BAKTAGenome Explorer: Sneathia sanguinegens (GCA_946997235.1)
Select a Genome:
|
BAKTA Annotations for GCA_946997235.1
|
Search & Sort all 2473 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CAMPUK010000001.1 | GCA946997235_00069 | gene | open | 74241-74502 | Bacteria_large_SRP | ||
| 2 | CAMPUK010000001.1 | GCA946997235_00070 | gene | open | 74293-74392 | Bacteria_small_SRP | ||
| 3 | CAMPUK010000001.1 | GCA946997235_00069 | ncRNA | open | 74241-74502 | Bacterial large signal recognition particle RNA | ||
| 4 | CAMPUK010000001.1 | GCA946997235_00070 | ncRNA | open | 74293-74392 | Bacterial small signal recognition particle RNA | ||
| 5 | CAMPUK010000001.1 | regulatory_region | open | 63568-63637 | S4-Fusobacteriales ribosomal protein leader | |||
| 6 | CAMPUK010000001.1 | GCA946997235_00001 | CDS | open | 71-781 | _na 236_aa | aminotransferase class V-fold PLP-dependent enzyme | |
| 7 | CAMPUK010000001.1 | GCA946997235_00002 | CDS | open | 759-1676 | _na 305_aa | pfkB | 1-phosphofructokinase |
| 8 | CAMPUK010000001.1 | GCA946997235_00003 | CDS | open | 1666-3525 | _na 619_aa | fructose-specific PTS transporter subunit EIIC | |
| 9 | CAMPUK010000001.1 | GCA946997235_00004 | CDS | open | 3555-4535 | _na 326_aa | tagatose 1%2C6-diphosphate aldolase | |
| 10 | CAMPUK010000001.1 | GCA946997235_00005 | CDS | open | 4549-5616 | _na 355_aa | SIS domain-containing protein | |
| 11 | CAMPUK010000001.1 | GCA946997235_00006 | CDS | open | 5906-10945 | _na 1679_aa | YadA-like family protein | |
| 12 | CAMPUK010000001.1 | GCA946997235_00007 | CDS | open | 11113-11616 | _na 167_aa | agaV | PTS N-acetylgalactosamine transporter subunit IIB |
| 13 | CAMPUK010000001.1 | GCA946997235_00008 | CDS | open | 11630-12391 | _na 253_aa | agaW | PTS N-acetylgalactosamine transporter subunit IIC |
| 14 | CAMPUK010000001.1 | GCA946997235_00009 | CDS | open | 12381-13202 | _na 273_aa | PTS system mannose/fructose/sorbose family transporter subunit IID | |
| 15 | CAMPUK010000001.1 | GCA946997235_00010 | CDS | open | 13202-13624 | _na 140_aa | PTS sugar transporter subunit IIA | |
| 16 | CAMPUK010000001.1 | GCA946997235_00011 | CDS | open | 13731-14738 | _na 335_aa | lacI | LacI family DNA-binding transcriptional regulator |
| 17 | CAMPUK010000001.1 | GCA946997235_00012 | CDS | open | 14854-15834 | _na 326_aa | bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase | |
| 18 | CAMPUK010000001.1 | GCA946997235_00013 | CDS | open | 15849-16490 | _na 213_aa | RpiB/LacA/LacB family sugar-phosphate isomerase | |
| 19 | CAMPUK010000001.1 | GCA946997235_00014 | CDS | open | 16511-17299 | _na 262_aa | gluconate 5-dehydrogenase | |
| 20 | CAMPUK010000001.1 | GCA946997235_00015 | CDS | open | 17312-17737 | _na 141_aa | PTS sugar transporter subunit IIA | |
| 21 | CAMPUK010000001.1 | GCA946997235_00016 | CDS | open | 17747-18931 | _na 394_aa | glycoside hydrolase family 88 protein | |
| 22 | CAMPUK010000001.1 | GCA946997235_00017 | CDS | open | 18945-19436 | _na 163_aa | PTS sugar transporter subunit IIB | |
| 23 | CAMPUK010000001.1 | GCA946997235_00018 | CDS | open | 19449-20219 | _na 256_aa | PTS sugar transporter subunit IIC | |
| 24 | CAMPUK010000001.1 | GCA946997235_00019 | CDS | open | 20209-21015 | _na 268_aa | PTS system mannose/fructose/sorbose family transporter subunit IID | |
| 25 | CAMPUK010000001.1 | GCA946997235_00020 | CDS | open | 21059-22813 | _na 584_aa | heparinase II/III family protein | |
| 26 | CAMPUK010000001.1 | GCA946997235_00021 | CDS | open | 22818-24785 | _na 655_aa | polysaccharide lyase 8 family protein | |
| 27 | CAMPUK010000001.1 | GCA946997235_00022 | CDS | open | 24855-25577 | _na 240_aa | gntR | GntR family transcriptional regulator |
| 28 | CAMPUK010000001.1 | GCA946997235_00023 | CDS | open | 25748-27010 | _na 420_aa | uraA | uracil permease |
| 29 | CAMPUK010000001.1 | GCA946997235_00024 | CDS | open | 27050-27613 | _na 187_aa | lemA | LemA family protein |
| 30 | CAMPUK010000001.1 | GCA946997235_00025 | CDS | open | 27733-28296 | _na 187_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 31 | CAMPUK010000001.1 | GCA946997235_00026 | CDS | open | 28309-28767 | _na 152_aa | tRNA (cytidine(34)-2'-O)-methyltransferase | |
| 32 | CAMPUK010000001.1 | GCA946997235_00027 | CDS | open | 28779-30650 | _na 623_aa | metG | methionine--tRNA ligase |
| 33 | CAMPUK010000001.1 | GCA946997235_00028 | CDS | open | 30647-31885 | _na 412_aa | lapB | lipopolysaccharide assembly protein LapB |
| 34 | CAMPUK010000001.1 | GCA946997235_00029 | CDS | open | 31895-32557 | _na 220_aa | tlpA | TlpA disulfide reductase family protein |
| 35 | CAMPUK010000001.1 | GCA946997235_00030 | CDS | open | 32761-34887 | _na 708_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 36 | CAMPUK010000001.1 | GCA946997235_00031 | CDS | open | 34884-35450 | _na 188_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 37 | CAMPUK010000001.1 | GCA946997235_00032 | CDS | open | 35502-35846 | _na 114_aa | Asp23/Gls24 family envelope stress response protein | |
| 38 | CAMPUK010000001.1 | GCA946997235_00033 | CDS | open | 35858-36445 | _na 195_aa | amaP | alkaline shock response membrane anchor protein AmaP |
| 39 | CAMPUK010000001.1 | GCA946997235_00034 | CDS | open | 36454-36852 | _na 132_aa | nusB | transcription antitermination factor NusB |
| 40 | CAMPUK010000001.1 | GCA946997235_00035 | CDS | open | 36854-38236 | _na 460_aa | PP2C family protein-serine/threonine phosphatase | |
| 41 | CAMPUK010000001.1 | GCA946997235_00036 | CDS | open | 38223-40223 | _na 666_aa | cation-translocating P-type ATPase | |
| 42 | CAMPUK010000001.1 | GCA946997235_00037 | CDS | open | 40220-41755 | _na 511_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 43 | CAMPUK010000001.1 | GCA946997235_00038 | CDS | open | 42112-43005 | _na 297_aa | ORF6N domain-containing protein | |
| 44 | CAMPUK010000001.1 | GCA946997235_00039 | CDS | open | 43135-44067 | _na 310_aa | hypothetical protein | |
| 45 | CAMPUK010000001.1 | GCA946997235_00040 | CDS | open | 44202-46103 | _na 633_aa | PTS sugar transporter subunit IIA | |
| 46 | CAMPUK010000001.1 | GCA946997235_00041 | CDS | open | 46105-46536 | _na 143_aa | PTS sugar transporter subunit IIA | |
| 47 | CAMPUK010000001.1 | GCA946997235_00042 | CDS | open | 46533-46814 | _na 93_aa | PTS sugar transporter subunit IIB | |
| 48 | CAMPUK010000001.1 | GCA946997235_00043 | CDS | open | 46827-48194 | _na 455_aa | PTS ascorbate transporter subunit IIC | |
| 49 | CAMPUK010000001.1 | GCA946997235_00044 | CDS | open | 48196-48903 | _na 235_aa | transaldolase | |
| 50 | CAMPUK010000001.1 | GCA946997235_00045 | CDS | open | 48947-49372 | _na 141_aa | hypothetical protein | |
| 51 | CAMPUK010000001.1 | GCA946997235_00046 | CDS | open | 49683-49802 | _na 39_aa | hypothetical protein | |
| 52 | CAMPUK010000001.1 | GCA946997235_00047 | CDS | open | 49806-51206 | _na 466_aa | SWIM zinc finger family protein | |
| 53 | CAMPUK010000001.1 | GCA946997235_00048 | CDS | open | 51212-52102 | _na 296_aa | tRNA-dihydrouridine synthase | |
| 54 | CAMPUK010000001.1 | GCA946997235_00049 | CDS | open | 52102-53013 | _na 303_aa | pseudouridine-5'-phosphate glycosidase | |
| 55 | CAMPUK010000001.1 | GCA946997235_00050 | CDS | open | 53003-54136 | _na 377_aa | carbohydrate kinase | |
| 56 | CAMPUK010000001.1 | GCA946997235_00051 | CDS | open | 54378-55229 | _na 283_aa | alpha/beta fold hydrolase | |
| 57 | CAMPUK010000001.1 | GCA946997235_00052 | CDS | open | 55241-56608 | _na 455_aa | NADP-dependent glyceraldehyde-3-phosphate dehydrogenase | |
| 58 | CAMPUK010000001.1 | GCA946997235_00053 | CDS | open | 56620-57573 | _na 317_aa | ROK family protein | |
| 59 | CAMPUK010000001.1 | GCA946997235_00054 | CDS | open | 57583-60768 | _na 1061_aa | hypothetical protein | |
| 60 | CAMPUK010000001.1 | GCA946997235_00055 | CDS | open | 61000-61719 | _na 239_aa | methionine ABC transporter ATP-binding protein | |
| 61 | CAMPUK010000001.1 | GCA946997235_00056 | CDS | open | 61712-62353 | _na 213_aa | methionine ABC transporter permease | |
| 62 | CAMPUK010000001.1 | GCA946997235_00057 | CDS | open | 62353-63069 | _na 238_aa | MetQ/NlpA family ABC transporter substrate-binding protein | |
| 63 | CAMPUK010000001.1 | GCA946997235_00058 | CDS | open | 63151-63387 | _na 78_aa | infA | translation initiation factor IF-1 |
| 64 | CAMPUK010000001.1 | GCA946997235_00059 | CDS | open | 63617-64033 | _na 138_aa | rpsM | 30S ribosomal protein S13 |
| 65 | CAMPUK010000001.1 | GCA946997235_00060 | CDS | open | 64057-64443 | _na 128_aa | rpsK | 30S ribosomal protein S11 |
| 66 | CAMPUK010000001.1 | GCA946997235_00061 | CDS | open | 64470-65057 | _na 195_aa | rpsD | 30S ribosomal protein S4 |
| 67 | CAMPUK010000001.1 | GCA946997235_00062 | CDS | open | 65106-66059 | _na 317_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 68 | CAMPUK010000001.1 | GCA946997235_00063 | CDS | open | 66082-66456 | _na 124_aa | rplQ | 50S ribosomal protein L17 |
| 69 | CAMPUK010000001.1 | GCA946997235_00064 | CDS | open | 66509-66955 | _na 148_aa | GNAT family N-acetyltransferase | |
| 70 | CAMPUK010000001.1 | GCA946997235_00065 | CDS | open | 66965-68878 | _na 637_aa | YadA-like family protein | |
| 71 | CAMPUK010000001.1 | GCA946997235_00066 | CDS | open | 68974-70884 | _na 636_aa | YadA-like family protein | |
| 72 | CAMPUK010000001.1 | GCA946997235_00067 | CDS | open | 70924-73071 | _na 715_aa | U32 family peptidase | |
| 73 | CAMPUK010000001.1 | GCA946997235_00068 | CDS | open | 73084-74220 | _na 378_aa | cation diffusion facilitator family transporter | |
| 74 | CAMPUK010000001.1 | GCA946997235_00071 | CDS | open | 74598-75863 | _na 421_aa | lepB | signal peptidase I |
| 75 | CAMPUK010000001.1 | GCA946997235_00072 | CDS | open | 75853-76227 | _na 124_aa | GNAT family N-acetyltransferase | |
| 76 | CAMPUK010000001.1 | GCA946997235_00073 | CDS | open | 76249-77427 | _na 392_aa | ROK family transcriptional regulator | |
| 77 | CAMPUK010000001.1 | GCA946997235_00074 | CDS | open | 77461-79038 | _na 525_aa | sppA | signal peptide peptidase SppA |
| 78 | CAMPUK010000001.1 | GCA946997235_00075 | CDS | open | 79113-80015 | _na 300_aa | DMT family transporter | |
| 79 | CAMPUK010000001.1 | GCA946997235_00076 | CDS | open | 80244-80996 | _na 250_aa | tpiA | triose-phosphate isomerase |
| 80 | CAMPUK010000001.1 | GCA946997235_00077 | CDS | open | 81006-81206 | _na 66_aa | secG | preprotein translocase subunit SecG |
| 81 | CAMPUK010000001.1 | GCA946997235_00078 | CDS | open | 81231-81512 | _na 93_aa | HU family DNA-binding protein | |
| 82 | CAMPUK010000001.1 | GCA946997235_00079 | CDS | open | 81630-83429 | _na 599_aa | lepA | translation elongation factor 4 |
| 83 | CAMPUK010000001.1 | GCA946997235_00080 | CDS | open | 83445-84047 | _na 200_aa | 3'-5' exonuclease | |
| 84 | CAMPUK010000001.1 | GCA946997235_00081 | CDS | open | 84049-84651 | _na 200_aa | trimeric intracellular cation channel family protein | |
| 85 | CAMPUK010000001.1 | GCA946997235_00082 | CDS | open | 84664-85284 | _na 206_aa | bifunctional 2-keto-4-hydroxyglutarate aldolase/2-keto-3-deoxy-6-phosphogluconate aldolase | |
| 86 | CAMPUK010000001.1 | GCA946997235_00083 | CDS | open | 85400-86731 | _na 443_aa | ClC family H(+)/Cl(-) exchange transporter | |
| 87 | CAMPUK010000001.1 | GCA946997235_00085 | CDS | open | 86938-87831 | _na 297_aa | lysR | LysR family transcriptional regulator |
| 88 | CAMPUK010000001.1 | GCA946997235_00086 | CDS | open | 87836-88993 | _na 385_aa | MalY/PatB family protein | |
| 89 | CAMPUK010000001.1 | GCA946997235_00087 | CDS | open | 89127-91307 | _na 726_aa | hypothetical protein | |
| 90 | CAMPUK010000001.1 | GCA946997235_00088 | CDS | open | 91406-91555 | _na 49_aa | rpmG | 50S ribosomal protein L33 |
| 91 | CAMPUK010000001.1 | GCA946997235_00090 | CDS | open | 91660-91869 | _na 69_aa | secE | preprotein translocase subunit SecE |
| 92 | CAMPUK010000001.1 | GCA946997235_00091 | CDS | open | 91881-92450 | _na 189_aa | nusG | transcription termination/antitermination protein NusG |
| 93 | CAMPUK010000001.1 | GCA946997235_00092 | CDS | open | 92499-92927 | _na 142_aa | rplK | 50S ribosomal protein L11 |
| 94 | CAMPUK010000001.1 | GCA946997235_00093 | CDS | open | 92977-93684 | _na 235_aa | rplA | 50S ribosomal protein L1 |
| 95 | CAMPUK010000001.1 | GCA946997235_00094 | CDS | open | 93745-95019 | _na 424_aa | hemolysin family protein | |
| 96 | CAMPUK010000001.1 | GCA946997235_00095 | CDS | open | 95043-96866 | _na 607_aa | typA | translational GTPase TypA |
| 97 | CAMPUK010000001.1 | GCA946997235_00096 | CDS | open | 96854-97267 | _na 137_aa | thioesterase family protein | |
| 98 | CAMPUK010000001.1 | GCA946997235_00097 | CDS | open | 97479-98348 | _na 289_aa | metal ABC transporter solute-binding protein%2C Zn/Mn family | |
| 99 | CAMPUK010000001.1 | GCA946997235_00098 | CDS | open | 98481-99065 | _na 194_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 100 | CAMPUK010000001.1 | GCA946997235_00099 | CDS | open | 99074-100066 | _na 330_aa | NAD(P)H-dependent glycerol-3-phosphate dehydrogenase | |
| 101 | CAMPUK010000001.1 | GCA946997235_00100 | CDS | open | 100075-100902 | _na 275_aa | RNA polymerase sigma factor RpoD/SigA | |
| 102 | CAMPUK010000001.1 | GCA946997235_00101 | CDS | open | 100905-102023 | _na 372_aa | dnaN | DNA polymerase III subunit beta |
| 103 | CAMPUK010000001.1 | GCA946997235_00102 | CDS | open | 102049-102531 | _na 160_aa | PTS glucose/sucrose transporter subunit IIB | |
| 104 | CAMPUK010000001.1 | GCA946997235_00103 | CDS | open | 102621-103127 | _na 168_aa | AmiS/UreI family transporter | |
| 105 | CAMPUK010000001.1 | GCA946997235_00104 | CDS | open | 103210-103569 | _na 119_aa | hypothetical protein | |
| 106 | CAMPUK010000001.1 | GCA946997235_00105 | CDS | open | 103544-104737 | _na 397_aa | thiI | tRNA uracil 4-sulfurtransferase ThiI |
| 107 | CAMPUK010000001.1 | GCA946997235_00106 | CDS | open | 104730-105902 | _na 390_aa | brkB | YihY/virulence factor BrkB family protein |
| 108 | CAMPUK010000001.1 | GCA946997235_00107 | CDS | open | 105889-107217 | _na 442_aa | rmuC | DNA recombination protein RmuC |
| 109 | CAMPUK010000001.1 | GCA946997235_00108 | CDS | open | 107192-107743 | _na 183_aa | chrA | Chromate transporter |
| 110 | CAMPUK010000001.1 | GCA946997235_00109 | CDS | open | 107737-108270 | _na 177_aa | chromate transporter | |
| 111 | CAMPUK010000001.1 | GCA946997235_00110 | CDS | open | 108263-108715 | _na 150_aa | dihydrofolate reductase | |
| 112 | CAMPUK010000001.1 | GCA946997235_00111 | CDS | open | 108718-111084 | _na 788_aa | mgtA | magnesium-translocating P-type ATPase |
| 113 | CAMPUK010000001.1 | GCA946997235_00112 | CDS | open | 111093-111560 | _na 155_aa | winged helix-turn-helix domain-containing protein | |
| 114 | CAMPUK010000001.1 | GCA946997235_00113 | CDS | open | 111644-114343 | _na 899_aa | mgtA | magnesium-translocating P-type ATPase |
| 115 | CAMPUK010000001.1 | GCA946997235_00114 | CDS | open | 114421-115806 | _na 461_aa | asnS | asparagine--tRNA ligase |
| 116 | CAMPUK010000001.1 | GCA946997235_00115 | CDS | open | 115815-116543 | _na 242_aa | lapB | lipopolysaccharide assembly protein LapB |
| 117 | CAMPUK010000001.1 | GCA946997235_00116 | CDS | open | 116554-117399 | _na 281_aa | dprA | DNA-processing protein DprA |
| 118 | CAMPUK010000001.1 | GCA946997235_00117 | CDS | open | 117350-119590 | _na 746_aa | topA | type I DNA topoisomerase |
| 119 | CAMPUK010000001.1 | GCA946997235_00118 | CDS | open | 119590-120498 | _na 302_aa | xerA | site-specific tyrosine recombinase/integron integrase |
| 120 | CAMPUK010000001.1 | GCA946997235_00119 | CDS | open | 120491-121609 | _na 372_aa | GTPase | |
| 121 | CAMPUK010000001.1 | GCA946997235_00120 | CDS | open | 121606-121716 | _na 36_aa | hypothetical protein | |
| 122 | CAMPUK010000001.1 | GCA946997235_00121 | CDS | open | 121706-122461 | _na 251_aa | MBL fold metallo-hydrolase | |
| 123 | CAMPUK010000001.1 | GCA946997235_00122 | CDS | open | 122467-123003 | _na 178_aa | uracil-DNA glycosylase family protein | |
| 124 | CAMPUK010000001.1 | GCA946997235_00123 | CDS | open | 123000-124103 | _na 367_aa | ychF | redox-regulated ATPase YchF |
| 125 | CAMPUK010000001.1 | GCA946997235_00124 | CDS | open | 124118-124939 | _na 273_aa | mechanosensitive ion channel family protein | |
| 126 | CAMPUK010000001.1 | GCA946997235_00125 | CDS | open | 124953-125570 | _na 205_aa | MBL fold metallo-hydrolase | |
| 127 | CAMPUK010000001.1 | GCA946997235_00126 | CDS | open | 125582-126199 | _na 205_aa | SIMPL domain-containing protein | |
| 128 | CAMPUK010000001.1 | GCA946997235_00127 | CDS | open | 126209-126781 | _na 190_aa | efp | elongation factor P |
| 129 | CAMPUK010000001.1 | GCA946997235_00128 | CDS | open | 126853-127647 | _na 264_aa | endonuclease/exonuclease/phosphatase family protein | |
| 130 | CAMPUK010000001.1 | GCA946997235_00129 | CDS | open | 127649-128962 | _na 437_aa | MATE family efflux transporter | |
| 131 | CAMPUK010000001.1 | GCA946997235_00130 | CDS | open | 128941-129555 | _na 204_aa | trmB | TrmB family transcriptional regulator |
| 132 | CAMPUK010000001.1 | GCA946997235_00131 | CDS | open | 129552-130217 | _na 221_aa | site-2 protease family protein | |
| 133 | CAMPUK010000001.1 | GCA946997235_00132 | CDS | open | 130231-131160 | _na 309_aa | nrnA | bifunctional oligoribonuclease/PAP phosphatase NrnA |
| 134 | CAMPUK010000001.1 | GCA946997235_00133 | CDS | open | 131148-131390 | _na 80_aa | hypothetical protein | |
| 135 | CAMPUK010000001.1 | GCA946997235_00134 | CDS | open | 131480-132751 | _na 423_aa | ABC transporter substrate-binding protein | |
| 136 | CAMPUK010000001.1 | GCA946997235_00135 | CDS | open | 132771-133643 | _na 290_aa | carbohydrate ABC transporter permease | |
| 137 | CAMPUK010000001.1 | GCA946997235_00136 | CDS | open | 133643-134455 | _na 270_aa | carbohydrate ABC transporter permease | |
| 138 | CAMPUK010000001.1 | GCA946997235_00137 | CDS | open | 134548-135315 | _na 255_aa | LCP family protein | |
| 139 | CAMPUK010000001.1 | GCA946997235_00138 | CDS | open | 135327-136127 | _na 266_aa | Cof-type HAD-IIB family hydrolase | |
| 140 | CAMPUK010000001.1 | GCA946997235_00001 | gene | open | 71-781 | |||
| 141 | CAMPUK010000001.1 | GCA946997235_00002 | gene | open | 759-1676 | pfkB | ||
| 142 | CAMPUK010000001.1 | GCA946997235_00003 | gene | open | 1666-3525 | |||
| 143 | CAMPUK010000001.1 | GCA946997235_00004 | gene | open | 3555-4535 | |||
| 144 | CAMPUK010000001.1 | GCA946997235_00005 | gene | open | 4549-5616 | |||
| 145 | CAMPUK010000001.1 | GCA946997235_00006 | gene | open | 5906-10945 | |||
| 146 | CAMPUK010000001.1 | GCA946997235_00007 | gene | open | 11113-11616 | agaV | ||
| 147 | CAMPUK010000001.1 | GCA946997235_00008 | gene | open | 11630-12391 | agaW | ||
| 148 | CAMPUK010000001.1 | GCA946997235_00009 | gene | open | 12381-13202 | |||
| 149 | CAMPUK010000001.1 | GCA946997235_00010 | gene | open | 13202-13624 | |||
| 150 | CAMPUK010000001.1 | GCA946997235_00011 | gene | open | 13731-14738 | lacI | ||
| 151 | CAMPUK010000001.1 | GCA946997235_00012 | gene | open | 14854-15834 | |||
| 152 | CAMPUK010000001.1 | GCA946997235_00013 | gene | open | 15849-16490 | |||
| 153 | CAMPUK010000001.1 | GCA946997235_00014 | gene | open | 16511-17299 | |||
| 154 | CAMPUK010000001.1 | GCA946997235_00015 | gene | open | 17312-17737 | |||
| 155 | CAMPUK010000001.1 | GCA946997235_00016 | gene | open | 17747-18931 | |||
| 156 | CAMPUK010000001.1 | GCA946997235_00017 | gene | open | 18945-19436 | |||
| 157 | CAMPUK010000001.1 | GCA946997235_00018 | gene | open | 19449-20219 | |||
| 158 | CAMPUK010000001.1 | GCA946997235_00019 | gene | open | 20209-21015 | |||
| 159 | CAMPUK010000001.1 | GCA946997235_00020 | gene | open | 21059-22813 | |||
| 160 | CAMPUK010000001.1 | GCA946997235_00021 | gene | open | 22818-24785 | |||
| 161 | CAMPUK010000001.1 | GCA946997235_00022 | gene | open | 24855-25577 | gntR | ||
| 162 | CAMPUK010000001.1 | GCA946997235_00023 | gene | open | 25748-27010 | uraA | ||
| 163 | CAMPUK010000001.1 | GCA946997235_00024 | gene | open | 27050-27613 | lemA | ||
| 164 | CAMPUK010000001.1 | GCA946997235_00025 | gene | open | 27733-28296 | ruvC | ||
| 165 | CAMPUK010000001.1 | GCA946997235_00026 | gene | open | 28309-28767 | |||
| 166 | CAMPUK010000001.1 | GCA946997235_00027 | gene | open | 28779-30650 | metG | ||
| 167 | CAMPUK010000001.1 | GCA946997235_00028 | gene | open | 30647-31885 | lapB | ||
| 168 | CAMPUK010000001.1 | GCA946997235_00029 | gene | open | 31895-32557 | tlpA | ||
| 169 | CAMPUK010000001.1 | GCA946997235_00030 | gene | open | 32761-34887 | nrdD | ||
| 170 | CAMPUK010000001.1 | GCA946997235_00031 | gene | open | 34884-35450 | nrdG | ||
| 171 | CAMPUK010000001.1 | GCA946997235_00032 | gene | open | 35502-35846 | |||
| 172 | CAMPUK010000001.1 | GCA946997235_00033 | gene | open | 35858-36445 | amaP | ||
| 173 | CAMPUK010000001.1 | GCA946997235_00034 | gene | open | 36454-36852 | nusB | ||
| 174 | CAMPUK010000001.1 | GCA946997235_00035 | gene | open | 36854-38236 | |||
| 175 | CAMPUK010000001.1 | GCA946997235_00036 | gene | open | 38223-40223 | |||
| 176 | CAMPUK010000001.1 | GCA946997235_00037 | gene | open | 40220-41755 | guaA | ||
| 177 | CAMPUK010000001.1 | GCA946997235_00038 | gene | open | 42112-43005 | |||
| 178 | CAMPUK010000001.1 | GCA946997235_00039 | gene | open | 43135-44067 | |||
| 179 | CAMPUK010000001.1 | GCA946997235_00040 | gene | open | 44202-46103 | |||
| 180 | CAMPUK010000001.1 | GCA946997235_00041 | gene | open | 46105-46536 | |||
| 181 | CAMPUK010000001.1 | GCA946997235_00042 | gene | open | 46533-46814 | |||
| 182 | CAMPUK010000001.1 | GCA946997235_00043 | gene | open | 46827-48194 | |||
| 183 | CAMPUK010000001.1 | GCA946997235_00044 | gene | open | 48196-48903 | |||
| 184 | CAMPUK010000001.1 | GCA946997235_00045 | gene | open | 48947-49372 | |||
| 185 | CAMPUK010000001.1 | GCA946997235_00046 | gene | open | 49683-49802 | |||
| 186 | CAMPUK010000001.1 | GCA946997235_00047 | gene | open | 49806-51206 | |||
| 187 | CAMPUK010000001.1 | GCA946997235_00048 | gene | open | 51212-52102 | |||
| 188 | CAMPUK010000001.1 | GCA946997235_00049 | gene | open | 52102-53013 | |||
| 189 | CAMPUK010000001.1 | GCA946997235_00050 | gene | open | 53003-54136 | |||
| 190 | CAMPUK010000001.1 | GCA946997235_00051 | gene | open | 54378-55229 | |||
| 191 | CAMPUK010000001.1 | GCA946997235_00052 | gene | open | 55241-56608 | |||
| 192 | CAMPUK010000001.1 | GCA946997235_00053 | gene | open | 56620-57573 | |||
| 193 | CAMPUK010000001.1 | GCA946997235_00054 | gene | open | 57583-60768 | |||
| 194 | CAMPUK010000001.1 | GCA946997235_00055 | gene | open | 61000-61719 | |||
| 195 | CAMPUK010000001.1 | GCA946997235_00056 | gene | open | 61712-62353 | |||
| 196 | CAMPUK010000001.1 | GCA946997235_00057 | gene | open | 62353-63069 | |||
| 197 | CAMPUK010000001.1 | GCA946997235_00058 | gene | open | 63151-63387 | infA | ||
| 198 | CAMPUK010000001.1 | GCA946997235_00059 | gene | open | 63617-64033 | rpsM | ||
| 199 | CAMPUK010000001.1 | GCA946997235_00060 | gene | open | 64057-64443 | rpsK | ||
| 200 | CAMPUK010000001.1 | GCA946997235_00061 | gene | open | 64470-65057 | rpsD | ||
| 201 | CAMPUK010000001.1 | GCA946997235_00062 | gene | open | 65106-66059 | rpoA | ||
| 202 | CAMPUK010000001.1 | GCA946997235_00063 | gene | open | 66082-66456 | rplQ | ||
| 203 | CAMPUK010000001.1 | GCA946997235_00064 | gene | open | 66509-66955 | |||
| 204 | CAMPUK010000001.1 | GCA946997235_00065 | gene | open | 66965-68878 | |||
| 205 | CAMPUK010000001.1 | GCA946997235_00066 | gene | open | 68974-70884 | |||
| 206 | CAMPUK010000001.1 | GCA946997235_00067 | gene | open | 70924-73071 | |||
| 207 | CAMPUK010000001.1 | GCA946997235_00068 | gene | open | 73084-74220 | |||
| 208 | CAMPUK010000001.1 | GCA946997235_00071 | gene | open | 74598-75863 | lepB | ||
| 209 | CAMPUK010000001.1 | GCA946997235_00072 | gene | open | 75853-76227 | |||
| 210 | CAMPUK010000001.1 | GCA946997235_00073 | gene | open | 76249-77427 | |||
| 211 | CAMPUK010000001.1 | GCA946997235_00074 | gene | open | 77461-79038 | sppA | ||
| 212 | CAMPUK010000001.1 | GCA946997235_00075 | gene | open | 79113-80015 | |||
| 213 | CAMPUK010000001.1 | GCA946997235_00076 | gene | open | 80244-80996 | tpiA | ||
| 214 | CAMPUK010000001.1 | GCA946997235_00077 | gene | open | 81006-81206 | secG | ||
| 215 | CAMPUK010000001.1 | GCA946997235_00078 | gene | open | 81231-81512 | |||
| 216 | CAMPUK010000001.1 | GCA946997235_00079 | gene | open | 81630-83429 | lepA | ||
| 217 | CAMPUK010000001.1 | GCA946997235_00080 | gene | open | 83445-84047 | |||
| 218 | CAMPUK010000001.1 | GCA946997235_00081 | gene | open | 84049-84651 | |||
| 219 | CAMPUK010000001.1 | GCA946997235_00082 | gene | open | 84664-85284 | |||
| 220 | CAMPUK010000001.1 | GCA946997235_00083 | gene | open | 85400-86731 | |||
| 221 | CAMPUK010000001.1 | GCA946997235_00085 | gene | open | 86938-87831 | lysR | ||
| 222 | CAMPUK010000001.1 | GCA946997235_00086 | gene | open | 87836-88993 | |||
| 223 | CAMPUK010000001.1 | GCA946997235_00087 | gene | open | 89127-91307 | |||
| 224 | CAMPUK010000001.1 | GCA946997235_00088 | gene | open | 91406-91555 | rpmG | ||
| 225 | CAMPUK010000001.1 | GCA946997235_00090 | gene | open | 91660-91869 | secE | ||
| 226 | CAMPUK010000001.1 | GCA946997235_00091 | gene | open | 91881-92450 | nusG | ||
| 227 | CAMPUK010000001.1 | GCA946997235_00092 | gene | open | 92499-92927 | rplK | ||
| 228 | CAMPUK010000001.1 | GCA946997235_00093 | gene | open | 92977-93684 | rplA | ||
| 229 | CAMPUK010000001.1 | GCA946997235_00094 | gene | open | 93745-95019 | |||
| 230 | CAMPUK010000001.1 | GCA946997235_00095 | gene | open | 95043-96866 | typA | ||
| 231 | CAMPUK010000001.1 | GCA946997235_00096 | gene | open | 96854-97267 | |||
| 232 | CAMPUK010000001.1 | GCA946997235_00097 | gene | open | 97479-98348 | |||
| 233 | CAMPUK010000001.1 | GCA946997235_00098 | gene | open | 98481-99065 | plsY | ||
| 234 | CAMPUK010000001.1 | GCA946997235_00099 | gene | open | 99074-100066 | |||
| 235 | CAMPUK010000001.1 | GCA946997235_00100 | gene | open | 100075-100902 | |||
| 236 | CAMPUK010000001.1 | GCA946997235_00101 | gene | open | 100905-102023 | dnaN | ||
| 237 | CAMPUK010000001.1 | GCA946997235_00102 | gene | open | 102049-102531 | |||
| 238 | CAMPUK010000001.1 | GCA946997235_00103 | gene | open | 102621-103127 | |||
| 239 | CAMPUK010000001.1 | GCA946997235_00104 | gene | open | 103210-103569 | |||
| 240 | CAMPUK010000001.1 | GCA946997235_00105 | gene | open | 103544-104737 | thiI | ||
| 241 | CAMPUK010000001.1 | GCA946997235_00106 | gene | open | 104730-105902 | brkB | ||
| 242 | CAMPUK010000001.1 | GCA946997235_00107 | gene | open | 105889-107217 | rmuC | ||
| 243 | CAMPUK010000001.1 | GCA946997235_00108 | gene | open | 107192-107743 | chrA | ||
| 244 | CAMPUK010000001.1 | GCA946997235_00109 | gene | open | 107737-108270 | |||
| 245 | CAMPUK010000001.1 | GCA946997235_00110 | gene | open | 108263-108715 | |||
| 246 | CAMPUK010000001.1 | GCA946997235_00111 | gene | open | 108718-111084 | mgtA | ||
| 247 | CAMPUK010000001.1 | GCA946997235_00112 | gene | open | 111093-111560 | |||
| 248 | CAMPUK010000001.1 | GCA946997235_00113 | gene | open | 111644-114343 | mgtA | ||
| 249 | CAMPUK010000001.1 | GCA946997235_00114 | gene | open | 114421-115806 | asnS | ||
| 250 | CAMPUK010000001.1 | GCA946997235_00115 | gene | open | 115815-116543 | lapB | ||
| 251 | CAMPUK010000001.1 | GCA946997235_00116 | gene | open | 116554-117399 | dprA | ||
| 252 | CAMPUK010000001.1 | GCA946997235_00117 | gene | open | 117350-119590 | topA | ||
| 253 | CAMPUK010000001.1 | GCA946997235_00118 | gene | open | 119590-120498 | xerA | ||
| 254 | CAMPUK010000001.1 | GCA946997235_00119 | gene | open | 120491-121609 | |||
| 255 | CAMPUK010000001.1 | GCA946997235_00120 | gene | open | 121606-121716 | |||
| 256 | CAMPUK010000001.1 | GCA946997235_00121 | gene | open | 121706-122461 | |||
| 257 | CAMPUK010000001.1 | GCA946997235_00122 | gene | open | 122467-123003 | |||
| 258 | CAMPUK010000001.1 | GCA946997235_00123 | gene | open | 123000-124103 | ychF | ||
| 259 | CAMPUK010000001.1 | GCA946997235_00124 | gene | open | 124118-124939 | |||
| 260 | CAMPUK010000001.1 | GCA946997235_00125 | gene | open | 124953-125570 | |||
| 261 | CAMPUK010000001.1 | GCA946997235_00126 | gene | open | 125582-126199 | |||
| 262 | CAMPUK010000001.1 | GCA946997235_00127 | gene | open | 126209-126781 | efp | ||
| 263 | CAMPUK010000001.1 | GCA946997235_00128 | gene | open | 126853-127647 | |||
| 264 | CAMPUK010000001.1 | GCA946997235_00129 | gene | open | 127649-128962 | |||
| 265 | CAMPUK010000001.1 | GCA946997235_00130 | gene | open | 128941-129555 | trmB | ||
| 266 | CAMPUK010000001.1 | GCA946997235_00131 | gene | open | 129552-130217 | |||
| 267 | CAMPUK010000001.1 | GCA946997235_00132 | gene | open | 130231-131160 | nrnA | ||
| 268 | CAMPUK010000001.1 | GCA946997235_00133 | gene | open | 131148-131390 | |||
| 269 | CAMPUK010000001.1 | GCA946997235_00134 | gene | open | 131480-132751 | |||
| 270 | CAMPUK010000001.1 | GCA946997235_00135 | gene | open | 132771-133643 | |||
| 271 | CAMPUK010000001.1 | GCA946997235_00136 | gene | open | 133643-134455 | |||
| 272 | CAMPUK010000001.1 | GCA946997235_00137 | gene | open | 134548-135315 | |||
| 273 | CAMPUK010000001.1 | GCA946997235_00138 | gene | open | 135327-136127 | |||
| 274 | CAMPUK010000001.1 | GCA946997235_00084 | gene | open | 86831-86907 | trnM | ||
| 275 | CAMPUK010000001.1 | GCA946997235_00089 | gene | open | 91561-91636 | trnW | ||
| 276 | CAMPUK010000001.1 | GCA946997235_00084 | tRNA | open | 86831-86907 | trnM | tRNA-Met(cat) | |
| 277 | CAMPUK010000001.1 | GCA946997235_00089 | tRNA | open | 91561-91636 | trnW | tRNA-Trp(cca) | |
| 278 | CAMPUK010000002.1 | GCA946997235_00159 | gene | open | 21243-21571 | ssrA | ||
| 279 | CAMPUK010000002.1 | GCA946997235_00159 | tmRNA | open | 21243-21571 | ssrA | transfer-messenger RNA%2C SsrA | |
| 280 | CAMPUK010000002.1 | GCA946997235_00225 | gene | open | 83502-83588 | skipping-rope | ||
| 281 | CAMPUK010000002.1 | GCA946997235_00225 | ncRNA | open | 83502-83588 | skipping-rope RNA | ||
| 282 | CAMPUK010000002.1 | regulatory_region | open | 93781-93854 | Fluoride riboswitch aptamer (crcB RNA motif) | |||
| 283 | CAMPUK010000002.1 | repeat_region | open | 576-1139 | CRISPR array with 9 repeats of length 36%2C consensus sequence ATTTGAAAGCATATTTTAATTTCTACTATTGTAGAT and spacer length 26 | |||
| 284 | CAMPUK010000002.1 | GCA946997235_00139 | CDS | open | 149-421 | _na 90_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 285 | CAMPUK010000002.1 | GCA946997235_00140 | CDS | open | 1379-1879 | _na 166_aa | hypothetical protein | |
| 286 | CAMPUK010000002.1 | GCA946997235_00141 | CDS | open | 1904-2854 | _na 316_aa | araC | AraC family transcriptional regulator |
| 287 | CAMPUK010000002.1 | GCA946997235_00142 | CDS | open | 3000-4754 | _na 584_aa | mdlB | ABC transporter ATP-binding protein |
| 288 | CAMPUK010000002.1 | GCA946997235_00143 | CDS | open | 4738-6459 | _na 573_aa | ABC transporter ATP-binding protein | |
| 289 | CAMPUK010000002.1 | GCA946997235_00144 | CDS | open | 6573-7040 | _na 155_aa | rimP | ribosome maturation factor RimP |
| 290 | CAMPUK010000002.1 | GCA946997235_00145 | CDS | open | 7030-8109 | _na 359_aa | nusA | transcription termination factor NusA |
| 291 | CAMPUK010000002.1 | GCA946997235_00146 | CDS | open | 8099-8377 | _na 92_aa | ylxR | YlxR family protein |
| 292 | CAMPUK010000002.1 | GCA946997235_00147 | CDS | open | 8361-10856 | _na 831_aa | infB | translation initiation factor IF-2 |
| 293 | CAMPUK010000002.1 | GCA946997235_00148 | CDS | open | 10857-11210 | _na 117_aa | rbfA | 30S ribosome-binding factor RbfA |
| 294 | CAMPUK010000002.1 | GCA946997235_00149 | CDS | open | 11249-12526 | _na 425_aa | tig | trigger factor |
| 295 | CAMPUK010000002.1 | GCA946997235_00150 | CDS | open | 12537-13109 | _na 190_aa | clpP | ATP-dependent Clp protease proteolytic subunit |
| 296 | CAMPUK010000002.1 | GCA946997235_00151 | CDS | open | 13127-14338 | _na 403_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 297 | CAMPUK010000002.1 | GCA946997235_00152 | CDS | open | 14350-16671 | _na 773_aa | lon | endopeptidase La |
| 298 | CAMPUK010000002.1 | GCA946997235_00153 | CDS | open | 16668-16922 | _na 84_aa | yajC | preprotein translocase subunit YajC |
| 299 | CAMPUK010000002.1 | GCA946997235_00154 | CDS | open | 16925-17953 | _na 342_aa | N-acetylmuramoyl-L-alanine amidase | |
| 300 | CAMPUK010000002.1 | GCA946997235_00155 | CDS | open | 17962-18414 | _na 150_aa | GerMN domain-containing protein | |
| 301 | CAMPUK010000002.1 | GCA946997235_00156 | CDS | open | 18459-19019 | _na 186_aa | yqeK | bis(5'-nucleosyl)-tetraphosphatase (symmetrical) YqeK |
| 302 | CAMPUK010000002.1 | GCA946997235_00157 | CDS | open | 19009-20811 | _na 600_aa | ribonuclease R family protein | |
| 303 | CAMPUK010000002.1 | GCA946997235_00158 | CDS | open | 20792-21226 | _na 144_aa | smpB | SsrA-binding protein SmpB |
| 304 | CAMPUK010000002.1 | GCA946997235_00160 | CDS | open | 21640-23067 | _na 475_aa | nicotinate phosphoribosyltransferase | |
| 305 | CAMPUK010000002.1 | GCA946997235_00161 | CDS | open | 23083-24048 | _na 321_aa | trpS | tryptophan--tRNA ligase |
| 306 | CAMPUK010000002.1 | GCA946997235_00162 | CDS | open | 24045-24935 | _na 296_aa | DNA polymerase III delta N-terminal domain-containing protein | |
| 307 | CAMPUK010000002.1 | GCA946997235_00163 | CDS | open | 24943-25764 | _na 273_aa | pseudouridylate synthase | |
| 308 | CAMPUK010000002.1 | GCA946997235_00164 | CDS | open | 25757-26374 | _na 205_aa | putative ABC transporter permease | |
| 309 | CAMPUK010000002.1 | GCA946997235_00165 | CDS | open | 26387-26851 | _na 154_aa | C40 family peptidase | |
| 310 | CAMPUK010000002.1 | GCA946997235_00166 | CDS | open | 26968-28149 | _na 393_aa | M20 family metallopeptidase | |
| 311 | CAMPUK010000002.1 | GCA946997235_00167 | CDS | open | 28143-29498 | _na 451_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 312 | CAMPUK010000002.1 | GCA946997235_00168 | CDS | open | 29724-31202 | _na 492_aa | lsa | Lsa family ABC-F type ribosomal protection protein |
| 313 | CAMPUK010000002.1 | GCA946997235_00169 | CDS | open | 31414-31590 | _na 58_aa | hypothetical protein | |
| 314 | CAMPUK010000002.1 | GCA946997235_00170 | CDS | open | 31842-32045 | _na 67_aa | hypothetical protein | |
| 315 | CAMPUK010000002.1 | GCA946997235_00171 | CDS | open | 32167-32340 | _na 57_aa | hypothetical protein | |
| 316 | CAMPUK010000002.1 | GCA946997235_00172 | CDS | open | 32353-33162 | _na 269_aa | ADP-ribosylglycohydrolase family protein | |
| 317 | CAMPUK010000002.1 | GCA946997235_00173 | CDS | open | 33607-33819 | _na 70_aa | N-6 DNA methylase | |
| 318 | CAMPUK010000002.1 | GCA946997235_00174 | CDS | open | 34441-34683 | _na 80_aa | hypothetical protein | |
| 319 | CAMPUK010000002.1 | GCA946997235_00175 | CDS | open | 34631-34789 | _na 52_aa | hypothetical protein | |
| 320 | CAMPUK010000002.1 | GCA946997235_00176 | CDS | open | 34914-35471 | _na 185_aa | Type III toxin-antitoxin system ToxN/AbiQ family toxin | |
| 321 | CAMPUK010000002.1 | GCA946997235_00177 | CDS | open | 35736-35906 | _na 56_aa | tnpW | Transposon-encoded protein TnpW |
| 322 | CAMPUK010000002.1 | GCA946997235_00178 | CDS | open | 35959-36279 | _na 106_aa | DNA topoisomerase type IA central domain-containing protein | |
| 323 | CAMPUK010000002.1 | GCA946997235_00179 | CDS | open | 36363-36548 | _na 61_aa | AbrB/MazE/SpoVT family DNA-binding domain-containing protein | |
| 324 | CAMPUK010000002.1 | GCA946997235_00180 | CDS | open | 36582-37613 | _na 343_aa | yhcG | Conjugative transposon protein |
| 325 | CAMPUK010000002.1 | GCA946997235_00181 | CDS | open | 37635-38279 | _na 214_aa | hypothetical protein | |
| 326 | CAMPUK010000002.1 | GCA946997235_00182 | CDS | open | 38512-38697 | _na 61_aa | hypothetical protein | |
| 327 | CAMPUK010000002.1 | GCA946997235_00183 | CDS | open | 38702-38893 | _na 63_aa | hypothetical protein | |
| 328 | CAMPUK010000002.1 | GCA946997235_00184 | CDS | open | 39223-39471 | _na 82_aa | replication initiator protein A | |
| 329 | CAMPUK010000002.1 | GCA946997235_00185 | CDS | open | 40149-40754 | _na 201_aa | cadD | Cadmium resistance protein CadD |
| 330 | CAMPUK010000002.1 | GCA946997235_00186 | CDS | open | 41827-42006 | _na 59_aa | tail tape measure protein | |
| 331 | CAMPUK010000002.1 | GCA946997235_00187 | CDS | open | 42093-43136 | _na 347_aa | Fic family protein | |
| 332 | CAMPUK010000002.1 | GCA946997235_00188 | CDS | open | 43216-43890 | _na 224_aa | DNA alkylation repair protein | |
| 333 | CAMPUK010000002.1 | GCA946997235_00189 | CDS | open | 43915-44331 | _na 138_aa | HD domain-containing protein | |
| 334 | CAMPUK010000002.1 | GCA946997235_00190 | CDS | open | 44504-45370 | _na 288_aa | bifunctional riboflavin kinase/FAD synthetase | |
| 335 | CAMPUK010000002.1 | GCA946997235_00191 | CDS | open | 45351-46043 | _na 230_aa | scpA | ScpA family protein |
| 336 | CAMPUK010000002.1 | GCA946997235_00192 | CDS | open | 46036-47499 | _na 487_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 337 | CAMPUK010000002.1 | GCA946997235_00193 | CDS | open | 47514-48623 | _na 369_aa | tolC | TolC family protein |
| 338 | CAMPUK010000002.1 | GCA946997235_00194 | CDS | open | 48631-49689 | _na 352_aa | efflux RND transporter periplasmic adaptor subunit | |
| 339 | CAMPUK010000002.1 | GCA946997235_00195 | CDS | open | 49689-50381 | _na 230_aa | ABC transporter ATP-binding protein | |
| 340 | CAMPUK010000002.1 | GCA946997235_00196 | CDS | open | 50381-51592 | _na 403_aa | ABC transporter permease | |
| 341 | CAMPUK010000002.1 | GCA946997235_00197 | CDS | open | 51699-52205 | _na 168_aa | hypothetical protein | |
| 342 | CAMPUK010000002.1 | GCA946997235_00198 | CDS | open | 52220-53245 | _na 341_aa | dLH | Acyl-CoA thioesterase |
| 343 | CAMPUK010000002.1 | GCA946997235_00199 | CDS | open | 53495-54823 | _na 442_aa | bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase | |
| 344 | CAMPUK010000002.1 | GCA946997235_00200 | CDS | open | 54820-55704 | _na 294_aa | galU | UTP--glucose-1-phosphate uridylyltransferase GalU |
| 345 | CAMPUK010000002.1 | GCA946997235_00201 | CDS | open | 55655-56545 | _na 296_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 346 | CAMPUK010000002.1 | GCA946997235_00202 | CDS | open | 56585-58072 | _na 495_aa | walK | cell wall metabolism sensor histidine kinase WalK |
| 347 | CAMPUK010000002.1 | GCA946997235_00203 | CDS | open | 58069-58740 | _na 223_aa | response regulator transcription factor | |
| 348 | CAMPUK010000002.1 | GCA946997235_00204 | CDS | open | 58750-60009 | _na 419_aa | U32 family peptidase | |
| 349 | CAMPUK010000002.1 | GCA946997235_00205 | CDS | open | 60006-61376 | _na 456_aa | dnaB | replicative DNA helicase |
| 350 | CAMPUK010000002.1 | GCA946997235_00206 | CDS | open | 61379-61831 | _na 150_aa | rplI | 50S ribosomal protein L9 |
| 351 | CAMPUK010000002.1 | GCA946997235_00207 | CDS | open | 61850-63214 | _na 454_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 352 | CAMPUK010000002.1 | GCA946997235_00208 | CDS | open | 63225-63905 | _na 226_aa | DUF4375 domain-containing protein | |
| 353 | CAMPUK010000002.1 | GCA946997235_00209 | CDS | open | 63905-64693 | _na 262_aa | hypothetical protein | |
| 354 | CAMPUK010000002.1 | GCA946997235_00210 | CDS | open | 64695-65393 | _na 232_aa | pseudouridine synthase | |
| 355 | CAMPUK010000002.1 | GCA946997235_00211 | CDS | open | 65462-65854 | _na 130_aa | hypothetical protein | |
| 356 | CAMPUK010000002.1 | GCA946997235_00212 | CDS | open | 65860-66534 | _na 224_aa | tRNA threonylcarbamoyladenosine dehydratase | |
| 357 | CAMPUK010000002.1 | GCA946997235_00213 | CDS | open | 66534-69242 | _na 902_aa | ABC transporter permease | |
| 358 | CAMPUK010000002.1 | GCA946997235_00214 | CDS | open | 69245-69928 | _na 227_aa | ABC transporter ATP-binding protein | |
| 359 | CAMPUK010000002.1 | GCA946997235_00215 | CDS | open | 69930-70448 | _na 172_aa | hypothetical protein | |
| 360 | CAMPUK010000002.1 | GCA946997235_00216 | CDS | open | 70457-71452 | _na 331_aa | thymidine kinase | |
| 361 | CAMPUK010000002.1 | GCA946997235_00217 | CDS | open | 71556-72284 | _na 242_aa | HAD family phosphatase | |
| 362 | CAMPUK010000002.1 | GCA946997235_00218 | CDS | open | 72315-73760 | _na 481_aa | hypothetical protein | |
| 363 | CAMPUK010000002.1 | GCA946997235_00219 | CDS | open | 73773-78785 | _na 1670_aa | S8 family serine peptidase | |
| 364 | CAMPUK010000002.1 | GCA946997235_00220 | CDS | open | 78794-80857 | _na 687_aa | hypothetical protein | |
| 365 | CAMPUK010000002.1 | GCA946997235_00221 | CDS | open | 81103-81462 | _na 119_aa | DUF2513 domain-containing protein | |
| 366 | CAMPUK010000002.1 | GCA946997235_00222 | CDS | open | 81577-82047 | _na 156_aa | Panacea domain-containing protein | |
| 367 | CAMPUK010000002.1 | GCA946997235_00223 | CDS | open | 82113-82322 | _na 69_aa | hypothetical protein | |
| 368 | CAMPUK010000002.1 | GCA946997235_00224 | CDS | open | 82338-83351 | _na 337_aa | minor capsid protein | |
| 369 | CAMPUK010000002.1 | GCA946997235_00226 | CDS | open | 83626-83793 | _na 55_aa | hypothetical protein | |
| 370 | CAMPUK010000002.1 | GCA946997235_00227 | CDS | open | 83765-83938 | _na 57_aa | hypothetical protein | |
| 371 | CAMPUK010000002.1 | GCA946997235_00228 | CDS | open | 84066-84374 | _na 102_aa | hypothetical protein | |
| 372 | CAMPUK010000002.1 | GCA946997235_00229 | CDS | open | 84367-84957 | _na 196_aa | ADP-ribosyltransferase | |
| 373 | CAMPUK010000002.1 | GCA946997235_00230 | CDS | open | 85255-85614 | _na 119_aa | DUF2513 domain-containing protein | |
| 374 | CAMPUK010000002.1 | GCA946997235_00231 | CDS | open | 85662-85856 | _na 64_aa | hypothetical protein | |
| 375 | CAMPUK010000002.1 | GCA946997235_00232 | CDS | open | 85858-86742 | _na 294_aa | polymorphic toxin type 50 domain-containing protein | |
| 376 | CAMPUK010000002.1 | GCA946997235_00233 | CDS | open | 86962-88548 | _na 528_aa | ABC-F family ATP-binding cassette domain-containing protein | |
| 377 | CAMPUK010000002.1 | GCA946997235_00234 | CDS | open | 88586-88999 | _na 137_aa | CPBP family intramembrane glutamic endopeptidase | |
| 378 | CAMPUK010000002.1 | GCA946997235_00235 | CDS | open | 88955-91084 | _na 709_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 379 | CAMPUK010000002.1 | GCA946997235_00236 | CDS | open | 91084-91485 | _na 133_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 380 | CAMPUK010000002.1 | GCA946997235_00237 | CDS | open | 91488-92498 | _na 336_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 381 | CAMPUK010000002.1 | GCA946997235_00238 | CDS | open | 92598-93743 | _na 381_aa | cation:proton antiporter | |
| 382 | CAMPUK010000002.1 | GCA946997235_00239 | CDS | open | 93879-94679 | _na 266_aa | HAD hydrolase-like protein | |
| 383 | CAMPUK010000002.1 | GCA946997235_00240 | CDS | open | 94669-96129 | _na 486_aa | MFS transporter | |
| 384 | CAMPUK010000002.1 | GCA946997235_00241 | CDS | open | 96098-96907 | _na 269_aa | SDR family oxidoreductase | |
| 385 | CAMPUK010000002.1 | GCA946997235_00242 | CDS | open | 96907-97959 | _na 350_aa | uxuA | mannonate dehydratase |
| 386 | CAMPUK010000002.1 | GCA946997235_00243 | CDS | open | 97956-99416 | _na 486_aa | uxaC | glucuronate isomerase |
| 387 | CAMPUK010000002.1 | GCA946997235_00244 | CDS | open | 99509-102193 | _na 894_aa | UvrD-helicase domain-containing protein | |
| 388 | CAMPUK010000002.1 | GCA946997235_00245 | CDS | open | 102183-104483 | _na 766_aa | PD-(D/E)XK endonuclease-like domain-containing protein | |
| 389 | CAMPUK010000002.1 | GCA946997235_00246 | CDS | open | 104494-108771 | _na 1425_aa | PolC-type DNA polymerase III | |
| 390 | CAMPUK010000002.1 | GCA946997235_00247 | CDS | open | 108759-109427 | _na 222_aa | deoxynucleoside kinase | |
| 391 | CAMPUK010000002.1 | GCA946997235_00248 | CDS | open | 109466-110713 | _na 415_aa | adenylosuccinate synthase | |
| 392 | CAMPUK010000002.1 | GCA946997235_00249 | CDS | open | 110715-110957 | _na 80_aa | KH domain-containing protein | |
| 393 | CAMPUK010000002.1 | GCA946997235_00250 | CDS | open | 110957-111199 | _na 80_aa | DUF4911 domain-containing protein | |
| 394 | CAMPUK010000002.1 | GCA946997235_00251 | CDS | open | 111186-111956 | _na 256_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 395 | CAMPUK010000002.1 | GCA946997235_00252 | CDS | open | 111949-112503 | _na 184_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 396 | CAMPUK010000002.1 | GCA946997235_00253 | CDS | open | 112565-113260 | _na 231_aa | TIGR02206 family membrane protein | |
| 397 | CAMPUK010000002.1 | GCA946997235_00254 | CDS | open | 113272-113859 | _na 195_aa | ruvA | Holliday junction branch migration protein RuvA |
| 398 | CAMPUK010000002.1 | GCA946997235_00255 | CDS | open | 113825-114562 | _na 245_aa | murI | glutamate racemase |
| 399 | CAMPUK010000002.1 | GCA946997235_00256 | CDS | open | 114564-115373 | _na 269_aa | Cof-type HAD-IIB family hydrolase | |
| 400 | CAMPUK010000002.1 | GCA946997235_00257 | CDS | open | 115373-116185 | _na 270_aa | hypothetical protein | |
| 401 | CAMPUK010000002.1 | GCA946997235_00258 | CDS | open | 116187-117218 | _na 343_aa | rod shape-determining protein | |
| 402 | CAMPUK010000002.1 | GCA946997235_00259 | CDS | open | 117215-118576 | _na 453_aa | cysS | cysteine--tRNA ligase |
| 403 | CAMPUK010000002.1 | GCA946997235_00260 | CDS | open | 118593-120938 | _na 781_aa | mutS2 | endonuclease MutS2 |
| 404 | CAMPUK010000002.1 | GCA946997235_00261 | CDS | open | 120949-122025 | _na 358_aa | D-alanyl-D-alanine carboxypeptidase family protein | |
| 405 | CAMPUK010000002.1 | GCA946997235_00262 | CDS | open | 122182-122478 | _na 98_aa | rplU | 50S ribosomal protein L21 |
| 406 | CAMPUK010000002.1 | GCA946997235_00263 | CDS | open | 122483-122800 | _na 105_aa | ribosomal-processing cysteine protease Prp | |
| 407 | CAMPUK010000002.1 | GCA946997235_00264 | CDS | open | 122803-123087 | _na 94_aa | rpmA | 50S ribosomal protein L27 |
| 408 | CAMPUK010000002.1 | GCA946997235_00265 | CDS | open | 123132-123743 | _na 203_aa | nth | endonuclease III |
| 409 | CAMPUK010000002.1 | GCA946997235_00266 | CDS | open | 123764-124633 | _na 289_aa | thyA | thymidylate synthase |
| 410 | CAMPUK010000002.1 | GCA946997235_00267 | CDS | open | 124620-125483 | _na 287_aa | bifunctional 5%2C10-methylenetetrahydrofolate dehydrogenase/5%2C10-methenyltetrahydrofolate cyclohydrolase | |
| 411 | CAMPUK010000002.1 | GCA946997235_00268 | CDS | open | 125529-125879 | _na 116_aa | rplT | 50S ribosomal protein L20 |
| 412 | CAMPUK010000002.1 | GCA946997235_00269 | CDS | open | 125894-126100 | _na 68_aa | rpmI | 50S ribosomal protein L35 |
| 413 | CAMPUK010000002.1 | GCA946997235_00270 | CDS | open | 126114-126647 | _na 177_aa | infC | translation initiation factor IF-3 |
| 414 | CAMPUK010000002.1 | GCA946997235_00271 | CDS | open | 126812-127471 | _na 219_aa | peptidylprolyl isomerase | |
| 415 | CAMPUK010000002.1 | GCA946997235_00272 | CDS | open | 127468-127836 | _na 122_aa | DUF2726 domain-containing protein | |
| 416 | CAMPUK010000002.1 | GCA946997235_00273 | CDS | open | 127984-128403 | _na 139_aa | tnpB | RNA-guided endonuclease TnpB family protein |
| 417 | CAMPUK010000002.1 | GCA946997235_00274 | CDS | open | 129459-130076 | _na 205_aa | restriction endonuclease subunit S | |
| 418 | CAMPUK010000002.1 | GCA946997235_00139 | gene | open | 149-421 | cas2 | ||
| 419 | CAMPUK010000002.1 | GCA946997235_00140 | gene | open | 1379-1879 | |||
| 420 | CAMPUK010000002.1 | GCA946997235_00141 | gene | open | 1904-2854 | araC | ||
| 421 | CAMPUK010000002.1 | GCA946997235_00142 | gene | open | 3000-4754 | mdlB | ||
| 422 | CAMPUK010000002.1 | GCA946997235_00143 | gene | open | 4738-6459 | |||
| 423 | CAMPUK010000002.1 | GCA946997235_00144 | gene | open | 6573-7040 | rimP | ||
| 424 | CAMPUK010000002.1 | GCA946997235_00145 | gene | open | 7030-8109 | nusA | ||
| 425 | CAMPUK010000002.1 | GCA946997235_00146 | gene | open | 8099-8377 | ylxR | ||
| 426 | CAMPUK010000002.1 | GCA946997235_00147 | gene | open | 8361-10856 | infB | ||
| 427 | CAMPUK010000002.1 | GCA946997235_00148 | gene | open | 10857-11210 | rbfA | ||
| 428 | CAMPUK010000002.1 | GCA946997235_00149 | gene | open | 11249-12526 | tig | ||
| 429 | CAMPUK010000002.1 | GCA946997235_00150 | gene | open | 12537-13109 | clpP | ||
| 430 | CAMPUK010000002.1 | GCA946997235_00151 | gene | open | 13127-14338 | clpX | ||
| 431 | CAMPUK010000002.1 | GCA946997235_00152 | gene | open | 14350-16671 | lon | ||
| 432 | CAMPUK010000002.1 | GCA946997235_00153 | gene | open | 16668-16922 | yajC | ||
| 433 | CAMPUK010000002.1 | GCA946997235_00154 | gene | open | 16925-17953 | |||
| 434 | CAMPUK010000002.1 | GCA946997235_00155 | gene | open | 17962-18414 | |||
| 435 | CAMPUK010000002.1 | GCA946997235_00156 | gene | open | 18459-19019 | yqeK | ||
| 436 | CAMPUK010000002.1 | GCA946997235_00157 | gene | open | 19009-20811 | |||
| 437 | CAMPUK010000002.1 | GCA946997235_00158 | gene | open | 20792-21226 | smpB | ||
| 438 | CAMPUK010000002.1 | GCA946997235_00160 | gene | open | 21640-23067 | |||
| 439 | CAMPUK010000002.1 | GCA946997235_00161 | gene | open | 23083-24048 | trpS | ||
| 440 | CAMPUK010000002.1 | GCA946997235_00162 | gene | open | 24045-24935 | |||
| 441 | CAMPUK010000002.1 | GCA946997235_00163 | gene | open | 24943-25764 | |||
| 442 | CAMPUK010000002.1 | GCA946997235_00164 | gene | open | 25757-26374 | |||
| 443 | CAMPUK010000002.1 | GCA946997235_00165 | gene | open | 26387-26851 | |||
| 444 | CAMPUK010000002.1 | GCA946997235_00166 | gene | open | 26968-28149 | |||
| 445 | CAMPUK010000002.1 | GCA946997235_00167 | gene | open | 28143-29498 | rlmD | ||
| 446 | CAMPUK010000002.1 | GCA946997235_00168 | gene | open | 29724-31202 | lsa | ||
| 447 | CAMPUK010000002.1 | GCA946997235_00169 | gene | open | 31414-31590 | |||
| 448 | CAMPUK010000002.1 | GCA946997235_00170 | gene | open | 31842-32045 | |||
| 449 | CAMPUK010000002.1 | GCA946997235_00171 | gene | open | 32167-32340 | |||
| 450 | CAMPUK010000002.1 | GCA946997235_00172 | gene | open | 32353-33162 | |||
| 451 | CAMPUK010000002.1 | GCA946997235_00173 | gene | open | 33607-33819 | |||
| 452 | CAMPUK010000002.1 | GCA946997235_00174 | gene | open | 34441-34683 | |||
| 453 | CAMPUK010000002.1 | GCA946997235_00175 | gene | open | 34631-34789 | |||
| 454 | CAMPUK010000002.1 | GCA946997235_00176 | gene | open | 34914-35471 | |||
| 455 | CAMPUK010000002.1 | GCA946997235_00177 | gene | open | 35736-35906 | tnpW | ||
| 456 | CAMPUK010000002.1 | GCA946997235_00178 | gene | open | 35959-36279 | |||
| 457 | CAMPUK010000002.1 | GCA946997235_00179 | gene | open | 36363-36548 | |||
| 458 | CAMPUK010000002.1 | GCA946997235_00180 | gene | open | 36582-37613 | yhcG | ||
| 459 | CAMPUK010000002.1 | GCA946997235_00181 | gene | open | 37635-38279 | |||
| 460 | CAMPUK010000002.1 | GCA946997235_00182 | gene | open | 38512-38697 | |||
| 461 | CAMPUK010000002.1 | GCA946997235_00183 | gene | open | 38702-38893 | |||
| 462 | CAMPUK010000002.1 | GCA946997235_00184 | gene | open | 39223-39471 | |||
| 463 | CAMPUK010000002.1 | GCA946997235_00185 | gene | open | 40149-40754 | cadD | ||
| 464 | CAMPUK010000002.1 | GCA946997235_00186 | gene | open | 41827-42006 | |||
| 465 | CAMPUK010000002.1 | GCA946997235_00187 | gene | open | 42093-43136 | |||
| 466 | CAMPUK010000002.1 | GCA946997235_00188 | gene | open | 43216-43890 | |||
| 467 | CAMPUK010000002.1 | GCA946997235_00189 | gene | open | 43915-44331 | |||
| 468 | CAMPUK010000002.1 | GCA946997235_00190 | gene | open | 44504-45370 | |||
| 469 | CAMPUK010000002.1 | GCA946997235_00191 | gene | open | 45351-46043 | scpA | ||
| 470 | CAMPUK010000002.1 | GCA946997235_00192 | gene | open | 46036-47499 | murJ | ||
| 471 | CAMPUK010000002.1 | GCA946997235_00193 | gene | open | 47514-48623 | tolC | ||
| 472 | CAMPUK010000002.1 | GCA946997235_00194 | gene | open | 48631-49689 | |||
| 473 | CAMPUK010000002.1 | GCA946997235_00195 | gene | open | 49689-50381 | |||
| 474 | CAMPUK010000002.1 | GCA946997235_00196 | gene | open | 50381-51592 | |||
| 475 | CAMPUK010000002.1 | GCA946997235_00197 | gene | open | 51699-52205 | |||
| 476 | CAMPUK010000002.1 | GCA946997235_00198 | gene | open | 52220-53245 | dLH | ||
| 477 | CAMPUK010000002.1 | GCA946997235_00199 | gene | open | 53495-54823 | |||
| 478 | CAMPUK010000002.1 | GCA946997235_00200 | gene | open | 54820-55704 | galU | ||
| 479 | CAMPUK010000002.1 | GCA946997235_00201 | gene | open | 55655-56545 | truB | ||
| 480 | CAMPUK010000002.1 | GCA946997235_00202 | gene | open | 56585-58072 | walK | ||
| 481 | CAMPUK010000002.1 | GCA946997235_00203 | gene | open | 58069-58740 | |||
| 482 | CAMPUK010000002.1 | GCA946997235_00204 | gene | open | 58750-60009 | |||
| 483 | CAMPUK010000002.1 | GCA946997235_00205 | gene | open | 60006-61376 | dnaB | ||
| 484 | CAMPUK010000002.1 | GCA946997235_00206 | gene | open | 61379-61831 | rplI | ||
| 485 | CAMPUK010000002.1 | GCA946997235_00207 | gene | open | 61850-63214 | dnaX | ||
| 486 | CAMPUK010000002.1 | GCA946997235_00208 | gene | open | 63225-63905 | |||
| 487 | CAMPUK010000002.1 | GCA946997235_00209 | gene | open | 63905-64693 | |||
| 488 | CAMPUK010000002.1 | GCA946997235_00210 | gene | open | 64695-65393 | |||
| 489 | CAMPUK010000002.1 | GCA946997235_00211 | gene | open | 65462-65854 | |||
| 490 | CAMPUK010000002.1 | GCA946997235_00212 | gene | open | 65860-66534 | |||
| 491 | CAMPUK010000002.1 | GCA946997235_00213 | gene | open | 66534-69242 | |||
| 492 | CAMPUK010000002.1 | GCA946997235_00214 | gene | open | 69245-69928 | |||
| 493 | CAMPUK010000002.1 | GCA946997235_00215 | gene | open | 69930-70448 | |||
| 494 | CAMPUK010000002.1 | GCA946997235_00216 | gene | open | 70457-71452 | |||
| 495 | CAMPUK010000002.1 | GCA946997235_00217 | gene | open | 71556-72284 | |||
| 496 | CAMPUK010000002.1 | GCA946997235_00218 | gene | open | 72315-73760 | |||
| 497 | CAMPUK010000002.1 | GCA946997235_00219 | gene | open | 73773-78785 | |||
| 498 | CAMPUK010000002.1 | GCA946997235_00220 | gene | open | 78794-80857 | |||
| 499 | CAMPUK010000002.1 | GCA946997235_00221 | gene | open | 81103-81462 | |||
| 500 | CAMPUK010000002.1 | GCA946997235_00222 | gene | open | 81577-82047 |
