HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister micraerophilus (GCA_946892155.1)

Select a Genome:
BAKTA Annotations for GCA_946892155.1
Genome Selected: Dialister micraerophilus
ContigsBases CDSrRNA tmRNAtRNA
76 1242955 1162 0 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2433 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 2433 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAMPOI010000035.1 GCA946892155_00993 gene open 11063-11746
2002 CAMPOI010000035.1 GCA946892155_00994 gene open 12279-12716
2003 CAMPOI010000036.1 GCA946892155_00995 CDS open 373-672 _na     99_aa hypothetical protein
2004 CAMPOI010000036.1 GCA946892155_00997 CDS open 1048-2280 _na     410_aa Aluminum resistance protein
2005 CAMPOI010000036.1 GCA946892155_00998 CDS open 2281-3198 _na     305_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
2006 CAMPOI010000036.1 GCA946892155_00999 CDS open 3195-3962 _na     255_aa SAM-dependent methyltransferase
2007 CAMPOI010000036.1 GCA946892155_01000 CDS open 3959-5827 _na     622_aa mutL DNA mismatch repair endonuclease MutL
2008 CAMPOI010000036.1 GCA946892155_01001 CDS open 5827-8385 _na     852_aa mutS DNA mismatch repair protein MutS
2009 CAMPOI010000036.1 GCA946892155_01002 CDS open 8415-9758 _na     447_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
2010 CAMPOI010000036.1 GCA946892155_01003 CDS open 9847-10515 _na     222_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
2011 CAMPOI010000036.1 GCA946892155_01004 CDS open 10515-11132 _na     205_aa ABC transporter permease
2012 CAMPOI010000036.1 GCA946892155_00995 gene open 373-672
2013 CAMPOI010000036.1 GCA946892155_00997 gene open 1048-2280
2014 CAMPOI010000036.1 GCA946892155_00998 gene open 2281-3198 miaA
2015 CAMPOI010000036.1 GCA946892155_00999 gene open 3195-3962
2016 CAMPOI010000036.1 GCA946892155_01000 gene open 3959-5827 mutL
2017 CAMPOI010000036.1 GCA946892155_01001 gene open 5827-8385 mutS
2018 CAMPOI010000036.1 GCA946892155_01002 gene open 8415-9758 miaB
2019 CAMPOI010000036.1 GCA946892155_01003 gene open 9847-10515
2020 CAMPOI010000036.1 GCA946892155_01004 gene open 10515-11132
2021 CAMPOI010000036.1 GCA946892155_00996 gene open 942-1018 trnV
2022 CAMPOI010000036.1 GCA946892155_00996 tRNA open 942-1018 trnV tRNA-Val(gac)
2023 CAMPOI010000037.1 GCA946892155_01005 CDS open 61-1887 _na     608_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
2024 CAMPOI010000037.1 GCA946892155_01006 CDS open 1989-2567 _na     192_aa Yip1 domain-containing protein
2025 CAMPOI010000037.1 GCA946892155_01007 CDS open 2577-3527 _na     316_aa Signal peptide peptidase
2026 CAMPOI010000037.1 GCA946892155_01009 CDS open 3805-4575 _na     256_aa type III pantothenate kinase
2027 CAMPOI010000037.1 GCA946892155_01010 CDS open 4593-5573 _na     326_aa birA Bifunctional ligase/repressor BirA
2028 CAMPOI010000037.1 GCA946892155_01011 CDS open 5698-7062 _na     454_aa hslU ATP-dependent protease ATPase subunit HslU
2029 CAMPOI010000037.1 GCA946892155_01012 CDS open 7063-7593 _na     176_aa hslV ATP-dependent protease subunit HslV
2030 CAMPOI010000037.1 GCA946892155_01013 CDS open 7663-8958 _na     431_aa trmFO methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO
2031 CAMPOI010000037.1 GCA946892155_01014 CDS open 8983-10899 _na     638_aa topA type I DNA topoisomerase
2032 CAMPOI010000037.1 GCA946892155_01005 gene open 61-1887 glmS
2033 CAMPOI010000037.1 GCA946892155_01006 gene open 1989-2567
2034 CAMPOI010000037.1 GCA946892155_01007 gene open 2577-3527
2035 CAMPOI010000037.1 GCA946892155_01009 gene open 3805-4575
2036 CAMPOI010000037.1 GCA946892155_01010 gene open 4593-5573 birA
2037 CAMPOI010000037.1 GCA946892155_01011 gene open 5698-7062 hslU
2038 CAMPOI010000037.1 GCA946892155_01012 gene open 7063-7593 hslV
2039 CAMPOI010000037.1 GCA946892155_01013 gene open 7663-8958 trmFO
2040 CAMPOI010000037.1 GCA946892155_01014 gene open 8983-10899 topA
2041 CAMPOI010000037.1 GCA946892155_01008 gene open 3639-3714 trnE
2042 CAMPOI010000037.1 GCA946892155_01008 tRNA open 3639-3714 trnE tRNA-Glu(ctc)
2043 CAMPOI010000038.1 GCA946892155_01015 CDS open 360-860 _na     166_aa hypothetical protein
2044 CAMPOI010000038.1 GCA946892155_01016 CDS open 900-1349 _na     149_aa hypothetical protein
2045 CAMPOI010000038.1 GCA946892155_01017 CDS open 1989-2165 _na     58_aa hypothetical protein
2046 CAMPOI010000038.1 GCA946892155_01018 CDS open 5291-6190 _na     299_aa Acetamidase/formamidase
2047 CAMPOI010000038.1 GCA946892155_01019 CDS open 6449-6841 _na     130_aa Pyridoxamine 5'-phosphate oxidase
2048 CAMPOI010000038.1 GCA946892155_01020 CDS open 6974-7879 _na     301_aa Acetamidase/formamidase
2049 CAMPOI010000038.1 GCA946892155_01021 CDS open 7917-9362 _na     481_aa nhaC NhaC family sodium:proton (Na+:H+) antiporter
2050 CAMPOI010000038.1 GCA946892155_01015 gene open 360-860
2051 CAMPOI010000038.1 GCA946892155_01016 gene open 900-1349
2052 CAMPOI010000038.1 GCA946892155_01017 gene open 1989-2165
2053 CAMPOI010000038.1 GCA946892155_01018 gene open 5291-6190
2054 CAMPOI010000038.1 GCA946892155_01019 gene open 6449-6841
2055 CAMPOI010000038.1 GCA946892155_01020 gene open 6974-7879
2056 CAMPOI010000038.1 GCA946892155_01021 gene open 7917-9362 nhaC
2057 CAMPOI010000039.1 GCA946892155_01022 CDS open 178-1029 _na     283_aa degV DegV family protein
2058 CAMPOI010000039.1 GCA946892155_01023 CDS open 1044-1334 _na     96_aa hypothetical protein
2059 CAMPOI010000039.1 GCA946892155_01024 CDS open 1331-2611 _na     426_aa DAK2 domain protein
2060 CAMPOI010000039.1 GCA946892155_01025 CDS open 2672-3292 _na     206_aa cobC alpha-ribazole phosphatase
2061 CAMPOI010000039.1 GCA946892155_01026 CDS open 3375-4913 _na     512_aa ppx exopolyphosphatase
2062 CAMPOI010000039.1 GCA946892155_01027 CDS open 5057-6610 _na     517_aa Exopolyphosphatase
2063 CAMPOI010000039.1 GCA946892155_01028 CDS open 6613-8772 _na     719_aa ppk1 polyphosphate kinase 1
2064 CAMPOI010000039.1 GCA946892155_01029 CDS open 9157-10134 _na     325_aa 3D domain protein
2065 CAMPOI010000039.1 GCA946892155_01022 gene open 178-1029 degV
2066 CAMPOI010000039.1 GCA946892155_01023 gene open 1044-1334
2067 CAMPOI010000039.1 GCA946892155_01024 gene open 1331-2611
2068 CAMPOI010000039.1 GCA946892155_01025 gene open 2672-3292 cobC
2069 CAMPOI010000039.1 GCA946892155_01026 gene open 3375-4913 ppx
2070 CAMPOI010000039.1 GCA946892155_01027 gene open 5057-6610
2071 CAMPOI010000039.1 GCA946892155_01028 gene open 6613-8772 ppk1
2072 CAMPOI010000039.1 GCA946892155_01029 gene open 9157-10134
2073 CAMPOI010000040.1 GCA946892155_01030 CDS open 390-4874 _na     1494_aa S-layer-like y domain-containing protein
2074 CAMPOI010000040.1 GCA946892155_01031 CDS open 8809-9252 _na     147_aa hypothetical protein
2075 CAMPOI010000040.1 GCA946892155_01030 gene open 390-4874
2076 CAMPOI010000040.1 GCA946892155_01031 gene open 8809-9252
2077 CAMPOI010000041.1 GCA946892155_01032 CDS open 1248-1670 _na     140_aa hypothetical protein
2078 CAMPOI010000041.1 GCA946892155_01033 CDS open 2029-3483 _na     484_aa vanW VanW like protein
2079 CAMPOI010000041.1 GCA946892155_01034 CDS open 3480-4484 _na     334_aa holA DNA polymerase III subunit delta
2080 CAMPOI010000041.1 GCA946892155_01035 CDS open 4497-6680 _na     727_aa Competence protein EC
2081 CAMPOI010000041.1 GCA946892155_01036 CDS open 6677-7219 _na     180_aa ComEA protein
2082 CAMPOI010000041.1 GCA946892155_01037 CDS open 7265-7738 _na     157_aa ATPase subunit H
2083 CAMPOI010000041.1 GCA946892155_01038 CDS open 7749-8240 _na     163_aa coaD pantetheine-phosphate adenylyltransferase
2084 CAMPOI010000041.1 GCA946892155_01039 CDS open 8240-8800 _na     186_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
2085 CAMPOI010000041.1 GCA946892155_01040 CDS open 8797-9555 _na     252_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
2086 CAMPOI010000041.1 GCA946892155_01032 gene open 1248-1670
2087 CAMPOI010000041.1 GCA946892155_01033 gene open 2029-3483 vanW
2088 CAMPOI010000041.1 GCA946892155_01034 gene open 3480-4484 holA
2089 CAMPOI010000041.1 GCA946892155_01035 gene open 4497-6680
2090 CAMPOI010000041.1 GCA946892155_01036 gene open 6677-7219
2091 CAMPOI010000041.1 GCA946892155_01037 gene open 7265-7738
2092 CAMPOI010000041.1 GCA946892155_01038 gene open 7749-8240 coaD
2093 CAMPOI010000041.1 GCA946892155_01039 gene open 8240-8800 rsmD
2094 CAMPOI010000041.1 GCA946892155_01040 gene open 8797-9555
2095 CAMPOI010000042.1 GCA946892155_01041 CDS open 30-1361 _na     443_aa Aminopeptidase
2096 CAMPOI010000042.1 GCA946892155_01042 CDS open 1509-2765 _na     418_aa YadA-like family protein
2097 CAMPOI010000042.1 GCA946892155_01043 CDS open 3152-5572 _na     806_aa P-type Cu(+) transporter
2098 CAMPOI010000042.1 GCA946892155_01044 CDS open 5569-6360 _na     263_aa NH(3)-dependent NAD(+) synthetase
2099 CAMPOI010000042.1 GCA946892155_01045 CDS open 6419-7141 _na     240_aa Methyltransferase
2100 CAMPOI010000042.1 GCA946892155_01046 CDS open 7141-8868 _na     575_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
2101 CAMPOI010000042.1 GCA946892155_01047 CDS open 8991-9278 _na     95_aa MFS transporter
2102 CAMPOI010000042.1 GCA946892155_01041 gene open 30-1361
2103 CAMPOI010000042.1 GCA946892155_01042 gene open 1509-2765
2104 CAMPOI010000042.1 GCA946892155_01043 gene open 3152-5572
2105 CAMPOI010000042.1 GCA946892155_01044 gene open 5569-6360
2106 CAMPOI010000042.1 GCA946892155_01045 gene open 6419-7141
2107 CAMPOI010000042.1 GCA946892155_01046 gene open 7141-8868
2108 CAMPOI010000042.1 GCA946892155_01047 gene open 8991-9278
2109 CAMPOI010000043.1 GCA946892155_01048 CDS open 55-609 _na     184_aa hypothetical protein
2110 CAMPOI010000043.1 GCA946892155_01049 CDS open 688-2109 _na     473_aa APC family amino acid transporter
2111 CAMPOI010000043.1 GCA946892155_01050 CDS open 2137-3531 _na     464_aa Na+/H+ antiporter
2112 CAMPOI010000043.1 GCA946892155_01051 CDS open 3640-4095 _na     151_aa Hut operon positive regulatory protein
2113 CAMPOI010000043.1 GCA946892155_01052 CDS open 4542-6416 _na     624_aa tdc tyrosine decarboxylase
2114 CAMPOI010000043.1 GCA946892155_01053 CDS open 6506-7915 _na     469_aa APC family amino acid transporter
2115 CAMPOI010000043.1 GCA946892155_01054 CDS open 8040-8468 _na     142_aa hutP HutP family protein
2116 CAMPOI010000043.1 GCA946892155_01048 gene open 55-609
2117 CAMPOI010000043.1 GCA946892155_01049 gene open 688-2109
2118 CAMPOI010000043.1 GCA946892155_01050 gene open 2137-3531
2119 CAMPOI010000043.1 GCA946892155_01051 gene open 3640-4095
2120 CAMPOI010000043.1 GCA946892155_01052 gene open 4542-6416 tdc
2121 CAMPOI010000043.1 GCA946892155_01053 gene open 6506-7915
2122 CAMPOI010000043.1 GCA946892155_01054 gene open 8040-8468 hutP
2123 CAMPOI010000044.1 GCA946892155_01055 CDS open 374-529 _na     51_aa hypothetical protein
2124 CAMPOI010000044.1 GCA946892155_01056 CDS open 652-1686 _na     344_aa aspartate-semialdehyde dehydrogenase
2125 CAMPOI010000044.1 GCA946892155_01057 CDS open 1698-2483 _na     261_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
2126 CAMPOI010000044.1 GCA946892155_01058 CDS open 2485-4161 _na     558_aa recN DNA repair protein RecN
2127 CAMPOI010000044.1 GCA946892155_01059 CDS open 4172-4645 _na     157_aa argR arginine repressor
2128 CAMPOI010000044.1 GCA946892155_01060 CDS open 4734-5594 _na     286_aa NAD kinase
2129 CAMPOI010000044.1 GCA946892155_01061 CDS open 5591-6427 _na     278_aa Ribosomal RNA large subunit methyltransferase J
2130 CAMPOI010000044.1 GCA946892155_01062 CDS open 6441-7295 _na     284_aa Geranyltranstransferase
2131 CAMPOI010000044.1 GCA946892155_01063 CDS open 7252-7515 _na     87_aa xseB exodeoxyribonuclease VII small subunit
2132 CAMPOI010000044.1 GCA946892155_01064 CDS open 7527-8075 _na     182_aa hypothetical protein
2133 CAMPOI010000044.1 GCA946892155_01055 gene open 374-529
2134 CAMPOI010000044.1 GCA946892155_01056 gene open 652-1686
2135 CAMPOI010000044.1 GCA946892155_01057 gene open 1698-2483 dapB
2136 CAMPOI010000044.1 GCA946892155_01058 gene open 2485-4161 recN
2137 CAMPOI010000044.1 GCA946892155_01059 gene open 4172-4645 argR
2138 CAMPOI010000044.1 GCA946892155_01060 gene open 4734-5594
2139 CAMPOI010000044.1 GCA946892155_01061 gene open 5591-6427
2140 CAMPOI010000044.1 GCA946892155_01062 gene open 6441-7295
2141 CAMPOI010000044.1 GCA946892155_01063 gene open 7252-7515 xseB
2142 CAMPOI010000044.1 GCA946892155_01064 gene open 7527-8075
2143 CAMPOI010000045.1 GCA946892155_01065 CDS open 331-1641 _na     436_aa potE putrescine-ornithine antiporter
2144 CAMPOI010000045.1 GCA946892155_01066 CDS open 1749-2360 _na     203_aa HTH tetR-type domain-containing protein
2145 CAMPOI010000045.1 GCA946892155_01067 CDS open 2372-2935 _na     187_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
2146 CAMPOI010000045.1 GCA946892155_01068 CDS open 3183-3425 _na     80_aa 50S ribosomal protein L7/L12
2147 CAMPOI010000045.1 GCA946892155_01069 CDS open 3501-3875 _na     124_aa rpsL 30S ribosomal protein S12
2148 CAMPOI010000045.1 GCA946892155_01070 CDS open 3912-4382 _na     156_aa rpsG 30S ribosomal protein S7
2149 CAMPOI010000045.1 GCA946892155_01071 CDS open 4401-6476 _na     691_aa fusA elongation factor G
2150 CAMPOI010000045.1 GCA946892155_01072 CDS open 6501-7688 _na     395_aa tuf elongation factor Tu
2151 CAMPOI010000045.1 GCA946892155_01065 gene open 331-1641 potE
2152 CAMPOI010000045.1 GCA946892155_01066 gene open 1749-2360
2153 CAMPOI010000045.1 GCA946892155_01067 gene open 2372-2935
2154 CAMPOI010000045.1 GCA946892155_01068 gene open 3183-3425
2155 CAMPOI010000045.1 GCA946892155_01069 gene open 3501-3875 rpsL
2156 CAMPOI010000045.1 GCA946892155_01070 gene open 3912-4382 rpsG
2157 CAMPOI010000045.1 GCA946892155_01071 gene open 4401-6476 fusA
2158 CAMPOI010000045.1 GCA946892155_01072 gene open 6501-7688 tuf
2159 CAMPOI010000046.1 GCA946892155_01073 CDS open 19-447 _na     142_aa eamA EamA domain-containing protein
2160 CAMPOI010000046.1 GCA946892155_01074 CDS open 872-2128 _na     418_aa hisS histidine--tRNA ligase
2161 CAMPOI010000046.1 GCA946892155_01075 CDS open 2279-5503 _na     1074_aa Helicase domain/SNF2 family domain protein
2162 CAMPOI010000046.1 GCA946892155_01076 CDS open 5496-6092 _na     198_aa DUF4391 domain-containing protein
2163 CAMPOI010000046.1 GCA946892155_01077 CDS open 7229-7663 _na     144_aa hypothetical protein
2164 CAMPOI010000046.1 GCA946892155_01073 gene open 19-447 eamA
2165 CAMPOI010000046.1 GCA946892155_01074 gene open 872-2128 hisS
2166 CAMPOI010000046.1 GCA946892155_01075 gene open 2279-5503
2167 CAMPOI010000046.1 GCA946892155_01076 gene open 5496-6092
2168 CAMPOI010000046.1 GCA946892155_01077 gene open 7229-7663
2169 CAMPOI010000047.1 GCA946892155_01078 CDS open 69-2882 _na     937_aa ileS isoleucine--tRNA ligase
2170 CAMPOI010000047.1 GCA946892155_01079 CDS open 3157-4353 _na     398_aa MFS family major facilitator transporter
2171 CAMPOI010000047.1 GCA946892155_01080 CDS open 4447-5316 _na     289_aa jag RNA-binding cell elongation regulator Jag/EloR
2172 CAMPOI010000047.1 GCA946892155_01081 CDS open 5313-6113 _na     266_aa ParB/SpoJ family partitioning protein
2173 CAMPOI010000047.1 GCA946892155_01082 CDS open 6221-6430 _na     69_aa yidD membrane protein insertion efficiency factor YidD
2174 CAMPOI010000047.1 GCA946892155_01083 CDS open 6427-6810 _na     127_aa rnpA ribonuclease P protein component
2175 CAMPOI010000047.1 GCA946892155_01084 CDS open 6803-6940 _na     45_aa rpmH 50S ribosomal protein L34
2176 CAMPOI010000047.1 GCA946892155_01085 CDS open 7054-7254 _na     66_aa hypothetical protein
2177 CAMPOI010000047.1 GCA946892155_01078 gene open 69-2882 ileS
2178 CAMPOI010000047.1 GCA946892155_01079 gene open 3157-4353
2179 CAMPOI010000047.1 GCA946892155_01080 gene open 4447-5316 jag
2180 CAMPOI010000047.1 GCA946892155_01081 gene open 5313-6113
2181 CAMPOI010000047.1 GCA946892155_01082 gene open 6221-6430 yidD
2182 CAMPOI010000047.1 GCA946892155_01083 gene open 6427-6810 rnpA
2183 CAMPOI010000047.1 GCA946892155_01084 gene open 6803-6940 rpmH
2184 CAMPOI010000047.1 GCA946892155_01085 gene open 7054-7254
2185 CAMPOI010000048.1 GCA946892155_01086 CDS open 6-479 _na     157_aa hypothetical protein
2186 CAMPOI010000048.1 GCA946892155_01087 CDS open 344-979 _na     211_aa CBS domain protein
2187 CAMPOI010000048.1 GCA946892155_01088 CDS open 1013-3391 _na     792_aa ppsA phosphoenolpyruvate synthase
2188 CAMPOI010000048.1 GCA946892155_01089 CDS open 3693-3908 _na     71_aa Phage protein
2189 CAMPOI010000048.1 GCA946892155_01090 CDS open 3926-5734 _na     602_aa AIPR family protein
2190 CAMPOI010000048.1 GCA946892155_01091 CDS open 5910-6635 _na     241_aa putative membrane transporter protein
2191 CAMPOI010000048.1 GCA946892155_01086 gene open 6-479
2192 CAMPOI010000048.1 GCA946892155_01087 gene open 344-979
2193 CAMPOI010000048.1 GCA946892155_01088 gene open 1013-3391 ppsA
2194 CAMPOI010000048.1 GCA946892155_01089 gene open 3693-3908
2195 CAMPOI010000048.1 GCA946892155_01090 gene open 3926-5734
2196 CAMPOI010000048.1 GCA946892155_01091 gene open 5910-6635
2197 CAMPOI010000048.1 GCA946892155_01092 gene open 7106-7179 trnQ
2198 CAMPOI010000048.1 GCA946892155_01092 tRNA open 7106-7179 trnQ tRNA-Gln(ttg)
2199 CAMPOI010000049.1 regulatory_region open 5425-5619 T-box leader
2200 CAMPOI010000049.1 GCA946892155_01093 CDS open 99-398 _na     99_aa hypothetical protein
2201 CAMPOI010000049.1 GCA946892155_01094 CDS open 1160-1642 _na     160_aa S-adenosylmethionine decarboxylase proenzyme
2202 CAMPOI010000049.1 GCA946892155_01095 CDS open 1688-4159 _na     823_aa pheT phenylalanine--tRNA ligase subunit beta
2203 CAMPOI010000049.1 GCA946892155_01096 CDS open 4176-5381 _na     401_aa pheS phenylalanine--tRNA ligase subunit alpha
2204 CAMPOI010000049.1 GCA946892155_01097 CDS open 5628-6764 _na     378_aa Acyl-CoA dehydrogenase
2205 CAMPOI010000049.1 GCA946892155_01093 gene open 99-398
2206 CAMPOI010000049.1 GCA946892155_01094 gene open 1160-1642
2207 CAMPOI010000049.1 GCA946892155_01095 gene open 1688-4159 pheT
2208 CAMPOI010000049.1 GCA946892155_01096 gene open 4176-5381 pheS
2209 CAMPOI010000049.1 GCA946892155_01097 gene open 5628-6764
2210 CAMPOI010000050.1 GCA946892155_01098 CDS open 1202-1774 _na     190_aa hypothetical protein
2211 CAMPOI010000050.1 GCA946892155_01099 CDS open 1792-2061 _na     89_aa DUF4321 domain-containing protein
2212 CAMPOI010000050.1 GCA946892155_01100 CDS open 2033-2773 _na     246_aa radC DNA repair protein RadC
2213 CAMPOI010000050.1 GCA946892155_01101 CDS open 2892-4994 _na     700_aa uvrB excinuclease ABC subunit UvrB
2214 CAMPOI010000050.1 GCA946892155_01102 CDS open 5561-5878 _na     105_aa hypothetical protein
2215 CAMPOI010000050.1 GCA946892155_01098 gene open 1202-1774
2216 CAMPOI010000050.1 GCA946892155_01099 gene open 1792-2061
2217 CAMPOI010000050.1 GCA946892155_01100 gene open 2033-2773 radC
2218 CAMPOI010000050.1 GCA946892155_01101 gene open 2892-4994 uvrB
2219 CAMPOI010000050.1 GCA946892155_01102 gene open 5561-5878
2220 CAMPOI010000051.1 GCA946892155_01103 CDS open 525-1295 _na     256_aa tatD Deoxyribonuclease TatD
2221 CAMPOI010000051.1 GCA946892155_01104 CDS open 1304-2683 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2222 CAMPOI010000051.1 GCA946892155_01105 CDS open 3094-4167 _na     357_aa Zinc ABC superfamily ATP binding cassette transporter%2C binding protein
2223 CAMPOI010000051.1 GCA946892155_01106 CDS open 4167-4877 _na     236_aa Zinc ABC superfamily ATP binding cassette transporter%2C ABC protein
2224 CAMPOI010000051.1 GCA946892155_01107 CDS open 4877-5695 _na     272_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
2225 CAMPOI010000051.1 GCA946892155_01108 CDS open 5695-6306 _na     203_aa DUF1980 domain-containing protein
2226 CAMPOI010000051.1 GCA946892155_01103 gene open 525-1295 tatD
2227 CAMPOI010000051.1 GCA946892155_01104 gene open 1304-2683 mnmE
2228 CAMPOI010000051.1 GCA946892155_01105 gene open 3094-4167
2229 CAMPOI010000051.1 GCA946892155_01106 gene open 4167-4877
2230 CAMPOI010000051.1 GCA946892155_01107 gene open 4877-5695
2231 CAMPOI010000051.1 GCA946892155_01108 gene open 5695-6306
2232 CAMPOI010000052.1 repeat_region open 214-654 CRISPR array with 7 repeats of length 36%2C consensus sequence GTTTTAGACATCTGTTGGATATAGGTAAACTGATAC and spacer length 30
2233 CAMPOI010000052.1 GCA946892155_01109 CDS open 797-1072 _na     91_aa hypothetical protein
2234 CAMPOI010000052.1 GCA946892155_01110 CDS open 1069-1626 _na     185_aa hypothetical protein
2235 CAMPOI010000052.1 GCA946892155_01111 CDS open 1755-2108 _na     117_aa hypothetical protein
2236 CAMPOI010000052.1 GCA946892155_01112 CDS open 2236-3636 _na     466_aa FAD dependent oxidoreductase
2237 CAMPOI010000052.1 GCA946892155_01113 CDS open 3629-4921 _na     430_aa purB adenylosuccinate lyase
2238 CAMPOI010000052.1 GCA946892155_01114 CDS open 4938-6227 _na     429_aa adenylosuccinate synthase
2239 CAMPOI010000052.1 GCA946892155_01109 gene open 797-1072
2240 CAMPOI010000052.1 GCA946892155_01110 gene open 1069-1626
2241 CAMPOI010000052.1 GCA946892155_01111 gene open 1755-2108
2242 CAMPOI010000052.1 GCA946892155_01112 gene open 2236-3636
2243 CAMPOI010000052.1 GCA946892155_01113 gene open 3629-4921 purB
2244 CAMPOI010000052.1 GCA946892155_01114 gene open 4938-6227
2245 CAMPOI010000053.1 GCA946892155_01115 CDS open 1062-3500 _na     812_aa TonB-dependent siderophore receptor
2246 CAMPOI010000053.1 GCA946892155_01116 CDS open 3715-5832 _na     705_aa TonB-dependent receptor
2247 CAMPOI010000053.1 GCA946892155_01115 gene open 1062-3500
2248 CAMPOI010000053.1 GCA946892155_01116 gene open 3715-5832
2249 CAMPOI010000054.1 GCA946892155_01117 CDS open 43-339 _na     98_aa hypothetical protein
2250 CAMPOI010000054.1 GCA946892155_01118 CDS open 501-1187 _na     228_aa AAA family ATPase
2251 CAMPOI010000054.1 GCA946892155_01119 CDS open 1194-1418 _na     74_aa hypothetical protein
2252 CAMPOI010000054.1 GCA946892155_01120 CDS open 1985-2383 _na     132_aa tnpA IS200/IS605 family transposase
2253 CAMPOI010000054.1 GCA946892155_01121 CDS open 2389-3495 _na     368_aa tnpB IS200/IS605 family element RNA-guided endonuclease TnpB
2254 CAMPOI010000054.1 GCA946892155_01122 CDS open 3624-4148 _na     174_aa Fic family protein
2255 CAMPOI010000054.1 GCA946892155_01123 CDS open 4159-4383 _na     74_aa parG plasmid partition protein ParG
2256 CAMPOI010000054.1 GCA946892155_01124 CDS open 5118-5735 _na     205_aa recombinase family protein
2257 CAMPOI010000054.1 GCA946892155_01117 gene open 43-339
2258 CAMPOI010000054.1 GCA946892155_01118 gene open 501-1187
2259 CAMPOI010000054.1 GCA946892155_01119 gene open 1194-1418
2260 CAMPOI010000054.1 GCA946892155_01120 gene open 1985-2383 tnpA
2261 CAMPOI010000054.1 GCA946892155_01121 gene open 2389-3495 tnpB
2262 CAMPOI010000054.1 GCA946892155_01122 gene open 3624-4148
2263 CAMPOI010000054.1 GCA946892155_01123 gene open 4159-4383 parG
2264 CAMPOI010000054.1 GCA946892155_01124 gene open 5118-5735
2265 CAMPOI010000055.1 GCA946892155_01125 CDS open 224-2818 _na     864_aa Cd(2+)-exporting ATPase
2266 CAMPOI010000055.1 GCA946892155_01126 CDS open 3006-4541 _na     511_aa DUF4127 domain-containing protein
2267 CAMPOI010000055.1 GCA946892155_01127 CDS open 4590-4874 _na     94_aa rpmA 50S ribosomal protein L27
2268 CAMPOI010000055.1 GCA946892155_01128 CDS open 4880-5209 _na     109_aa Ribosomal processing cysteine protease Prp
2269 CAMPOI010000055.1 GCA946892155_01129 CDS open 5209-5517 _na     102_aa rplU 50S ribosomal protein L21
2270 CAMPOI010000055.1 GCA946892155_01130 CDS open 5664-5909 _na     81_aa hypothetical protein
2271 CAMPOI010000055.1 GCA946892155_01125 gene open 224-2818
2272 CAMPOI010000055.1 GCA946892155_01126 gene open 3006-4541
2273 CAMPOI010000055.1 GCA946892155_01127 gene open 4590-4874 rpmA
2274 CAMPOI010000055.1 GCA946892155_01128 gene open 4880-5209
2275 CAMPOI010000055.1 GCA946892155_01129 gene open 5209-5517 rplU
2276 CAMPOI010000055.1 GCA946892155_01130 gene open 5664-5909
2277 CAMPOI010000056.1 GCA946892155_01131 CDS open 1-291 _na     96_aa hypothetical protein
2278 CAMPOI010000056.1 GCA946892155_01132 CDS open 291-1220 _na     309_aa pstA phosphate ABC transporter permease PstA
2279 CAMPOI010000056.1 GCA946892155_01133 CDS open 1220-2005 _na     261_aa pstB phosphate ABC transporter ATP-binding protein PstB
2280 CAMPOI010000056.1 GCA946892155_01134 CDS open 2041-2745 _na     234_aa Phosphate regulon response regulator
2281 CAMPOI010000056.1 GCA946892155_01135 CDS open 2742-4694 _na     650_aa histidine kinase
2282 CAMPOI010000056.1 GCA946892155_01136 CDS open 5119-5310 _na     63_aa hypothetical protein
2283 CAMPOI010000056.1 GCA946892155_01131 gene open 1-291
2284 CAMPOI010000056.1 GCA946892155_01132 gene open 291-1220 pstA
2285 CAMPOI010000056.1 GCA946892155_01133 gene open 1220-2005 pstB
2286 CAMPOI010000056.1 GCA946892155_01134 gene open 2041-2745
2287 CAMPOI010000056.1 GCA946892155_01135 gene open 2742-4694
2288 CAMPOI010000056.1 GCA946892155_01136 gene open 5119-5310
2289 CAMPOI010000057.1 GCA946892155_01137 CDS open 309-812 _na     167_aa thiW energy coupling factor transporter S component ThiW
2290 CAMPOI010000057.1 GCA946892155_01138 CDS open 1438-3087 _na     549_aa SLH domain-containing protein
2291 CAMPOI010000057.1 GCA946892155_01139 CDS open 3088-3267 _na     59_aa hypothetical protein
2292 CAMPOI010000057.1 GCA946892155_01140 CDS open 3213-3908 _na     231_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2293 CAMPOI010000057.1 GCA946892155_01141 CDS open 3905-5305 _na     466_aa mnmG tRNA uridine 5-carboxymethylaminomethyl modification enzyme MnmG
2294 CAMPOI010000057.1 GCA946892155_01137 gene open 309-812 thiW
2295 CAMPOI010000057.1 GCA946892155_01138 gene open 1438-3087
2296 CAMPOI010000057.1 GCA946892155_01139 gene open 3088-3267
2297 CAMPOI010000057.1 GCA946892155_01140 gene open 3213-3908 rsmG
2298 CAMPOI010000057.1 GCA946892155_01141 gene open 3905-5305 mnmG
2299 CAMPOI010000058.1 GCA946892155_01142 CDS open 1132-1893 _na     253_aa tpiA triose-phosphate isomerase
2300 CAMPOI010000058.1 GCA946892155_01143 CDS open 1899-3083 _na     394_aa Phosphoglycerate kinase
2301 CAMPOI010000058.1 GCA946892155_01144 CDS open 3087-4094 _na     335_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
2302 CAMPOI010000058.1 GCA946892155_01142 gene open 1132-1893 tpiA
2303 CAMPOI010000058.1 GCA946892155_01143 gene open 1899-3083
2304 CAMPOI010000058.1 GCA946892155_01144 gene open 3087-4094 gap
2305 CAMPOI010000059.1 GCA946892155_01145 CDS open 514-1170 _na     218_aa YadA-like family protein
2306 CAMPOI010000059.1 GCA946892155_01146 CDS open 1253-3376 _na     707_aa DNA topoisomerase 3
2307 CAMPOI010000059.1 GCA946892155_01147 CDS open 3373-3567 _na     64_aa hypothetical protein
2308 CAMPOI010000059.1 GCA946892155_01148 CDS open 3662-4372 _na     236_aa hypothetical protein
2309 CAMPOI010000059.1 GCA946892155_01145 gene open 514-1170
2310 CAMPOI010000059.1 GCA946892155_01146 gene open 1253-3376
2311 CAMPOI010000059.1 GCA946892155_01147 gene open 3373-3567
2312 CAMPOI010000059.1 GCA946892155_01148 gene open 3662-4372
2313 CAMPOI010000060.1 GCA946892155_01149 CDS open 516-1025 _na     169_aa DUF304 domain-containing protein
2314 CAMPOI010000060.1 GCA946892155_01150 CDS open 1030-4641 _na     1203_aa phosphoribosylformylglycinamidine synthase
2315 CAMPOI010000060.1 GCA946892155_01149 gene open 516-1025
2316 CAMPOI010000060.1 GCA946892155_01150 gene open 1030-4641
2317 CAMPOI010000061.1 GCA946892155_01151 CDS open 224-667 _na     147_aa hypothetical protein
2318 CAMPOI010000061.1 GCA946892155_01152 CDS open 1732-2139 _na     135_aa Heat shock protein Hsp20
2319 CAMPOI010000061.1 GCA946892155_01153 CDS open 2364-3221 _na     285_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
2320 CAMPOI010000061.1 GCA946892155_01154 CDS open 3218-3652 _na     144_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2321 CAMPOI010000061.1 GCA946892155_01155 CDS open 3757-4569 _na     270_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2322 CAMPOI010000061.1 GCA946892155_01151 gene open 224-667
2323 CAMPOI010000061.1 GCA946892155_01152 gene open 1732-2139
2324 CAMPOI010000061.1 GCA946892155_01153 gene open 2364-3221 lpxC
2325 CAMPOI010000061.1 GCA946892155_01154 gene open 3218-3652 fabZ
2326 CAMPOI010000061.1 GCA946892155_01155 gene open 3757-4569 lpxA
2327 CAMPOI010000062.1 GCA946892155_01157 CDS open 361-1020 _na     219_aa Formiminotransferase-cyclodeaminase superfamily protein
2328 CAMPOI010000062.1 GCA946892155_01158 CDS open 1029-1601 _na     190_aa xanthine phosphoribosyltransferase
2329 CAMPOI010000062.1 GCA946892155_01159 CDS open 1602-2522 _na     306_aa mmuM homocysteine S-methyltransferase
2330 CAMPOI010000062.1 GCA946892155_01160 CDS open 3187-4518 _na     443_aa brnQ branched-chain amino acid transport system II carrier protein
2331 CAMPOI010000062.1 GCA946892155_01157 gene open 361-1020
2332 CAMPOI010000062.1 GCA946892155_01158 gene open 1029-1601
2333 CAMPOI010000062.1 GCA946892155_01159 gene open 1602-2522 mmuM
2334 CAMPOI010000062.1 GCA946892155_01160 gene open 3187-4518 brnQ
2335 CAMPOI010000062.1 GCA946892155_01156 gene open 6-81 trnH
2336 CAMPOI010000062.1 GCA946892155_01156 tRNA open 6-81 trnH tRNA-His(gtg)
2337 CAMPOI010000063.1 GCA946892155_01161 CDS open 475-1431 _na     318_aa N(6)-L-threonylcarbamoyladenine synthase
2338 CAMPOI010000063.1 GCA946892155_01162 CDS open 1424-1825 _na     133_aa nusB transcription antitermination factor NusB
2339 CAMPOI010000063.1 GCA946892155_01163 CDS open 1835-2176 _na     113_aa Asp23/Gls24 family envelope stress response protein
2340 CAMPOI010000063.1 GCA946892155_01164 CDS open 2192-2539 _na     115_aa Asp23/Gls24 family envelope stress response protein
2341 CAMPOI010000063.1 GCA946892155_01165 CDS open 2547-3107 _na     186_aa efp elongation factor P
2342 CAMPOI010000063.1 GCA946892155_01166 CDS open 3120-4175 _na     351_aa Xaa-Pro dipeptidase
2343 CAMPOI010000063.1 GCA946892155_01161 gene open 475-1431
2344 CAMPOI010000063.1 GCA946892155_01162 gene open 1424-1825 nusB
2345 CAMPOI010000063.1 GCA946892155_01163 gene open 1835-2176
2346 CAMPOI010000063.1 GCA946892155_01164 gene open 2192-2539
2347 CAMPOI010000063.1 GCA946892155_01165 gene open 2547-3107 efp
2348 CAMPOI010000063.1 GCA946892155_01166 gene open 3120-4175
2349 CAMPOI010000064.1 GCA946892155_01167 CDS open 226-648 _na     140_aa yajC preprotein translocase subunit YajC
2350 CAMPOI010000064.1 GCA946892155_01168 CDS open 648-1229 _na     193_aa 5-formyltetrahydrofolate cyclo-ligase
2351 CAMPOI010000064.1 GCA946892155_01169 CDS open 1216-2490 _na     424_aa secD Protein translocase subunit SecD
2352 CAMPOI010000064.1 GCA946892155_01170 CDS open 2487-3368 _na     293_aa secF Protein-export membrane protein SecF
2353 CAMPOI010000064.1 GCA946892155_01171 CDS open 3933-4235 _na     100_aa hypothetical protein
2354 CAMPOI010000064.1 GCA946892155_01167 gene open 226-648 yajC
2355 CAMPOI010000064.1 GCA946892155_01168 gene open 648-1229
2356 CAMPOI010000064.1 GCA946892155_01169 gene open 1216-2490 secD
2357 CAMPOI010000064.1 GCA946892155_01170 gene open 2487-3368 secF
2358 CAMPOI010000064.1 GCA946892155_01171 gene open 3933-4235
2359 CAMPOI010000065.1 GCA946892155_01172 CDS open 142-1107 _na     321_aa Phosphatidate cytidylyltransferase
2360 CAMPOI010000065.1 GCA946892155_01173 CDS open 1516-2076 _na     186_aa nicotinamidase
2361 CAMPOI010000065.1 GCA946892155_01174 CDS open 2076-3074 _na     332_aa thiL thiamine-phosphate kinase
2362 CAMPOI010000065.1 GCA946892155_01175 CDS open 3098-3844 _na     248_aa gpmA 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase
2363 CAMPOI010000065.1 GCA946892155_01172 gene open 142-1107
2364 CAMPOI010000065.1 GCA946892155_01173 gene open 1516-2076
2365 CAMPOI010000065.1 GCA946892155_01174 gene open 2076-3074 thiL
2366 CAMPOI010000065.1 GCA946892155_01175 gene open 3098-3844 gpmA
2367 CAMPOI010000066.1 GCA946892155_01176 CDS open 67-1281 _na     404_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
2368 CAMPOI010000066.1 GCA946892155_01177 CDS open 1281-1982 _na     233_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
2369 CAMPOI010000066.1 GCA946892155_01178 CDS open 1984-3063 _na     359_aa Efflux transporter%2C RND family%2C MFP subunit
2370 CAMPOI010000066.1 GCA946892155_01179 CDS open 3179-4081 _na     300_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
2371 CAMPOI010000066.1 GCA946892155_01176 gene open 67-1281
2372 CAMPOI010000066.1 GCA946892155_01177 gene open 1281-1982
2373 CAMPOI010000066.1 GCA946892155_01178 gene open 1984-3063
2374 CAMPOI010000066.1 GCA946892155_01179 gene open 3179-4081 rsmA
2375 CAMPOI010000067.1 GCA946892155_01182 gene open 1469-1810 ssrA
2376 CAMPOI010000067.1 GCA946892155_01182 tmRNA open 1469-1810 ssrA transfer-messenger RNA%2C SsrA
2377 CAMPOI010000067.1 GCA946892155_01180 CDS open 56-487 _na     143_aa lspA signal peptidase II
2378 CAMPOI010000067.1 GCA946892155_01181 CDS open 487-1410 _na     307_aa Pseudouridine synthase
2379 CAMPOI010000067.1 GCA946892155_01183 CDS open 1909-2226 _na     105_aa Thioredoxin
2380 CAMPOI010000067.1 GCA946892155_01184 CDS open 2296-3099 _na     267_aa thiM hydroxyethylthiazole kinase
2381 CAMPOI010000067.1 GCA946892155_01185 CDS open 3089-3727 _na     212_aa Thiamine-phosphate synthase
2382 CAMPOI010000067.1 GCA946892155_01180 gene open 56-487 lspA
2383 CAMPOI010000067.1 GCA946892155_01181 gene open 487-1410
2384 CAMPOI010000067.1 GCA946892155_01183 gene open 1909-2226
2385 CAMPOI010000067.1 GCA946892155_01184 gene open 2296-3099 thiM
2386 CAMPOI010000067.1 GCA946892155_01185 gene open 3089-3727
2387 CAMPOI010000068.1 GCA946892155_01186 CDS open 438-1271 _na     277_aa hypothetical protein
2388 CAMPOI010000068.1 GCA946892155_01187 CDS open 2107-2439 _na     110_aa B-glycosyltransferase
2389 CAMPOI010000068.1 GCA946892155_01186 gene open 438-1271
2390 CAMPOI010000068.1 GCA946892155_01187 gene open 2107-2439
2391 CAMPOI010000069.1 GCA946892155_01188 CDS open 28-660 _na     210_aa Ribokinase
2392 CAMPOI010000069.1 GCA946892155_01189 CDS open 648-1052 _na     134_aa rbsD D-ribose pyranase
2393 CAMPOI010000069.1 GCA946892155_01190 CDS open 1101-2567 _na     488_aa ccmA heme ABC exporter ATP-binding protein CcmA
2394 CAMPOI010000069.1 GCA946892155_01191 CDS open 2569-3459 _na     296_aa Ribose ABC superfamily ATP binding cassette transporter%2C permease protein
2395 CAMPOI010000069.1 GCA946892155_01188 gene open 28-660
2396 CAMPOI010000069.1 GCA946892155_01189 gene open 648-1052 rbsD
2397 CAMPOI010000069.1 GCA946892155_01190 gene open 1101-2567 ccmA
2398 CAMPOI010000069.1 GCA946892155_01191 gene open 2569-3459
2399 CAMPOI010000070.1 regulatory_region open 3352-3441 Glycine riboswitch aptamer
2400 CAMPOI010000070.1 GCA946892155_01192 CDS open 352-1590 _na     412_aa DAACS family dicarboxylate/amino acid:cation symporter
2401 CAMPOI010000070.1 GCA946892155_01193 CDS open 1902-3257 _na     451_aa AGCS family alanine:sodium (Na+) symporter
2402 CAMPOI010000070.1 GCA946892155_01192 gene open 352-1590
2403 CAMPOI010000070.1 GCA946892155_01193 gene open 1902-3257
2404 CAMPOI010000071.1 GCA946892155_01194 CDS open 64-3150 _na     1028_aa Type III restriction-modification system%2C res subunit
2405 CAMPOI010000071.1 GCA946892155_01194 gene open 64-3150
2406 CAMPOI010000072.1 GCA946892155_01195 CDS open 40-1257 _na     405_aa argS arginine--tRNA ligase
2407 CAMPOI010000072.1 GCA946892155_01196 CDS open 1268-2884 _na     538_aa CTP synthase
2408 CAMPOI010000072.1 GCA946892155_01195 gene open 40-1257 argS
2409 CAMPOI010000072.1 GCA946892155_01196 gene open 1268-2884
2410 CAMPOI010000073.1 GCA946892155_01197 CDS open 295-855 _na     186_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
2411 CAMPOI010000073.1 GCA946892155_01198 CDS open 867-2198 _na     443_aa der ribosome biogenesis GTPase Der
2412 CAMPOI010000073.1 GCA946892155_01199 CDS open 2373-3446 _na     357_aa 30S ribosomal protein S1
2413 CAMPOI010000073.1 GCA946892155_01197 gene open 295-855 plsY
2414 CAMPOI010000073.1 GCA946892155_01198 gene open 867-2198 der
2415 CAMPOI010000073.1 GCA946892155_01199 gene open 2373-3446
2416 CAMPOI010000074.1 GCA946892155_01200 CDS open 191-745 _na     184_aa lepB signal peptidase I
2417 CAMPOI010000074.1 GCA946892155_01201 CDS open 810-2048 _na     412_aa LL-diaminopimelate aminotransferase
2418 CAMPOI010000074.1 GCA946892155_01202 CDS open 2052-3158 _na     368_aa ychF redox-regulated ATPase YchF
2419 CAMPOI010000074.1 GCA946892155_01200 gene open 191-745 lepB
2420 CAMPOI010000074.1 GCA946892155_01201 gene open 810-2048
2421 CAMPOI010000074.1 GCA946892155_01202 gene open 2052-3158 ychF
2422 CAMPOI010000075.1 GCA946892155_01203 CDS open 497-910 _na     137_aa DUF4418 domain-containing protein
2423 CAMPOI010000075.1 GCA946892155_01204 CDS open 1008-1844 _na     278_aa ATPase AAA-type core domain-containing protein
2424 CAMPOI010000075.1 GCA946892155_01205 CDS open 1868-2770 _na     300_aa murB UDP-N-acetylmuramate dehydrogenase
2425 CAMPOI010000075.1 GCA946892155_01206 CDS open 2889-3254 _na     121_aa hypothetical protein
2426 CAMPOI010000075.1 GCA946892155_01203 gene open 497-910
2427 CAMPOI010000075.1 GCA946892155_01204 gene open 1008-1844
2428 CAMPOI010000075.1 GCA946892155_01205 gene open 1868-2770 murB
2429 CAMPOI010000075.1 GCA946892155_01206 gene open 2889-3254
2430 CAMPOI010000076.1 GCA946892155_01207 CDS open 156-713 _na     185_aa Amino acid permease
2431 CAMPOI010000076.1 GCA946892155_01208 CDS open 769-2565 _na     598_aa lepA translation elongation factor 4
2432 CAMPOI010000076.1 GCA946892155_01207 gene open 156-713
2433 CAMPOI010000076.1 GCA946892155_01208 gene open 769-2565 lepA