCA946891835_01266 CDS open 135-1187 _na     350_aa ybbC Lipoprotein
2539 CAMPNM010000180.1 GCA946891835_01267 CDS open 1266-3731 _na     821_aa cTD-A PKD domain-containing protein
2540 CAMPNM010000180.1 GCA946891835_01266 gene open 135-1187 ybbC
2541 CAMPNM010000180.1 GCA946891835_01267 gene open 1266-3731 cTD-A
2542 CAMPNM010000181.1 GCA946891835_01268 CDS open 347-940 _na     197_aa chrA putative chromate transport protein
2543 CAMPNM010000181.1 GCA946891835_01269 CDS open 959-1549 _na     196_aa chrA Chromate transporter
2544 CAMPNM010000181.1 GCA946891835_01270 CDS open 1710-2789 _na     359_aa porN Gliding motility protein GldN
2545 CAMPNM010000181.1 GCA946891835_01271 CDS open 2798-3964 _na     388_aa hypothetical protein
2546 CAMPNM010000181.1 GCA946891835_01268 gene open 347-940 chrA
2547 CAMPNM010000181.1 GCA946891835_01269 gene open 959-1549 chrA
2548 CAMPNM010000181.1 GCA946891835_01270 gene open 1710-2789 porN
2549 CAMPNM010000181.1 GCA946891835_01271 gene open 2798-3964
2550 CAMPNM010000182.1 GCA946891835_01272 CDS open 272-3067 _na     931_aa lptD LPS-assembly protein LptD central domain-containing protein
2551 CAMPNM010000182.1 GCA946891835_01273 CDS open 3094-3810 _na     238_aa glpG Rhomboid family protein
2552 CAMPNM010000182.1 GCA946891835_01272 gene open 272-3067 lptD
2553 CAMPNM010000182.1 GCA946891835_01273 gene open 3094-3810 glpG
2554 CAMPNM010000183.1 GCA946891835_01274 CDS open 1158-2021 _na     287_aa DUF4292 domain-containing protein
2555 CAMPNM010000183.1 GCA946891835_01275 CDS open 2018-3757 _na     579_aa tadD TPR domain protein
2556 CAMPNM010000183.1 GCA946891835_01274 gene open 1158-2021
2557 CAMPNM010000183.1 GCA946891835_01275 gene open 2018-3757 tadD
2558 CAMPNM010000184.1 GCA946891835_01276 CDS open 131-592 _na     153_aa PepSY-like domain-containing protein
2559 CAMPNM010000184.1 GCA946891835_01277 CDS open 987-1907 _na     306_aa corA Transporter
2560 CAMPNM010000184.1 GCA946891835_01278 CDS open 1912-2658 _na     248_aa cutC PF03932 family protein CutC
2561 CAMPNM010000184.1 GCA946891835_01279 CDS open 2834-3430 _na     198_aa pabA Anthranilate synthase component II
2562 CAMPNM010000184.1 GCA946891835_01280 CDS open 3452-3799 _na     115_aa PAS fold-4 domain-containing protein
2563 CAMPNM010000184.1 GCA946891835_01276 gene open 131-592
2564 CAMPNM010000184.1 GCA946891835_01277 gene open 987-1907 corA
2565 CAMPNM010000184.1 GCA946891835_01278 gene open 1912-2658 cutC
2566 CAMPNM010000184.1 GCA946891835_01279 gene open 2834-3430 pabA
2567 CAMPNM010000184.1 GCA946891835_01280 gene open 3452-3799
2568 CAMPNM010000185.1 GCA946891835_01281 CDS open 950-1513 _na     187_aa pduO Corrinoid adenosyltransferase
2569 CAMPNM010000185.1 GCA946891835_01282 CDS open 1536-2186 _na     216_aa SAM-dependent methyltransferase
2570 CAMPNM010000185.1 GCA946891835_01283 CDS open 2211-3398 _na     395_aa uraA Uracil permease
2571 CAMPNM010000185.1 GCA946891835_01284 CDS open 3605-3709 _na     34_aa hypothetical protein
2572 CAMPNM010000185.1 GCA946891835_01281 gene open 950-1513 pduO
2573 CAMPNM010000185.1 GCA946891835_01282 gene open 1536-2186
2574 CAMPNM010000185.1 GCA946891835_01283 gene open 2211-3398 uraA
2575 CAMPNM010000185.1 GCA946891835_01284 gene open 3605-3709
2576 CAMPNM010000186.1 GCA946891835_01286 CDS open 482-1399 _na     305_aa mrr Mrr restriction system protein
2577 CAMPNM010000186.1 GCA946891835_01287 CDS open 2504-3169 _na     221_aa psd phosphatidylserine decarboxylase family protein
2578 CAMPNM010000186.1 GCA946891835_01288 CDS open 3171-3881 _na     236_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
2579 CAMPNM010000186.1 GCA946891835_01286 gene open 482-1399 mrr
2580 CAMPNM010000186.1 GCA946891835_01287 gene open 2504-3169 psd
2581 CAMPNM010000186.1 GCA946891835_01288 gene open 3171-3881 pssA
2582 CAMPNM010000186.1 GCA946891835_01285 gene open 262-343 trnL
2583 CAMPNM010000186.1 GCA946891835_01285 tRNA open 262-343 trnL tRNA-Leu(tag)
2584 CAMPNM010000187.1 repeat_region open 3372-3832 CRISPR array with 7 repeats of length 36%2C consensus sequence GTTGGGAATACCCTTAGTTAGAAGGGTGGAGACAAC and spacer length 29
2585 CAMPNM010000187.1 GCA946891835_01289 CDS open 1-3363 _na     1120_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
2586 CAMPNM010000187.1 GCA946891835_01289 gene open 1-3363 cas13b
2587 CAMPNM010000188.1 GCA946891835_01290 CDS open 368-3124 _na     918_aa mgtA calcium-translocating P-type ATPase%2C PMCA-type
2588 CAMPNM010000188.1 GCA946891835_01290 gene open 368-3124 mgtA
2589 CAMPNM010000189.1 GCA946891835_01291 CDS open 290-595 _na     101_aa DNA-binding protein
2590 CAMPNM010000189.1 GCA946891835_01292 CDS open 833-2122 _na     429_aa fucP Putative transmembrane glucose/galactose transporter
2591 CAMPNM010000189.1 GCA946891835_01293 CDS open 2161-3120 _na     319_aa ldhA D-isomer specific 2-hydroxyacid dehydrogenase family protein
2592 CAMPNM010000189.1 GCA946891835_01294 CDS open 3339-3764 _na     141_aa hypothetical protein
2593 CAMPNM010000189.1 GCA946891835_01291 gene open 290-595
2594 CAMPNM010000189.1 GCA946891835_01292 gene open 833-2122 fucP
2595 CAMPNM010000189.1 GCA946891835_01293 gene open 2161-3120 ldhA
2596 CAMPNM010000189.1 GCA946891835_01294 gene open 3339-3764
2597 CAMPNM010000190.1 GCA946891835_01295 CDS open 1446-3047 _na     533_aa ctpA Carboxyl-terminal processing protease
2598 CAMPNM010000190.1 GCA946891835_01296 CDS open 3065-3178 _na     37_aa hypothetical protein
2599 CAMPNM010000190.1 GCA946891835_01295 gene open 1446-3047 ctpA
2600 CAMPNM010000190.1 GCA946891835_01296 gene open 3065-3178
2601 CAMPNM010000191.1 GCA946891835_01297 CDS open 1077-3392 _na     771_aa GH92 family glycosyl hydrolase
2602 CAMPNM010000191.1 GCA946891835_01297 gene open 1077-3392
2603 CAMPNM010000192.1 GCA946891835_01298 CDS open 506-1120 _na     204_aa wcaJ Bacterial sugar transferase domain-containing protein
2604 CAMPNM010000192.1 GCA946891835_01299 CDS open 1295-2923 _na     542_aa asnB asparagine synthase (glutamine-hydrolyzing)
2605 CAMPNM010000192.1 GCA946891835_01300 CDS open 2886-3662 _na     258_aa rfbX PorS protein
2606 CAMPNM010000192.1 GCA946891835_01298 gene open 506-1120 wcaJ
2607 CAMPNM010000192.1 GCA946891835_01299 gene open 1295-2923 asnB
2608 CAMPNM010000192.1 GCA946891835_01300 gene open 2886-3662 rfbX
2609 CAMPNM010000193.1 GCA946891835_01301 CDS open 55-3528 _na     1157_aa sprA cell surface protein SprA
2610 CAMPNM010000193.1 GCA946891835_01301 gene open 55-3528 sprA
2611 CAMPNM010000194.1 GCA946891835_01302 CDS open 43-495 _na     150_aa hypothetical protein
2612 CAMPNM010000194.1 GCA946891835_01303 CDS open 524-3154 _na     876_aa valS valine--tRNA ligase
2613 CAMPNM010000194.1 GCA946891835_01302 gene open 43-495
2614 CAMPNM010000194.1 GCA946891835_01303 gene open 524-3154 valS
2615 CAMPNM010000195.1 GCA946891835_01304 CDS open 77-616 _na     179_aa gloB Metallo-beta-lactamase family protein
2616 CAMPNM010000195.1 GCA946891835_01305 CDS open 621-3488 _na     955_aa gcvP aminomethyl-transferring glycine dehydrogenase
2617 CAMPNM010000195.1 GCA946891835_01304 gene open 77-616 gloB
2618 CAMPNM010000195.1 GCA946891835_01305 gene open 621-3488 gcvP
2619 CAMPNM010000196.1 GCA946891835_01307 CDS open 491-3013 _na     840_aa prtT Thiol protease/hemagglutinin PrtT
2620 CAMPNM010000196.1 GCA946891835_01307 gene open 491-3013 prtT
2621 CAMPNM010000196.1 GCA946891835_01306 gene open 269-342 trnR
2622 CAMPNM010000196.1 GCA946891835_01306 tRNA open 269-342 trnR tRNA-Arg(tct)
2623 CAMPNM010000197.1 GCA946891835_01308 CDS open 158-514 _na     118_aa panD aspartate 1-decarboxylase
2624 CAMPNM010000197.1 GCA946891835_01309 CDS open 591-1928 _na     445_aa ffh signal recognition particle protein
2625 CAMPNM010000197.1 GCA946891835_01310 CDS open 2049-2939 _na     296_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
2626 CAMPNM010000197.1 GCA946891835_01308 gene open 158-514 panD
2627 CAMPNM010000197.1 GCA946891835_01309 gene open 591-1928 ffh
2628 CAMPNM010000197.1 GCA946891835_01310 gene open 2049-2939 folD
2629 CAMPNM010000198.1 GCA946891835_01311 CDS open 155-1510 _na     451_aa adhE Succinate-semialdehyde dehydrogenase
2630 CAMPNM010000198.1 GCA946891835_01312 CDS open 1706-2821 _na     371_aa eutG NAD-dependent 4-hydroxybutyrate dehydrogenase
2631 CAMPNM010000198.1 GCA946891835_01313 CDS open 2872-3450 _na     192_aa Acetyl-CoA hydrolase/transferase C-terminal domain-containing protein
2632 CAMPNM010000198.1 GCA946891835_01311 gene open 155-1510 adhE
2633 CAMPNM010000198.1 GCA946891835_01312 gene open 1706-2821 eutG
2634 CAMPNM010000198.1 GCA946891835_01313 gene open 2872-3450
2635 CAMPNM010000199.1 GCA946891835_01314 CDS open 93-1544 _na     483_aa pcnB PolyA polymerase family protein
2636 CAMPNM010000199.1 GCA946891835_01315 CDS open 1529-3088 _na     519_aa NAD(P)/FAD-dependent oxidoreductase
2637 CAMPNM010000199.1 GCA946891835_01314 gene open 93-1544 pcnB
2638 CAMPNM010000199.1 GCA946891835_01315 gene open 1529-3088
2639 CAMPNM010000199.1 GCA946891835_01316 gene open 3154-3226 trnG
2640 CAMPNM010000199.1 GCA946891835_01316 tRNA open 3154-3226 trnG tRNA-Gly(ccc)
2641 CAMPNM010000200.1 GCA946891835_01317 CDS open 878-2704 _na     608_aa fAA1 Long-chain-fatty-acid-CoA ligase
2642 CAMPNM010000200.1 GCA946891835_01317 gene open 878-2704 fAA1
2643 CAMPNM010000201.1 GCA946891835_01318 CDS open 328-1677 _na     449_aa atoC Sigma-54 dependent DNA-binding response regulator
2644 CAMPNM010000201.1 GCA946891835_01319 CDS open 1688-3025 _na     445_aa ntrY histidine kinase
2645 CAMPNM010000201.1 GCA946891835_01318 gene open 328-1677 atoC
2646 CAMPNM010000201.1 GCA946891835_01319 gene open 1688-3025 ntrY
2647 CAMPNM010000202.1 GCA946891835_01320 CDS open 393-545 _na     50_aa rpmH 50S ribosomal protein L34
2648 CAMPNM010000202.1 GCA946891835_01321 CDS open 607-1206 _na     199_aa maf dTTP/UTP pyrophosphatase
2649 CAMPNM010000202.1 GCA946891835_01322 CDS open 1246-1767 _na     173_aa kdsC putative hydrolase
2650 CAMPNM010000202.1 GCA946891835_01323 CDS open 1784-2596 _na     270_aa DUF2520 domain-containing protein
2651 CAMPNM010000202.1 GCA946891835_01324 CDS open 2589-3143 _na     184_aa nfnB Nitroreductase family protein
2652 CAMPNM010000202.1 GCA946891835_01320 gene open 393-545 rpmH
2653 CAMPNM010000202.1 GCA946891835_01321 gene open 607-1206 maf
2654 CAMPNM010000202.1 GCA946891835_01322 gene open 1246-1767 kdsC
2655 CAMPNM010000202.1 GCA946891835_01323 gene open 1784-2596
2656 CAMPNM010000202.1 GCA946891835_01324 gene open 2589-3143 nfnB
2657 CAMPNM010000203.1 GCA946891835_01325 CDS open 709-1173 _na     154_aa hypothetical protein
2658 CAMPNM010000203.1 GCA946891835_01326 CDS open 1107-2246 _na     379_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
2659 CAMPNM010000203.1 GCA946891835_01327 CDS open 2243-3283 _na     346_aa ftsW putative peptidoglycan glycosyltransferase FtsW
2660 CAMPNM010000203.1 GCA946891835_01325 gene open 709-1173
2661 CAMPNM010000203.1 GCA946891835_01326 gene open 1107-2246 murG
2662 CAMPNM010000203.1 GCA946891835_01327 gene open 2243-3283 ftsW
2663 CAMPNM010000204.1 GCA946891835_01328 CDS open 289-2892 _na     867_aa btuB TonB-dependent receptor plug domain-containing protein
2664 CAMPNM010000204.1 GCA946891835_01328 gene open 289-2892 btuB
2665 CAMPNM010000205.1 GCA946891835_01329 CDS open 300-3122 _na     940_aa cTD-A Peptidase S1 domain-containing protein
2666 CAMPNM010000205.1 GCA946891835_01329 gene open 300-3122 cTD-A
2667 CAMPNM010000206.1 GCA946891835_01330 CDS open 139-1212 _na     357_aa dihydroorotase
2668 CAMPNM010000206.1 GCA946891835_01331 CDS open 1379-2128 _na     249_aa hypothetical protein
2669 CAMPNM010000206.1 GCA946891835_01332 CDS open 2094-2489 _na     131_aa gtrA GtrA family protein
2670 CAMPNM010000206.1 GCA946891835_01330 gene open 139-1212
2671 CAMPNM010000206.1 GCA946891835_01331 gene open 1379-2128
2672 CAMPNM010000206.1 GCA946891835_01332 gene open 2094-2489 gtrA
2673 CAMPNM010000206.1 GCA946891835_01333 gene open 2545-2618 trnA
2674 CAMPNM010000206.1 GCA946891835_01333 tRNA open 2545-2618 trnA tRNA-Ala(ggc)
2675 CAMPNM010000207.1 GCA946891835_01334 CDS open 269-682 _na     137_aa hypothetical protein
2676 CAMPNM010000207.1 GCA946891835_01335 CDS open 708-2828 _na     706_aa TonB-linked receptor Tlr
2677 CAMPNM010000207.1 GCA946891835_01334 gene open 269-682
2678 CAMPNM010000207.1 GCA946891835_01335 gene open 708-2828
2679 CAMPNM010000208.1 GCA946891835_01336 CDS open 1097-1465 _na     122_aa transposase
2680 CAMPNM010000208.1 GCA946891835_01337 CDS open 1552-1866 _na     104_aa trxA thioredoxin
2681 CAMPNM010000208.1 GCA946891835_01338 CDS open 1915-3345 _na     476_aa OB-fold nucleic acid binding domain-containing protein
2682 CAMPNM010000208.1 GCA946891835_01336 gene open 1097-1465
2683 CAMPNM010000208.1 GCA946891835_01337 gene open 1552-1866 trxA
2684 CAMPNM010000208.1 GCA946891835_01338 gene open 1915-3345
2685 CAMPNM010000209.1 GCA946891835_01339 CDS open 309-731 _na     140_aa hypothetical protein
2686 CAMPNM010000209.1 GCA946891835_01340 CDS open 752-1609 _na     285_aa Putative auto-transporter adhesin head GIN domain-containing protein
2687 CAMPNM010000209.1 GCA946891835_01341 CDS open 1884-2477 _na     197_aa Putative auto-transporter adhesin head GIN domain-containing protein
2688 CAMPNM010000209.1 GCA946891835_01339 gene open 309-731
2689 CAMPNM010000209.1 GCA946891835_01340 gene open 752-1609
2690 CAMPNM010000209.1 GCA946891835_01341 gene open 1884-2477
2691 CAMPNM010000210.1 GCA946891835_01342 CDS open 157-381 _na     74_aa hypothetical protein
2692 CAMPNM010000210.1 GCA946891835_01343 CDS open 489-2180 _na     563_aa phoA Alkaline phosphatase%2C putative
2693 CAMPNM010000210.1 GCA946891835_01344 CDS open 2216-3295 _na     359_aa pepP Peptidase M24
2694 CAMPNM010000210.1 GCA946891835_01342 gene open 157-381
2695 CAMPNM010000210.1 GCA946891835_01343 gene open 489-2180 phoA
2696 CAMPNM010000210.1 GCA946891835_01344 gene open 2216-3295 pepP
2697 CAMPNM010000211.1 GCA946891835_01345 CDS open 12-512 _na     166_aa DUF4199 domain-containing protein
2698 CAMPNM010000211.1 GCA946891835_01346 CDS open 509-1462 _na     317_aa wcaA Glycosyl transferase%2C group 2 family protein
2699 CAMPNM010000211.1 GCA946891835_01347 CDS open 1462-2001 _na     179_aa nfnB Nitroreductase family protein
2700 CAMPNM010000211.1 GCA946891835_01348 CDS open 1998-3011 _na     337_aa apbE FAD:protein FMN transferase
2701 CAMPNM010000211.1 GCA946891835_01345 gene open 12-512
2702 CAMPNM010000211.1 GCA946891835_01346 gene open 509-1462 wcaA
2703 CAMPNM010000211.1 GCA946891835_01347 gene open 1462-2001 nfnB
2704 CAMPNM010000211.1 GCA946891835_01348 gene open 1998-3011 apbE
2705 CAMPNM010000212.1 GCA946891835_01349 CDS open 557-2704 _na     715_aa Peptidylprolyl isomerase
2706 CAMPNM010000212.1 GCA946891835_01350 CDS open 2811-3209 _na     132_aa transporter associated domain-containing protein
2707 CAMPNM010000212.1 GCA946891835_01349 gene open 557-2704
2708 CAMPNM010000212.1 GCA946891835_01350 gene open 2811-3209
2709 CAMPNM010000213.1 GCA946891835_01351 CDS open 425-2959 _na     844_aa feoB ferrous iron transport protein B
2710 CAMPNM010000213.1 GCA946891835_01351 gene open 425-2959 feoB
2711 CAMPNM010000214.1 repeat_region open 30-405 CRISPR array with 6 repeats of length 36%2C consensus sequence GTTGGATCTACCCTCTATTTGAAGGGTACACACAAC and spacer length 30
2712 CAMPNM010000214.1 GCA946891835_01352 CDS open 1219-2400 _na     393_aa megL methionine gamma-lyase
2713 CAMPNM010000214.1 GCA946891835_01353 CDS open 2581-3174 _na     197_aa metallophosphoesterase
2714 CAMPNM010000214.1 GCA946891835_01352 gene open 1219-2400 megL
2715 CAMPNM010000214.1 GCA946891835_01353 gene open 2581-3174
2716 CAMPNM010000215.1 GCA946891835_01354 CDS open 6-2489 _na     827_aa fepA TonB-dependent receptor plug domain-containing protein
2717 CAMPNM010000215.1 GCA946891835_01354 gene open 6-2489 fepA
2718 CAMPNM010000215.1 GCA946891835_01355 gene open 2907-2979 trnG
2719 CAMPNM010000215.1 GCA946891835_01356 gene open 3028-3112 trnL
2720 CAMPNM010000215.1 GCA946891835_01355 tRNA open 2907-2979 trnG tRNA-Gly(gcc)
2721 CAMPNM010000215.1 GCA946891835_01356 tRNA open 3028-3112 trnL tRNA-Leu(taa)
2722 CAMPNM010000216.1 GCA946891835_01357 CDS open 58-393 _na     111_aa hypothetical protein
2723 CAMPNM010000216.1 GCA946891835_01358 CDS open 401-1258 _na     285_aa Lipoprotein
2724 CAMPNM010000216.1 GCA946891835_01359 CDS open 1304-2182 _na     292_aa mlaD Mce/MlaD domain-containing protein
2725 CAMPNM010000216.1 GCA946891835_01360 CDS open 2223-3140 _na     305_aa hypothetical protein
2726 CAMPNM010000216.1 GCA946891835_01357 gene open 58-393
2727 CAMPNM010000216.1 GCA946891835_01358 gene open 401-1258
2728 CAMPNM010000216.1 GCA946891835_01359 gene open 1304-2182 mlaD
2729 CAMPNM010000216.1 GCA946891835_01360 gene open 2223-3140
2730 CAMPNM010000217.1 GCA946891835_01361 CDS open 156-494 _na     112_aa hypothetical protein
2731 CAMPNM010000217.1 GCA946891835_01362 CDS open 828-1910 _na     360_aa serC phosphoserine transaminase
2732 CAMPNM010000217.1 GCA946891835_01363 CDS open 2014-2934 _na     306_aa serA D-3-phosphoglycerate dehydrogenase
2733 CAMPNM010000217.1 GCA946891835_01361 gene open 156-494
2734 CAMPNM010000217.1 GCA946891835_01362 gene open 828-1910 serC
2735 CAMPNM010000217.1 GCA946891835_01363 gene open 2014-2934 serA
2736 CAMPNM010000218.1 GCA946891835_01364 CDS open 927-2849 _na     640_aa dnaK molecular chaperone DnaK
2737 CAMPNM010000218.1 GCA946891835_01364 gene open 927-2849 dnaK
2738 CAMPNM010000219.1 GCA946891835_01365 CDS open 48-269 _na     73_aa hypothetical protein
2739 CAMPNM010000219.1 GCA946891835_01366 CDS open 270-1160 _na     296_aa hypothetical protein
2740 CAMPNM010000219.1 GCA946891835_01367 CDS open 1191-1751 _na     186_aa hypothetical protein
2741 CAMPNM010000219.1 GCA946891835_01368 CDS open 2091-3077 _na     328_aa DUF4876 domain-containing protein
2742 CAMPNM010000219.1 GCA946891835_01365 gene open 48-269
2743 CAMPNM010000219.1 GCA946891835_01366 gene open 270-1160
2744 CAMPNM010000219.1 GCA946891835_01367 gene open 1191-1751
2745 CAMPNM010000219.1 GCA946891835_01368 gene open 2091-3077
2746 CAMPNM010000220.1 GCA946891835_01369 CDS open 1175-1918 _na     247_aa batC putative aerotolerance-related exported protein BatC
2747 CAMPNM010000220.1 GCA946891835_01370 CDS open 1915-2934 _na     339_aa batB Putative aerotolerance-related exported protein BatB
2748 CAMPNM010000220.1 GCA946891835_01369 gene open 1175-1918 batC
2749 CAMPNM010000220.1 GCA946891835_01370 gene open 1915-2934 batB
2750 CAMPNM010000221.1 GCA946891835_01371 CDS open 107-544 _na     145_aa hypothetical protein
2751 CAMPNM010000221.1 GCA946891835_01372 CDS open 704-832 _na     42_aa hypothetical protein
2752 CAMPNM010000221.1 GCA946891835_01373 CDS open 1194-2513 _na     439_aa rsuA Pseudouridine synthase
2753 CAMPNM010000221.1 GCA946891835_01374 CDS open 2614-3069 _na     151_aa Adenylosuccinate lyase
2754 CAMPNM010000221.1 GCA946891835_01371 gene open 107-544
2755 CAMPNM010000221.1 GCA946891835_01372 gene open 704-832
2756 CAMPNM010000221.1 GCA946891835_01373 gene open 1194-2513 rsuA
2757 CAMPNM010000221.1 GCA946891835_01374 gene open 2614-3069
2758 CAMPNM010000222.1 GCA946891835_01375 CDS open 542-1039 _na     165_aa hypothetical protein
2759 CAMPNM010000222.1 GCA946891835_01376 CDS open 1211-2221 _na     336_aa pta phosphate acetyltransferase
2760 CAMPNM010000222.1 GCA946891835_01377 CDS open 2432-2989 _na     185_aa hypothetical protein
2761 CAMPNM010000222.1 GCA946891835_01375 gene open 542-1039
2762 CAMPNM010000222.1 GCA946891835_01376 gene open 1211-2221 pta
2763 CAMPNM010000222.1 GCA946891835_01377 gene open 2432-2989
2764 CAMPNM010000223.1 GCA946891835_01378 CDS open 352-1419 _na     355_aa wcaE Glycosyl transferase%2C group 2 family protein
2765 CAMPNM010000223.1 GCA946891835_01379 CDS open 1439-2731 _na     430_aa tyrS tyrosine--tRNA ligase
2766 CAMPNM010000223.1 GCA946891835_01378 gene open 352-1419 wcaE
2767 CAMPNM010000223.1 GCA946891835_01379 gene open 1439-2731 tyrS
2768 CAMPNM010000224.1 GCA946891835_01380 CDS open 195-1715 _na     506_aa cobH Precorrin-3B C(17)-methyltransferase
2769 CAMPNM010000224.1 GCA946891835_01381 CDS open 1681-2949 _na     422_aa cobL Precorrin-6Y C5%2C15-methyltransferase%2C decarboxylating
2770 CAMPNM010000224.1 GCA946891835_01380 gene open 195-1715 cobH
2771 CAMPNM010000224.1 GCA946891835_01381 gene open 1681-2949 cobL
2772 CAMPNM010000225.1 GCA946891835_01382 CDS open 86-451 _na     121_aa rplS 50S ribosomal protein L19
2773 CAMPNM010000225.1 GCA946891835_01383 CDS open 700-1140 _na     146_aa hypothetical protein
2774 CAMPNM010000225.1 GCA946891835_01384 CDS open 1234-1560 _na     108_aa hypothetical protein
2775 CAMPNM010000225.1 GCA946891835_01385 CDS open 1753-2214 _na     153_aa hypothetical protein
2776 CAMPNM010000225.1 GCA946891835_01386 CDS open 2223-2759 _na     178_aa hypothetical protein
2777 CAMPNM010000225.1 GCA946891835_01382 gene open 86-451 rplS
2778 CAMPNM010000225.1 GCA946891835_01383 gene open 700-1140
2779 CAMPNM010000225.1 GCA946891835_01384 gene open 1234-1560
2780 CAMPNM010000225.1 GCA946891835_01385 gene open 1753-2214
2781 CAMPNM010000225.1 GCA946891835_01386 gene open 2223-2759
2782 CAMPNM010000226.1 GCA946891835_01387 CDS open 217-939 _na     240_aa porT Outer membrane protein beta-barrel domain-containing protein
2783 CAMPNM010000226.1 GCA946891835_01388 CDS open 948-2453 _na     501_aa sleL LysM domain-containing protein
2784 CAMPNM010000226.1 GCA946891835_01387 gene open 217-939 porT
2785 CAMPNM010000226.1 GCA946891835_01388 gene open 948-2453 sleL
2786 CAMPNM010000227.1 GCA946891835_01389 CDS open 252-902 _na     216_aa upp uracil phosphoribosyltransferase
2787 CAMPNM010000227.1 GCA946891835_01390 CDS open 886-2793 _na     635_aa rlhA Protease
2788 CAMPNM010000227.1 GCA946891835_01389 gene open 252-902 upp
2789 CAMPNM010000227.1 GCA946891835_01390 gene open 886-2793 rlhA
2790 CAMPNM010000228.1 GCA946891835_01391 CDS open 36-2762 _na     908_aa ppdK pyruvate%2C phosphate dikinase
2791 CAMPNM010000228.1 GCA946891835_01391 gene open 36-2762 ppdK
2792 CAMPNM010000229.1 GCA946891835_01392 CDS open 78-665 _na     195_aa ISAs1 family transposase
2793 CAMPNM010000229.1 GCA946891835_01393 CDS open 978-2687 _na     569_aa ctpA Carboxyl-terminal processing protease
2794 CAMPNM010000229.1 GCA946891835_01392 gene open 78-665
2795 CAMPNM010000229.1 GCA946891835_01393 gene open 978-2687 ctpA
2796 CAMPNM010000230.1 GCA946891835_01394 CDS open 68-1564 _na     498_aa aCH1 Acetyl-CoA hydrolase/transferase family protein
2797 CAMPNM010000230.1 GCA946891835_01395 CDS open 2096-2737 _na     213_aa hypothetical protein
2798 CAMPNM010000230.1 GCA946891835_01394 gene open 68-1564 aCH1
2799 CAMPNM010000230.1 GCA946891835_01395 gene open 2096-2737
2800 CAMPNM010000231.1 GCA946891835_01396 CDS open 103-273 _na     56_aa hypothetical protein
2801 CAMPNM010000231.1 GCA946891835_01397 CDS open 451-717 _na     88_aa hypothetical protein
2802 CAMPNM010000231.1 GCA946891835_01398 CDS open 1797-2738 _na     313_aa hypothetical protein
2803 CAMPNM010000231.1 GCA946891835_01396 gene open 103-273
2804 CAMPNM010000231.1 GCA946891835_01397 gene open 451-717
2805 CAMPNM010000231.1 GCA946891835_01398 gene open 1797-2738
2806 CAMPNM010000232.1 GCA946891835_01399 CDS open 62-679 _na     205_aa GMP synthase (glutamine-hydrolyzing)
2807 CAMPNM010000232.1 GCA946891835_01400 CDS open 750-1571 _na     273_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
2808 CAMPNM010000232.1 GCA946891835_01401 CDS open 1623-2255 _na     210_aa yadS YadS protein
2809 CAMPNM010000232.1 GCA946891835_01399 gene open 62-679
2810 CAMPNM010000232.1 GCA946891835_01400 gene open 750-1571 panB
2811 CAMPNM010000232.1 GCA946891835_01401 gene open 1623-2255 yadS
2812 CAMPNM010000233.1 GCA946891835_01402 CDS open 12-1103 _na     363_aa DUF3078 domain-containing protein
2813 CAMPNM010000233.1 GCA946891835_01403 CDS open 1120-2535 _na     471_aa recD UvrD-like helicase C-terminal domain-containing protein
2814 CAMPNM010000233.1 GCA946891835_01402 gene open 12-1103
2815 CAMPNM010000233.1 GCA946891835_01403 gene open 1120-2535 recD
2816 CAMPNM010000234.1 GCA946891835_01404 CDS open 175-2307 _na     710_aa topA DNA topoisomerase
2817 CAMPNM010000234.1 GCA946891835_01405 CDS open 2372-2494 _na     40_aa hypothetical protein
2818 CAMPNM010000234.1 GCA946891835_01404 gene open 175-2307 topA
2819 CAMPNM010000234.1 GCA946891835_01405 gene open 2372-2494
2820 CAMPNM010000235.1 GCA946891835_01406 CDS open 1192-1401 _na     69_aa hypothetical protein
2821 CAMPNM010000235.1 GCA946891835_01407 CDS open 1659-2219 _na     186_aa fldA Flavodoxin-like domain-containing protein
2822 CAMPNM010000235.1 GCA946891835_01406 gene open 1192-1401
2823 CAMPNM010000235.1 GCA946891835_01407 gene open 1659-2219 fldA
2824 CAMPNM010000236.1 GCA946891835_01408 CDS open 73-1371 _na     432_aa dinP UmuC protein
2825 CAMPNM010000236.1 GCA946891835_01409 CDS open 1379-1804 _na     141_aa lexA Translesion error-prone DNA polymerase V autoproteolytic subunit
2826 CAMPNM010000236.1 GCA946891835_01410 CDS open 1868-2053 _na     61_aa hypothetical protein
2827 CAMPNM010000236.1 GCA946891835_01411 CDS open 2177-2398 _na     73_aa hypothetical protein
2828 CAMPNM010000236.1 GCA946891835_01408 gene open 73-1371 dinP
2829 CAMPNM010000236.1 GCA946891835_01409 gene open 1379-1804 lexA
2830 CAMPNM010000236.1 GCA946891835_01410 gene open 1868-2053
2831 CAMPNM010000236.1 GCA946891835_01411 gene open 2177-2398