HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister micraerophilus (GCA_946892155.1)

Select a Genome:
BAKTA Annotations for GCA_946892155.1
Genome Selected: Dialister micraerophilus
ContigsBases CDSrRNA tmRNAtRNA
76 1242955 1162 0 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2433 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 2433 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAMPOI010000021.1 GCA946892155_00739 gene open 5600-8071 leuS
1502 CAMPOI010000021.1 GCA946892155_00740 gene open 8178-9092
1503 CAMPOI010000021.1 GCA946892155_00741 gene open 9092-9733 nth
1504 CAMPOI010000021.1 GCA946892155_00742 gene open 9833-10957
1505 CAMPOI010000021.1 GCA946892155_00743 gene open 11083-12108
1506 CAMPOI010000021.1 GCA946892155_00744 gene open 12096-12944 yaaT
1507 CAMPOI010000021.1 GCA946892155_00745 gene open 12937-13677
1508 CAMPOI010000021.1 GCA946892155_00746 gene open 13679-14527 rsmI
1509 CAMPOI010000021.1 GCA946892155_00747 gene open 14577-16481 metG
1510 CAMPOI010000021.1 GCA946892155_00748 gene open 16478-17248 tatD
1511 CAMPOI010000021.1 GCA946892155_00749 gene open 17378-18826 hldE
1512 CAMPOI010000021.1 GCA946892155_00750 gene open 18889-20118
1513 CAMPOI010000021.1 GCA946892155_00751 gene open 20181-20786
1514 CAMPOI010000021.1 GCA946892155_00752 gene open 20834-21316
1515 CAMPOI010000022.1 GCA946892155_00753 CDS open 42-542 _na     166_aa pyruvate%2C water dikinase regulatory protein
1516 CAMPOI010000022.1 GCA946892155_00754 CDS open 756-1769 _na     337_aa deoxyguanosinetriphosphate triphosphohydrolase
1517 CAMPOI010000022.1 GCA946892155_00755 CDS open 1895-2239 _na     114_aa Arsenical resistance operon repressor
1518 CAMPOI010000022.1 GCA946892155_00756 CDS open 2500-3729 _na     409_aa dinB DNA polymerase IV
1519 CAMPOI010000022.1 GCA946892155_00757 CDS open 3692-4819 _na     375_aa M20/M25/M40 family peptidase
1520 CAMPOI010000022.1 GCA946892155_00758 CDS open 5177-6571 _na     464_aa NCS2 family nucleobase:cation symporter-2%2C xanthine/uracil permease
1521 CAMPOI010000022.1 GCA946892155_00759 CDS open 6719-7636 _na     305_aa Pyruvate formate-lyase activating enzyme
1522 CAMPOI010000022.1 GCA946892155_00760 CDS open 7649-8032 _na     127_aa Fluoroacetyl-CoA-specific thioesterase-like domain-containing protein
1523 CAMPOI010000022.1 GCA946892155_00761 CDS open 8135-9175 _na     346_aa Endolytic murein transglycosylase
1524 CAMPOI010000022.1 GCA946892155_00762 CDS open 9175-9768 _na     197_aa O-methyltransferase
1525 CAMPOI010000022.1 GCA946892155_00763 CDS open 9768-11000 _na     410_aa U32 family peptidase
1526 CAMPOI010000022.1 GCA946892155_00764 CDS open 10990-11214 _na     74_aa DUF4911 domain-containing protein
1527 CAMPOI010000022.1 GCA946892155_00765 CDS open 11260-12717 _na     485_aa nicotinate phosphoribosyltransferase
1528 CAMPOI010000022.1 GCA946892155_00766 CDS open 12833-13282 _na     149_aa Universal stress protein
1529 CAMPOI010000022.1 GCA946892155_00767 CDS open 13458-13877 _na     139_aa nhaX Universal stress protein NhaX
1530 CAMPOI010000022.1 GCA946892155_00768 CDS open 14101-15033 _na     310_aa Porin domain-containing protein
1531 CAMPOI010000022.1 GCA946892155_00769 CDS open 15163-15726 _na     187_aa Folate family ECF transporter S component
1532 CAMPOI010000022.1 GCA946892155_00770 CDS open 15859-16308 _na     149_aa nhaX Universal stress protein NhaX
1533 CAMPOI010000022.1 GCA946892155_00771 CDS open 16361-17803 _na     480_aa DUF2157 domain-containing protein
1534 CAMPOI010000022.1 GCA946892155_00772 CDS open 17796-18476 _na     226_aa hypothetical protein
1535 CAMPOI010000022.1 GCA946892155_00773 CDS open 18479-18925 _na     148_aa sixA Phosphohistidine phosphatase SixA
1536 CAMPOI010000022.1 GCA946892155_00774 CDS open 18941-19738 _na     265_aa Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase
1537 CAMPOI010000022.1 GCA946892155_00775 CDS open 19739-20320 _na     193_aa yfbR 5'-deoxynucleotidase
1538 CAMPOI010000022.1 GCA946892155_00753 gene open 42-542
1539 CAMPOI010000022.1 GCA946892155_00754 gene open 756-1769
1540 CAMPOI010000022.1 GCA946892155_00755 gene open 1895-2239
1541 CAMPOI010000022.1 GCA946892155_00756 gene open 2500-3729 dinB
1542 CAMPOI010000022.1 GCA946892155_00757 gene open 3692-4819
1543 CAMPOI010000022.1 GCA946892155_00758 gene open 5177-6571
1544 CAMPOI010000022.1 GCA946892155_00759 gene open 6719-7636
1545 CAMPOI010000022.1 GCA946892155_00760 gene open 7649-8032
1546 CAMPOI010000022.1 GCA946892155_00761 gene open 8135-9175
1547 CAMPOI010000022.1 GCA946892155_00762 gene open 9175-9768
1548 CAMPOI010000022.1 GCA946892155_00763 gene open 9768-11000
1549 CAMPOI010000022.1 GCA946892155_00764 gene open 10990-11214
1550 CAMPOI010000022.1 GCA946892155_00765 gene open 11260-12717
1551 CAMPOI010000022.1 GCA946892155_00766 gene open 12833-13282
1552 CAMPOI010000022.1 GCA946892155_00767 gene open 13458-13877 nhaX
1553 CAMPOI010000022.1 GCA946892155_00768 gene open 14101-15033
1554 CAMPOI010000022.1 GCA946892155_00769 gene open 15163-15726
1555 CAMPOI010000022.1 GCA946892155_00770 gene open 15859-16308 nhaX
1556 CAMPOI010000022.1 GCA946892155_00771 gene open 16361-17803
1557 CAMPOI010000022.1 GCA946892155_00772 gene open 17796-18476
1558 CAMPOI010000022.1 GCA946892155_00773 gene open 18479-18925 sixA
1559 CAMPOI010000022.1 GCA946892155_00774 gene open 18941-19738
1560 CAMPOI010000022.1 GCA946892155_00775 gene open 19739-20320 yfbR
1561 CAMPOI010000022.1 GCA946892155_00776 gene open 20362-20445 trnL
1562 CAMPOI010000022.1 GCA946892155_00776 tRNA open 20362-20445 trnL tRNA-Leu(tag)
1563 CAMPOI010000023.1 regulatory_region open 14428-14549 FMN riboswitch aptamer (RFN element)
1564 CAMPOI010000023.1 GCA946892155_00777 CDS open 172-318 _na     48_aa hypothetical protein
1565 CAMPOI010000023.1 GCA946892155_00778 CDS open 363-1610 _na     415_aa lysA diaminopimelate decarboxylase
1566 CAMPOI010000023.1 GCA946892155_00779 CDS open 1673-2791 _na     372_aa Monogalactosyldiacylglycerol synthase%2C C-terminal domain protein
1567 CAMPOI010000023.1 GCA946892155_00780 CDS open 2927-3205 _na     92_aa DNA-binding protein HU
1568 CAMPOI010000023.1 GCA946892155_00781 CDS open 3461-5062 _na     533_aa Stage V sporulation protein B
1569 CAMPOI010000023.1 GCA946892155_00782 CDS open 5067-8447 _na     1126_aa mfd transcription-repair coupling factor
1570 CAMPOI010000023.1 GCA946892155_00783 CDS open 8459-8941 _na     160_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1571 CAMPOI010000023.1 GCA946892155_00784 CDS open 8938-9303 _na     121_aa folB dihydroneopterin aldolase
1572 CAMPOI010000023.1 GCA946892155_00785 CDS open 9305-10147 _na     280_aa folP dihydropteroate synthase
1573 CAMPOI010000023.1 GCA946892155_00786 CDS open 10279-10884 _na     201_aa Phosphate transport regulator
1574 CAMPOI010000023.1 GCA946892155_00787 CDS open 10910-11371 _na     153_aa ribE 6%2C7-dimethyl-8-ribityllumazine synthase
1575 CAMPOI010000023.1 GCA946892155_00788 CDS open 11392-12594 _na     400_aa Riboflavin biosynthesis protein RibBA
1576 CAMPOI010000023.1 GCA946892155_00789 CDS open 12584-13231 _na     215_aa ribE riboflavin synthase
1577 CAMPOI010000023.1 GCA946892155_00790 CDS open 13253-14389 _na     378_aa ribD bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD
1578 CAMPOI010000023.1 GCA946892155_00791 CDS open 14376-14549 _na     57_aa hypothetical protein
1579 CAMPOI010000023.1 GCA946892155_00792 CDS open 14573-15247 _na     224_aa tmk dTMP kinase
1580 CAMPOI010000023.1 GCA946892155_00793 CDS open 15323-15895 _na     190_aa pth aminoacyl-tRNA hydrolase
1581 CAMPOI010000023.1 GCA946892155_00794 CDS open 15897-16850 _na     317_aa prsA Ribose-phosphate pyrophosphokinase
1582 CAMPOI010000023.1 GCA946892155_00795 CDS open 17006-18388 _na     460_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
1583 CAMPOI010000023.1 GCA946892155_00796 CDS open 18507-19775 _na     422_aa Cell wall lytic enzyme
1584 CAMPOI010000023.1 GCA946892155_00797 CDS open 20336-20515 _na     59_aa hypothetical protein
1585 CAMPOI010000023.1 GCA946892155_00777 gene open 172-318
1586 CAMPOI010000023.1 GCA946892155_00778 gene open 363-1610 lysA
1587 CAMPOI010000023.1 GCA946892155_00779 gene open 1673-2791
1588 CAMPOI010000023.1 GCA946892155_00780 gene open 2927-3205
1589 CAMPOI010000023.1 GCA946892155_00781 gene open 3461-5062
1590 CAMPOI010000023.1 GCA946892155_00782 gene open 5067-8447 mfd
1591 CAMPOI010000023.1 GCA946892155_00783 gene open 8459-8941 folK
1592 CAMPOI010000023.1 GCA946892155_00784 gene open 8938-9303 folB
1593 CAMPOI010000023.1 GCA946892155_00785 gene open 9305-10147 folP
1594 CAMPOI010000023.1 GCA946892155_00786 gene open 10279-10884
1595 CAMPOI010000023.1 GCA946892155_00787 gene open 10910-11371 ribE
1596 CAMPOI010000023.1 GCA946892155_00788 gene open 11392-12594
1597 CAMPOI010000023.1 GCA946892155_00789 gene open 12584-13231 ribE
1598 CAMPOI010000023.1 GCA946892155_00790 gene open 13253-14389 ribD
1599 CAMPOI010000023.1 GCA946892155_00791 gene open 14376-14549
1600 CAMPOI010000023.1 GCA946892155_00792 gene open 14573-15247 tmk
1601 CAMPOI010000023.1 GCA946892155_00793 gene open 15323-15895 pth
1602 CAMPOI010000023.1 GCA946892155_00794 gene open 15897-16850 prsA
1603 CAMPOI010000023.1 GCA946892155_00795 gene open 17006-18388 glmU
1604 CAMPOI010000023.1 GCA946892155_00796 gene open 18507-19775
1605 CAMPOI010000023.1 GCA946892155_00797 gene open 20336-20515
1606 CAMPOI010000024.1 regulatory_region open 4288-4529 T-box leader
1607 CAMPOI010000024.1 GCA946892155_00798 CDS open 706-1200 _na     164_aa queF preQ(1) synthase
1608 CAMPOI010000024.1 GCA946892155_00799 CDS open 1259-1942 _na     227_aa Cobalt transporter
1609 CAMPOI010000024.1 GCA946892155_00800 CDS open 1943-2755 _na     270_aa Cobalt ABC superfamily ATP binding cassette transporter%2C ABC protein
1610 CAMPOI010000024.1 GCA946892155_00801 CDS open 2759-4231 _na     490_aa Cobalt ABC superfamily ATP binding cassette transporter%2C ABC protein
1611 CAMPOI010000024.1 GCA946892155_00802 CDS open 4552-5433 _na     293_aa mscS MscS family small conductance mechanosenstive ion channel
1612 CAMPOI010000024.1 GCA946892155_00803 CDS open 5437-6288 _na     283_aa folD Bifunctional protein FolD
1613 CAMPOI010000024.1 GCA946892155_00804 CDS open 6298-7965 _na     555_aa formate--tetrahydrofolate ligase
1614 CAMPOI010000024.1 GCA946892155_00805 CDS open 8307-8837 _na     176_aa radC Putative DNA repair protein RadC
1615 CAMPOI010000024.1 GCA946892155_00806 CDS open 9189-11153 _na     654_aa Penicillin-binding protein 2B
1616 CAMPOI010000024.1 GCA946892155_00807 CDS open 11140-12612 _na     490_aa RNA nucleotidyltransferase
1617 CAMPOI010000024.1 GCA946892155_00808 CDS open 12782-13984 _na     400_aa NADP-dependent malate dehydrogenase (Oxaloacetate-decarboxylating)
1618 CAMPOI010000024.1 GCA946892155_00809 CDS open 13998-14816 _na     272_aa speD adenosylmethionine decarboxylase
1619 CAMPOI010000024.1 GCA946892155_00810 CDS open 14860-15447 _na     195_aa XTP/dITP diphosphatase
1620 CAMPOI010000024.1 GCA946892155_00811 CDS open 15571-15840 _na     89_aa rpsO 30S ribosomal protein S15
1621 CAMPOI010000024.1 GCA946892155_00812 CDS open 15972-17048 _na     358_aa ABC superfamily ATP binding cassette transporter substrate binding protein
1622 CAMPOI010000024.1 GCA946892155_00813 CDS open 17091-17276 _na     61_aa rpmF 50S ribosomal protein L32
1623 CAMPOI010000024.1 GCA946892155_00814 CDS open 17456-19309 _na     617_aa uvrC excinuclease ABC subunit UvrC
1624 CAMPOI010000024.1 GCA946892155_00815 CDS open 19302-20258 _na     318_aa hypothetical protein
1625 CAMPOI010000024.1 GCA946892155_00798 gene open 706-1200 queF
1626 CAMPOI010000024.1 GCA946892155_00799 gene open 1259-1942
1627 CAMPOI010000024.1 GCA946892155_00800 gene open 1943-2755
1628 CAMPOI010000024.1 GCA946892155_00801 gene open 2759-4231
1629 CAMPOI010000024.1 GCA946892155_00802 gene open 4552-5433 mscS
1630 CAMPOI010000024.1 GCA946892155_00803 gene open 5437-6288 folD
1631 CAMPOI010000024.1 GCA946892155_00804 gene open 6298-7965
1632 CAMPOI010000024.1 GCA946892155_00805 gene open 8307-8837 radC
1633 CAMPOI010000024.1 GCA946892155_00806 gene open 9189-11153
1634 CAMPOI010000024.1 GCA946892155_00807 gene open 11140-12612
1635 CAMPOI010000024.1 GCA946892155_00808 gene open 12782-13984
1636 CAMPOI010000024.1 GCA946892155_00809 gene open 13998-14816 speD
1637 CAMPOI010000024.1 GCA946892155_00810 gene open 14860-15447
1638 CAMPOI010000024.1 GCA946892155_00811 gene open 15571-15840 rpsO
1639 CAMPOI010000024.1 GCA946892155_00812 gene open 15972-17048
1640 CAMPOI010000024.1 GCA946892155_00813 gene open 17091-17276 rpmF
1641 CAMPOI010000024.1 GCA946892155_00814 gene open 17456-19309 uvrC
1642 CAMPOI010000024.1 GCA946892155_00815 gene open 19302-20258
1643 CAMPOI010000025.1 regulatory_region open 8410-8495 pan motif
1644 CAMPOI010000025.1 GCA946892155_00816 CDS open 111-929 _na     272_aa ftsY signal recognition particle-docking protein FtsY
1645 CAMPOI010000025.1 GCA946892155_00817 CDS open 1112-1978 _na     288_aa lysR LysR family transcriptional regulator
1646 CAMPOI010000025.1 GCA946892155_00822 CDS open 2621-3598 _na     325_aa lysR LysR family transcriptional regulator
1647 CAMPOI010000025.1 GCA946892155_00823 CDS open 4029-4913 _na     294_aa glycine--tRNA ligase subunit alpha
1648 CAMPOI010000025.1 GCA946892155_00824 CDS open 4906-6954 _na     682_aa Glycine--tRNA ligase beta subunit
1649 CAMPOI010000025.1 GCA946892155_00825 CDS open 7145-8395 _na     416_aa deaD ATP-dependent RNA helicase DeaD
1650 CAMPOI010000025.1 GCA946892155_00826 CDS open 8501-9115 _na     204_aa Thiamine transporter protein (Thia_YuaJ)
1651 CAMPOI010000025.1 GCA946892155_00827 CDS open 9160-10113 _na     317_aa DUF1858 domain-containing protein
1652 CAMPOI010000025.1 GCA946892155_00828 CDS open 10253-11224 _na     323_aa Serine-type D-Ala-D-Ala carboxypeptidase
1653 CAMPOI010000025.1 GCA946892155_00829 CDS open 11217-11525 _na     102_aa ftsL Cell division protein FtsL
1654 CAMPOI010000025.1 GCA946892155_00830 CDS open 11603-12118 _na     171_aa S1 RNA-binding domain protein
1655 CAMPOI010000025.1 GCA946892155_00831 CDS open 12168-13076 _na     302_aa Ppx/GppA phosphatase
1656 CAMPOI010000025.1 GCA946892155_00832 CDS open 13069-14523 _na     484_aa tRNA(Ile)-lysidine synthase
1657 CAMPOI010000025.1 GCA946892155_00833 CDS open 14544-15089 _na     181_aa hpt hypoxanthine phosphoribosyltransferase
1658 CAMPOI010000025.1 GCA946892155_00834 CDS open 15170-17011 _na     613_aa ftsH ATP-dependent zinc metalloprotease FtsH
1659 CAMPOI010000025.1 GCA946892155_00835 CDS open 17175-17615 _na     146_aa rplM 50S ribosomal protein L13
1660 CAMPOI010000025.1 GCA946892155_00836 CDS open 17638-18030 _na     130_aa rpsI 30S ribosomal protein S9
1661 CAMPOI010000025.1 GCA946892155_00837 CDS open 18163-18957 _na     264_aa hypothetical protein
1662 CAMPOI010000025.1 GCA946892155_00816 gene open 111-929 ftsY
1663 CAMPOI010000025.1 GCA946892155_00817 gene open 1112-1978 lysR
1664 CAMPOI010000025.1 GCA946892155_00822 gene open 2621-3598 lysR
1665 CAMPOI010000025.1 GCA946892155_00823 gene open 4029-4913
1666 CAMPOI010000025.1 GCA946892155_00824 gene open 4906-6954
1667 CAMPOI010000025.1 GCA946892155_00825 gene open 7145-8395 deaD
1668 CAMPOI010000025.1 GCA946892155_00826 gene open 8501-9115
1669 CAMPOI010000025.1 GCA946892155_00827 gene open 9160-10113
1670 CAMPOI010000025.1 GCA946892155_00828 gene open 10253-11224
1671 CAMPOI010000025.1 GCA946892155_00829 gene open 11217-11525 ftsL
1672 CAMPOI010000025.1 GCA946892155_00830 gene open 11603-12118
1673 CAMPOI010000025.1 GCA946892155_00831 gene open 12168-13076
1674 CAMPOI010000025.1 GCA946892155_00832 gene open 13069-14523
1675 CAMPOI010000025.1 GCA946892155_00833 gene open 14544-15089 hpt
1676 CAMPOI010000025.1 GCA946892155_00834 gene open 15170-17011 ftsH
1677 CAMPOI010000025.1 GCA946892155_00835 gene open 17175-17615 rplM
1678 CAMPOI010000025.1 GCA946892155_00836 gene open 17638-18030 rpsI
1679 CAMPOI010000025.1 GCA946892155_00837 gene open 18163-18957
1680 CAMPOI010000025.1 GCA946892155_00818 gene open 2138-2213 trnV
1681 CAMPOI010000025.1 GCA946892155_00819 gene open 2295-2370 trnN
1682 CAMPOI010000025.1 GCA946892155_00820 gene open 2373-2447 trnE
1683 CAMPOI010000025.1 GCA946892155_00821 gene open 2451-2526 trnV
1684 CAMPOI010000025.1 GCA946892155_00818 tRNA open 2138-2213 trnV tRNA-Val(tac)
1685 CAMPOI010000025.1 GCA946892155_00819 tRNA open 2295-2370 trnN tRNA-Asn(gtt)
1686 CAMPOI010000025.1 GCA946892155_00820 tRNA open 2373-2447 trnE tRNA-Glu(ttc)
1687 CAMPOI010000025.1 GCA946892155_00821 tRNA open 2451-2526 trnV tRNA-Val(tac)
1688 CAMPOI010000026.1 GCA946892155_00858 gene open 18173-18303 SpR18_sRNA
1689 CAMPOI010000026.1 GCA946892155_00858 ncRNA open 18173-18303 Streptococcus sRNA SpR18
1690 CAMPOI010000026.1 GCA946892155_00838 CDS open 664-897 _na     77_aa secE preprotein translocase subunit SecE
1691 CAMPOI010000026.1 GCA946892155_00839 CDS open 910-1533 _na     207_aa nusG transcription termination/antitermination protein NusG
1692 CAMPOI010000026.1 GCA946892155_00840 CDS open 1629-2054 _na     141_aa rplK 50S ribosomal protein L11
1693 CAMPOI010000026.1 GCA946892155_00841 CDS open 2096-2803 _na     235_aa rplA 50S ribosomal protein L1
1694 CAMPOI010000026.1 GCA946892155_00842 CDS open 2965-3504 _na     179_aa rplJ 50S ribosomal protein L10
1695 CAMPOI010000026.1 GCA946892155_00843 CDS open 3540-3911 _na     123_aa rplL 50S ribosomal protein L7/L12
1696 CAMPOI010000026.1 GCA946892155_00844 CDS open 4006-4263 _na     85_aa rpsT 30S ribosomal protein S20
1697 CAMPOI010000026.1 GCA946892155_00845 CDS open 4408-4776 _na     122_aa Holo-[acyl-carrier-protein] synthase
1698 CAMPOI010000026.1 GCA946892155_00846 CDS open 4779-6308 _na     509_aa Bifunctional NAD(P)H-hydrate repair enzyme
1699 CAMPOI010000026.1 GCA946892155_00847 CDS open 6369-7355 _na     328_aa diaminopimelate dehydrogenase
1700 CAMPOI010000026.1 GCA946892155_00849 CDS open 7662-8348 _na     228_aa hypothetical protein
1701 CAMPOI010000026.1 GCA946892155_00850 CDS open 8371-8922 _na     183_aa Adenine phosphoribosyltransferase
1702 CAMPOI010000026.1 GCA946892155_00851 CDS open 9328-10254 _na     308_aa cpsY Transcriptional regulator CpsY
1703 CAMPOI010000026.1 GCA946892155_00852 CDS open 10355-12637 _na     760_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
1704 CAMPOI010000026.1 GCA946892155_00853 CDS open 12615-13499 _na     294_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
1705 CAMPOI010000026.1 GCA946892155_00854 CDS open 13516-13707 _na     63_aa hypothetical protein
1706 CAMPOI010000026.1 GCA946892155_00855 CDS open 13857-14924 _na     355_aa NADP-dependent alcohol dehydrogenase
1707 CAMPOI010000026.1 GCA946892155_00856 CDS open 15099-16463 _na     454_aa APC family amino acid transporter
1708 CAMPOI010000026.1 GCA946892155_00857 CDS open 16610-18148 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
1709 CAMPOI010000026.1 GCA946892155_00838 gene open 664-897 secE
1710 CAMPOI010000026.1 GCA946892155_00839 gene open 910-1533 nusG
1711 CAMPOI010000026.1 GCA946892155_00840 gene open 1629-2054 rplK
1712 CAMPOI010000026.1 GCA946892155_00841 gene open 2096-2803 rplA
1713 CAMPOI010000026.1 GCA946892155_00842 gene open 2965-3504 rplJ
1714 CAMPOI010000026.1 GCA946892155_00843 gene open 3540-3911 rplL
1715 CAMPOI010000026.1 GCA946892155_00844 gene open 4006-4263 rpsT
1716 CAMPOI010000026.1 GCA946892155_00845 gene open 4408-4776
1717 CAMPOI010000026.1 GCA946892155_00846 gene open 4779-6308
1718 CAMPOI010000026.1 GCA946892155_00847 gene open 6369-7355
1719 CAMPOI010000026.1 GCA946892155_00849 gene open 7662-8348
1720 CAMPOI010000026.1 GCA946892155_00850 gene open 8371-8922
1721 CAMPOI010000026.1 GCA946892155_00851 gene open 9328-10254 cpsY
1722 CAMPOI010000026.1 GCA946892155_00852 gene open 10355-12637 metE
1723 CAMPOI010000026.1 GCA946892155_00853 gene open 12615-13499 metF
1724 CAMPOI010000026.1 GCA946892155_00854 gene open 13516-13707
1725 CAMPOI010000026.1 GCA946892155_00855 gene open 13857-14924
1726 CAMPOI010000026.1 GCA946892155_00856 gene open 15099-16463
1727 CAMPOI010000026.1 GCA946892155_00857 gene open 16610-18148 guaA
1728 CAMPOI010000026.1 GCA946892155_00848 gene open 7435-7525 trnS
1729 CAMPOI010000026.1 GCA946892155_00848 tRNA open 7435-7525 trnS tRNA-Ser(gct)
1730 CAMPOI010000027.1 GCA946892155_00859 CDS open 155-2155 _na     666_aa YadA-like family protein
1731 CAMPOI010000027.1 GCA946892155_00860 CDS open 2279-2692 _na     137_aa hypothetical protein
1732 CAMPOI010000027.1 GCA946892155_00861 CDS open 2641-3150 _na     169_aa Pseudouridine synthase
1733 CAMPOI010000027.1 GCA946892155_00862 CDS open 3128-3979 _na     283_aa pgeF peptidoglycan editing factor PgeF
1734 CAMPOI010000027.1 GCA946892155_00863 CDS open 4004-4816 _na     270_aa Oxidoreductase%2C aldo/keto reductase family protein
1735 CAMPOI010000027.1 GCA946892155_00864 CDS open 4862-5800 _na     312_aa araC AraC family transcriptional regulator
1736 CAMPOI010000027.1 GCA946892155_00865 CDS open 5954-7690 _na     578_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
1737 CAMPOI010000027.1 GCA946892155_00866 CDS open 7687-9408 _na     573_aa Cyclic beta-1%2C2-glucan ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
1738 CAMPOI010000027.1 GCA946892155_00867 CDS open 9464-9694 _na     76_aa hypothetical protein
1739 CAMPOI010000027.1 GCA946892155_00868 CDS open 9687-10400 _na     237_aa Ser/Thr protein phosphatase
1740 CAMPOI010000027.1 GCA946892155_00869 CDS open 10402-11163 _na     253_aa UTP-hexose-1-phosphate uridylyltransferase
1741 CAMPOI010000027.1 GCA946892155_00870 CDS open 11332-12129 _na     265_aa Amino acid ABC superfamily ATP binding cassette transporter%2C binding protein
1742 CAMPOI010000027.1 GCA946892155_00871 CDS open 12199-12852 _na     217_aa Amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein
1743 CAMPOI010000027.1 GCA946892155_00872 CDS open 12861-13616 _na     251_aa Glutamine ABC superfamily ATP binding cassette transporter%2C ABC protein
1744 CAMPOI010000027.1 GCA946892155_00873 CDS open 13729-14760 _na     343_aa Efflux transporter%2C RND family%2C MFP subunit
1745 CAMPOI010000027.1 GCA946892155_00874 CDS open 14861-18418 _na     1185_aa smc chromosome segregation protein SMC
1746 CAMPOI010000027.1 GCA946892155_00859 gene open 155-2155
1747 CAMPOI010000027.1 GCA946892155_00860 gene open 2279-2692
1748 CAMPOI010000027.1 GCA946892155_00861 gene open 2641-3150
1749 CAMPOI010000027.1 GCA946892155_00862 gene open 3128-3979 pgeF
1750 CAMPOI010000027.1 GCA946892155_00863 gene open 4004-4816
1751 CAMPOI010000027.1 GCA946892155_00864 gene open 4862-5800 araC
1752 CAMPOI010000027.1 GCA946892155_00865 gene open 5954-7690
1753 CAMPOI010000027.1 GCA946892155_00866 gene open 7687-9408
1754 CAMPOI010000027.1 GCA946892155_00867 gene open 9464-9694
1755 CAMPOI010000027.1 GCA946892155_00868 gene open 9687-10400
1756 CAMPOI010000027.1 GCA946892155_00869 gene open 10402-11163
1757 CAMPOI010000027.1 GCA946892155_00870 gene open 11332-12129
1758 CAMPOI010000027.1 GCA946892155_00871 gene open 12199-12852
1759 CAMPOI010000027.1 GCA946892155_00872 gene open 12861-13616
1760 CAMPOI010000027.1 GCA946892155_00873 gene open 13729-14760
1761 CAMPOI010000027.1 GCA946892155_00874 gene open 14861-18418 smc
1762 CAMPOI010000028.1 GCA946892155_00876 CDS open 145-411 _na     88_aa hypothetical protein
1763 CAMPOI010000028.1 GCA946892155_00878 CDS open 767-1057 _na     96_aa Lipoyl-binding domain-containing protein
1764 CAMPOI010000028.1 GCA946892155_00879 CDS open 1074-2879 _na     601_aa Peptidase S55 domain-containing protein
1765 CAMPOI010000028.1 GCA946892155_00880 CDS open 2907-3668 _na     253_aa ABC transporter permease
1766 CAMPOI010000028.1 GCA946892155_00881 CDS open 3677-4441 _na     254_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
1767 CAMPOI010000028.1 GCA946892155_00882 CDS open 4438-5589 _na     383_aa Mce/MlaD domain-containing protein
1768 CAMPOI010000028.1 GCA946892155_00883 CDS open 5600-7021 _na     473_aa Outer membrane efflux protein
1769 CAMPOI010000028.1 GCA946892155_00884 CDS open 7045-11412 _na     1455_aa tamB Translocation and assembly module TamB
1770 CAMPOI010000028.1 GCA946892155_00885 CDS open 11602-13881 _na     759_aa outer membrane protein assembly factor
1771 CAMPOI010000028.1 GCA946892155_00886 CDS open 13981-14505 _na     174_aa Outer membrane chaperone Skp (OmpH)
1772 CAMPOI010000028.1 GCA946892155_00887 CDS open 14505-15422 _na     305_aa Outer membrane protein
1773 CAMPOI010000028.1 GCA946892155_00888 CDS open 15431-15865 _na     144_aa Outer membrane chaperone Skp (OmpH)
1774 CAMPOI010000028.1 GCA946892155_00889 CDS open 15867-16901 _na     344_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
1775 CAMPOI010000028.1 GCA946892155_00890 CDS open 17018-17371 _na     117_aa hypothetical protein
1776 CAMPOI010000028.1 GCA946892155_00876 gene open 145-411
1777 CAMPOI010000028.1 GCA946892155_00878 gene open 767-1057
1778 CAMPOI010000028.1 GCA946892155_00879 gene open 1074-2879
1779 CAMPOI010000028.1 GCA946892155_00880 gene open 2907-3668
1780 CAMPOI010000028.1 GCA946892155_00881 gene open 3677-4441
1781 CAMPOI010000028.1 GCA946892155_00882 gene open 4438-5589
1782 CAMPOI010000028.1 GCA946892155_00883 gene open 5600-7021
1783 CAMPOI010000028.1 GCA946892155_00884 gene open 7045-11412 tamB
1784 CAMPOI010000028.1 GCA946892155_00885 gene open 11602-13881
1785 CAMPOI010000028.1 GCA946892155_00886 gene open 13981-14505
1786 CAMPOI010000028.1 GCA946892155_00887 gene open 14505-15422
1787 CAMPOI010000028.1 GCA946892155_00888 gene open 15431-15865
1788 CAMPOI010000028.1 GCA946892155_00889 gene open 15867-16901 lpxD
1789 CAMPOI010000028.1 GCA946892155_00890 gene open 17018-17371
1790 CAMPOI010000028.1 GCA946892155_00875 gene open 1-76 trnK
1791 CAMPOI010000028.1 GCA946892155_00877 gene open 560-634 trnR
1792 CAMPOI010000028.1 GCA946892155_00875 tRNA open 1-76 trnK tRNA-Lys(ctt)
1793 CAMPOI010000028.1 GCA946892155_00877 tRNA open 560-634 trnR tRNA-Arg(ccg)
1794 CAMPOI010000029.1 GCA946892155_00891 CDS open 63-1355 _na     430_aa hypothetical protein
1795 CAMPOI010000029.1 GCA946892155_00892 CDS open 1345-1794 _na     149_aa dut dUTP diphosphatase
1796 CAMPOI010000029.1 GCA946892155_00893 CDS open 1901-3238 _na     445_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
1797 CAMPOI010000029.1 GCA946892155_00894 CDS open 3240-3602 _na     120_aa Purine nucleoside phosphoramidase
1798 CAMPOI010000029.1 GCA946892155_00895 CDS open 3740-3916 _na     58_aa rpsU 30S ribosomal protein S21
1799 CAMPOI010000029.1 GCA946892155_00896 CDS open 4019-4450 _na     143_aa GatB/Yqey family protein
1800 CAMPOI010000029.1 GCA946892155_00897 CDS open 4580-6472 _na     630_aa Glutamate--ammonia ligase%2C catalytic domain protein
1801 CAMPOI010000029.1 GCA946892155_00902 CDS open 6950-7432 _na     160_aa ybaK Cys-tRNA(Pro) deacylase
1802 CAMPOI010000029.1 GCA946892155_00903 CDS open 7655-8620 _na     321_aa aspartate carbamoyltransferase catalytic subunit
1803 CAMPOI010000029.1 GCA946892155_00904 CDS open 8598-9893 _na     431_aa Dihydroorotase
1804 CAMPOI010000029.1 GCA946892155_00905 CDS open 9890-10957 _na     355_aa carbamoyl phosphate synthase small subunit
1805 CAMPOI010000029.1 GCA946892155_00906 CDS open 10950-14156 _na     1068_aa carB carbamoyl-phosphate synthase large subunit
1806 CAMPOI010000029.1 GCA946892155_00907 CDS open 14158-14922 _na     254_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
1807 CAMPOI010000029.1 GCA946892155_00908 CDS open 14919-15824 _na     301_aa dihydroorotate dehydrogenase
1808 CAMPOI010000029.1 GCA946892155_00909 CDS open 16000-16722 _na     240_aa alanine:cation symporter family protein
1809 CAMPOI010000029.1 GCA946892155_00891 gene open 63-1355
1810 CAMPOI010000029.1 GCA946892155_00892 gene open 1345-1794 dut
1811 CAMPOI010000029.1 GCA946892155_00893 gene open 1901-3238 mtaB
1812 CAMPOI010000029.1 GCA946892155_00894 gene open 3240-3602
1813 CAMPOI010000029.1 GCA946892155_00895 gene open 3740-3916 rpsU
1814 CAMPOI010000029.1 GCA946892155_00896 gene open 4019-4450
1815 CAMPOI010000029.1 GCA946892155_00897 gene open 4580-6472
1816 CAMPOI010000029.1 GCA946892155_00902 gene open 6950-7432 ybaK
1817 CAMPOI010000029.1 GCA946892155_00903 gene open 7655-8620
1818 CAMPOI010000029.1 GCA946892155_00904 gene open 8598-9893
1819 CAMPOI010000029.1 GCA946892155_00905 gene open 9890-10957
1820 CAMPOI010000029.1 GCA946892155_00906 gene open 10950-14156 carB
1821 CAMPOI010000029.1 GCA946892155_00907 gene open 14158-14922
1822 CAMPOI010000029.1 GCA946892155_00908 gene open 14919-15824
1823 CAMPOI010000029.1 GCA946892155_00909 gene open 16000-16722
1824 CAMPOI010000029.1 GCA946892155_00898 gene open 6557-6645 trnL
1825 CAMPOI010000029.1 GCA946892155_00899 gene open 6655-6728 trnC
1826 CAMPOI010000029.1 GCA946892155_00900 gene open 6733-6807 trnG
1827 CAMPOI010000029.1 GCA946892155_00901 gene open 6811-6887 trnD
1828 CAMPOI010000029.1 GCA946892155_00898 tRNA open 6557-6645 trnL tRNA-Leu(taa)
1829 CAMPOI010000029.1 GCA946892155_00899 tRNA open 6655-6728 trnC tRNA-Cys(gca)
1830 CAMPOI010000029.1 GCA946892155_00900 tRNA open 6733-6807 trnG tRNA-Gly(gcc)
1831 CAMPOI010000029.1 GCA946892155_00901 tRNA open 6811-6887 trnD tRNA-Asp(gtc)
1832 CAMPOI010000030.1 GCA946892155_00910 CDS open 21-1076 _na     351_aa Eco57I restriction-modification methylase domain-containing protein
1833 CAMPOI010000030.1 GCA946892155_00911 CDS open 1070-2536 _na     488_aa Type I restriction modification DNA specificity domain-containing protein
1834 CAMPOI010000030.1 GCA946892155_00912 CDS open 2624-2899 _na     91_aa hypothetical protein
1835 CAMPOI010000030.1 GCA946892155_00913 CDS open 3241-4845 _na     534_aa peptide chain release factor 3
1836 CAMPOI010000030.1 GCA946892155_00914 CDS open 4919-6130 _na     403_aa Spermidine synthase
1837 CAMPOI010000030.1 GCA946892155_00915 CDS open 6182-7201 _na     339_aa Diacylglycerol kinase catalytic domain protein
1838 CAMPOI010000030.1 GCA946892155_00916 CDS open 7293-8309 _na     338_aa UDP-N-acetylglucosamine kinase
1839 CAMPOI010000030.1 GCA946892155_00917 CDS open 8587-9918 _na     443_aa hypothetical protein
1840 CAMPOI010000030.1 GCA946892155_00918 CDS open 9944-10606 _na     220_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
1841 CAMPOI010000030.1 GCA946892155_00919 CDS open 10617-11486 _na     289_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
1842 CAMPOI010000030.1 GCA946892155_00920 CDS open 11541-12233 _na     230_aa Type VII secretion system protein EssD-like domain-containing protein
1843 CAMPOI010000030.1 GCA946892155_00921 CDS open 12307-14502 _na     731_aa Ornithine decarboxylase
1844 CAMPOI010000030.1 GCA946892155_00922 CDS open 15913-16377 _na     154_aa hypothetical protein
1845 CAMPOI010000030.1 GCA946892155_00910 gene open 21-1076
1846 CAMPOI010000030.1 GCA946892155_00911 gene open 1070-2536
1847 CAMPOI010000030.1 GCA946892155_00912 gene open 2624-2899
1848 CAMPOI010000030.1 GCA946892155_00913 gene open 3241-4845
1849 CAMPOI010000030.1 GCA946892155_00914 gene open 4919-6130
1850 CAMPOI010000030.1 GCA946892155_00915 gene open 6182-7201
1851 CAMPOI010000030.1 GCA946892155_00916 gene open 7293-8309
1852 CAMPOI010000030.1 GCA946892155_00917 gene open 8587-9918
1853 CAMPOI010000030.1 GCA946892155_00918 gene open 9944-10606 sdaAB
1854 CAMPOI010000030.1 GCA946892155_00919 gene open 10617-11486 sdaAA
1855 CAMPOI010000030.1 GCA946892155_00920 gene open 11541-12233
1856 CAMPOI010000030.1 GCA946892155_00921 gene open 12307-14502
1857 CAMPOI010000030.1 GCA946892155_00922 gene open 15913-16377
1858 CAMPOI010000031.1 GCA946892155_00938 gene open 13367-13581 Bacteria_large_SRP
1859 CAMPOI010000031.1 GCA946892155_00939 gene open 13400-13498 Bacteria_small_SRP
1860 CAMPOI010000031.1 GCA946892155_00938 ncRNA open 13367-13581 Bacterial large signal recognition particle RNA
1861 CAMPOI010000031.1 GCA946892155_00939 ncRNA open 13400-13498 Bacterial small signal recognition particle RNA
1862 CAMPOI010000031.1 GCA946892155_00923 CDS open 12-560 _na     182_aa hypothetical protein
1863 CAMPOI010000031.1 GCA946892155_00924 CDS open 550-1026 _na     158_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
1864 CAMPOI010000031.1 GCA946892155_00925 CDS open 1010-1702 _na     230_aa tsaB tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB
1865 CAMPOI010000031.1 GCA946892155_00926 CDS open 1675-2157 _na     160_aa rimI ribosomal protein S18-alanine N-acetyltransferase
1866 CAMPOI010000031.1 GCA946892155_00927 CDS open 2154-3170 _na     338_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
1867 CAMPOI010000031.1 GCA946892155_00928 CDS open 3167-4558 _na     463_aa histidine kinase
1868 CAMPOI010000031.1 GCA946892155_00929 CDS open 4562-5149 _na     195_aa Two component system response regulator
1869 CAMPOI010000031.1 GCA946892155_00930 CDS open 5594-6649 _na     351_aa hrcA heat-inducible transcriptional repressor HrcA
1870 CAMPOI010000031.1 GCA946892155_00931 CDS open 6658-7287 _na     209_aa grpE Protein GrpE
1871 CAMPOI010000031.1 GCA946892155_00932 CDS open 7329-9200 _na     623_aa dnaK molecular chaperone DnaK
1872 CAMPOI010000031.1 GCA946892155_00933 CDS open 9220-10365 _na     381_aa dnaJ molecular chaperone DnaJ
1873 CAMPOI010000031.1 GCA946892155_00934 CDS open 10412-10663 _na     83_aa YibE/F-like protein
1874 CAMPOI010000031.1 GCA946892155_00935 CDS open 10670-11260 _na     196_aa recR recombination mediator RecR
1875 CAMPOI010000031.1 GCA946892155_00936 CDS open 11260-11586 _na     108_aa YbaB/EbfC family nucleoid-associated protein
1876 CAMPOI010000031.1 GCA946892155_00937 CDS open 11607-13355 _na     582_aa dnaX DNA polymerase III subunit gamma/tau
1877 CAMPOI010000031.1 GCA946892155_00940 CDS open 13700-15085 _na     461_aa fumC class II fumarate hydratase
1878 CAMPOI010000031.1 GCA946892155_00923 gene open 12-560
1879 CAMPOI010000031.1 GCA946892155_00924 gene open 550-1026 tsaE
1880 CAMPOI010000031.1 GCA946892155_00925 gene open 1010-1702 tsaB
1881 CAMPOI010000031.1 GCA946892155_00926 gene open 1675-2157 rimI
1882 CAMPOI010000031.1 GCA946892155_00927 gene open 2154-3170 tsaD
1883 CAMPOI010000031.1 GCA946892155_00928 gene open 3167-4558
1884 CAMPOI010000031.1 GCA946892155_00929 gene open 4562-5149
1885 CAMPOI010000031.1 GCA946892155_00930 gene open 5594-6649 hrcA
1886 CAMPOI010000031.1 GCA946892155_00931 gene open 6658-7287 grpE
1887 CAMPOI010000031.1 GCA946892155_00932 gene open 7329-9200 dnaK
1888 CAMPOI010000031.1 GCA946892155_00933 gene open 9220-10365 dnaJ
1889 CAMPOI010000031.1 GCA946892155_00934 gene open 10412-10663
1890 CAMPOI010000031.1 GCA946892155_00935 gene open 10670-11260 recR
1891 CAMPOI010000031.1 GCA946892155_00936 gene open 11260-11586
1892 CAMPOI010000031.1 GCA946892155_00937 gene open 11607-13355 dnaX
1893 CAMPOI010000031.1 GCA946892155_00940 gene open 13700-15085 fumC
1894 CAMPOI010000032.1 repeat_region open 13669-13966 CRISPR array with 5 repeats of length 36%2C consensus sequence GTTTTAGACATCTGTTGGATATAGGTAAACTGATAC and spacer length 29
1895 CAMPOI010000032.1 GCA946892155_00941 CDS open 22-816 _na     264_aa corA CorA family magnesium transporter
1896 CAMPOI010000032.1 GCA946892155_00942 CDS open 930-1556 _na     208_aa Nitroreductase domain-containing protein
1897 CAMPOI010000032.1 GCA946892155_00943 CDS open 1710-3800 _na     696_aa ATPase dynein-related AAA domain-containing protein
1898 CAMPOI010000032.1 GCA946892155_00944 CDS open 3784-5541 _na     585_aa DUF2357 domain-containing protein
1899 CAMPOI010000032.1 GCA946892155_00945 CDS open 5542-5811 _na     89_aa DUF1294 domain-containing protein
1900 CAMPOI010000032.1 GCA946892155_00946 CDS open 6086-7351 _na     421_aa uraA uracil permease
1901 CAMPOI010000032.1 GCA946892155_00947 CDS open 7500-7922 _na     140_aa Putative acetyltransferase
1902 CAMPOI010000032.1 GCA946892155_00948 CDS open 7942-8535 _na     197_aa HTH tetR-type domain-containing protein
1903 CAMPOI010000032.1 GCA946892155_00949 CDS open 9035-12475 _na     1146_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1904 CAMPOI010000032.1 GCA946892155_00950 CDS open 12436-13353 _na     305_aa cas1 type II CRISPR-associated endonuclease Cas1
1905 CAMPOI010000032.1 GCA946892155_00951 CDS open 13350-13658 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
1906 CAMPOI010000032.1 GCA946892155_00941 gene open 22-816 corA
1907 CAMPOI010000032.1 GCA946892155_00942 gene open 930-1556
1908 CAMPOI010000032.1 GCA946892155_00943 gene open 1710-3800
1909 CAMPOI010000032.1 GCA946892155_00944 gene open 3784-5541
1910 CAMPOI010000032.1 GCA946892155_00945 gene open 5542-5811
1911 CAMPOI010000032.1 GCA946892155_00946 gene open 6086-7351 uraA
1912 CAMPOI010000032.1 GCA946892155_00947 gene open 7500-7922
1913 CAMPOI010000032.1 GCA946892155_00948 gene open 7942-8535
1914 CAMPOI010000032.1 GCA946892155_00949 gene open 9035-12475 cas9
1915 CAMPOI010000032.1 GCA946892155_00950 gene open 12436-13353 cas1
1916 CAMPOI010000032.1 GCA946892155_00951 gene open 13350-13658 cas2
1917 CAMPOI010000033.1 GCA946892155_00964 gene open 11276-11620 RNaseP_bact_a
1918 CAMPOI010000033.1 GCA946892155_00964 ncRNA open 11276-11620 Bacterial RNase P class A
1919 CAMPOI010000033.1 GCA946892155_00952 CDS open 65-1741 _na     558_aa glutamine--tRNA ligase/YqeY domain fusion protein
1920 CAMPOI010000033.1 GCA946892155_00953 CDS open 1738-2370 _na     210_aa hypothetical protein
1921 CAMPOI010000033.1 GCA946892155_00954 CDS open 2472-2900 _na     142_aa flavodoxin
1922 CAMPOI010000033.1 GCA946892155_00955 CDS open 2921-3349 _na     142_aa flavodoxin
1923 CAMPOI010000033.1 GCA946892155_00956 CDS open 3502-4695 _na     397_aa Lipoprotein
1924 CAMPOI010000033.1 GCA946892155_00957 CDS open 4714-5511 _na     265_aa undecaprenyl-diphosphate phosphatase
1925 CAMPOI010000033.1 GCA946892155_00958 CDS open 5584-6300 _na     238_aa ATP-grasp domain-containing protein
1926 CAMPOI010000033.1 GCA946892155_00959 CDS open 6397-8187 _na     596_aa DNA primase
1927 CAMPOI010000033.1 GCA946892155_00960 CDS open 8221-9345 _na     374_aa sigA RNA polymerase sigma factor SigA
1928 CAMPOI010000033.1 GCA946892155_00962 CDS open 9538-10221 _na     227_aa SAM-dependent methyltransferase
1929 CAMPOI010000033.1 GCA946892155_00963 CDS open 10218-11243 _na     341_aa Nif3-like dinuclear metal center hexameric protein
1930 CAMPOI010000033.1 GCA946892155_00965 CDS open 11711-11830 _na     39_aa hypothetical protein
1931 CAMPOI010000033.1 GCA946892155_00966 CDS open 11987-13477 _na     496_aa putP sodium/proline symporter PutP
1932 CAMPOI010000033.1 GCA946892155_00952 gene open 65-1741
1933 CAMPOI010000033.1 GCA946892155_00953 gene open 1738-2370
1934 CAMPOI010000033.1 GCA946892155_00954 gene open 2472-2900
1935 CAMPOI010000033.1 GCA946892155_00955 gene open 2921-3349
1936 CAMPOI010000033.1 GCA946892155_00956 gene open 3502-4695
1937 CAMPOI010000033.1 GCA946892155_00957 gene open 4714-5511
1938 CAMPOI010000033.1 GCA946892155_00958 gene open 5584-6300
1939 CAMPOI010000033.1 GCA946892155_00959 gene open 6397-8187
1940 CAMPOI010000033.1 GCA946892155_00960 gene open 8221-9345 sigA
1941 CAMPOI010000033.1 GCA946892155_00962 gene open 9538-10221
1942 CAMPOI010000033.1 GCA946892155_00963 gene open 10218-11243
1943 CAMPOI010000033.1 GCA946892155_00965 gene open 11711-11830
1944 CAMPOI010000033.1 GCA946892155_00966 gene open 11987-13477 putP
1945 CAMPOI010000033.1 GCA946892155_00961 gene open 9409-9483 trnI
1946 CAMPOI010000033.1 GCA946892155_00961 tRNA open 9409-9483 trnI tRNA-Ile2(cat)
1947 CAMPOI010000034.1 GCA946892155_00967 CDS open 13-756 _na     247_aa hypothetical protein
1948 CAMPOI010000034.1 GCA946892155_00968 CDS open 1177-2838 _na     553_aa Ribonuclease J
1949 CAMPOI010000034.1 GCA946892155_00969 CDS open 2888-3841 _na     317_aa DUF2232 domain-containing protein
1950 CAMPOI010000034.1 GCA946892155_00970 CDS open 3909-5894 _na     661_aa Cyclic-di-AMP phosphodiesterase
1951 CAMPOI010000034.1 GCA946892155_00971 CDS open 5897-6343 _na     148_aa rplI 50S ribosomal protein L9
1952 CAMPOI010000034.1 GCA946892155_00972 CDS open 6393-6545 _na     50_aa hypothetical protein
1953 CAMPOI010000034.1 GCA946892155_00973 CDS open 6754-8286 _na     510_aa AGCS family alanine or glycine:sodium (Na+) or proton (H+) symporter
1954 CAMPOI010000034.1 GCA946892155_00974 CDS open 8504-9892 _na     462_aa Arsenic transporter
1955 CAMPOI010000034.1 GCA946892155_00975 CDS open 10209-11576 _na     455_aa Na+/H+ antiporter
1956 CAMPOI010000034.1 GCA946892155_00967 gene open 13-756
1957 CAMPOI010000034.1 GCA946892155_00968 gene open 1177-2838
1958 CAMPOI010000034.1 GCA946892155_00969 gene open 2888-3841
1959 CAMPOI010000034.1 GCA946892155_00970 gene open 3909-5894
1960 CAMPOI010000034.1 GCA946892155_00971 gene open 5897-6343 rplI
1961 CAMPOI010000034.1 GCA946892155_00972 gene open 6393-6545
1962 CAMPOI010000034.1 GCA946892155_00973 gene open 6754-8286
1963 CAMPOI010000034.1 GCA946892155_00974 gene open 8504-9892
1964 CAMPOI010000034.1 GCA946892155_00975 gene open 10209-11576
1965 CAMPOI010000035.1 GCA946892155_00976 CDS open 10-264 _na     84_aa hypothetical protein
1966 CAMPOI010000035.1 GCA946892155_00977 CDS open 326-706 _na     126_aa Trimeric autotransporter adhesin YadA-like C-terminal membrane anchor domain-containing protein
1967 CAMPOI010000035.1 GCA946892155_00978 CDS open 733-837 _na     34_aa hypothetical protein
1968 CAMPOI010000035.1 GCA946892155_00979 CDS open 1103-1603 _na     166_aa Tfp pilus assembly protein FimT/FimU
1969 CAMPOI010000035.1 GCA946892155_00980 CDS open 1603-1971 _na     122_aa hypothetical protein
1970 CAMPOI010000035.1 GCA946892155_00981 CDS open 1968-2483 _na     171_aa type II secretion system protein
1971 CAMPOI010000035.1 GCA946892155_00982 CDS open 2476-2871 _na     131_aa pilX Type 4 fimbrial biogenesis protein PilX N-terminal domain-containing protein
1972 CAMPOI010000035.1 GCA946892155_00983 CDS open 2873-4192 _na     439_aa pilN Fimbrial assembly protein PilN
1973 CAMPOI010000035.1 GCA946892155_00984 CDS open 4185-4634 _na     149_aa Prepilin-type cleavage/methylation N-terminal domain protein
1974 CAMPOI010000035.1 GCA946892155_00985 CDS open 4637-5239 _na     200_aa Shikimate kinase
1975 CAMPOI010000035.1 GCA946892155_00986 CDS open 5243-6601 _na     452_aa CBS domain protein
1976 CAMPOI010000035.1 GCA946892155_00987 CDS open 6585-7022 _na     145_aa hypothetical protein
1977 CAMPOI010000035.1 GCA946892155_00988 CDS open 7218-7541 _na     107_aa trxA thioredoxin
1978 CAMPOI010000035.1 GCA946892155_00989 CDS open 7932-8693 _na     253_aa Sporulation initiation inhibitor protein Soj
1979 CAMPOI010000035.1 GCA946892155_00990 CDS open 8686-9537 _na     283_aa Chromosome partitioning protein SpoOJ
1980 CAMPOI010000035.1 GCA946892155_00991 CDS open 9539-10123 _na     194_aa DUF4446 domain-containing protein
1981 CAMPOI010000035.1 GCA946892155_00992 CDS open 10120-11013 _na     297_aa M23 peptidase domain protein
1982 CAMPOI010000035.1 GCA946892155_00993 CDS open 11063-11746 _na     227_aa DNA alkylation repair enzyme
1983 CAMPOI010000035.1 GCA946892155_00994 CDS open 12279-12716 _na     145_aa hypothetical protein
1984 CAMPOI010000035.1 GCA946892155_00976 gene open 10-264
1985 CAMPOI010000035.1 GCA946892155_00977 gene open 326-706
1986 CAMPOI010000035.1 GCA946892155_00978 gene open 733-837
1987 CAMPOI010000035.1 GCA946892155_00979 gene open 1103-1603
1988 CAMPOI010000035.1 GCA946892155_00980 gene open 1603-1971
1989 CAMPOI010000035.1 GCA946892155_00981 gene open 1968-2483
1990 CAMPOI010000035.1 GCA946892155_00982 gene open 2476-2871 pilX
1991 CAMPOI010000035.1 GCA946892155_00983 gene open 2873-4192 pilN
1992 CAMPOI010000035.1 GCA946892155_00984 gene open 4185-4634
1993 CAMPOI010000035.1 GCA946892155_00985 gene open 4637-5239
1994 CAMPOI010000035.1 GCA946892155_00986 gene open 5243-6601
1995 CAMPOI010000035.1 GCA946892155_00987 gene open 6585-7022
1996 CAMPOI010000035.1 GCA946892155_00988 gene open 7218-7541 trxA
1997 CAMPOI010000035.1 GCA946892155_00989 gene open 7932-8693
1998 CAMPOI010000035.1 GCA946892155_00990 gene open 8686-9537
1999 CAMPOI010000035.1 GCA946892155_00991 gene open 9539-10123
2000 CAMPOI010000035.1 GCA946892155_00992 gene open 10120-11013