HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Sneathia vaginalis (GCA_946891995.1)

Select a Genome:
BAKTA Annotations for GCA_946891995.1
Genome Selected: Sneathia vaginalis
ContigsBases CDSrRNA tmRNAtRNA
18 1273293 1228 1 1 24
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2530 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 2530 [6 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAMPNV010000006.1 GCA946891995_00772 CDS open 49256-49627 _na     123_aa hypothetical protein
1502 CAMPNV010000006.1 GCA946891995_00773 CDS open 49691-50932 _na     413_aa repB RepB family plasmid replication initiator protein
1503 CAMPNV010000006.1 GCA946891995_00774 CDS open 51116-51544 _na     142_aa PTS mannose transporter subunit IIA
1504 CAMPNV010000006.1 GCA946891995_00775 CDS open 51529-52020 _na     163_aa agaB PTS sugar transporter
1505 CAMPNV010000006.1 GCA946891995_00776 CDS open 51999-52763 _na     254_aa manY PTS sugar transporter
1506 CAMPNV010000006.1 GCA946891995_00777 CDS open 52750-53571 _na     273_aa manZ PTS mannose transporter subunit IID
1507 CAMPNV010000006.1 GCA946891995_00778 CDS open 53573-54550 _na     325_aa glmS SIS domain-containing protein
1508 CAMPNV010000006.1 GCA946891995_00779 CDS open 54562-55557 _na     331_aa agaS Glucosamine-fructose-6-phosphate aminotransferase
1509 CAMPNV010000006.1 GCA946891995_00780 CDS open 55621-55959 _na     112_aa hypothetical protein
1510 CAMPNV010000006.1 GCA946891995_00781 CDS open 55986-56585 _na     199_aa yadA YadA C-terminal domain-containing protein
1511 CAMPNV010000006.1 GCA946891995_00782 CDS open 56867-58849 _na     660_aa fusA Elongation factor G
1512 CAMPNV010000006.1 GCA946891995_00783 CDS open 58849-59382 _na     177_aa serA Hydroxyacid dehydrogenase
1513 CAMPNV010000006.1 GCA946891995_00784 CDS open 59401-59730 _na     109_aa hypothetical protein
1514 CAMPNV010000006.1 GCA946891995_00785 CDS open 59754-60413 _na     219_aa NADH dehydrogenase subunit 6
1515 CAMPNV010000006.1 GCA946891995_00786 CDS open 60388-61584 _na     398_aa ackA Acetate kinase
1516 CAMPNV010000006.1 GCA946891995_00787 CDS open 61598-62602 _na     334_aa pta phosphate acetyltransferase
1517 CAMPNV010000006.1 GCA946891995_00788 CDS open 62615-63493 _na     292_aa ftsY signal recognition particle-docking protein FtsY
1518 CAMPNV010000006.1 GCA946891995_00789 CDS open 63497-64168 _na     223_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1519 CAMPNV010000006.1 GCA946891995_00790 CDS open 64137-64622 _na     161_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1520 CAMPNV010000006.1 GCA946891995_00791 CDS open 64640-65269 _na     209_aa upp uracil phosphoribosyltransferase
1521 CAMPNV010000006.1 GCA946891995_00792 CDS open 65325-65564 _na     79_aa rpmE type B 50S ribosomal protein L31
1522 CAMPNV010000006.1 GCA946891995_00793 CDS open 65695-66468 _na     257_aa dAP2 Serine hydrolase domain-containing protein
1523 CAMPNV010000006.1 GCA946891995_00794 CDS open 66522-67640 _na     372_aa Tetratricopeptide repeat protein
1524 CAMPNV010000006.1 GCA946891995_00795 CDS open 67739-68530 _na     263_aa queH Epoxyqueuosine reductase QueH
1525 CAMPNV010000006.1 GCA946891995_00796 CDS open 68496-69632 _na     378_aa yhiN BaiN-like insert domain-containing protein
1526 CAMPNV010000006.1 GCA946891995_00797 CDS open 69626-71230 _na     534_aa FAD-dependent protein C-terminal domain-containing protein
1527 CAMPNV010000006.1 GCA946891995_00798 CDS open 71205-72755 _na     516_aa manB Phosphoglucomutase
1528 CAMPNV010000006.1 GCA946891995_00799 CDS open 72833-73087 _na     84_aa hypothetical protein
1529 CAMPNV010000006.1 GCA946891995_00800 CDS open 73026-73241 _na     71_aa hypothetical protein
1530 CAMPNV010000006.1 GCA946891995_00801 CDS open 73273-74751 _na     492_aa gltX glutamate--tRNA ligase
1531 CAMPNV010000006.1 GCA946891995_00802 CDS open 75192-76559 _na     455_aa asnS asparagine--tRNA ligase
1532 CAMPNV010000006.1 GCA946891995_00803 CDS open 76568-77293 _na     241_aa tetratricopeptide repeat protein
1533 CAMPNV010000006.1 GCA946891995_00804 CDS open 77302-78153 _na     283_aa dprA DNA-processing protein DprA
1534 CAMPNV010000006.1 GCA946891995_00805 CDS open 78092-80338 _na     748_aa topA type I DNA topoisomerase
1535 CAMPNV010000006.1 GCA946891995_00806 CDS open 80338-81249 _na     303_aa xerA site-specific tyrosine recombinase/integron integrase
1536 CAMPNV010000006.1 GCA946891995_00807 CDS open 81239-82360 _na     373_aa rbgA Ribosome biogenesis GTPase RbgA
1537 CAMPNV010000006.1 GCA946891995_00808 CDS open 82442-83209 _na     255_aa phnP Metallo-beta-lactamase domain-containing protein
1538 CAMPNV010000006.1 GCA946891995_00809 CDS open 83215-83736 _na     173_aa udg4 Uracil-DNA glycosylase-like domain-containing protein
1539 CAMPNV010000006.1 GCA946891995_00810 CDS open 83730-84833 _na     367_aa ychF redox-regulated ATPase YchF
1540 CAMPNV010000006.1 GCA946891995_00811 CDS open 84844-85668 _na     274_aa mscS Mechanosensitive ion channel protein MscS
1541 CAMPNV010000006.1 GCA946891995_00812 CDS open 85682-86302 _na     206_aa gloB Metallo-beta-lactamase domain-containing protein
1542 CAMPNV010000006.1 GCA946891995_00813 CDS open 86315-86950 _na     211_aa sIMPL SIMPL domain-containing protein
1543 CAMPNV010000006.1 GCA946891995_00814 CDS open 86969-87541 _na     190_aa efp elongation factor P
1544 CAMPNV010000006.1 GCA946891995_00815 CDS open 87583-88377 _na     264_aa Endonuclease
1545 CAMPNV010000006.1 GCA946891995_00816 CDS open 88364-89698 _na     444_aa norM Multidrug-efflux transporter
1546 CAMPNV010000006.1 GCA946891995_00817 CDS open 89689-90276 _na     195_aa yrhO Transcription regulator TrmB N-terminal domain-containing protein
1547 CAMPNV010000006.1 GCA946891995_00818 CDS open 90270-90950 _na     226_aa rseP Peptidase M50 domain-containing protein
1548 CAMPNV010000006.1 GCA946891995_00819 CDS open 90952-91884 _na     310_aa nrnA nanoRNase/pAp phosphatase%2C hydrolyzes c-di-AMP and oligoRNAs
1549 CAMPNV010000006.1 GCA946891995_00820 CDS open 91872-92198 _na     108_aa PepSY domain-containing protein
1550 CAMPNV010000006.1 GCA946891995_00821 CDS open 92275-93366 _na     363_aa ORF6N domain-containing protein
1551 CAMPNV010000006.1 GCA946891995_00822 CDS open 93474-94388 _na     304_aa hypothetical protein
1552 CAMPNV010000006.1 GCA946891995_00726 gene open 136-1134 hrcA
1553 CAMPNV010000006.1 GCA946891995_00727 gene open 1144-1662 grpE
1554 CAMPNV010000006.1 GCA946891995_00728 gene open 1673-3484 dnaK
1555 CAMPNV010000006.1 GCA946891995_00729 gene open 3498-4640 dnaJ
1556 CAMPNV010000006.1 GCA946891995_00730 gene open 4589-5350 yjbM
1557 CAMPNV010000006.1 GCA946891995_00731 gene open 5533-7335 surA
1558 CAMPNV010000006.1 GCA946891995_00732 gene open 7379-8713 ktrB
1559 CAMPNV010000006.1 GCA946891995_00733 gene open 8722-9375 ktrA
1560 CAMPNV010000006.1 GCA946891995_00734 gene open 9369-11258 mnmG
1561 CAMPNV010000006.1 GCA946891995_00735 gene open 11252-11893 rsmG
1562 CAMPNV010000006.1 GCA946891995_00736 gene open 11932-12723 cof
1563 CAMPNV010000006.1 GCA946891995_00737 gene open 12724-14316 oppA
1564 CAMPNV010000006.1 GCA946891995_00738 gene open 14328-15923 oppA
1565 CAMPNV010000006.1 GCA946891995_00739 gene open 15926-16858 dppD
1566 CAMPNV010000006.1 GCA946891995_00740 gene open 16858-17958 dppD
1567 CAMPNV010000006.1 GCA946891995_00741 gene open 17970-18920 dppC
1568 CAMPNV010000006.1 GCA946891995_00742 gene open 18920-19891 dppB
1569 CAMPNV010000006.1 GCA946891995_00743 gene open 20260-20850
1570 CAMPNV010000006.1 GCA946891995_00744 gene open 20923-21255 sdpI
1571 CAMPNV010000006.1 GCA946891995_00745 gene open 21309-22460 araJ
1572 CAMPNV010000006.1 GCA946891995_00746 gene open 22707-23903
1573 CAMPNV010000006.1 GCA946891995_00747 gene open 23896-24150
1574 CAMPNV010000006.1 GCA946891995_00748 gene open 24455-25750
1575 CAMPNV010000006.1 GCA946891995_00749 gene open 26309-28960 adhE
1576 CAMPNV010000006.1 GCA946891995_00750 gene open 29037-29927 aes
1577 CAMPNV010000006.1 GCA946891995_00751 gene open 29915-30667 nadK
1578 CAMPNV010000006.1 GCA946891995_00752 gene open 30643-31566 aes
1579 CAMPNV010000006.1 GCA946891995_00753 gene open 31560-32507 aes
1580 CAMPNV010000006.1 GCA946891995_00754 gene open 32482-34092 recN
1581 CAMPNV010000006.1 GCA946891995_00755 gene open 34094-34984 xerD
1582 CAMPNV010000006.1 GCA946891995_00756 gene open 34965-35363
1583 CAMPNV010000006.1 GCA946891995_00757 gene open 35379-36041
1584 CAMPNV010000006.1 GCA946891995_00758 gene open 36041-36946
1585 CAMPNV010000006.1 GCA946891995_00759 gene open 36970-37611 pcp
1586 CAMPNV010000006.1 GCA946891995_00760 gene open 37605-38000 ytfP
1587 CAMPNV010000006.1 GCA946891995_00761 gene open 38010-39098 prfB
1588 CAMPNV010000006.1 GCA946891995_00762 gene open 39079-39408
1589 CAMPNV010000006.1 GCA946891995_00763 gene open 39398-40078 azlC
1590 CAMPNV010000006.1 GCA946891995_00764 gene open 40079-42610 polA
1591 CAMPNV010000006.1 GCA946891995_00765 gene open 42684-43745 pepP
1592 CAMPNV010000006.1 GCA946891995_00766 gene open 43735-43938
1593 CAMPNV010000006.1 GCA946891995_00767 gene open 44010-45929 bglG
1594 CAMPNV010000006.1 GCA946891995_00768 gene open 45890-46246 celC
1595 CAMPNV010000006.1 GCA946891995_00769 gene open 46219-46560 celA
1596 CAMPNV010000006.1 GCA946891995_00770 gene open 46539-47831 celB
1597 CAMPNV010000006.1 GCA946891995_00771 gene open 47821-49185 bglB
1598 CAMPNV010000006.1 GCA946891995_00772 gene open 49256-49627
1599 CAMPNV010000006.1 GCA946891995_00773 gene open 49691-50932 repB
1600 CAMPNV010000006.1 GCA946891995_00774 gene open 51116-51544
1601 CAMPNV010000006.1 GCA946891995_00775 gene open 51529-52020 agaB
1602 CAMPNV010000006.1 GCA946891995_00776 gene open 51999-52763 manY
1603 CAMPNV010000006.1 GCA946891995_00777 gene open 52750-53571 manZ
1604 CAMPNV010000006.1 GCA946891995_00778 gene open 53573-54550 glmS
1605 CAMPNV010000006.1 GCA946891995_00779 gene open 54562-55557 agaS
1606 CAMPNV010000006.1 GCA946891995_00780 gene open 55621-55959
1607 CAMPNV010000006.1 GCA946891995_00781 gene open 55986-56585 yadA
1608 CAMPNV010000006.1 GCA946891995_00782 gene open 56867-58849 fusA
1609 CAMPNV010000006.1 GCA946891995_00783 gene open 58849-59382 serA
1610 CAMPNV010000006.1 GCA946891995_00784 gene open 59401-59730
1611 CAMPNV010000006.1 GCA946891995_00785 gene open 59754-60413
1612 CAMPNV010000006.1 GCA946891995_00786 gene open 60388-61584 ackA
1613 CAMPNV010000006.1 GCA946891995_00787 gene open 61598-62602 pta
1614 CAMPNV010000006.1 GCA946891995_00788 gene open 62615-63493 ftsY
1615 CAMPNV010000006.1 GCA946891995_00789 gene open 63497-64168 tsaB
1616 CAMPNV010000006.1 GCA946891995_00790 gene open 64137-64622 tsaE
1617 CAMPNV010000006.1 GCA946891995_00791 gene open 64640-65269 upp
1618 CAMPNV010000006.1 GCA946891995_00792 gene open 65325-65564 rpmE
1619 CAMPNV010000006.1 GCA946891995_00793 gene open 65695-66468 dAP2
1620 CAMPNV010000006.1 GCA946891995_00794 gene open 66522-67640
1621 CAMPNV010000006.1 GCA946891995_00795 gene open 67739-68530 queH
1622 CAMPNV010000006.1 GCA946891995_00796 gene open 68496-69632 yhiN
1623 CAMPNV010000006.1 GCA946891995_00797 gene open 69626-71230
1624 CAMPNV010000006.1 GCA946891995_00798 gene open 71205-72755 manB
1625 CAMPNV010000006.1 GCA946891995_00799 gene open 72833-73087
1626 CAMPNV010000006.1 GCA946891995_00800 gene open 73026-73241
1627 CAMPNV010000006.1 GCA946891995_00801 gene open 73273-74751 gltX
1628 CAMPNV010000006.1 GCA946891995_00802 gene open 75192-76559 asnS
1629 CAMPNV010000006.1 GCA946891995_00803 gene open 76568-77293
1630 CAMPNV010000006.1 GCA946891995_00804 gene open 77302-78153 dprA
1631 CAMPNV010000006.1 GCA946891995_00805 gene open 78092-80338 topA
1632 CAMPNV010000006.1 GCA946891995_00806 gene open 80338-81249 xerA
1633 CAMPNV010000006.1 GCA946891995_00807 gene open 81239-82360 rbgA
1634 CAMPNV010000006.1 GCA946891995_00808 gene open 82442-83209 phnP
1635 CAMPNV010000006.1 GCA946891995_00809 gene open 83215-83736 udg4
1636 CAMPNV010000006.1 GCA946891995_00810 gene open 83730-84833 ychF
1637 CAMPNV010000006.1 GCA946891995_00811 gene open 84844-85668 mscS
1638 CAMPNV010000006.1 GCA946891995_00812 gene open 85682-86302 gloB
1639 CAMPNV010000006.1 GCA946891995_00813 gene open 86315-86950 sIMPL
1640 CAMPNV010000006.1 GCA946891995_00814 gene open 86969-87541 efp
1641 CAMPNV010000006.1 GCA946891995_00815 gene open 87583-88377
1642 CAMPNV010000006.1 GCA946891995_00816 gene open 88364-89698 norM
1643 CAMPNV010000006.1 GCA946891995_00817 gene open 89689-90276 yrhO
1644 CAMPNV010000006.1 GCA946891995_00818 gene open 90270-90950 rseP
1645 CAMPNV010000006.1 GCA946891995_00819 gene open 90952-91884 nrnA
1646 CAMPNV010000006.1 GCA946891995_00820 gene open 91872-92198
1647 CAMPNV010000006.1 GCA946891995_00821 gene open 92275-93366
1648 CAMPNV010000006.1 GCA946891995_00822 gene open 93474-94388
1649 CAMPNV010000007.1 regulatory_region open 42276-42348 S4-Fusobacteriales ribosomal protein leader
1650 CAMPNV010000007.1 repeat_region open 93672-94343 CRISPR array with 11 repeats of length 36%2C consensus sequence ATTTGAAAGCACATTTTAATTTCTACTATTGTAGAT and spacer length 26
1651 CAMPNV010000007.1 GCA946891995_00823 CDS open 25-564 _na     179_aa tnpB RNA-guided endonuclease TnpB family protein
1652 CAMPNV010000007.1 GCA946891995_00824 CDS open 593-1129 _na     178_aa Transposase
1653 CAMPNV010000007.1 GCA946891995_00825 CDS open 1237-1497 _na     86_aa DUF4143 domain-containing protein
1654 CAMPNV010000007.1 GCA946891995_00826 CDS open 1586-2113 _na     175_aa N-acetyltransferase domain-containing protein
1655 CAMPNV010000007.1 GCA946891995_00827 CDS open 2137-2847 _na     236_aa alkD DNA alkylation repair protein
1656 CAMPNV010000007.1 GCA946891995_00828 CDS open 2883-4085 _na     400_aa gltP Sodium:proton antiporter
1657 CAMPNV010000007.1 GCA946891995_00829 CDS open 4245-4838 _na     197_aa Trep-Strep domain-containing protein
1658 CAMPNV010000007.1 GCA946891995_00830 CDS open 4840-5535 _na     231_aa ecfT Cobalt transport protein
1659 CAMPNV010000007.1 GCA946891995_00831 CDS open 5528-6895 _na     455_aa ccmA heme ABC exporter ATP-binding protein CcmA
1660 CAMPNV010000007.1 GCA946891995_00832 CDS open 7081-9315 _na     744_aa pflB formate C-acetyltransferase
1661 CAMPNV010000007.1 GCA946891995_00833 CDS open 9378-10112 _na     244_aa pflA pyruvate formate-lyase-activating protein
1662 CAMPNV010000007.1 GCA946891995_00834 CDS open 10214-11206 _na     330_aa fba class II fructose-bisphosphate aldolase
1663 CAMPNV010000007.1 GCA946891995_00835 CDS open 11256-12740 _na     494_aa hypothetical protein
1664 CAMPNV010000007.1 GCA946891995_00836 CDS open 12680-13969 _na     429_aa clcA Sodium:proton antiporter
1665 CAMPNV010000007.1 GCA946891995_00837 CDS open 14115-16142 _na     675_aa bglG HTH domain-containing protein
1666 CAMPNV010000007.1 GCA946891995_00838 CDS open 16157-16612 _na     151_aa ptsN PTS EIIA type-2 domain-containing protein
1667 CAMPNV010000007.1 GCA946891995_00839 CDS open 16625-16903 _na     92_aa sgaB PTS galactitol transporter subunit IIB
1668 CAMPNV010000007.1 GCA946891995_00840 CDS open 16917-18263 _na     448_aa sgcC PTS galactitol transporter subunit IIC
1669 CAMPNV010000007.1 GCA946891995_00841 CDS open 18248-18904 _na     218_aa araD Aldolase
1670 CAMPNV010000007.1 GCA946891995_00842 CDS open 18917-20500 _na     527_aa hypothetical protein
1671 CAMPNV010000007.1 GCA946891995_00843 CDS open 20564-21874 _na     436_aa nCS2 Guanine permease
1672 CAMPNV010000007.1 GCA946891995_00844 CDS open 22288-23610 _na     440_aa nhaC Sodium:proton antiporter
1673 CAMPNV010000007.1 GCA946891995_00845 CDS open 23728-24624 _na     298_aa znuA ABC transporter substrate-binding protein
1674 CAMPNV010000007.1 GCA946891995_00846 CDS open 24594-25061 _na     155_aa ybaK Cys-tRNA(Pro) deacylase
1675 CAMPNV010000007.1 GCA946891995_00847 CDS open 25094-25702 _na     202_aa rsmC Methyltransferase
1676 CAMPNV010000007.1 GCA946891995_00848 CDS open 25702-26139 _na     145_aa rimI N-acetyltransferase domain-containing protein
1677 CAMPNV010000007.1 GCA946891995_00849 CDS open 26129-26848 _na     239_aa truA tRNA pseudouridine(38-40) synthase TruA
1678 CAMPNV010000007.1 GCA946891995_00850 CDS open 26839-27435 _na     198_aa serB HAD-IB family hydrolase
1679 CAMPNV010000007.1 GCA946891995_00851 CDS open 27404-28447 _na     347_aa gspE Bacterial type II secretion system protein E domain-containing protein
1680 CAMPNV010000007.1 GCA946891995_00852 CDS open 28470-28928 _na     152_aa viral A-type inclusion protein
1681 CAMPNV010000007.1 GCA946891995_00853 CDS open 28915-29511 _na     198_aa tsaC L-threonylcarbamoyladenylate synthase
1682 CAMPNV010000007.1 GCA946891995_00854 CDS open 29498-30481 _na     327_aa prsA Ribose-phosphate pyrophosphokinase
1683 CAMPNV010000007.1 GCA946891995_00855 CDS open 30501-31826 _na     441_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
1684 CAMPNV010000007.1 GCA946891995_00856 CDS open 31880-32815 _na     311_aa mdh L-lactate dehydrogenase
1685 CAMPNV010000007.1 GCA946891995_00857 CDS open 32779-33438 _na     219_aa dppF ABC transporter ATP-binding protein
1686 CAMPNV010000007.1 GCA946891995_00858 CDS open 33557-34033 _na     158_aa tpx thiol peroxidase
1687 CAMPNV010000007.1 GCA946891995_00859 CDS open 34051-36171 _na     706_aa dAP2 Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
1688 CAMPNV010000007.1 GCA946891995_00860 CDS open 36274-36894 _na     206_aa trmR Methyltransferase
1689 CAMPNV010000007.1 GCA946891995_00861 CDS open 36879-38141 _na     420_aa digH Glycosyl hydrolase-like 10 domain-containing protein
1690 CAMPNV010000007.1 GCA946891995_00862 CDS open 38141-40102 _na     653_aa uvrB excinuclease ABC subunit UvrB
1691 CAMPNV010000007.1 GCA946891995_00863 CDS open 40102-41289 _na     395_aa xseA exodeoxyribonuclease VII large subunit
1692 CAMPNV010000007.1 GCA946891995_00864 CDS open 41289-41774 _na     161_aa comEB Cytidine deaminase
1693 CAMPNV010000007.1 GCA946891995_00865 CDS open 41876-42094 _na     72_aa infA translation initiation factor IF-1
1694 CAMPNV010000007.1 GCA946891995_00866 CDS open 42108-42221 _na     37_aa rpmJ 50S ribosomal protein L36
1695 CAMPNV010000007.1 GCA946891995_00867 CDS open 42286-42744 _na     152_aa Small ribosomal subunit protein uS13
1696 CAMPNV010000007.1 GCA946891995_00868 CDS open 42767-43153 _na     128_aa rpsK 30S ribosomal protein S11
1697 CAMPNV010000007.1 GCA946891995_00869 CDS open 43180-43770 _na     196_aa rpsD 30S ribosomal protein S4
1698 CAMPNV010000007.1 GCA946891995_00870 CDS open 43815-44771 _na     318_aa rpoA DNA-directed RNA polymerase subunit alpha
1699 CAMPNV010000007.1 GCA946891995_00871 CDS open 44794-45168 _na     124_aa rplQ 50S ribosomal protein L17
1700 CAMPNV010000007.1 GCA946891995_00872 CDS open 45212-45757 _na     181_aa rimL N-acetyltransferase domain-containing protein
1701 CAMPNV010000007.1 GCA946891995_00873 CDS open 45786-46220 _na     144_aa mraZ division/cell wall cluster transcriptional repressor MraZ
1702 CAMPNV010000007.1 GCA946891995_00874 CDS open 46229-47170 _na     313_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
1703 CAMPNV010000007.1 GCA946891995_00875 CDS open 47149-47472 _na     107_aa ftsL Cell division protein FtsL
1704 CAMPNV010000007.1 GCA946891995_00876 CDS open 47671-50682 _na     1003_aa pulA pullulanase
1705 CAMPNV010000007.1 GCA946891995_00877 CDS open 50764-51150 _na     128_aa hipB helix-turn-helix domain-containing protein
1706 CAMPNV010000007.1 GCA946891995_00878 CDS open 51144-51545 _na     133_aa immA ImmA/IrrE family metallo-endopeptidase
1707 CAMPNV010000007.1 GCA946891995_00879 CDS open 51622-52782 _na     386_aa abgB Peptidase M20
1708 CAMPNV010000007.1 GCA946891995_00880 CDS open 52776-54134 _na     452_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
1709 CAMPNV010000007.1 GCA946891995_00881 CDS open 54136-54726 _na     196_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
1710 CAMPNV010000007.1 GCA946891995_00882 CDS open 54735-55730 _na     331_aa gpsA Glycerol-3-phosphate dehydrogenase [NAD(P)+]
1711 CAMPNV010000007.1 GCA946891995_00883 CDS open 55740-56573 _na     277_aa rpoD RNA polymerase sigma factor
1712 CAMPNV010000007.1 GCA946891995_00884 CDS open 56560-57669 _na     369_aa dnaN DNA polymerase III subunit beta
1713 CAMPNV010000007.1 GCA946891995_00885 CDS open 57686-58234 _na     182_aa ptsG2 PTS EIIB type-1 domain-containing protein
1714 CAMPNV010000007.1 GCA946891995_00886 CDS open 58341-59057 _na     238_aa cps2a Transcriptional regulator
1715 CAMPNV010000007.1 GCA946891995_00887 CDS open 59073-59873 _na     266_aa cof Cof-type HAD-IIB family hydrolase
1716 CAMPNV010000007.1 GCA946891995_00888 CDS open 59961-60716 _na     251_aa tpiA triose-phosphate isomerase
1717 CAMPNV010000007.1 GCA946891995_00889 CDS open 60725-60925 _na     66_aa secG preprotein translocase subunit SecG
1718 CAMPNV010000007.1 GCA946891995_00890 CDS open 60952-61230 _na     92_aa hupA DNA-binding protein
1719 CAMPNV010000007.1 GCA946891995_00891 CDS open 61298-62875 _na     525_aa sunT ABC transporter domain-containing protein
1720 CAMPNV010000007.1 GCA946891995_00892 CDS open 62862-64403 _na     513_aa mdlB ABC transporter ATP-binding protein
1721 CAMPNV010000007.1 GCA946891995_00893 CDS open 64396-65670 _na     424_aa mpfA Hemolysin
1722 CAMPNV010000007.1 GCA946891995_00894 CDS open 65814-66713 _na     299_aa uRH1 Inosine/uridine-preferring nucleoside hydrolase domain-containing protein
1723 CAMPNV010000007.1 GCA946891995_00895 CDS open 66722-69190 _na     822_aa glgP Alpha-1%2C4 glucan phosphorylase
1724 CAMPNV010000007.1 GCA946891995_00896 CDS open 69196-70281 _na     361_aa hypothetical protein
1725 CAMPNV010000007.1 GCA946891995_00897 CDS open 70283-71590 _na     435_aa CheW-like domain-containing protein
1726 CAMPNV010000007.1 GCA946891995_00898 CDS open 71575-72363 _na     262_aa cdsA phosphatidate cytidylyltransferase
1727 CAMPNV010000007.1 GCA946891995_00899 CDS open 72350-73051 _na     233_aa uppS polyprenyl diphosphate synthase
1728 CAMPNV010000007.1 GCA946891995_00900 CDS open 73211-75406 _na     731_aa pnp polyribonucleotide nucleotidyltransferase
1729 CAMPNV010000007.1 GCA946891995_00901 CDS open 75390-75947 _na     185_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1730 CAMPNV010000007.1 GCA946891995_00902 CDS open 75940-76464 _na     174_aa hypothetical protein
1731 CAMPNV010000007.1 GCA946891995_00903 CDS open 76475-79117 _na     880_aa mgtA ATPase
1732 CAMPNV010000007.1 GCA946891995_00904 CDS open 79087-80001 _na     304_aa tPR Beta-lactamase
1733 CAMPNV010000007.1 GCA946891995_00905 CDS open 79994-80857 _na     287_aa dacC Peptidase S11 D-alanyl-D-alanine carboxypeptidase A N-terminal domain-containing protein
1734 CAMPNV010000007.1 GCA946891995_00906 CDS open 80833-81702 _na     289_aa lgt prolipoprotein diacylglyceryl transferase
1735 CAMPNV010000007.1 GCA946891995_00907 CDS open 81810-82610 _na     266_aa iclR IclR family transcriptional regulator
1736 CAMPNV010000007.1 GCA946891995_00908 CDS open 82562-84709 _na     715_aa spoT Guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase
1737 CAMPNV010000007.1 GCA946891995_00909 CDS open 84717-85865 _na     382_aa tgt tRNA guanosine(34) transglycosylase Tgt
1738 CAMPNV010000007.1 GCA946891995_00910 CDS open 85878-87182 _na     434_aa pepC Aminopeptidase
1739 CAMPNV010000007.1 GCA946891995_00911 CDS open 87245-88333 _na     362_aa abgB Peptidase M20 dimerisation domain-containing protein
1740 CAMPNV010000007.1 GCA946891995_00912 CDS open 88484-92212 _na     1242_aa cas12a type V CRISPR-associated protein Cas12a/Cpf1
1741 CAMPNV010000007.1 GCA946891995_00913 CDS open 92217-92777 _na     186_aa cas4 type V CRISPR-associated protein Cas4
1742 CAMPNV010000007.1 GCA946891995_00914 CDS open 92771-93535 _na     254_aa cas1 CRISPR-associated endonuclease Cas1
1743 CAMPNV010000007.1 GCA946891995_00823 gene open 25-564 tnpB
1744 CAMPNV010000007.1 GCA946891995_00824 gene open 593-1129
1745 CAMPNV010000007.1 GCA946891995_00825 gene open 1237-1497
1746 CAMPNV010000007.1 GCA946891995_00826 gene open 1586-2113
1747 CAMPNV010000007.1 GCA946891995_00827 gene open 2137-2847 alkD
1748 CAMPNV010000007.1 GCA946891995_00828 gene open 2883-4085 gltP
1749 CAMPNV010000007.1 GCA946891995_00829 gene open 4245-4838
1750 CAMPNV010000007.1 GCA946891995_00830 gene open 4840-5535 ecfT
1751 CAMPNV010000007.1 GCA946891995_00831 gene open 5528-6895 ccmA
1752 CAMPNV010000007.1 GCA946891995_00832 gene open 7081-9315 pflB
1753 CAMPNV010000007.1 GCA946891995_00833 gene open 9378-10112 pflA
1754 CAMPNV010000007.1 GCA946891995_00834 gene open 10214-11206 fba
1755 CAMPNV010000007.1 GCA946891995_00835 gene open 11256-12740
1756 CAMPNV010000007.1 GCA946891995_00836 gene open 12680-13969 clcA
1757 CAMPNV010000007.1 GCA946891995_00837 gene open 14115-16142 bglG
1758 CAMPNV010000007.1 GCA946891995_00838 gene open 16157-16612 ptsN
1759 CAMPNV010000007.1 GCA946891995_00839 gene open 16625-16903 sgaB
1760 CAMPNV010000007.1 GCA946891995_00840 gene open 16917-18263 sgcC
1761 CAMPNV010000007.1 GCA946891995_00841 gene open 18248-18904 araD
1762 CAMPNV010000007.1 GCA946891995_00842 gene open 18917-20500
1763 CAMPNV010000007.1 GCA946891995_00843 gene open 20564-21874 nCS2
1764 CAMPNV010000007.1 GCA946891995_00844 gene open 22288-23610 nhaC
1765 CAMPNV010000007.1 GCA946891995_00845 gene open 23728-24624 znuA
1766 CAMPNV010000007.1 GCA946891995_00846 gene open 24594-25061 ybaK
1767 CAMPNV010000007.1 GCA946891995_00847 gene open 25094-25702 rsmC
1768 CAMPNV010000007.1 GCA946891995_00848 gene open 25702-26139 rimI
1769 CAMPNV010000007.1 GCA946891995_00849 gene open 26129-26848 truA
1770 CAMPNV010000007.1 GCA946891995_00850 gene open 26839-27435 serB
1771 CAMPNV010000007.1 GCA946891995_00851 gene open 27404-28447 gspE
1772 CAMPNV010000007.1 GCA946891995_00852 gene open 28470-28928
1773 CAMPNV010000007.1 GCA946891995_00853 gene open 28915-29511 tsaC
1774 CAMPNV010000007.1 GCA946891995_00854 gene open 29498-30481 prsA
1775 CAMPNV010000007.1 GCA946891995_00855 gene open 30501-31826 glmU
1776 CAMPNV010000007.1 GCA946891995_00856 gene open 31880-32815 mdh
1777 CAMPNV010000007.1 GCA946891995_00857 gene open 32779-33438 dppF
1778 CAMPNV010000007.1 GCA946891995_00858 gene open 33557-34033 tpx
1779 CAMPNV010000007.1 GCA946891995_00859 gene open 34051-36171 dAP2
1780 CAMPNV010000007.1 GCA946891995_00860 gene open 36274-36894 trmR
1781 CAMPNV010000007.1 GCA946891995_00861 gene open 36879-38141 digH
1782 CAMPNV010000007.1 GCA946891995_00862 gene open 38141-40102 uvrB
1783 CAMPNV010000007.1 GCA946891995_00863 gene open 40102-41289 xseA
1784 CAMPNV010000007.1 GCA946891995_00864 gene open 41289-41774 comEB
1785 CAMPNV010000007.1 GCA946891995_00865 gene open 41876-42094 infA
1786 CAMPNV010000007.1 GCA946891995_00866 gene open 42108-42221 rpmJ
1787 CAMPNV010000007.1 GCA946891995_00867 gene open 42286-42744
1788 CAMPNV010000007.1 GCA946891995_00868 gene open 42767-43153 rpsK
1789 CAMPNV010000007.1 GCA946891995_00869 gene open 43180-43770 rpsD
1790 CAMPNV010000007.1 GCA946891995_00870 gene open 43815-44771 rpoA
1791 CAMPNV010000007.1 GCA946891995_00871 gene open 44794-45168 rplQ
1792 CAMPNV010000007.1 GCA946891995_00872 gene open 45212-45757 rimL
1793 CAMPNV010000007.1 GCA946891995_00873 gene open 45786-46220 mraZ
1794 CAMPNV010000007.1 GCA946891995_00874 gene open 46229-47170 rsmH
1795 CAMPNV010000007.1 GCA946891995_00875 gene open 47149-47472 ftsL
1796 CAMPNV010000007.1 GCA946891995_00876 gene open 47671-50682 pulA
1797 CAMPNV010000007.1 GCA946891995_00877 gene open 50764-51150 hipB
1798 CAMPNV010000007.1 GCA946891995_00878 gene open 51144-51545 immA
1799 CAMPNV010000007.1 GCA946891995_00879 gene open 51622-52782 abgB
1800 CAMPNV010000007.1 GCA946891995_00880 gene open 52776-54134 rlmD
1801 CAMPNV010000007.1 GCA946891995_00881 gene open 54136-54726 plsY
1802 CAMPNV010000007.1 GCA946891995_00882 gene open 54735-55730 gpsA
1803 CAMPNV010000007.1 GCA946891995_00883 gene open 55740-56573 rpoD
1804 CAMPNV010000007.1 GCA946891995_00884 gene open 56560-57669 dnaN
1805 CAMPNV010000007.1 GCA946891995_00885 gene open 57686-58234 ptsG2
1806 CAMPNV010000007.1 GCA946891995_00886 gene open 58341-59057 cps2a
1807 CAMPNV010000007.1 GCA946891995_00887 gene open 59073-59873 cof
1808 CAMPNV010000007.1 GCA946891995_00888 gene open 59961-60716 tpiA
1809 CAMPNV010000007.1 GCA946891995_00889 gene open 60725-60925 secG
1810 CAMPNV010000007.1 GCA946891995_00890 gene open 60952-61230 hupA
1811 CAMPNV010000007.1 GCA946891995_00891 gene open 61298-62875 sunT
1812 CAMPNV010000007.1 GCA946891995_00892 gene open 62862-64403 mdlB
1813 CAMPNV010000007.1 GCA946891995_00893 gene open 64396-65670 mpfA
1814 CAMPNV010000007.1 GCA946891995_00894 gene open 65814-66713 uRH1
1815 CAMPNV010000007.1 GCA946891995_00895 gene open 66722-69190 glgP
1816 CAMPNV010000007.1 GCA946891995_00896 gene open 69196-70281
1817 CAMPNV010000007.1 GCA946891995_00897 gene open 70283-71590
1818 CAMPNV010000007.1 GCA946891995_00898 gene open 71575-72363 cdsA
1819 CAMPNV010000007.1 GCA946891995_00899 gene open 72350-73051 uppS
1820 CAMPNV010000007.1 GCA946891995_00900 gene open 73211-75406 pnp
1821 CAMPNV010000007.1 GCA946891995_00901 gene open 75390-75947 pgsA
1822 CAMPNV010000007.1 GCA946891995_00902 gene open 75940-76464
1823 CAMPNV010000007.1 GCA946891995_00903 gene open 76475-79117 mgtA
1824 CAMPNV010000007.1 GCA946891995_00904 gene open 79087-80001 tPR
1825 CAMPNV010000007.1 GCA946891995_00905 gene open 79994-80857 dacC
1826 CAMPNV010000007.1 GCA946891995_00906 gene open 80833-81702 lgt
1827 CAMPNV010000007.1 GCA946891995_00907 gene open 81810-82610 iclR
1828 CAMPNV010000007.1 GCA946891995_00908 gene open 82562-84709 spoT
1829 CAMPNV010000007.1 GCA946891995_00909 gene open 84717-85865 tgt
1830 CAMPNV010000007.1 GCA946891995_00910 gene open 85878-87182 pepC
1831 CAMPNV010000007.1 GCA946891995_00911 gene open 87245-88333 abgB
1832 CAMPNV010000007.1 GCA946891995_00912 gene open 88484-92212 cas12a
1833 CAMPNV010000007.1 GCA946891995_00913 gene open 92217-92777 cas4
1834 CAMPNV010000007.1 GCA946891995_00914 gene open 92771-93535 cas1
1835 CAMPNV010000008.1 rep_origin open 83676-84151
1836 CAMPNV010000008.1 GCA946891995_00915 CDS open 60-2138 _na     692_aa fusA elongation factor G
1837 CAMPNV010000008.1 GCA946891995_00916 CDS open 2156-2626 _na     156_aa rpsG 30S ribosomal protein S7
1838 CAMPNV010000008.1 GCA946891995_00917 CDS open 2642-3013 _na     123_aa rpsL 30S ribosomal protein S12
1839 CAMPNV010000008.1 GCA946891995_00918 CDS open 3274-3600 _na     108_aa AAA family ATPase
1840 CAMPNV010000008.1 GCA946891995_00919 CDS open 4103-5596 _na     497_aa autotransporter outer membrane beta-barrel domain-containing protein
1841 CAMPNV010000008.1 GCA946891995_00920 CDS open 5761-7551 _na     596_aa nadN NAD nucleotidase
1842 CAMPNV010000008.1 GCA946891995_00921 CDS open 7809-9686 _na     625_aa abc-f ribosomal protection-like ABC-F family protein
1843 CAMPNV010000008.1 GCA946891995_00922 CDS open 9676-10332 _na     218_aa ycjU HAD family phosphatase
1844 CAMPNV010000008.1 GCA946891995_00923 CDS open 10458-11528 _na     356_aa hypothetical protein
1845 CAMPNV010000008.1 GCA946891995_00924 CDS open 11528-11728 _na     66_aa hypothetical protein
1846 CAMPNV010000008.1 GCA946891995_00925 CDS open 11857-12162 _na     101_aa celA PTS EIIB type-3 domain-containing protein
1847 CAMPNV010000008.1 GCA946891995_00926 CDS open 12167-13480 _na     437_aa celB Permease IIC component
1848 CAMPNV010000008.1 GCA946891995_00927 CDS open 13482-13883 _na     133_aa DUF3284 domain-containing protein
1849 CAMPNV010000008.1 GCA946891995_00928 CDS open 13885-14532 _na     215_aa mngR HTH gntR-type domain-containing protein
1850 CAMPNV010000008.1 GCA946891995_00929 CDS open 14543-15919 _na     458_aa bglB 6-phospho-beta-glucosidase
1851 CAMPNV010000008.1 GCA946891995_00930 CDS open 15929-16246 _na     105_aa celC PTS lactose/cellobiose transporter subunit IIA
1852 CAMPNV010000008.1 GCA946891995_00931 CDS open 16239-17084 _na     281_aa PEP phosphonomutase
1853 CAMPNV010000008.1 GCA946891995_00932 CDS open 17071-18330 _na     419_aa abgB Amidohydrolase
1854 CAMPNV010000008.1 GCA946891995_00933 CDS open 18449-20056 _na     535_aa Autotransporter domain-containing protein
1855 CAMPNV010000008.1 GCA946891995_00934 CDS open 20336-21733 _na     465_aa Autotransporter domain-containing protein
1856 CAMPNV010000008.1 GCA946891995_00935 CDS open 22018-23343 _na     441_aa hypothetical protein
1857 CAMPNV010000008.1 GCA946891995_00936 CDS open 23702-24907 _na     401_aa hypothetical protein
1858 CAMPNV010000008.1 GCA946891995_00937 CDS open 25201-26373 _na     390_aa hypothetical protein
1859 CAMPNV010000008.1 GCA946891995_00938 CDS open 26360-26719 _na     119_aa hypothetical protein
1860 CAMPNV010000008.1 GCA946891995_00939 CDS open 26944-27534 _na     196_aa Outer membrane protein beta-barrel domain-containing protein
1861 CAMPNV010000008.1 GCA946891995_00940 CDS open 27867-29789 _na     640_aa bglG PTS system EIIA component
1862 CAMPNV010000008.1 GCA946891995_00941 CDS open 29802-30254 _na     150_aa ptsN Ascorbate-specific PTS system EIIA component
1863 CAMPNV010000008.1 GCA946891995_00942 CDS open 30239-30517 _na     92_aa sgaB PTS ascorbate transporter subunit IIB
1864 CAMPNV010000008.1 GCA946891995_00943 CDS open 30531-31799 _na     422_aa ulaA Ascorbate-specific PTS system EIIC component
1865 CAMPNV010000008.1 GCA946891995_00944 CDS open 31812-32654 _na     280_aa tktA1 Transketolase
1866 CAMPNV010000008.1 GCA946891995_00945 CDS open 32618-33547 _na     309_aa tktA2 Transketolase
1867 CAMPNV010000008.1 GCA946891995_00946 CDS open 33835-35424 _na     529_aa Autotransporter domain-containing protein
1868 CAMPNV010000008.1 GCA946891995_00947 CDS open 35705-37888 _na     727_aa Autotransporter domain-containing protein
1869 CAMPNV010000008.1 GCA946891995_00948 CDS open 38093-39106 _na     337_aa hypothetical protein
1870 CAMPNV010000008.1 GCA946891995_00949 CDS open 39484-40314 _na     276_aa nagB glucosamine-6-phosphate deaminase
1871 CAMPNV010000008.1 GCA946891995_00950 CDS open 40315-40836 _na     173_aa hypothetical protein
1872 CAMPNV010000008.1 GCA946891995_00951 CDS open 40838-43417 _na     859_aa recJ single-stranded-DNA-specific exonuclease RecJ
1873 CAMPNV010000008.1 GCA946891995_00952 CDS open 43427-43915 _na     162_aa fldA flavodoxin
1874 CAMPNV010000008.1 GCA946891995_00953 CDS open 43930-45765 _na     611_aa pulA type I pullulanase
1875 CAMPNV010000008.1 GCA946891995_00954 CDS open 45769-46689 _na     306_aa ABC transporter substrate-binding protein
1876 CAMPNV010000008.1 GCA946891995_00955 CDS open 46698-47591 _na     297_aa ABC transporter substrate-binding protein
1877 CAMPNV010000008.1 GCA946891995_00956 CDS open 47593-48501 _na     302_aa ABC transporter substrate-binding protein
1878 CAMPNV010000008.1 GCA946891995_00957 CDS open 48514-49605 _na     363_aa ABC transporter permease
1879 CAMPNV010000008.1 GCA946891995_00958 CDS open 49606-50400 _na     264_aa phnK ABC transporter ATP-binding protein
1880 CAMPNV010000008.1 GCA946891995_00959 CDS open 50614-51201 _na     195_aa DUF6162 domain-containing protein
1881 CAMPNV010000008.1 GCA946891995_00960 CDS open 51203-52111 _na     302_aa znuA ABC transporter substrate-binding protein
1882 CAMPNV010000008.1 GCA946891995_00961 CDS open 52105-52797 _na     230_aa znuC Manganese transporter
1883 CAMPNV010000008.1 GCA946891995_00962 CDS open 52810-53715 _na     301_aa znuB Zinc ABC transporter permease
1884 CAMPNV010000008.1 GCA946891995_00963 CDS open 53691-54572 _na     293_aa znuA ABC transporter substrate-binding protein
1885 CAMPNV010000008.1 GCA946891995_00964 CDS open 54584-55024 _na     146_aa hypothetical protein
1886 CAMPNV010000008.1 GCA946891995_00965 CDS open 55179-56504 _na     441_aa ATP-binding protein
1887 CAMPNV010000008.1 GCA946891995_00966 CDS open 56602-57900 _na     432_aa ATPase AAA
1888 CAMPNV010000008.1 GCA946891995_00967 CDS open 57919-59943 _na     674_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
1889 CAMPNV010000008.1 GCA946891995_00968 CDS open 59937-60677 _na     246_aa ubiE Methyltransferase domain-containing protein
1890 CAMPNV010000008.1 GCA946891995_00969 CDS open 60670-61008 _na     112_aa qdoI Cupin
1891 CAMPNV010000008.1 GCA946891995_00970 CDS open 60986-61987 _na     333_aa araC helix-turn-helix domain-containing protein
1892 CAMPNV010000008.1 GCA946891995_00971 CDS open 62090-63832 _na     580_aa mdlB ABC transporter ATP-binding protein
1893 CAMPNV010000008.1 GCA946891995_00972 CDS open 63816-65528 _na     570_aa mdlB ABC transporter ATP-binding protein
1894 CAMPNV010000008.1 GCA946891995_00973 CDS open 65649-66791 _na     380_aa YadA-like family protein
1895 CAMPNV010000008.1 GCA946891995_00974 CDS open 67029-67937 _na     302_aa yhfZ GntR family transcriptional regulator YhfZ
1896 CAMPNV010000008.1 GCA946891995_00975 CDS open 67987-68364 _na     125_aa PRD domain-containing protein
1897 CAMPNV010000008.1 GCA946891995_00976 CDS open 68349-68726 _na     125_aa DUF2620 domain-containing protein
1898 CAMPNV010000008.1 GCA946891995_00977 CDS open 68705-70009 _na     434_aa Membrane protein
1899 CAMPNV010000008.1 GCA946891995_00978 CDS open 70020-70895 _na     291_aa php Hydrolase
1900 CAMPNV010000008.1 GCA946891995_00979 CDS open 70906-72195 _na     429_aa ampC Beta-lactamase
1901 CAMPNV010000008.1 GCA946891995_00980 CDS open 72137-73252 _na     371_aa metC Cystathionine beta-lyase/cystathionine gamma-synthase
1902 CAMPNV010000008.1 GCA946891995_00981 CDS open 73237-74385 _na     382_aa yhfX Amino acid racemase
1903 CAMPNV010000008.1 GCA946891995_00982 CDS open 74378-75601 _na     407_aa deoB phosphopentomutase
1904 CAMPNV010000008.1 GCA946891995_00993 CDS open 76789-77034 _na     81_aa hslR RNA-binding protein S4
1905 CAMPNV010000008.1 GCA946891995_00994 CDS open 77034-77585 _na     183_aa Lipoprotein
1906 CAMPNV010000008.1 GCA946891995_00995 CDS open 77578-80256 _na     892_aa mfd transcription-repair coupling factor
1907 CAMPNV010000008.1 GCA946891995_00996 CDS open 80240-81049 _na     269_aa DUF721 domain-containing protein
1908 CAMPNV010000008.1 GCA946891995_00997 CDS open 81039-82082 _na     347_aa recF DNA replication/repair protein RecF
1909 CAMPNV010000008.1 GCA946891995_00998 CDS open 82082-82285 _na     67_aa ybcJ RNA-binding S4 domain-containing protein
1910 CAMPNV010000008.1 GCA946891995_00999 CDS open 82287-83675 _na     462_aa dnaA chromosomal replication initiator protein DnaA
1911 CAMPNV010000008.1 GCA946891995_01000 CDS open 84152-84286 _na     44_aa rpmH 50S ribosomal protein L34
1912 CAMPNV010000008.1 GCA946891995_01001 CDS open 84340-84708 _na     122_aa rnpA ribonuclease P protein component
1913 CAMPNV010000008.1 GCA946891995_01002 CDS open 84653-84859 _na     68_aa yidD membrane protein insertion efficiency factor YidD
1914 CAMPNV010000008.1 GCA946891995_01003 CDS open 84870-85556 _na     228_aa yidC Membrane protein
1915 CAMPNV010000008.1 GCA946891995_01004 CDS open 85544-86233 _na     229_aa jag R3H domain-containing protein
1916 CAMPNV010000008.1 GCA946891995_01005 CDS open 86235-87593 _na     452_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1917 CAMPNV010000008.1 GCA946891995_01006 CDS open 87605-87985 _na     126_aa DUF956 domain-containing protein
1918 CAMPNV010000008.1 GCA946891995_01007 CDS open 87985-88902 _na     305_aa manZ PTS system mannose family transporter subunit IID
1919 CAMPNV010000008.1 GCA946891995_01008 CDS open 88886-89734 _na     282_aa manY PTS mannose transporter subunit IIC
1920 CAMPNV010000008.1 GCA946891995_01009 CDS open 89743-90735 _na     330_aa agaB PTS system mannose-specific EIIAB component
1921 CAMPNV010000008.1 GCA946891995_00915 gene open 60-2138 fusA
1922 CAMPNV010000008.1 GCA946891995_00916 gene open 2156-2626 rpsG
1923 CAMPNV010000008.1 GCA946891995_00917 gene open 2642-3013 rpsL
1924 CAMPNV010000008.1 GCA946891995_00918 gene open 3274-3600
1925 CAMPNV010000008.1 GCA946891995_00919 gene open 4103-5596
1926 CAMPNV010000008.1 GCA946891995_00920 gene open 5761-7551 nadN
1927 CAMPNV010000008.1 GCA946891995_00921 gene open 7809-9686 abc-f
1928 CAMPNV010000008.1 GCA946891995_00922 gene open 9676-10332 ycjU
1929 CAMPNV010000008.1 GCA946891995_00923 gene open 10458-11528
1930 CAMPNV010000008.1 GCA946891995_00924 gene open 11528-11728
1931 CAMPNV010000008.1 GCA946891995_00925 gene open 11857-12162 celA
1932 CAMPNV010000008.1 GCA946891995_00926 gene open 12167-13480 celB
1933 CAMPNV010000008.1 GCA946891995_00927 gene open 13482-13883
1934 CAMPNV010000008.1 GCA946891995_00928 gene open 13885-14532 mngR
1935 CAMPNV010000008.1 GCA946891995_00929 gene open 14543-15919 bglB
1936 CAMPNV010000008.1 GCA946891995_00930 gene open 15929-16246 celC
1937 CAMPNV010000008.1 GCA946891995_00931 gene open 16239-17084
1938 CAMPNV010000008.1 GCA946891995_00932 gene open 17071-18330 abgB
1939 CAMPNV010000008.1 GCA946891995_00933 gene open 18449-20056
1940 CAMPNV010000008.1 GCA946891995_00934 gene open 20336-21733
1941 CAMPNV010000008.1 GCA946891995_00935 gene open 22018-23343
1942 CAMPNV010000008.1 GCA946891995_00936 gene open 23702-24907
1943 CAMPNV010000008.1 GCA946891995_00937 gene open 25201-26373
1944 CAMPNV010000008.1 GCA946891995_00938 gene open 26360-26719
1945 CAMPNV010000008.1 GCA946891995_00939 gene open 26944-27534
1946 CAMPNV010000008.1 GCA946891995_00940 gene open 27867-29789 bglG
1947 CAMPNV010000008.1 GCA946891995_00941 gene open 29802-30254 ptsN
1948 CAMPNV010000008.1 GCA946891995_00942 gene open 30239-30517 sgaB
1949 CAMPNV010000008.1 GCA946891995_00943 gene open 30531-31799 ulaA
1950 CAMPNV010000008.1 GCA946891995_00944 gene open 31812-32654 tktA1
1951 CAMPNV010000008.1 GCA946891995_00945 gene open 32618-33547 tktA2
1952 CAMPNV010000008.1 GCA946891995_00946 gene open 33835-35424
1953 CAMPNV010000008.1 GCA946891995_00947 gene open 35705-37888
1954 CAMPNV010000008.1 GCA946891995_00948 gene open 38093-39106
1955 CAMPNV010000008.1 GCA946891995_00949 gene open 39484-40314 nagB
1956 CAMPNV010000008.1 GCA946891995_00950 gene open 40315-40836
1957 CAMPNV010000008.1 GCA946891995_00951 gene open 40838-43417 recJ
1958 CAMPNV010000008.1 GCA946891995_00952 gene open 43427-43915 fldA
1959 CAMPNV010000008.1 GCA946891995_00953 gene open 43930-45765 pulA
1960 CAMPNV010000008.1 GCA946891995_00954 gene open 45769-46689
1961 CAMPNV010000008.1 GCA946891995_00955 gene open 46698-47591
1962 CAMPNV010000008.1 GCA946891995_00956 gene open 47593-48501
1963 CAMPNV010000008.1 GCA946891995_00957 gene open 48514-49605
1964 CAMPNV010000008.1 GCA946891995_00958 gene open 49606-50400 phnK
1965 CAMPNV010000008.1 GCA946891995_00959 gene open 50614-51201
1966 CAMPNV010000008.1 GCA946891995_00960 gene open 51203-52111 znuA
1967 CAMPNV010000008.1 GCA946891995_00961 gene open 52105-52797 znuC
1968 CAMPNV010000008.1 GCA946891995_00962 gene open 52810-53715 znuB
1969 CAMPNV010000008.1 GCA946891995_00963 gene open 53691-54572 znuA
1970 CAMPNV010000008.1 GCA946891995_00964 gene open 54584-55024
1971 CAMPNV010000008.1 GCA946891995_00965 gene open 55179-56504
1972 CAMPNV010000008.1 GCA946891995_00966 gene open 56602-57900
1973 CAMPNV010000008.1 GCA946891995_00967 gene open 57919-59943 metE
1974 CAMPNV010000008.1 GCA946891995_00968 gene open 59937-60677 ubiE
1975 CAMPNV010000008.1 GCA946891995_00969 gene open 60670-61008 qdoI
1976 CAMPNV010000008.1 GCA946891995_00970 gene open 60986-61987 araC
1977 CAMPNV010000008.1 GCA946891995_00971 gene open 62090-63832 mdlB
1978 CAMPNV010000008.1 GCA946891995_00972 gene open 63816-65528 mdlB
1979 CAMPNV010000008.1 GCA946891995_00973 gene open 65649-66791
1980 CAMPNV010000008.1 GCA946891995_00974 gene open 67029-67937 yhfZ
1981 CAMPNV010000008.1 GCA946891995_00975 gene open 67987-68364
1982 CAMPNV010000008.1 GCA946891995_00976 gene open 68349-68726
1983 CAMPNV010000008.1 GCA946891995_00977 gene open 68705-70009
1984 CAMPNV010000008.1 GCA946891995_00978 gene open 70020-70895 php
1985 CAMPNV010000008.1 GCA946891995_00979 gene open 70906-72195 ampC
1986 CAMPNV010000008.1 GCA946891995_00980 gene open 72137-73252 metC
1987 CAMPNV010000008.1 GCA946891995_00981 gene open 73237-74385 yhfX
1988 CAMPNV010000008.1 GCA946891995_00982 gene open 74378-75601 deoB
1989 CAMPNV010000008.1 GCA946891995_00993 gene open 76789-77034 hslR
1990 CAMPNV010000008.1 GCA946891995_00994 gene open 77034-77585
1991 CAMPNV010000008.1 GCA946891995_00995 gene open 77578-80256 mfd
1992 CAMPNV010000008.1 GCA946891995_00996 gene open 80240-81049
1993 CAMPNV010000008.1 GCA946891995_00997 gene open 81039-82082 recF
1994 CAMPNV010000008.1 GCA946891995_00998 gene open 82082-82285 ybcJ
1995 CAMPNV010000008.1 GCA946891995_00999 gene open 82287-83675 dnaA
1996 CAMPNV010000008.1 GCA946891995_01000 gene open 84152-84286 rpmH
1997 CAMPNV010000008.1 GCA946891995_01001 gene open 84340-84708 rnpA
1998 CAMPNV010000008.1 GCA946891995_01002 gene open 84653-84859 yidD
1999 CAMPNV010000008.1 GCA946891995_01003 gene open 84870-85556 yidC
2000 CAMPNV010000008.1 GCA946891995_01004 gene open 85544-86233 jag