HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella bivia (GCA_946997545.1)

Select a Genome:
BAKTA Annotations for GCA_946997545.1
Genome Selected: Prevotella bivia
ContigsBases CDSrRNA tmRNAtRNA
47 2028815 1696 0 1 27
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3466 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3466 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAMPVT010000010.1 GCA946997545_01017 CDS open 34036-35166 _na     376_aa irrE IrrE N-terminal-like domain-containing protein
2002 CAMPVT010000010.1 GCA946997545_01018 CDS open 36901-37008 _na     35_aa hypothetical protein
2003 CAMPVT010000010.1 GCA946997545_01019 CDS open 37107-37265 _na     52_aa hypothetical protein
2004 CAMPVT010000010.1 GCA946997545_01020 CDS open 37390-38022 _na     210_aa HTH cro/C1-type domain-containing protein
2005 CAMPVT010000010.1 GCA946997545_01021 CDS open 38274-38417 _na     47_aa hypothetical protein
2006 CAMPVT010000010.1 GCA946997545_01022 CDS open 39302-40276 _na     324_aa Bacterial group 2 Ig-like protein
2007 CAMPVT010000010.1 GCA946997545_01023 CDS open 40298-41668 _na     456_aa BT-3987-like N-terminal domain-containing protein
2008 CAMPVT010000010.1 GCA946997545_01024 CDS open 41706-42851 _na     381_aa LamG-like jellyroll fold domain-containing protein
2009 CAMPVT010000010.1 GCA946997545_01025 CDS open 42858-43901 _na     347_aa Lipoprotein
2010 CAMPVT010000010.1 GCA946997545_01026 CDS open 43954-45516 _na     520_aa ragB Susd and RagB outer membrane lipoprotein
2011 CAMPVT010000010.1 GCA946997545_01027 CDS open 45524-48646 _na     1040_aa TonB-dependent receptor plug domain protein
2012 CAMPVT010000010.1 GCA946997545_01028 CDS open 49060-49779 _na     239_aa PA14 domain-containing protein
2013 CAMPVT010000010.1 GCA946997545_01029 CDS open 49714-50952 _na     412_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
2014 CAMPVT010000010.1 GCA946997545_01030 CDS open 51141-51722 _na     193_aa Lipoprotein
2015 CAMPVT010000010.1 GCA946997545_01031 CDS open 51838-52248 _na     136_aa traM Conjugative transposon protein TraM
2016 CAMPVT010000010.1 GCA946997545_01032 CDS open 52390-52866 _na     158_aa DUF4923 domain-containing protein
2017 CAMPVT010000010.1 GCA946997545_01033 CDS open 53019-54302 _na     427_aa DUF4302 domain-containing protein
2018 CAMPVT010000010.1 GCA946997545_01034 CDS open 54322-55677 _na     451_aa Substrate import-associated zinc metallohydrolase lipoprotein
2019 CAMPVT010000010.1 GCA946997545_01035 CDS open 55713-57305 _na     530_aa SusD-like N-terminal domain-containing protein
2020 CAMPVT010000010.1 GCA946997545_01036 CDS open 57327-60635 _na     1102_aa TonB-dependent receptor plug domain protein
2021 CAMPVT010000010.1 GCA946997545_01037 CDS open 61257-61694 _na     145_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
2022 CAMPVT010000010.1 GCA946997545_01038 CDS open 61663-62445 _na     260_aa Lysozyme M1 (1%2C4-beta-N-acetylmuramidase)
2023 CAMPVT010000010.1 GCA946997545_01039 CDS open 62450-62947 _na     165_aa trxA thioredoxin
2024 CAMPVT010000010.1 GCA946997545_01040 CDS open 63447-63917 _na     156_aa Putative DNA-binding protein
2025 CAMPVT010000010.1 GCA946997545_00985 gene open 1276-1500
2026 CAMPVT010000010.1 GCA946997545_00986 gene open 2131-3756 groL
2027 CAMPVT010000010.1 GCA946997545_00987 gene open 3790-4059 groES
2028 CAMPVT010000010.1 GCA946997545_00988 gene open 4249-4374
2029 CAMPVT010000010.1 GCA946997545_00989 gene open 4377-4862
2030 CAMPVT010000010.1 GCA946997545_00990 gene open 5027-6535
2031 CAMPVT010000010.1 GCA946997545_00991 gene open 6672-6806
2032 CAMPVT010000010.1 GCA946997545_00992 gene open 7064-8668 nadB
2033 CAMPVT010000010.1 GCA946997545_00993 gene open 8671-9672 nadA
2034 CAMPVT010000010.1 GCA946997545_00994 gene open 9712-10566 nadC
2035 CAMPVT010000010.1 GCA946997545_00995 gene open 10652-11305 rbr
2036 CAMPVT010000010.1 GCA946997545_00996 gene open 11597-14455 lptD
2037 CAMPVT010000010.1 GCA946997545_00997 gene open 14616-15122
2038 CAMPVT010000010.1 GCA946997545_00998 gene open 15269-16990
2039 CAMPVT010000010.1 GCA946997545_00999 gene open 17291-17647
2040 CAMPVT010000010.1 GCA946997545_01000 gene open 18245-18820
2041 CAMPVT010000010.1 GCA946997545_01001 gene open 19044-19286
2042 CAMPVT010000010.1 GCA946997545_01002 gene open 19297-24255 tamB
2043 CAMPVT010000010.1 GCA946997545_01003 gene open 24303-26687
2044 CAMPVT010000010.1 GCA946997545_01004 gene open 26848-27060
2045 CAMPVT010000010.1 GCA946997545_01005 gene open 27063-28622
2046 CAMPVT010000010.1 GCA946997545_01006 gene open 28692-28847
2047 CAMPVT010000010.1 GCA946997545_01007 gene open 29006-30259
2048 CAMPVT010000010.1 GCA946997545_01008 gene open 30263-30580
2049 CAMPVT010000010.1 GCA946997545_01009 gene open 30664-30954
2050 CAMPVT010000010.1 GCA946997545_01010 gene open 31042-31137
2051 CAMPVT010000010.1 GCA946997545_01011 gene open 31130-31219
2052 CAMPVT010000010.1 GCA946997545_01012 gene open 31183-31437
2053 CAMPVT010000010.1 GCA946997545_01013 gene open 31425-31643
2054 CAMPVT010000010.1 GCA946997545_01014 gene open 31585-31908
2055 CAMPVT010000010.1 GCA946997545_01015 gene open 31911-33080
2056 CAMPVT010000010.1 GCA946997545_01016 gene open 33543-34025
2057 CAMPVT010000010.1 GCA946997545_01017 gene open 34036-35166 irrE
2058 CAMPVT010000010.1 GCA946997545_01018 gene open 36901-37008
2059 CAMPVT010000010.1 GCA946997545_01019 gene open 37107-37265
2060 CAMPVT010000010.1 GCA946997545_01020 gene open 37390-38022
2061 CAMPVT010000010.1 GCA946997545_01021 gene open 38274-38417
2062 CAMPVT010000010.1 GCA946997545_01022 gene open 39302-40276
2063 CAMPVT010000010.1 GCA946997545_01023 gene open 40298-41668
2064 CAMPVT010000010.1 GCA946997545_01024 gene open 41706-42851
2065 CAMPVT010000010.1 GCA946997545_01025 gene open 42858-43901
2066 CAMPVT010000010.1 GCA946997545_01026 gene open 43954-45516 ragB
2067 CAMPVT010000010.1 GCA946997545_01027 gene open 45524-48646
2068 CAMPVT010000010.1 GCA946997545_01028 gene open 49060-49779
2069 CAMPVT010000010.1 GCA946997545_01029 gene open 49714-50952 dacB
2070 CAMPVT010000010.1 GCA946997545_01030 gene open 51141-51722
2071 CAMPVT010000010.1 GCA946997545_01031 gene open 51838-52248 traM
2072 CAMPVT010000010.1 GCA946997545_01032 gene open 52390-52866
2073 CAMPVT010000010.1 GCA946997545_01033 gene open 53019-54302
2074 CAMPVT010000010.1 GCA946997545_01034 gene open 54322-55677
2075 CAMPVT010000010.1 GCA946997545_01035 gene open 55713-57305
2076 CAMPVT010000010.1 GCA946997545_01036 gene open 57327-60635
2077 CAMPVT010000010.1 GCA946997545_01037 gene open 61257-61694
2078 CAMPVT010000010.1 GCA946997545_01038 gene open 61663-62445
2079 CAMPVT010000010.1 GCA946997545_01039 gene open 62450-62947 trxA
2080 CAMPVT010000010.1 GCA946997545_01040 gene open 63447-63917
2081 CAMPVT010000011.1 GCA946997545_01041 CDS open 1804-2586 _na     260_aa hypothetical protein
2082 CAMPVT010000011.1 GCA946997545_01042 CDS open 2642-3076 _na     144_aa Lipoprotein
2083 CAMPVT010000011.1 GCA946997545_01043 CDS open 3248-5404 _na     718_aa tetQ Tetracycline resistance protein TetQ
2084 CAMPVT010000011.1 GCA946997545_01044 CDS open 5620-6771 _na     383_aa hemW radical SAM family heme chaperone HemW
2085 CAMPVT010000011.1 GCA946997545_01045 CDS open 6806-7132 _na     108_aa Positive regulator of sigma(E)%2C RseC/MucC
2086 CAMPVT010000011.1 GCA946997545_01046 CDS open 7188-8396 _na     402_aa Putative uracil permease
2087 CAMPVT010000011.1 GCA946997545_01047 CDS open 8519-9535 _na     338_aa ABC-type Fe3+-siderophore transport system%2C permease component
2088 CAMPVT010000011.1 GCA946997545_01048 CDS open 9554-10684 _na     376_aa ABC-type Fe3+-hydroxamate transport system%2C periplasmic component
2089 CAMPVT010000011.1 GCA946997545_01049 CDS open 10799-12262 _na     487_aa Anion transporter
2090 CAMPVT010000011.1 GCA946997545_01050 CDS open 12497-12943 _na     148_aa putative protein%2C YhcH/YjgK/YiaL family
2091 CAMPVT010000011.1 GCA946997545_01051 CDS open 13218-14558 _na     446_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
2092 CAMPVT010000011.1 GCA946997545_01052 CDS open 14614-15489 _na     291_aa Uridine phosphorylase
2093 CAMPVT010000011.1 GCA946997545_01053 CDS open 15684-17990 _na     768_aa gltA NADPH-dependent glutamate synthase
2094 CAMPVT010000011.1 GCA946997545_01054 CDS open 18091-19380 _na     429_aa serS serine--tRNA ligase
2095 CAMPVT010000011.1 GCA946997545_01055 CDS open 19572-19862 _na     96_aa rpmA 50S ribosomal protein L27
2096 CAMPVT010000011.1 GCA946997545_01056 CDS open 19882-20325 _na     147_aa rplU 50S ribosomal protein L21
2097 CAMPVT010000011.1 GCA946997545_01057 CDS open 20945-21769 _na     274_aa Peptidase M15A C-terminal domain-containing protein
2098 CAMPVT010000011.1 GCA946997545_01058 CDS open 21882-22835 _na     317_aa PhoH-like protein
2099 CAMPVT010000011.1 GCA946997545_01059 CDS open 22883-23881 _na     332_aa purC phosphoribosylaminoimidazolesuccinocarboxamide synthase
2100 CAMPVT010000011.1 GCA946997545_01060 CDS open 23990-24724 _na     244_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
2101 CAMPVT010000011.1 GCA946997545_01061 CDS open 24749-25498 _na     249_aa Shikimate dehydrogenase
2102 CAMPVT010000011.1 GCA946997545_01062 CDS open 25543-26706 _na     387_aa purM Phosphoribosylformylglycinamidine cyclo-ligase
2103 CAMPVT010000011.1 GCA946997545_01063 CDS open 26766-27878 _na     370_aa prfA peptide chain release factor 1
2104 CAMPVT010000011.1 GCA946997545_01064 CDS open 27919-28743 _na     274_aa pyrF orotidine-5'-phosphate decarboxylase
2105 CAMPVT010000011.1 GCA946997545_01065 CDS open 28911-30134 _na     407_aa HD domain protein
2106 CAMPVT010000011.1 GCA946997545_01066 CDS open 30178-31218 _na     346_aa lpxD UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
2107 CAMPVT010000011.1 GCA946997545_01067 CDS open 31228-32613 _na     461_aa bifunctional UDP-3-O-[3-hydroxymyristoyl] N-acetylglucosamine deacetylase/3-hydroxyacyl-ACP dehydratase
2108 CAMPVT010000011.1 GCA946997545_01068 CDS open 32630-33403 _na     257_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2109 CAMPVT010000011.1 GCA946997545_01069 CDS open 33408-34316 _na     302_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
2110 CAMPVT010000011.1 GCA946997545_01070 CDS open 34368-36905 _na     845_aa peptidoglycan glycosyltransferase
2111 CAMPVT010000011.1 GCA946997545_01071 CDS open 36923-38689 _na     588_aa AAA+ ATPase domain-containing protein
2112 CAMPVT010000011.1 GCA946997545_01072 CDS open 38758-39237 _na     159_aa Beta-lactamase-inhibitor-like PepSY-like domain-containing protein
2113 CAMPVT010000011.1 GCA946997545_01073 CDS open 39228-40370 _na     380_aa orfB Transposase%2C IS605 OrfB family
2114 CAMPVT010000011.1 GCA946997545_01074 CDS open 40442-40843 _na     133_aa tnpA IS200/IS605 family transposase
2115 CAMPVT010000011.1 GCA946997545_01075 CDS open 41292-41786 _na     164_aa DUF4112 domain-containing protein
2116 CAMPVT010000011.1 GCA946997545_01076 CDS open 41892-42278 _na     128_aa DUF1573 domain-containing protein
2117 CAMPVT010000011.1 GCA946997545_01077 CDS open 42645-45758 _na     1037_aa TonB-dependent receptor
2118 CAMPVT010000011.1 GCA946997545_01078 CDS open 45784-47334 _na     516_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
2119 CAMPVT010000011.1 GCA946997545_01079 CDS open 47371-48489 _na     372_aa Endo-beta-N-acetylglucosaminidase F2
2120 CAMPVT010000011.1 GCA946997545_01080 CDS open 48510-49685 _na     391_aa BT-3987-like N-terminal domain-containing protein
2121 CAMPVT010000011.1 GCA946997545_01081 CDS open 49711-50724 _na     337_aa F5/8 type C domain protein
2122 CAMPVT010000011.1 GCA946997545_01082 CDS open 50948-52519 _na     523_aa F5/8 type C domain protein
2123 CAMPVT010000011.1 GCA946997545_01083 CDS open 52562-53848 _na     428_aa Transporter%2C major facilitator family protein
2124 CAMPVT010000011.1 GCA946997545_01084 CDS open 53929-55560 _na     543_aa beta-N-acetylhexosaminidase
2125 CAMPVT010000011.1 GCA946997545_01085 CDS open 55694-56356 _na     220_aa Tetratricopeptide repeat protein
2126 CAMPVT010000011.1 GCA946997545_01086 CDS open 56717-57100 _na     127_aa yjbR YjbR protein
2127 CAMPVT010000011.1 GCA946997545_01087 CDS open 57136-58227 _na     363_aa zinc-dependent metalloproteinase lipoprotein
2128 CAMPVT010000011.1 GCA946997545_01088 CDS open 58347-59777 _na     476_aa SecDF P1 head subdomain domain-containing protein
2129 CAMPVT010000011.1 GCA946997545_01089 CDS open 59816-61516 _na     566_aa Glycosyl hydrolase-like 10 domain-containing protein
2130 CAMPVT010000011.1 GCA946997545_01090 CDS open 61730-62224 _na     164_aa Outer membrane protein beta-barrel domain-containing protein
2131 CAMPVT010000011.1 GCA946997545_01091 CDS open 62244-62852 _na     202_aa recR recombination mediator RecR
2132 CAMPVT010000011.1 GCA946997545_01092 CDS open 62842-63312 _na     156_aa DUF2975 domain-containing protein
2133 CAMPVT010000011.1 GCA946997545_01093 CDS open 63321-63842 _na     173_aa Acetyltransferase%2C ribosomal protein N-acetylase
2134 CAMPVT010000011.1 GCA946997545_01041 gene open 1804-2586
2135 CAMPVT010000011.1 GCA946997545_01042 gene open 2642-3076
2136 CAMPVT010000011.1 GCA946997545_01043 gene open 3248-5404 tetQ
2137 CAMPVT010000011.1 GCA946997545_01044 gene open 5620-6771 hemW
2138 CAMPVT010000011.1 GCA946997545_01045 gene open 6806-7132
2139 CAMPVT010000011.1 GCA946997545_01046 gene open 7188-8396
2140 CAMPVT010000011.1 GCA946997545_01047 gene open 8519-9535
2141 CAMPVT010000011.1 GCA946997545_01048 gene open 9554-10684
2142 CAMPVT010000011.1 GCA946997545_01049 gene open 10799-12262
2143 CAMPVT010000011.1 GCA946997545_01050 gene open 12497-12943
2144 CAMPVT010000011.1 GCA946997545_01051 gene open 13218-14558 mnmE
2145 CAMPVT010000011.1 GCA946997545_01052 gene open 14614-15489
2146 CAMPVT010000011.1 GCA946997545_01053 gene open 15684-17990 gltA
2147 CAMPVT010000011.1 GCA946997545_01054 gene open 18091-19380 serS
2148 CAMPVT010000011.1 GCA946997545_01055 gene open 19572-19862 rpmA
2149 CAMPVT010000011.1 GCA946997545_01056 gene open 19882-20325 rplU
2150 CAMPVT010000011.1 GCA946997545_01057 gene open 20945-21769
2151 CAMPVT010000011.1 GCA946997545_01058 gene open 21882-22835
2152 CAMPVT010000011.1 GCA946997545_01059 gene open 22883-23881 purC
2153 CAMPVT010000011.1 GCA946997545_01060 gene open 23990-24724 ubiE
2154 CAMPVT010000011.1 GCA946997545_01061 gene open 24749-25498
2155 CAMPVT010000011.1 GCA946997545_01062 gene open 25543-26706 purM
2156 CAMPVT010000011.1 GCA946997545_01063 gene open 26766-27878 prfA
2157 CAMPVT010000011.1 GCA946997545_01064 gene open 27919-28743 pyrF
2158 CAMPVT010000011.1 GCA946997545_01065 gene open 28911-30134
2159 CAMPVT010000011.1 GCA946997545_01066 gene open 30178-31218 lpxD
2160 CAMPVT010000011.1 GCA946997545_01067 gene open 31228-32613
2161 CAMPVT010000011.1 GCA946997545_01068 gene open 32630-33403 lpxA
2162 CAMPVT010000011.1 GCA946997545_01069 gene open 33408-34316 miaA
2163 CAMPVT010000011.1 GCA946997545_01070 gene open 34368-36905
2164 CAMPVT010000011.1 GCA946997545_01071 gene open 36923-38689
2165 CAMPVT010000011.1 GCA946997545_01072 gene open 38758-39237
2166 CAMPVT010000011.1 GCA946997545_01073 gene open 39228-40370 orfB
2167 CAMPVT010000011.1 GCA946997545_01074 gene open 40442-40843 tnpA
2168 CAMPVT010000011.1 GCA946997545_01075 gene open 41292-41786
2169 CAMPVT010000011.1 GCA946997545_01076 gene open 41892-42278
2170 CAMPVT010000011.1 GCA946997545_01077 gene open 42645-45758
2171 CAMPVT010000011.1 GCA946997545_01078 gene open 45784-47334
2172 CAMPVT010000011.1 GCA946997545_01079 gene open 47371-48489
2173 CAMPVT010000011.1 GCA946997545_01080 gene open 48510-49685
2174 CAMPVT010000011.1 GCA946997545_01081 gene open 49711-50724
2175 CAMPVT010000011.1 GCA946997545_01082 gene open 50948-52519
2176 CAMPVT010000011.1 GCA946997545_01083 gene open 52562-53848
2177 CAMPVT010000011.1 GCA946997545_01084 gene open 53929-55560
2178 CAMPVT010000011.1 GCA946997545_01085 gene open 55694-56356
2179 CAMPVT010000011.1 GCA946997545_01086 gene open 56717-57100 yjbR
2180 CAMPVT010000011.1 GCA946997545_01087 gene open 57136-58227
2181 CAMPVT010000011.1 GCA946997545_01088 gene open 58347-59777
2182 CAMPVT010000011.1 GCA946997545_01089 gene open 59816-61516
2183 CAMPVT010000011.1 GCA946997545_01090 gene open 61730-62224
2184 CAMPVT010000011.1 GCA946997545_01091 gene open 62244-62852 recR
2185 CAMPVT010000011.1 GCA946997545_01092 gene open 62842-63312
2186 CAMPVT010000011.1 GCA946997545_01093 gene open 63321-63842
2187 CAMPVT010000011.1 GCA946997545_01094 gene open 63930-64003 trnD
2188 CAMPVT010000011.1 GCA946997545_01094 tRNA open 63930-64003 trnD tRNA-Asp(gtc)
2189 CAMPVT010000012.1 GCA946997545_01095 CDS open 474-1844 _na     456_aa lpdA dihydrolipoyl dehydrogenase
2190 CAMPVT010000012.1 GCA946997545_01096 CDS open 1831-3312 _na     493_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
2191 CAMPVT010000012.1 GCA946997545_01097 CDS open 3305-4624 _na     439_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
2192 CAMPVT010000012.1 GCA946997545_01098 CDS open 4630-5010 _na     126_aa gcvH glycine cleavage system protein GcvH
2193 CAMPVT010000012.1 GCA946997545_01099 CDS open 5054-6148 _na     364_aa gcvT glycine cleavage system aminomethyltransferase GcvT
2194 CAMPVT010000012.1 GCA946997545_01100 CDS open 6553-8373 _na     606_aa lipA lipoyl synthase
2195 CAMPVT010000012.1 GCA946997545_01101 CDS open 8731-11322 _na     863_aa clpB ATP-dependent chaperone ClpB
2196 CAMPVT010000012.1 GCA946997545_01102 CDS open 11589-17156 _na     1855_aa Large extracellular alpha-helical protein
2197 CAMPVT010000012.1 GCA946997545_01103 CDS open 17178-18092 _na     304_aa 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
2198 CAMPVT010000012.1 GCA946997545_01104 CDS open 18106-19533 _na     475_aa Transporter%2C SSS family
2199 CAMPVT010000012.1 GCA946997545_01105 CDS open 19851-20459 _na     202_aa Outer membrane protein beta-barrel domain-containing protein
2200 CAMPVT010000012.1 GCA946997545_01106 CDS open 20987-22099 _na     370_aa Putative carbohydrate metabolism domain-containing protein
2201 CAMPVT010000012.1 GCA946997545_01107 CDS open 22160-22939 _na     259_aa Outer membrane protein beta-barrel domain-containing protein
2202 CAMPVT010000012.1 GCA946997545_01108 CDS open 22959-24092 _na     377_aa Acyltransferase
2203 CAMPVT010000012.1 GCA946997545_01109 CDS open 24191-26752 _na     853_aa clpC Clp protease ClpC
2204 CAMPVT010000012.1 GCA946997545_01110 CDS open 27065-28510 _na     481_aa DUF4270 domain-containing protein
2205 CAMPVT010000012.1 GCA946997545_01111 CDS open 28538-29347 _na     269_aa starch synthase
2206 CAMPVT010000012.1 GCA946997545_01112 CDS open 29503-30384 _na     293_aa panC pantoate--beta-alanine ligase
2207 CAMPVT010000012.1 GCA946997545_01113 CDS open 30389-30733 _na     114_aa panD aspartate 1-decarboxylase
2208 CAMPVT010000012.1 GCA946997545_01114 CDS open 30907-31332 _na     141_aa hypothetical protein
2209 CAMPVT010000012.1 GCA946997545_01115 CDS open 31348-31497 _na     49_aa NHR domain-containing protein
2210 CAMPVT010000012.1 GCA946997545_01116 CDS open 31515-33080 _na     521_aa mmdA putative propionyl-CoA carboxylase beta chain 5
2211 CAMPVT010000012.1 GCA946997545_01117 CDS open 33900-34478 _na     192_aa ruvC crossover junction endodeoxyribonuclease RuvC
2212 CAMPVT010000012.1 GCA946997545_01118 CDS open 34483-35127 _na     214_aa Metallo-beta-lactamase domain protein
2213 CAMPVT010000012.1 GCA946997545_01119 CDS open 35182-35808 _na     208_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
2214 CAMPVT010000012.1 GCA946997545_01120 CDS open 36067-36690 _na     207_aa HAD hydrolase%2C family IA%2C variant 3
2215 CAMPVT010000012.1 GCA946997545_01121 CDS open 36767-37585 _na     272_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
2216 CAMPVT010000012.1 GCA946997545_01122 CDS open 37658-38833 _na     391_aa Sugar phosphate permease
2217 CAMPVT010000012.1 GCA946997545_01123 CDS open 38864-39706 _na     280_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
2218 CAMPVT010000012.1 GCA946997545_01124 CDS open 39851-41368 _na     505_aa dnaB replicative DNA helicase
2219 CAMPVT010000012.1 GCA946997545_01125 CDS open 41499-42839 _na     446_aa yihY YihY family protein
2220 CAMPVT010000012.1 GCA946997545_01126 CDS open 42841-45450 _na     869_aa Carboxypeptidase-like regulatory domain-containing protein
2221 CAMPVT010000012.1 GCA946997545_01127 CDS open 45839-46813 _na     324_aa Glycosidase
2222 CAMPVT010000012.1 GCA946997545_01128 CDS open 46916-49171 _na     751_aa Putative alpha-1%2C2-mannosidase
2223 CAMPVT010000012.1 GCA946997545_01129 CDS open 49437-51512 _na     691_aa beta-N-acetylhexosaminidase
2224 CAMPVT010000012.1 GCA946997545_01130 CDS open 51538-53178 _na     546_aa exo-alpha-sialidase
2225 CAMPVT010000012.1 GCA946997545_01131 CDS open 53211-55361 _na     716_aa Putative alpha-1%2C2-mannosidase
2226 CAMPVT010000012.1 GCA946997545_01132 CDS open 55377-56465 _na     362_aa Putative homoserine kinase type II (Protein kinase fold)
2227 CAMPVT010000012.1 GCA946997545_01133 CDS open 56466-57122 _na     218_aa Carbohydrate-binding domain-containing protein
2228 CAMPVT010000012.1 GCA946997545_01134 CDS open 57250-57993 _na     247_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
2229 CAMPVT010000012.1 GCA946997545_01135 CDS open 58077-58859 _na     260_aa NADP oxidoreductase coenzyme F420-dependent
2230 CAMPVT010000012.1 GCA946997545_01136 CDS open 58866-59384 _na     172_aa yrbI 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family
2231 CAMPVT010000012.1 GCA946997545_01137 CDS open 59408-59995 _na     195_aa dTTP/UTP pyrophosphatase
2232 CAMPVT010000012.1 GCA946997545_01138 CDS open 59967-60437 _na     156_aa rlmH 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH
2233 CAMPVT010000012.1 GCA946997545_01139 CDS open 60447-60773 _na     108_aa DUF4491 domain-containing protein
2234 CAMPVT010000012.1 GCA946997545_01140 CDS open 60959-62707 _na     582_aa Putative phosphoglucomutase
2235 CAMPVT010000012.1 GCA946997545_01095 gene open 474-1844 lpdA
2236 CAMPVT010000012.1 GCA946997545_01096 gene open 1831-3312 gcvPB
2237 CAMPVT010000012.1 GCA946997545_01097 gene open 3305-4624 gcvPA
2238 CAMPVT010000012.1 GCA946997545_01098 gene open 4630-5010 gcvH
2239 CAMPVT010000012.1 GCA946997545_01099 gene open 5054-6148 gcvT
2240 CAMPVT010000012.1 GCA946997545_01100 gene open 6553-8373 lipA
2241 CAMPVT010000012.1 GCA946997545_01101 gene open 8731-11322 clpB
2242 CAMPVT010000012.1 GCA946997545_01102 gene open 11589-17156
2243 CAMPVT010000012.1 GCA946997545_01103 gene open 17178-18092
2244 CAMPVT010000012.1 GCA946997545_01104 gene open 18106-19533
2245 CAMPVT010000012.1 GCA946997545_01105 gene open 19851-20459
2246 CAMPVT010000012.1 GCA946997545_01106 gene open 20987-22099
2247 CAMPVT010000012.1 GCA946997545_01107 gene open 22160-22939
2248 CAMPVT010000012.1 GCA946997545_01108 gene open 22959-24092
2249 CAMPVT010000012.1 GCA946997545_01109 gene open 24191-26752 clpC
2250 CAMPVT010000012.1 GCA946997545_01110 gene open 27065-28510
2251 CAMPVT010000012.1 GCA946997545_01111 gene open 28538-29347
2252 CAMPVT010000012.1 GCA946997545_01112 gene open 29503-30384 panC
2253 CAMPVT010000012.1 GCA946997545_01113 gene open 30389-30733 panD
2254 CAMPVT010000012.1 GCA946997545_01114 gene open 30907-31332
2255 CAMPVT010000012.1 GCA946997545_01115 gene open 31348-31497
2256 CAMPVT010000012.1 GCA946997545_01116 gene open 31515-33080 mmdA
2257 CAMPVT010000012.1 GCA946997545_01117 gene open 33900-34478 ruvC
2258 CAMPVT010000012.1 GCA946997545_01118 gene open 34483-35127
2259 CAMPVT010000012.1 GCA946997545_01119 gene open 35182-35808 rsmG
2260 CAMPVT010000012.1 GCA946997545_01120 gene open 36067-36690
2261 CAMPVT010000012.1 GCA946997545_01121 gene open 36767-37585 panB
2262 CAMPVT010000012.1 GCA946997545_01122 gene open 37658-38833
2263 CAMPVT010000012.1 GCA946997545_01123 gene open 38864-39706 ispE
2264 CAMPVT010000012.1 GCA946997545_01124 gene open 39851-41368 dnaB
2265 CAMPVT010000012.1 GCA946997545_01125 gene open 41499-42839 yihY
2266 CAMPVT010000012.1 GCA946997545_01126 gene open 42841-45450
2267 CAMPVT010000012.1 GCA946997545_01127 gene open 45839-46813
2268 CAMPVT010000012.1 GCA946997545_01128 gene open 46916-49171
2269 CAMPVT010000012.1 GCA946997545_01129 gene open 49437-51512
2270 CAMPVT010000012.1 GCA946997545_01130 gene open 51538-53178
2271 CAMPVT010000012.1 GCA946997545_01131 gene open 53211-55361
2272 CAMPVT010000012.1 GCA946997545_01132 gene open 55377-56465
2273 CAMPVT010000012.1 GCA946997545_01133 gene open 56466-57122
2274 CAMPVT010000012.1 GCA946997545_01134 gene open 57250-57993 kdsB
2275 CAMPVT010000012.1 GCA946997545_01135 gene open 58077-58859
2276 CAMPVT010000012.1 GCA946997545_01136 gene open 58866-59384 yrbI
2277 CAMPVT010000012.1 GCA946997545_01137 gene open 59408-59995
2278 CAMPVT010000012.1 GCA946997545_01138 gene open 59967-60437 rlmH
2279 CAMPVT010000012.1 GCA946997545_01139 gene open 60447-60773
2280 CAMPVT010000012.1 GCA946997545_01140 gene open 60959-62707
2281 CAMPVT010000013.1 repeat_region open 1-2302 CRISPR array with 7 repeats of length 47%2C consensus sequence GTTGTGTTTGATACCACAAAGATAGAAATTTTCAAGCAAATCACAAC and spacer length 29
2282 CAMPVT010000013.1 repeat_region open 538-2302 CRISPR array with 13 repeats of length 47%2C consensus sequence GTTGTGTTTGATACCACAAAGATAGAAATTTTCAAGCAAATCACAAC and spacer length 29
2283 CAMPVT010000013.1 repeat_region open 1536-2302 CRISPR array with 10 repeats of length 47%2C consensus sequence GTTGTGTTTGATACCACAAAGATAGAAATTTTCAAGCAAATCACAAC and spacer length 29
2284 CAMPVT010000013.1 GCA946997545_01142 CDS open 3306-4343 _na     345_aa asnA aspartate--ammonia ligase
2285 CAMPVT010000013.1 GCA946997545_01143 CDS open 4487-5374 _na     295_aa Acyltransferase
2286 CAMPVT010000013.1 GCA946997545_01144 CDS open 5386-6450 _na     354_aa Peptidylarginine deiminase-like enzyme
2287 CAMPVT010000013.1 GCA946997545_01145 CDS open 6748-6858 _na     36_aa hypothetical protein
2288 CAMPVT010000013.1 GCA946997545_01146 CDS open 7212-8027 _na     271_aa Nif3-like dinuclear metal center hexameric protein
2289 CAMPVT010000013.1 GCA946997545_01147 CDS open 8063-8887 _na     274_aa C4-type zinc ribbon domain-containing protein
2290 CAMPVT010000013.1 GCA946997545_01148 CDS open 9361-9537 _na     58_aa hypothetical protein
2291 CAMPVT010000013.1 GCA946997545_01149 CDS open 9602-10456 _na     284_aa GLPGLI family protein
2292 CAMPVT010000013.1 GCA946997545_01150 CDS open 10453-13032 _na     859_aa TonB-dependent receptor
2293 CAMPVT010000013.1 GCA946997545_01151 CDS open 13383-14615 _na     410_aa Sigma-54 interaction domain protein
2294 CAMPVT010000013.1 GCA946997545_01152 CDS open 14612-15202 _na     196_aa Lipoprotein
2295 CAMPVT010000013.1 GCA946997545_01153 CDS open 15214-15981 _na     255_aa Tetratricopeptide repeat protein
2296 CAMPVT010000013.1 GCA946997545_01154 CDS open 15992-16357 _na     121_aa secG preprotein translocase subunit SecG
2297 CAMPVT010000013.1 GCA946997545_01156 CDS open 16654-17436 _na     260_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
2298 CAMPVT010000013.1 GCA946997545_01157 CDS open 17526-18905 _na     459_aa nodT Efflux transporter%2C outer membrane factor lipoprotein%2C NodT family
2299 CAMPVT010000013.1 GCA946997545_01158 CDS open 18925-22197 _na     1090_aa RND transporter%2C HAE1 family
2300 CAMPVT010000013.1 GCA946997545_01159 CDS open 22228-23562 _na     444_aa RND family efflux transporter%2C MFP subunit
2301 CAMPVT010000013.1 GCA946997545_01160 CDS open 23693-25117 _na     474_aa Putative domain HDIG-containing protein
2302 CAMPVT010000013.1 GCA946997545_01161 CDS open 25238-26074 _na     278_aa Antioxidant%2C AhpC/TSA family
2303 CAMPVT010000013.1 GCA946997545_01162 CDS open 26296-26988 _na     230_aa queuosine precursor transporter
2304 CAMPVT010000013.1 GCA946997545_01163 CDS open 26993-27451 _na     152_aa queF preQ(1) synthase
2305 CAMPVT010000013.1 GCA946997545_01164 CDS open 27536-30559 _na     1007_aa Pyruvate phosphate dikinase%2C PEP/pyruvate binding domain protein
2306 CAMPVT010000013.1 GCA946997545_01165 CDS open 30758-30973 _na     71_aa DNA cytosine methyltransferase
2307 CAMPVT010000013.1 GCA946997545_01166 CDS open 31027-31131 _na     34_aa hypothetical protein
2308 CAMPVT010000013.1 GCA946997545_01167 CDS open 31457-34384 _na     975_aa Outer membrane protein beta-barrel domain-containing protein
2309 CAMPVT010000013.1 GCA946997545_01168 CDS open 34476-35162 _na     228_aa Response regulator with CheY-like receiver domain and winged-helix DNA-binding domain
2310 CAMPVT010000013.1 GCA946997545_01169 CDS open 35170-36492 _na     440_aa MATE efflux family protein
2311 CAMPVT010000013.1 GCA946997545_01170 CDS open 36511-36651 _na     46_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
2312 CAMPVT010000013.1 GCA946997545_01171 CDS open 36765-38957 _na     730_aa Dipeptidyl aminopeptidase/acylaminoacyl peptidase
2313 CAMPVT010000013.1 GCA946997545_01172 CDS open 39043-39432 _na     129_aa pqqD PqqD family protein
2314 CAMPVT010000013.1 GCA946997545_01173 CDS open 39457-39948 _na     163_aa Peptidase S24-like protein
2315 CAMPVT010000013.1 GCA946997545_01174 CDS open 39951-40838 _na     295_aa scmC SynChlorMet cassette protein ScmC
2316 CAMPVT010000013.1 GCA946997545_01175 CDS open 40932-41390 _na     152_aa DUF4136 domain-containing protein
2317 CAMPVT010000013.1 GCA946997545_01176 CDS open 41427-42287 _na     286_aa DNA-directed RNA polymerase%2C sigma subunit (Sigma70/sigma32)
2318 CAMPVT010000013.1 GCA946997545_01177 CDS open 42912-43460 _na     182_aa Nucleotide modification associated domain-containing protein
2319 CAMPVT010000013.1 GCA946997545_01178 CDS open 43447-44910 _na     487_aa Triosephosphate isomerase
2320 CAMPVT010000013.1 GCA946997545_01179 CDS open 44944-45705 _na     253_aa tpiA triose-phosphate isomerase
2321 CAMPVT010000013.1 GCA946997545_01180 CDS open 45791-46528 _na     245_aa Sporulation and cell division repeat protein
2322 CAMPVT010000013.1 GCA946997545_01181 CDS open 46549-47142 _na     197_aa folE GTP cyclohydrolase I FolE
2323 CAMPVT010000013.1 GCA946997545_01182 CDS open 47178-47888 _na     236_aa Lipoprotein
2324 CAMPVT010000013.1 GCA946997545_01183 CDS open 47892-48641 _na     249_aa exodeoxyribonuclease III
2325 CAMPVT010000013.1 GCA946997545_01184 CDS open 48653-49405 _na     250_aa SGNH hydrolase-type esterase domain-containing protein
2326 CAMPVT010000013.1 GCA946997545_01185 CDS open 49415-50881 _na     488_aa Putative membrane protein involved in D-alanine export
2327 CAMPVT010000013.1 GCA946997545_01186 CDS open 50896-51348 _na     150_aa tRNA-specific adenosine deaminase
2328 CAMPVT010000013.1 GCA946997545_01187 CDS open 51430-51795 _na     121_aa UPF0102 protein PrebiDRAFT_2176
2329 CAMPVT010000013.1 GCA946997545_01188 CDS open 51815-52603 _na     262_aa Biotin-(Acetyl-CoA carboxylase) ligase
2330 CAMPVT010000013.1 GCA946997545_01189 CDS open 52627-53337 _na     236_aa pyrH UMP kinase
2331 CAMPVT010000013.1 GCA946997545_01190 CDS open 53479-54009 _na     176_aa yhcR Endonuclease YhcR N-terminal domain-containing protein
2332 CAMPVT010000013.1 GCA946997545_01191 CDS open 54364-56442 _na     692_aa Cytochrome C biogenesis protein transmembrane region
2333 CAMPVT010000013.1 GCA946997545_01192 CDS open 56674-58191 _na     505_aa Arabinose efflux permease family protein
2334 CAMPVT010000013.1 GCA946997545_01193 CDS open 58661-59560 _na     299_aa diaminopimelate dehydrogenase
2335 CAMPVT010000013.1 GCA946997545_01194 CDS open 59734-60234 _na     166_aa RNA polymerase sigma factor%2C sigma-70 family
2336 CAMPVT010000013.1 GCA946997545_01195 CDS open 60231-60962 _na     243_aa hypothetical protein
2337 CAMPVT010000013.1 GCA946997545_01196 CDS open 60959-61810 _na     283_aa GLPGLI family protein
2338 CAMPVT010000013.1 GCA946997545_01197 CDS open 61904-62272 _na     122_aa Putative superoxide reductase
2339 CAMPVT010000013.1 GCA946997545_01142 gene open 3306-4343 asnA
2340 CAMPVT010000013.1 GCA946997545_01143 gene open 4487-5374
2341 CAMPVT010000013.1 GCA946997545_01144 gene open 5386-6450
2342 CAMPVT010000013.1 GCA946997545_01145 gene open 6748-6858
2343 CAMPVT010000013.1 GCA946997545_01146 gene open 7212-8027
2344 CAMPVT010000013.1 GCA946997545_01147 gene open 8063-8887
2345 CAMPVT010000013.1 GCA946997545_01148 gene open 9361-9537
2346 CAMPVT010000013.1 GCA946997545_01149 gene open 9602-10456
2347 CAMPVT010000013.1 GCA946997545_01150 gene open 10453-13032
2348 CAMPVT010000013.1 GCA946997545_01151 gene open 13383-14615
2349 CAMPVT010000013.1 GCA946997545_01152 gene open 14612-15202
2350 CAMPVT010000013.1 GCA946997545_01153 gene open 15214-15981
2351 CAMPVT010000013.1 GCA946997545_01154 gene open 15992-16357 secG
2352 CAMPVT010000013.1 GCA946997545_01156 gene open 16654-17436 lpxA
2353 CAMPVT010000013.1 GCA946997545_01157 gene open 17526-18905 nodT
2354 CAMPVT010000013.1 GCA946997545_01158 gene open 18925-22197
2355 CAMPVT010000013.1 GCA946997545_01159 gene open 22228-23562
2356 CAMPVT010000013.1 GCA946997545_01160 gene open 23693-25117
2357 CAMPVT010000013.1 GCA946997545_01161 gene open 25238-26074
2358 CAMPVT010000013.1 GCA946997545_01162 gene open 26296-26988
2359 CAMPVT010000013.1 GCA946997545_01163 gene open 26993-27451 queF
2360 CAMPVT010000013.1 GCA946997545_01164 gene open 27536-30559
2361 CAMPVT010000013.1 GCA946997545_01165 gene open 30758-30973
2362 CAMPVT010000013.1 GCA946997545_01166 gene open 31027-31131
2363 CAMPVT010000013.1 GCA946997545_01167 gene open 31457-34384
2364 CAMPVT010000013.1 GCA946997545_01168 gene open 34476-35162
2365 CAMPVT010000013.1 GCA946997545_01169 gene open 35170-36492
2366 CAMPVT010000013.1 GCA946997545_01170 gene open 36511-36651
2367 CAMPVT010000013.1 GCA946997545_01171 gene open 36765-38957
2368 CAMPVT010000013.1 GCA946997545_01172 gene open 39043-39432 pqqD
2369 CAMPVT010000013.1 GCA946997545_01173 gene open 39457-39948
2370 CAMPVT010000013.1 GCA946997545_01174 gene open 39951-40838 scmC
2371 CAMPVT010000013.1 GCA946997545_01175 gene open 40932-41390
2372 CAMPVT010000013.1 GCA946997545_01176 gene open 41427-42287
2373 CAMPVT010000013.1 GCA946997545_01177 gene open 42912-43460
2374 CAMPVT010000013.1 GCA946997545_01178 gene open 43447-44910
2375 CAMPVT010000013.1 GCA946997545_01179 gene open 44944-45705 tpiA
2376 CAMPVT010000013.1 GCA946997545_01180 gene open 45791-46528
2377 CAMPVT010000013.1 GCA946997545_01181 gene open 46549-47142 folE
2378 CAMPVT010000013.1 GCA946997545_01182 gene open 47178-47888
2379 CAMPVT010000013.1 GCA946997545_01183 gene open 47892-48641
2380 CAMPVT010000013.1 GCA946997545_01184 gene open 48653-49405
2381 CAMPVT010000013.1 GCA946997545_01185 gene open 49415-50881
2382 CAMPVT010000013.1 GCA946997545_01186 gene open 50896-51348
2383 CAMPVT010000013.1 GCA946997545_01187 gene open 51430-51795
2384 CAMPVT010000013.1 GCA946997545_01188 gene open 51815-52603
2385 CAMPVT010000013.1 GCA946997545_01189 gene open 52627-53337 pyrH
2386 CAMPVT010000013.1 GCA946997545_01190 gene open 53479-54009 yhcR
2387 CAMPVT010000013.1 GCA946997545_01191 gene open 54364-56442
2388 CAMPVT010000013.1 GCA946997545_01192 gene open 56674-58191
2389 CAMPVT010000013.1 GCA946997545_01193 gene open 58661-59560
2390 CAMPVT010000013.1 GCA946997545_01194 gene open 59734-60234
2391 CAMPVT010000013.1 GCA946997545_01195 gene open 60231-60962
2392 CAMPVT010000013.1 GCA946997545_01196 gene open 60959-61810
2393 CAMPVT010000013.1 GCA946997545_01197 gene open 61904-62272
2394 CAMPVT010000013.1 GCA946997545_01141 gene open 2934-3005 trnR
2395 CAMPVT010000013.1 GCA946997545_01155 gene open 16448-16524 trnH
2396 CAMPVT010000013.1 GCA946997545_01141 tRNA open 2934-3005 trnR tRNA-Arg(ccg)
2397 CAMPVT010000013.1 GCA946997545_01155 tRNA open 16448-16524 trnH tRNA-His(gtg)
2398 CAMPVT010000014.1 GCA946997545_01198 CDS open 114-710 _na     198_aa IS982 family transposase
2399 CAMPVT010000014.1 GCA946997545_01199 CDS open 1347-2891 _na     514_aa Glycosyl hydrolase family 109
2400 CAMPVT010000014.1 GCA946997545_01200 CDS open 3242-3688 _na     148_aa Transglycosylase SLT domain-containing protein
2401 CAMPVT010000014.1 GCA946997545_01201 CDS open 3831-4526 _na     231_aa GDSL-like protein
2402 CAMPVT010000014.1 GCA946997545_01202 CDS open 4674-5774 _na     366_aa Iron-sulfur cluster carrier protein
2403 CAMPVT010000014.1 GCA946997545_01203 CDS open 5836-6540 _na     234_aa Putative HAD superfamily hydrolase
2404 CAMPVT010000014.1 GCA946997545_01204 CDS open 6823-8094 _na     423_aa O-acetylhomoserine aminocarboxypropyltransferase
2405 CAMPVT010000014.1 GCA946997545_01205 CDS open 8271-9521 _na     416_aa hflX GTPase HflX
2406 CAMPVT010000014.1 GCA946997545_01206 CDS open 9574-11430 _na     618_aa DUF6819 domain-containing protein
2407 CAMPVT010000014.1 GCA946997545_01207 CDS open 11452-14391 _na     979_aa Peptidase M16 inactive domain protein
2408 CAMPVT010000014.1 GCA946997545_01208 CDS open 14479-16119 _na     546_aa ttdA Fumarate hydratase class I
2409 CAMPVT010000014.1 GCA946997545_01209 CDS open 16294-16962 _na     222_aa Channel protein%2C hemolysin III family
2410 CAMPVT010000014.1 GCA946997545_01210 CDS open 17015-17515 _na     166_aa gldH Gliding motility-associated lipoprotein GldH
2411 CAMPVT010000014.1 GCA946997545_01211 CDS open 17505-18758 _na     417_aa PSP1 C-terminal domain-containing protein
2412 CAMPVT010000014.1 GCA946997545_01212 CDS open 18813-19964 _na     383_aa DNA polymerase III%2C delta' subunit
2413 CAMPVT010000014.1 GCA946997545_01213 CDS open 20083-21243 _na     386_aa Thiol-disulfide isomerase-like thioredoxin
2414 CAMPVT010000014.1 GCA946997545_01214 CDS open 21512-22474 _na     320_aa manA mannose-6-phosphate isomerase%2C class I
2415 CAMPVT010000014.1 GCA946997545_01215 CDS open 22829-23890 _na     353_aa Glycosyltransferase%2C group 2 family protein
2416 CAMPVT010000014.1 GCA946997545_01216 CDS open 23890-25245 _na     451_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
2417 CAMPVT010000014.1 GCA946997545_01217 CDS open 25618-25857 _na     79_aa Entericidin
2418 CAMPVT010000014.1 GCA946997545_01218 CDS open 25920-26666 _na     248_aa protein acetyllysine N-acetyltransferase
2419 CAMPVT010000014.1 GCA946997545_01219 CDS open 26974-27237 _na     87_aa Lipoprotein
2420 CAMPVT010000014.1 GCA946997545_01220 CDS open 27411-28037 _na     208_aa Deoxynucleoside kinase
2421 CAMPVT010000014.1 GCA946997545_01221 CDS open 28072-28686 _na     204_aa Deoxynucleoside kinase
2422 CAMPVT010000014.1 GCA946997545_01222 CDS open 28689-30182 _na     497_aa Type I phosphodiesterase / nucleotide pyrophosphatase
2423 CAMPVT010000014.1 GCA946997545_01223 CDS open 30225-31484 _na     419_aa Nramp family divalent metal transporter
2424 CAMPVT010000014.1 GCA946997545_01224 CDS open 31606-32847 _na     413_aa Flavoprotein family protein
2425 CAMPVT010000014.1 GCA946997545_01225 CDS open 33043-34323 _na     426_aa Serine hydroxymethyltransferase
2426 CAMPVT010000014.1 GCA946997545_01226 CDS open 34809-36365 _na     518_aa DUF4301 domain-containing protein
2427 CAMPVT010000014.1 GCA946997545_01227 CDS open 36432-37895 _na     487_aa PepSY domain protein
2428 CAMPVT010000014.1 GCA946997545_01228 CDS open 38526-39551 _na     341_aa IS110 family transposase
2429 CAMPVT010000014.1 GCA946997545_01229 CDS open 40361-40711 _na     116_aa DNA-binding helix-turn-helix protein
2430 CAMPVT010000014.1 GCA946997545_01230 CDS open 41035-41655 _na     206_aa DUF3575 domain-containing protein
2431 CAMPVT010000014.1 GCA946997545_01231 CDS open 41671-43221 _na     516_aa Tetratricopeptide repeat protein
2432 CAMPVT010000014.1 GCA946997545_01232 CDS open 43242-44297 _na     351_aa Fimbrillin-A associated anchor protein Mfa1 and Mfa2
2433 CAMPVT010000014.1 GCA946997545_01233 CDS open 44391-45854 _na     487_aa Major fimbrial subunit protein N-terminal domain-containing protein
2434 CAMPVT010000014.1 GCA946997545_01234 CDS open 45859-48102 _na     747_aa Fibrobacter succinogene major domain protein
2435 CAMPVT010000014.1 GCA946997545_01235 CDS open 48270-49460 _na     396_aa Clostripain family protein
2436 CAMPVT010000014.1 GCA946997545_01198 gene open 114-710
2437 CAMPVT010000014.1 GCA946997545_01199 gene open 1347-2891
2438 CAMPVT010000014.1 GCA946997545_01200 gene open 3242-3688
2439 CAMPVT010000014.1 GCA946997545_01201 gene open 3831-4526
2440 CAMPVT010000014.1 GCA946997545_01202 gene open 4674-5774
2441 CAMPVT010000014.1 GCA946997545_01203 gene open 5836-6540
2442 CAMPVT010000014.1 GCA946997545_01204 gene open 6823-8094
2443 CAMPVT010000014.1 GCA946997545_01205 gene open 8271-9521 hflX
2444 CAMPVT010000014.1 GCA946997545_01206 gene open 9574-11430
2445 CAMPVT010000014.1 GCA946997545_01207 gene open 11452-14391
2446 CAMPVT010000014.1 GCA946997545_01208 gene open 14479-16119 ttdA
2447 CAMPVT010000014.1 GCA946997545_01209 gene open 16294-16962
2448 CAMPVT010000014.1 GCA946997545_01210 gene open 17015-17515 gldH
2449 CAMPVT010000014.1 GCA946997545_01211 gene open 17505-18758
2450 CAMPVT010000014.1 GCA946997545_01212 gene open 18813-19964
2451 CAMPVT010000014.1 GCA946997545_01213 gene open 20083-21243
2452 CAMPVT010000014.1 GCA946997545_01214 gene open 21512-22474 manA
2453 CAMPVT010000014.1 GCA946997545_01215 gene open 22829-23890
2454 CAMPVT010000014.1 GCA946997545_01216 gene open 23890-25245 mtaB
2455 CAMPVT010000014.1 GCA946997545_01217 gene open 25618-25857
2456 CAMPVT010000014.1 GCA946997545_01218 gene open 25920-26666
2457 CAMPVT010000014.1 GCA946997545_01219 gene open 26974-27237
2458 CAMPVT010000014.1 GCA946997545_01220 gene open 27411-28037
2459 CAMPVT010000014.1 GCA946997545_01221 gene open 28072-28686
2460 CAMPVT010000014.1 GCA946997545_01222 gene open 28689-30182
2461 CAMPVT010000014.1 GCA946997545_01223 gene open 30225-31484
2462 CAMPVT010000014.1 GCA946997545_01224 gene open 31606-32847
2463 CAMPVT010000014.1 GCA946997545_01225 gene open 33043-34323
2464 CAMPVT010000014.1 GCA946997545_01226 gene open 34809-36365
2465 CAMPVT010000014.1 GCA946997545_01227 gene open 36432-37895
2466 CAMPVT010000014.1 GCA946997545_01228 gene open 38526-39551
2467 CAMPVT010000014.1 GCA946997545_01229 gene open 40361-40711
2468 CAMPVT010000014.1 GCA946997545_01230 gene open 41035-41655
2469 CAMPVT010000014.1 GCA946997545_01231 gene open 41671-43221
2470 CAMPVT010000014.1 GCA946997545_01232 gene open 43242-44297
2471 CAMPVT010000014.1 GCA946997545_01233 gene open 44391-45854
2472 CAMPVT010000014.1 GCA946997545_01234 gene open 45859-48102
2473 CAMPVT010000014.1 GCA946997545_01235 gene open 48270-49460
2474 CAMPVT010000015.1 GCA946997545_01236 CDS open 272-493 _na     73_aa hypothetical protein
2475 CAMPVT010000015.1 GCA946997545_01237 CDS open 932-1483 _na     183_aa 30S ribosomal protein S16
2476 CAMPVT010000015.1 GCA946997545_01238 CDS open 1950-2537 _na     195_aa Chorismate binding enzyme
2477 CAMPVT010000015.1 GCA946997545_01239 CDS open 2534-3511 _na     325_aa aminodeoxychorismate synthase component I
2478 CAMPVT010000015.1 GCA946997545_01240 CDS open 3508-4167 _na     219_aa Glutamine amidotransferase%2C class I
2479 CAMPVT010000015.1 GCA946997545_01241 CDS open 4257-7082 _na     941_aa uvrA excinuclease ABC subunit UvrA
2480 CAMPVT010000015.1 GCA946997545_01242 CDS open 7259-8632 _na     457_aa lysM LysM domain protein
2481 CAMPVT010000015.1 GCA946997545_01243 CDS open 8665-9420 _na     251_aa Outer membrane protein beta-barrel domain-containing protein
2482 CAMPVT010000015.1 GCA946997545_01244 CDS open 9426-10985 _na     519_aa Amino acid/peptide transporter
2483 CAMPVT010000015.1 GCA946997545_01245 CDS open 11332-12582 _na     416_aa Phosphoglycerate kinase
2484 CAMPVT010000015.1 GCA946997545_01246 CDS open 12701-13354 _na     217_aa queC 7-cyano-7-deazaguanine synthase QueC
2485 CAMPVT010000015.1 GCA946997545_01247 CDS open 13930-14733 _na     267_aa Metal-dependent hydrolase%2C beta-lactamase superfamily I
2486 CAMPVT010000015.1 GCA946997545_01248 CDS open 14798-15271 _na     157_aa Carboxypeptidase regulatory-like domain-containing protein
2487 CAMPVT010000015.1 GCA946997545_01249 CDS open 15444-15983 _na     179_aa Primosomal protein N' (Replication factor Y)-superfamily II helicase
2488 CAMPVT010000015.1 GCA946997545_01250 CDS open 16018-16983 _na     321_aa Cell division protein
2489 CAMPVT010000015.1 GCA946997545_01251 CDS open 17193-17747 _na     184_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
2490 CAMPVT010000015.1 GCA946997545_01252 CDS open 17836-18618 _na     260_aa DUF4738 domain-containing protein
2491 CAMPVT010000015.1 GCA946997545_01253 CDS open 18916-20448 _na     510_aa Outer membrane insertion signal domain protein
2492 CAMPVT010000015.1 GCA946997545_01254 CDS open 20506-22110 _na     534_aa pyrG CTP synthase
2493 CAMPVT010000015.1 GCA946997545_01255 CDS open 22116-24041 _na     641_aa yidC membrane protein insertase YidC
2494 CAMPVT010000015.1 GCA946997545_01256 CDS open 24061-26226 _na     721_aa Dipeptidyl aminopeptidase/acylaminoacyl peptidase
2495 CAMPVT010000015.1 GCA946997545_01257 CDS open 26272-27897 _na     541_aa Lysosomal dipeptide transporter MFSD1
2496 CAMPVT010000015.1 GCA946997545_01258 CDS open 28004-28564 _na     186_aa Zinc finger/thioredoxin putative domain-containing protein
2497 CAMPVT010000015.1 GCA946997545_01259 CDS open 28770-30464 _na     564_aa putative transporter
2498 CAMPVT010000015.1 GCA946997545_01260 CDS open 30491-30619 _na     42_aa hypothetical protein
2499 CAMPVT010000015.1 GCA946997545_01261 CDS open 30671-32620 _na     649_aa thrS threonine--tRNA ligase
2500 CAMPVT010000015.1 GCA946997545_01262 CDS open 32857-33543 _na     228_aa Sigma-70 region 2