HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella bivia (GCA_946997545.1)

Select a Genome:
BAKTA Annotations for GCA_946997545.1
Genome Selected: Prevotella bivia
ContigsBases CDSrRNA tmRNAtRNA
47 2,028,815 1696 0 1 27
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3466 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3466 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAMPVT010000023.1 GCA946997545_01494 gene open 8755-11457
3002 CAMPVT010000023.1 GCA946997545_01496 gene open 12026-13690
3003 CAMPVT010000023.1 GCA946997545_01497 gene open 13702-15363 recN
3004 CAMPVT010000023.1 GCA946997545_01498 gene open 15476-16720 coaBC
3005 CAMPVT010000023.1 GCA946997545_01499 gene open 16745-17608
3006 CAMPVT010000023.1 GCA946997545_01500 gene open 17698-18930 dnaN
3007 CAMPVT010000023.1 GCA946997545_01501 gene open 19026-19415
3008 CAMPVT010000023.1 GCA946997545_01502 gene open 19537-19962
3009 CAMPVT010000023.1 GCA946997545_01503 gene open 20234-21172
3010 CAMPVT010000023.1 GCA946997545_01504 gene open 21695-21952
3011 CAMPVT010000023.1 GCA946997545_01495 gene open 11774-11848 trnR
3012 CAMPVT010000023.1 GCA946997545_01495 tRNA open 11774-11848 trnR tRNA-Arg(tct)
3013 CAMPVT010000024.1 GCA946997545_01505 CDS open 1035-2024 _na     329_aa Acetyltransferase%2C fucose-4-O-acetylase
3014 CAMPVT010000024.1 GCA946997545_01506 CDS open 2435-3517 _na     360_aa Acyltransferase family protein
3015 CAMPVT010000024.1 GCA946997545_01507 CDS open 3548-4657 _na     369_aa Putative PLP-dependent enzyme possibly involved in cell wall biogenesis
3016 CAMPVT010000024.1 GCA946997545_01508 CDS open 4677-5966 _na     429_aa Endonuclease GajA/Old nuclease/RecF-like AAA domain-containing protein
3017 CAMPVT010000024.1 GCA946997545_01509 CDS open 5953-6372 _na     139_aa hypothetical protein
3018 CAMPVT010000024.1 GCA946997545_01510 CDS open 6379-7584 _na     401_aa Biotin carboxylase
3019 CAMPVT010000024.1 GCA946997545_01511 CDS open 7621-8052 _na     143_aa Acetyltransferase
3020 CAMPVT010000024.1 GCA946997545_01512 CDS open 8049-9347 _na     432_aa Polysaccharide pyruvyl transferase domain-containing protein
3021 CAMPVT010000024.1 GCA946997545_01513 CDS open 9513-10949 _na     478_aa Membrane protein involved in the export of O-antigen and teichoic acid
3022 CAMPVT010000024.1 GCA946997545_01514 CDS open 10946-12208 _na     420_aa Glycosyltransferase
3023 CAMPVT010000024.1 GCA946997545_01515 CDS open 12189-13265 _na     358_aa Acyltransferase 3 domain-containing protein
3024 CAMPVT010000024.1 GCA946997545_01516 CDS open 13244-14206 _na     320_aa Glycosyl transferase
3025 CAMPVT010000024.1 GCA946997545_01517 CDS open 14188-15258 _na     356_aa Glycosyltransferase
3026 CAMPVT010000024.1 GCA946997545_01518 CDS open 15275-16114 _na     279_aa Putative glycosyltransferase
3027 CAMPVT010000024.1 GCA946997545_01519 CDS open 16116-17096 _na     326_aa Glycosyl transferase
3028 CAMPVT010000024.1 GCA946997545_01520 CDS open 17179-18327 _na     382_aa epsG EpsG family protein
3029 CAMPVT010000024.1 GCA946997545_01521 CDS open 18327-19253 _na     308_aa Glycosyl transferase
3030 CAMPVT010000024.1 GCA946997545_01522 CDS open 19256-20299 _na     347_aa Glycosyltransferase
3031 CAMPVT010000024.1 GCA946997545_01523 CDS open 20301-21371 _na     356_aa Glycosyltransferase
3032 CAMPVT010000024.1 GCA946997545_01505 gene open 1035-2024
3033 CAMPVT010000024.1 GCA946997545_01506 gene open 2435-3517
3034 CAMPVT010000024.1 GCA946997545_01507 gene open 3548-4657
3035 CAMPVT010000024.1 GCA946997545_01508 gene open 4677-5966
3036 CAMPVT010000024.1 GCA946997545_01509 gene open 5953-6372
3037 CAMPVT010000024.1 GCA946997545_01510 gene open 6379-7584
3038 CAMPVT010000024.1 GCA946997545_01511 gene open 7621-8052
3039 CAMPVT010000024.1 GCA946997545_01512 gene open 8049-9347
3040 CAMPVT010000024.1 GCA946997545_01513 gene open 9513-10949
3041 CAMPVT010000024.1 GCA946997545_01514 gene open 10946-12208
3042 CAMPVT010000024.1 GCA946997545_01515 gene open 12189-13265
3043 CAMPVT010000024.1 GCA946997545_01516 gene open 13244-14206
3044 CAMPVT010000024.1 GCA946997545_01517 gene open 14188-15258
3045 CAMPVT010000024.1 GCA946997545_01518 gene open 15275-16114
3046 CAMPVT010000024.1 GCA946997545_01519 gene open 16116-17096
3047 CAMPVT010000024.1 GCA946997545_01520 gene open 17179-18327 epsG
3048 CAMPVT010000024.1 GCA946997545_01521 gene open 18327-19253
3049 CAMPVT010000024.1 GCA946997545_01522 gene open 19256-20299
3050 CAMPVT010000024.1 GCA946997545_01523 gene open 20301-21371
3051 CAMPVT010000025.1 GCA946997545_01524 CDS open 429-920 _na     163_aa sarZ HTH-type transcriptional regulator SarZ
3052 CAMPVT010000025.1 GCA946997545_01525 CDS open 1197-1487 _na     96_aa RNA-binding protein
3053 CAMPVT010000025.1 GCA946997545_01526 CDS open 1492-2598 _na     368_aa recF DNA replication/repair protein RecF
3054 CAMPVT010000025.1 GCA946997545_01527 CDS open 2751-3425 _na     224_aa cpoB Ancillary SecYEG translocon subunit/Cell division coordinator CpoB TPR domain-containing protein
3055 CAMPVT010000025.1 GCA946997545_01528 CDS open 3434-3910 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
3056 CAMPVT010000025.1 GCA946997545_01529 CDS open 4137-4502 _na     121_aa Outer membrane insertion signal domain protein
3057 CAMPVT010000025.1 GCA946997545_01530 CDS open 4725-7106 _na     793_aa peptidoglycan glycosyltransferase
3058 CAMPVT010000025.1 GCA946997545_01531 CDS open 7219-8166 _na     315_aa pyrB aspartate carbamoyltransferase
3059 CAMPVT010000025.1 GCA946997545_01532 CDS open 8274-8729 _na     151_aa pyrI aspartate carbamoyltransferase regulatory subunit
3060 CAMPVT010000025.1 GCA946997545_01533 CDS open 8762-8911 _na     49_aa hypothetical protein
3061 CAMPVT010000025.1 GCA946997545_01534 CDS open 8875-9909 _na     344_aa Endolytic murein transglycosylase
3062 CAMPVT010000025.1 GCA946997545_01535 CDS open 10028-10669 _na     213_aa Haloacid dehalogenase superfamily enzyme%2C subfamily IA
3063 CAMPVT010000025.1 GCA946997545_01536 CDS open 11198-12160 _na     320_aa K+dependent Na+ exchanger related-protein
3064 CAMPVT010000025.1 GCA946997545_01537 CDS open 12248-14470 _na     740_aa RelA/SpoT family protein
3065 CAMPVT010000025.1 GCA946997545_01538 CDS open 14718-16691 _na     657_aa rho transcription termination factor Rho
3066 CAMPVT010000025.1 GCA946997545_01539 CDS open 16867-18429 _na     520_aa ahpF alkyl hydroperoxide reductase subunit F
3067 CAMPVT010000025.1 GCA946997545_01540 CDS open 18573-19139 _na     188_aa ahpC alkyl hydroperoxide reductase subunit C
3068 CAMPVT010000025.1 GCA946997545_01541 CDS open 19189-19872 _na     227_aa Superoxide dismutase
3069 CAMPVT010000025.1 GCA946997545_01542 CDS open 20082-21008 _na     308_aa Transcriptional regulator
3070 CAMPVT010000025.1 GCA946997545_01524 gene open 429-920 sarZ
3071 CAMPVT010000025.1 GCA946997545_01525 gene open 1197-1487
3072 CAMPVT010000025.1 GCA946997545_01526 gene open 1492-2598 recF
3073 CAMPVT010000025.1 GCA946997545_01527 gene open 2751-3425 cpoB
3074 CAMPVT010000025.1 GCA946997545_01528 gene open 3434-3910 ribH
3075 CAMPVT010000025.1 GCA946997545_01529 gene open 4137-4502
3076 CAMPVT010000025.1 GCA946997545_01530 gene open 4725-7106
3077 CAMPVT010000025.1 GCA946997545_01531 gene open 7219-8166 pyrB
3078 CAMPVT010000025.1 GCA946997545_01532 gene open 8274-8729 pyrI
3079 CAMPVT010000025.1 GCA946997545_01533 gene open 8762-8911
3080 CAMPVT010000025.1 GCA946997545_01534 gene open 8875-9909
3081 CAMPVT010000025.1 GCA946997545_01535 gene open 10028-10669
3082 CAMPVT010000025.1 GCA946997545_01536 gene open 11198-12160
3083 CAMPVT010000025.1 GCA946997545_01537 gene open 12248-14470
3084 CAMPVT010000025.1 GCA946997545_01538 gene open 14718-16691 rho
3085 CAMPVT010000025.1 GCA946997545_01539 gene open 16867-18429 ahpF
3086 CAMPVT010000025.1 GCA946997545_01540 gene open 18573-19139 ahpC
3087 CAMPVT010000025.1 GCA946997545_01541 gene open 19189-19872
3088 CAMPVT010000025.1 GCA946997545_01542 gene open 20082-21008
3089 CAMPVT010000026.1 GCA946997545_01544 CDS open 246-2189 _na     647_aa mutL DNA mismatch repair endonuclease MutL
3090 CAMPVT010000026.1 GCA946997545_01545 CDS open 2200-2529 _na     109_aa Ubiquitin carboxyl-hydrolase
3091 CAMPVT010000026.1 GCA946997545_01546 CDS open 2546-4489 _na     647_aa lptC LPS export ABC transporter periplasmic protein LptC
3092 CAMPVT010000026.1 GCA946997545_01547 CDS open 4486-5946 _na     486_aa PPIC-type PPIASE domain protein
3093 CAMPVT010000026.1 GCA946997545_01548 CDS open 5961-7094 _na     377_aa PPIC-type PPIASE domain protein
3094 CAMPVT010000026.1 GCA946997545_01549 CDS open 7223-8707 _na     494_aa guaB IMP dehydrogenase
3095 CAMPVT010000026.1 GCA946997545_01550 CDS open 9487-10815 _na     442_aa zinc-dependent metalloproteinase lipoprotein
3096 CAMPVT010000026.1 GCA946997545_01551 CDS open 10841-12283 _na     480_aa Fibronectin type-III domain-containing protein
3097 CAMPVT010000026.1 GCA946997545_01552 CDS open 12505-13128 _na     207_aa udk uridine kinase
3098 CAMPVT010000026.1 GCA946997545_01553 CDS open 13240-13830 _na     196_aa Uracil-DNA glycosylase family protein
3099 CAMPVT010000026.1 GCA946997545_01554 CDS open 13987-15033 _na     348_aa Endonuclease/exonuclease/phosphatase family protein
3100 CAMPVT010000026.1 GCA946997545_01555 CDS open 15245-17827 _na     860_aa TonB-dependent receptor
3101 CAMPVT010000026.1 GCA946997545_01556 CDS open 17849-19057 _na     402_aa DUF5689 domain-containing protein
3102 CAMPVT010000026.1 GCA946997545_01557 CDS open 19093-20481 _na     462_aa Nucleic acid-binding domain protein
3103 CAMPVT010000026.1 GCA946997545_01558 CDS open 20625-20876 _na     83_aa rpmE type B 50S ribosomal protein L31
3104 CAMPVT010000026.1 GCA946997545_01544 gene open 246-2189 mutL
3105 CAMPVT010000026.1 GCA946997545_01545 gene open 2200-2529
3106 CAMPVT010000026.1 GCA946997545_01546 gene open 2546-4489 lptC
3107 CAMPVT010000026.1 GCA946997545_01547 gene open 4486-5946
3108 CAMPVT010000026.1 GCA946997545_01548 gene open 5961-7094
3109 CAMPVT010000026.1 GCA946997545_01549 gene open 7223-8707 guaB
3110 CAMPVT010000026.1 GCA946997545_01550 gene open 9487-10815
3111 CAMPVT010000026.1 GCA946997545_01551 gene open 10841-12283
3112 CAMPVT010000026.1 GCA946997545_01552 gene open 12505-13128 udk
3113 CAMPVT010000026.1 GCA946997545_01553 gene open 13240-13830
3114 CAMPVT010000026.1 GCA946997545_01554 gene open 13987-15033
3115 CAMPVT010000026.1 GCA946997545_01555 gene open 15245-17827
3116 CAMPVT010000026.1 GCA946997545_01556 gene open 17849-19057
3117 CAMPVT010000026.1 GCA946997545_01557 gene open 19093-20481
3118 CAMPVT010000026.1 GCA946997545_01558 gene open 20625-20876 rpmE
3119 CAMPVT010000026.1 GCA946997545_01543 gene open 60-134 trnV
3120 CAMPVT010000026.1 GCA946997545_01543 tRNA open 60-134 trnV tRNA-Val(tac)
3121 CAMPVT010000027.1 GCA946997545_01559 CDS open 72-2966 _na     964_aa PD-(D/E)XK endonuclease-like domain-containing protein
3122 CAMPVT010000027.1 GCA946997545_01560 CDS open 2988-6377 _na     1129_aa DNA 3'-5' helicase
3123 CAMPVT010000027.1 GCA946997545_01561 CDS open 6425-8485 _na     686_aa Outer membrane protein%2C OMP85 family
3124 CAMPVT010000027.1 GCA946997545_01562 CDS open 8667-10214 _na     515_aa algI Alginate O-acetyltransferase AlgI family protein
3125 CAMPVT010000027.1 GCA946997545_01563 CDS open 10246-11646 _na     466_aa SGNH hydrolase-type esterase domain-containing protein
3126 CAMPVT010000027.1 GCA946997545_01564 CDS open 11843-13129 _na     428_aa Malic enzyme%2C NAD binding domain protein
3127 CAMPVT010000027.1 GCA946997545_01565 CDS open 14142-14444 _na     100_aa Cupin 2 conserved barrel domain protein
3128 CAMPVT010000027.1 GCA946997545_01566 CDS open 14449-14823 _na     124_aa hypothetical protein
3129 CAMPVT010000027.1 GCA946997545_01567 CDS open 14830-16002 _na     390_aa PAS domain-containing protein
3130 CAMPVT010000027.1 GCA946997545_01568 CDS open 16470-17210 _na     246_aa WG repeat-containing protein
3131 CAMPVT010000027.1 GCA946997545_01559 gene open 72-2966
3132 CAMPVT010000027.1 GCA946997545_01560 gene open 2988-6377
3133 CAMPVT010000027.1 GCA946997545_01561 gene open 6425-8485
3134 CAMPVT010000027.1 GCA946997545_01562 gene open 8667-10214 algI
3135 CAMPVT010000027.1 GCA946997545_01563 gene open 10246-11646
3136 CAMPVT010000027.1 GCA946997545_01564 gene open 11843-13129
3137 CAMPVT010000027.1 GCA946997545_01565 gene open 14142-14444
3138 CAMPVT010000027.1 GCA946997545_01566 gene open 14449-14823
3139 CAMPVT010000027.1 GCA946997545_01567 gene open 14830-16002
3140 CAMPVT010000027.1 GCA946997545_01568 gene open 16470-17210
3141 CAMPVT010000028.1 GCA946997545_01569 CDS open 254-604 _na     116_aa nuoA NADH-quinone oxidoreductase subunit A
3142 CAMPVT010000028.1 GCA946997545_01570 CDS open 595-1500 _na     301_aa NADH-quinone oxidoreductase subunit B
3143 CAMPVT010000028.1 GCA946997545_01571 CDS open 1512-3089 _na     525_aa NADH-quinone oxidoreductase subunit D
3144 CAMPVT010000028.1 GCA946997545_01572 CDS open 3132-4229 _na     365_aa nuoH NADH-quinone oxidoreductase subunit NuoH
3145 CAMPVT010000028.1 GCA946997545_01573 CDS open 4235-4768 _na     177_aa 4Fe-4S binding domain protein
3146 CAMPVT010000028.1 GCA946997545_01574 CDS open 4776-5309 _na     177_aa NADH-quinone oxidoreductase subunit J
3147 CAMPVT010000028.1 GCA946997545_01575 CDS open 5310-5618 _na     102_aa nuoK NADH-quinone oxidoreductase subunit NuoK
3148 CAMPVT010000028.1 GCA946997545_01576 CDS open 5626-7686 _na     686_aa Proton-translocating NADH-quinone oxidoreductase%2C chain L
3149 CAMPVT010000028.1 GCA946997545_01577 CDS open 7691-9202 _na     503_aa Proton-translocating NADH-quinone oxidoreductase%2C chain M
3150 CAMPVT010000028.1 GCA946997545_01578 CDS open 9215-10654 _na     479_aa NADH-quinone oxidoreductase subunit N
3151 CAMPVT010000028.1 GCA946997545_01579 CDS open 10888-11100 _na     70_aa Fic family protein
3152 CAMPVT010000028.1 GCA946997545_01580 CDS open 11300-12646 _na     448_aa purB adenylosuccinate lyase
3153 CAMPVT010000028.1 GCA946997545_01581 CDS open 12754-14421 _na     555_aa Pseudouridine synthase
3154 CAMPVT010000028.1 GCA946997545_01582 CDS open 14519-15910 _na     463_aa asnS asparagine--tRNA ligase
3155 CAMPVT010000028.1 GCA946997545_01583 CDS open 16207-16305 _na     32_aa hypothetical protein
3156 CAMPVT010000028.1 GCA946997545_01569 gene open 254-604 nuoA
3157 CAMPVT010000028.1 GCA946997545_01570 gene open 595-1500
3158 CAMPVT010000028.1 GCA946997545_01571 gene open 1512-3089
3159 CAMPVT010000028.1 GCA946997545_01572 gene open 3132-4229 nuoH
3160 CAMPVT010000028.1 GCA946997545_01573 gene open 4235-4768
3161 CAMPVT010000028.1 GCA946997545_01574 gene open 4776-5309
3162 CAMPVT010000028.1 GCA946997545_01575 gene open 5310-5618 nuoK
3163 CAMPVT010000028.1 GCA946997545_01576 gene open 5626-7686
3164 CAMPVT010000028.1 GCA946997545_01577 gene open 7691-9202
3165 CAMPVT010000028.1 GCA946997545_01578 gene open 9215-10654
3166 CAMPVT010000028.1 GCA946997545_01579 gene open 10888-11100
3167 CAMPVT010000028.1 GCA946997545_01580 gene open 11300-12646 purB
3168 CAMPVT010000028.1 GCA946997545_01581 gene open 12754-14421
3169 CAMPVT010000028.1 GCA946997545_01582 gene open 14519-15910 asnS
3170 CAMPVT010000028.1 GCA946997545_01583 gene open 16207-16305
3171 CAMPVT010000029.1 GCA946997545_01584 CDS open 517-1179 _na     220_aa hypothetical protein
3172 CAMPVT010000029.1 GCA946997545_01585 CDS open 1338-1469 _na     43_aa hypothetical protein
3173 CAMPVT010000029.1 GCA946997545_01586 CDS open 1700-2365 _na     221_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
3174 CAMPVT010000029.1 GCA946997545_01587 CDS open 2592-3146 _na     184_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
3175 CAMPVT010000029.1 GCA946997545_01588 CDS open 3156-3980 _na     274_aa Esterase/lipase
3176 CAMPVT010000029.1 GCA946997545_01589 CDS open 4190-5413 _na     407_aa Acyl-coenzyme A:6-aminopenicillanic acid acyl-transferase
3177 CAMPVT010000029.1 GCA946997545_01590 CDS open 5531-5911 _na     126_aa mscL large-conductance mechanosensitive channel protein MscL
3178 CAMPVT010000029.1 GCA946997545_01591 CDS open 6168-7196 _na     342_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
3179 CAMPVT010000029.1 GCA946997545_01592 CDS open 7585-8526 _na     313_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
3180 CAMPVT010000029.1 GCA946997545_01593 CDS open 8953-10236 _na     427_aa tetrahydrofolate synthase
3181 CAMPVT010000029.1 GCA946997545_01594 CDS open 10359-11519 _na     386_aa dnaJ molecular chaperone DnaJ
3182 CAMPVT010000029.1 GCA946997545_01595 CDS open 11653-12243 _na     196_aa grpE Protein GrpE
3183 CAMPVT010000029.1 GCA946997545_01596 CDS open 12492-14108 _na     538_aa ABC transporter%2C ATP-binding protein
3184 CAMPVT010000029.1 GCA946997545_01597 CDS open 14202-15206 _na     334_aa DNA cytosine methyltransferase
3185 CAMPVT010000029.1 GCA946997545_01598 CDS open 15246-16199 _na     317_aa HaeIII family restriction endonuclease
3186 CAMPVT010000029.1 GCA946997545_01584 gene open 517-1179
3187 CAMPVT010000029.1 GCA946997545_01585 gene open 1338-1469
3188 CAMPVT010000029.1 GCA946997545_01586 gene open 1700-2365
3189 CAMPVT010000029.1 GCA946997545_01587 gene open 2592-3146
3190 CAMPVT010000029.1 GCA946997545_01588 gene open 3156-3980
3191 CAMPVT010000029.1 GCA946997545_01589 gene open 4190-5413
3192 CAMPVT010000029.1 GCA946997545_01590 gene open 5531-5911 mscL
3193 CAMPVT010000029.1 GCA946997545_01591 gene open 6168-7196 gap
3194 CAMPVT010000029.1 GCA946997545_01592 gene open 7585-8526 miaA
3195 CAMPVT010000029.1 GCA946997545_01593 gene open 8953-10236
3196 CAMPVT010000029.1 GCA946997545_01594 gene open 10359-11519 dnaJ
3197 CAMPVT010000029.1 GCA946997545_01595 gene open 11653-12243 grpE
3198 CAMPVT010000029.1 GCA946997545_01596 gene open 12492-14108
3199 CAMPVT010000029.1 GCA946997545_01597 gene open 14202-15206
3200 CAMPVT010000029.1 GCA946997545_01598 gene open 15246-16199
3201 CAMPVT010000030.1 GCA946997545_01599 CDS open 83-622 _na     179_aa Phage protein
3202 CAMPVT010000030.1 GCA946997545_01600 CDS open 657-1100 _na     147_aa Single-stranded DNA-binding protein
3203 CAMPVT010000030.1 GCA946997545_01601 CDS open 1100-2425 _na     441_aa gldE Gliding motility-associated protein GldE
3204 CAMPVT010000030.1 GCA946997545_01602 CDS open 2412-2933 _na     173_aa Phosphopantetheinyl transferase component of siderophore synthetase
3205 CAMPVT010000030.1 GCA946997545_01603 CDS open 3036-4520 _na     494_aa Glycosyltransferase%2C group 2 family protein
3206 CAMPVT010000030.1 GCA946997545_01604 CDS open 4541-5461 _na     306_aa DUF4922 domain-containing protein
3207 CAMPVT010000030.1 GCA946997545_01605 CDS open 5477-6799 _na     440_aa SpoIID/LytB domain protein
3208 CAMPVT010000030.1 GCA946997545_01606 CDS open 6815-8173 _na     452_aa Transporter%2C major facilitator family protein
3209 CAMPVT010000030.1 GCA946997545_01607 CDS open 8311-9189 _na     292_aa Peptidase M48 domain-containing protein
3210 CAMPVT010000030.1 GCA946997545_01608 CDS open 9321-10712 _na     463_aa mepA Multidrug export protein MepA
3211 CAMPVT010000030.1 GCA946997545_01609 CDS open 10739-11863 _na     374_aa UDP-N-acetylglucosamine 2-epimerase
3212 CAMPVT010000030.1 GCA946997545_01610 CDS open 11872-12825 _na     317_aa Membrane protease subunit%2C stomatin/prohibitin
3213 CAMPVT010000030.1 GCA946997545_01611 CDS open 12842-13300 _na     152_aa Membrane protein implicated in regulation of membrane protease activity
3214 CAMPVT010000030.1 GCA946997545_01599 gene open 83-622
3215 CAMPVT010000030.1 GCA946997545_01600 gene open 657-1100
3216 CAMPVT010000030.1 GCA946997545_01601 gene open 1100-2425 gldE
3217 CAMPVT010000030.1 GCA946997545_01602 gene open 2412-2933
3218 CAMPVT010000030.1 GCA946997545_01603 gene open 3036-4520
3219 CAMPVT010000030.1 GCA946997545_01604 gene open 4541-5461
3220 CAMPVT010000030.1 GCA946997545_01605 gene open 5477-6799
3221 CAMPVT010000030.1 GCA946997545_01606 gene open 6815-8173
3222 CAMPVT010000030.1 GCA946997545_01607 gene open 8311-9189
3223 CAMPVT010000030.1 GCA946997545_01608 gene open 9321-10712 mepA
3224 CAMPVT010000030.1 GCA946997545_01609 gene open 10739-11863
3225 CAMPVT010000030.1 GCA946997545_01610 gene open 11872-12825
3226 CAMPVT010000030.1 GCA946997545_01611 gene open 12842-13300
3227 CAMPVT010000031.1 GCA946997545_01612 CDS open 368-730 _na     120_aa helix-turn-helix transcriptional regulator
3228 CAMPVT010000031.1 GCA946997545_01613 CDS open 745-1041 _na     98_aa higB type II toxin-antitoxin system HigB family toxin
3229 CAMPVT010000031.1 GCA946997545_01614 CDS open 1228-1530 _na     100_aa type II toxin-antitoxin system RelE/ParE family toxin
3230 CAMPVT010000031.1 GCA946997545_01615 CDS open 1527-1778 _na     83_aa copG CopG family transcriptional regulator
3231 CAMPVT010000031.1 GCA946997545_01616 CDS open 2209-3414 _na     401_aa pncB nicotinate phosphoribosyltransferase
3232 CAMPVT010000031.1 GCA946997545_01617 CDS open 3453-4466 _na     337_aa fmt methionyl-tRNA formyltransferase
3233 CAMPVT010000031.1 GCA946997545_01618 CDS open 4514-6328 _na     604_aa eriC Chloride channel protein EriC
3234 CAMPVT010000031.1 GCA946997545_01619 CDS open 6351-6920 _na     189_aa L-threonylcarbamoyladenylate synthase
3235 CAMPVT010000031.1 GCA946997545_01620 CDS open 7072-8049 _na     325_aa ROK family protein
3236 CAMPVT010000031.1 GCA946997545_01621 CDS open 8139-8855 _na     238_aa lysE Translocator protein%2C LysE family
3237 CAMPVT010000031.1 GCA946997545_01622 CDS open 8884-9495 _na     203_aa DUF4924 domain-containing protein
3238 CAMPVT010000031.1 GCA946997545_01623 CDS open 9529-10401 _na     290_aa rfbD dTDP-4-dehydrorhamnose reductase
3239 CAMPVT010000031.1 GCA946997545_01624 CDS open 10403-11971 _na     522_aa peptide chain release factor 3
3240 CAMPVT010000031.1 GCA946997545_01612 gene open 368-730
3241 CAMPVT010000031.1 GCA946997545_01613 gene open 745-1041 higB
3242 CAMPVT010000031.1 GCA946997545_01614 gene open 1228-1530
3243 CAMPVT010000031.1 GCA946997545_01615 gene open 1527-1778 copG
3244 CAMPVT010000031.1 GCA946997545_01616 gene open 2209-3414 pncB
3245 CAMPVT010000031.1 GCA946997545_01617 gene open 3453-4466 fmt
3246 CAMPVT010000031.1 GCA946997545_01618 gene open 4514-6328 eriC
3247 CAMPVT010000031.1 GCA946997545_01619 gene open 6351-6920
3248 CAMPVT010000031.1 GCA946997545_01620 gene open 7072-8049
3249 CAMPVT010000031.1 GCA946997545_01621 gene open 8139-8855 lysE
3250 CAMPVT010000031.1 GCA946997545_01622 gene open 8884-9495
3251 CAMPVT010000031.1 GCA946997545_01623 gene open 9529-10401 rfbD
3252 CAMPVT010000031.1 GCA946997545_01624 gene open 10403-11971
3253 CAMPVT010000032.1 GCA946997545_01625 CDS open 59-796 _na     245_aa Nitroreductase
3254 CAMPVT010000032.1 GCA946997545_01626 CDS open 893-3481 _na     862_aa adenosylcobalamin-dependent ribonucleoside-diphosphate reductase
3255 CAMPVT010000032.1 GCA946997545_01627 CDS open 3541-3951 _na     136_aa folB dihydroneopterin aldolase
3256 CAMPVT010000032.1 GCA946997545_01628 CDS open 3976-5205 _na     409_aa N-acetylmuramoyl-L-alanine amidase
3257 CAMPVT010000032.1 GCA946997545_01629 CDS open 5218-6198 _na     326_aa Mce/MlaD domain-containing protein
3258 CAMPVT010000032.1 GCA946997545_01630 CDS open 6598-8001 _na     467_aa dnaA chromosomal replication initiator protein DnaA
3259 CAMPVT010000032.1 GCA946997545_01631 CDS open 8158-8889 _na     243_aa Cysteine-rich domain protein
3260 CAMPVT010000032.1 GCA946997545_01632 CDS open 8910-10325 _na     471_aa 4Fe-4S ferredoxin-type domain-containing protein
3261 CAMPVT010000032.1 GCA946997545_01633 CDS open 10350-10925 _na     191_aa LUD domain-containing protein
3262 CAMPVT010000032.1 GCA946997545_01634 CDS open 11053-12360 _na     435_aa eno phosphopyruvate hydratase
3263 CAMPVT010000032.1 GCA946997545_01625 gene open 59-796
3264 CAMPVT010000032.1 GCA946997545_01626 gene open 893-3481
3265 CAMPVT010000032.1 GCA946997545_01627 gene open 3541-3951 folB
3266 CAMPVT010000032.1 GCA946997545_01628 gene open 3976-5205
3267 CAMPVT010000032.1 GCA946997545_01629 gene open 5218-6198
3268 CAMPVT010000032.1 GCA946997545_01630 gene open 6598-8001 dnaA
3269 CAMPVT010000032.1 GCA946997545_01631 gene open 8158-8889
3270 CAMPVT010000032.1 GCA946997545_01632 gene open 8910-10325
3271 CAMPVT010000032.1 GCA946997545_01633 gene open 10350-10925
3272 CAMPVT010000032.1 GCA946997545_01634 gene open 11053-12360 eno
3273 CAMPVT010000033.1 GCA946997545_01635 CDS open 673-2610 _na     645_aa Hyaluronoglucosaminidase
3274 CAMPVT010000033.1 GCA946997545_01636 CDS open 3292-4692 _na     466_aa Aminopeptidase
3275 CAMPVT010000033.1 GCA946997545_01637 CDS open 5064-6137 _na     357_aa ompA OmpA family protein
3276 CAMPVT010000033.1 GCA946997545_01638 CDS open 6335-6952 _na     205_aa ruvA Holliday junction branch migration protein RuvA
3277 CAMPVT010000033.1 GCA946997545_01639 CDS open 6961-7368 _na     135_aa DUF304 domain-containing protein
3278 CAMPVT010000033.1 GCA946997545_01640 CDS open 7371-8711 _na     446_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
3279 CAMPVT010000033.1 GCA946997545_01641 CDS open 8722-9723 _na     333_aa DUF4435 domain-containing protein
3280 CAMPVT010000033.1 GCA946997545_01642 CDS open 9736-10557 _na     273_aa AAA+ ATPase domain-containing protein
3281 CAMPVT010000033.1 GCA946997545_01643 CDS open 10818-11765 _na     315_aa cysK cysteine synthase A
3282 CAMPVT010000033.1 GCA946997545_01635 gene open 673-2610
3283 CAMPVT010000033.1 GCA946997545_01636 gene open 3292-4692
3284 CAMPVT010000033.1 GCA946997545_01637 gene open 5064-6137 ompA
3285 CAMPVT010000033.1 GCA946997545_01638 gene open 6335-6952 ruvA
3286 CAMPVT010000033.1 GCA946997545_01639 gene open 6961-7368
3287 CAMPVT010000033.1 GCA946997545_01640 gene open 7371-8711 dacB
3288 CAMPVT010000033.1 GCA946997545_01641 gene open 8722-9723
3289 CAMPVT010000033.1 GCA946997545_01642 gene open 9736-10557
3290 CAMPVT010000033.1 GCA946997545_01643 gene open 10818-11765 cysK
3291 CAMPVT010000034.1 GCA946997545_01652 gene open 9469-9699 sRNA_1300
3292 CAMPVT010000034.1 GCA946997545_01652 ncRNA open 9469-9699 Enterococcus sRNA 1300
3293 CAMPVT010000034.1 GCA946997545_01644 CDS open 77-1729 _na     550_aa tnpX TnpX site-specific recombinase family protein
3294 CAMPVT010000034.1 GCA946997545_01645 CDS open 1801-1968 _na     55_aa zapA Cell division protein ZapA
3295 CAMPVT010000034.1 GCA946997545_01646 CDS open 1987-2934 _na     315_aa hypothetical protein
3296 CAMPVT010000034.1 GCA946997545_01647 CDS open 3352-5676 _na     774_aa Nucleoside triphosphatase%2C D5 family
3297 CAMPVT010000034.1 GCA946997545_01648 CDS open 5988-6200 _na     70_aa HTH cro/C1-type domain-containing protein
3298 CAMPVT010000034.1 GCA946997545_01649 CDS open 6200-6490 _na     96_aa DNA methylase N-4/N-6
3299 CAMPVT010000034.1 GCA946997545_01650 CDS open 6608-8071 _na     487_aa msr(D) ABC-F type ribosomal protection protein Msr(D)
3300 CAMPVT010000034.1 GCA946997545_01651 CDS open 8191-9408 _na     405_aa mef(A) macrolide efflux MFS transporter Mef(A)
3301 CAMPVT010000034.1 GCA946997545_01653 CDS open 9794-9964 _na     56_aa DNA recombinase
3302 CAMPVT010000034.1 GCA946997545_01644 gene open 77-1729 tnpX
3303 CAMPVT010000034.1 GCA946997545_01645 gene open 1801-1968 zapA
3304 CAMPVT010000034.1 GCA946997545_01646 gene open 1987-2934
3305 CAMPVT010000034.1 GCA946997545_01647 gene open 3352-5676
3306 CAMPVT010000034.1 GCA946997545_01648 gene open 5988-6200
3307 CAMPVT010000034.1 GCA946997545_01649 gene open 6200-6490
3308 CAMPVT010000034.1 GCA946997545_01650 gene open 6608-8071 msr(D)
3309 CAMPVT010000034.1 GCA946997545_01651 gene open 8191-9408 mef(A)
3310 CAMPVT010000034.1 GCA946997545_01653 gene open 9794-9964
3311 CAMPVT010000035.1 GCA946997545_01654 CDS open 351-1448 _na     365_aa Mannose-1-phosphate guanylyltransferase
3312 CAMPVT010000035.1 GCA946997545_01655 CDS open 1521-1919 _na     132_aa HIT family hydrolase%2C diadenosine tetraphosphate hydrolase
3313 CAMPVT010000035.1 GCA946997545_01656 CDS open 1949-2410 _na     153_aa greA transcription elongation factor GreA
3314 CAMPVT010000035.1 GCA946997545_01657 CDS open 2695-3414 _na     239_aa FtsH-interacting integral membrane protein
3315 CAMPVT010000035.1 GCA946997545_01658 CDS open 3526-4878 _na     450_aa AAA domain-containing protein
3316 CAMPVT010000035.1 GCA946997545_01659 CDS open 5148-6404 _na     418_aa Clostripain family protein
3317 CAMPVT010000035.1 GCA946997545_01660 CDS open 6401-6544 _na     47_aa hypothetical protein
3318 CAMPVT010000035.1 GCA946997545_01661 CDS open 6803-7345 _na     180_aa Arginine repressor
3319 CAMPVT010000035.1 GCA946997545_01662 CDS open 7809-9959 _na     716_aa Zn-dependent oligopeptidase
3320 CAMPVT010000035.1 GCA946997545_01654 gene open 351-1448
3321 CAMPVT010000035.1 GCA946997545_01655 gene open 1521-1919
3322 CAMPVT010000035.1 GCA946997545_01656 gene open 1949-2410 greA
3323 CAMPVT010000035.1 GCA946997545_01657 gene open 2695-3414
3324 CAMPVT010000035.1 GCA946997545_01658 gene open 3526-4878
3325 CAMPVT010000035.1 GCA946997545_01659 gene open 5148-6404
3326 CAMPVT010000035.1 GCA946997545_01660 gene open 6401-6544
3327 CAMPVT010000035.1 GCA946997545_01661 gene open 6803-7345
3328 CAMPVT010000035.1 GCA946997545_01662 gene open 7809-9959
3329 CAMPVT010000036.1 regulatory_region open 787-886 TPP riboswitch aptamer (THI element)
3330 CAMPVT010000036.1 GCA946997545_01664 CDS open 394-645 _na     83_aa HEPN domain-containing protein
3331 CAMPVT010000036.1 GCA946997545_01665 CDS open 955-1770 _na     271_aa hydroxymethylpyrimidine kinase
3332 CAMPVT010000036.1 GCA946997545_01666 CDS open 1767-2387 _na     206_aa thiamine phosphate synthase
3333 CAMPVT010000036.1 GCA946997545_01667 CDS open 2392-3963 _na     523_aa thiC phosphomethylpyrimidine synthase ThiC
3334 CAMPVT010000036.1 GCA946997545_01668 CDS open 3985-4758 _na     257_aa sulfide-dependent adenosine diphosphate thiazole synthase
3335 CAMPVT010000036.1 GCA946997545_01669 CDS open 4781-5437 _na     218_aa Thiamine monophosphate synthase
3336 CAMPVT010000036.1 GCA946997545_01670 CDS open 5531-6262 _na     243_aa Short-chain dehydrogenase
3337 CAMPVT010000036.1 GCA946997545_01671 CDS open 6324-6656 _na     110_aa Cupin domain-containing protein
3338 CAMPVT010000036.1 GCA946997545_01672 CDS open 6685-9945 _na     1086_aa TonB-dependent receptor plug domain protein
3339 CAMPVT010000036.1 GCA946997545_01664 gene open 394-645
3340 CAMPVT010000036.1 GCA946997545_01665 gene open 955-1770
3341 CAMPVT010000036.1 GCA946997545_01666 gene open 1767-2387
3342 CAMPVT010000036.1 GCA946997545_01667 gene open 2392-3963 thiC
3343 CAMPVT010000036.1 GCA946997545_01668 gene open 3985-4758
3344 CAMPVT010000036.1 GCA946997545_01669 gene open 4781-5437
3345 CAMPVT010000036.1 GCA946997545_01670 gene open 5531-6262
3346 CAMPVT010000036.1 GCA946997545_01671 gene open 6324-6656
3347 CAMPVT010000036.1 GCA946997545_01672 gene open 6685-9945
3348 CAMPVT010000036.1 GCA946997545_01663 gene open 143-215 trnfM
3349 CAMPVT010000036.1 GCA946997545_01663 tRNA open 143-215 trnfM tRNA-fMet(cat)
3350 CAMPVT010000037.1 GCA946997545_01673 CDS open 158-433 _na     91_aa rpsO 30S ribosomal protein S15
3351 CAMPVT010000037.1 GCA946997545_01674 CDS open 642-2444 _na     600_aa typA translational GTPase TypA
3352 CAMPVT010000037.1 GCA946997545_01675 CDS open 2701-3375 _na     224_aa hypothetical protein
3353 CAMPVT010000037.1 GCA946997545_01676 CDS open 3397-5595 _na     732_aa Tex-like protein
3354 CAMPVT010000037.1 GCA946997545_01677 CDS open 5692-7677 _na     661_aa abc-f ribosomal protection-like ABC-F family protein
3355 CAMPVT010000037.1 GCA946997545_01678 CDS open 7774-9807 _na     677_aa Peptidase family M13
3356 CAMPVT010000037.1 GCA946997545_01673 gene open 158-433 rpsO
3357 CAMPVT010000037.1 GCA946997545_01674 gene open 642-2444 typA
3358 CAMPVT010000037.1 GCA946997545_01675 gene open 2701-3375
3359 CAMPVT010000037.1 GCA946997545_01676 gene open 3397-5595
3360 CAMPVT010000037.1 GCA946997545_01677 gene open 5692-7677 abc-f
3361 CAMPVT010000037.1 GCA946997545_01678 gene open 7774-9807
3362 CAMPVT010000038.1 GCA946997545_01679 CDS open 54-632 _na     192_aa GTP cyclohydrolase-2
3363 CAMPVT010000038.1 GCA946997545_01680 CDS open 849-1913 _na     354_aa Lipoprotein
3364 CAMPVT010000038.1 GCA946997545_01681 CDS open 1936-2700 _na     254_aa Lipoprotein
3365 CAMPVT010000038.1 GCA946997545_01682 CDS open 2737-4866 _na     709_aa TonB-dependent receptor
3366 CAMPVT010000038.1 GCA946997545_01683 CDS open 5617-8418 _na     933_aa TonB-dependent receptor
3367 CAMPVT010000038.1 GCA946997545_01684 CDS open 8469-8735 _na     88_aa hypothetical protein
3368 CAMPVT010000038.1 GCA946997545_01679 gene open 54-632
3369 CAMPVT010000038.1 GCA946997545_01680 gene open 849-1913
3370 CAMPVT010000038.1 GCA946997545_01681 gene open 1936-2700
3371 CAMPVT010000038.1 GCA946997545_01682 gene open 2737-4866
3372 CAMPVT010000038.1 GCA946997545_01683 gene open 5617-8418
3373 CAMPVT010000038.1 GCA946997545_01684 gene open 8469-8735
3374 CAMPVT010000039.1 repeat_region open 8083-8365 CRISPR array with 4 repeats of length 47%2C consensus sequence GTTGTGTTTGATACCACAAAGATAGAAATTTTCAAGCAAATCACAAC and spacer length 29
3375 CAMPVT010000039.1 GCA946997545_01685 CDS open 773-1417 _na     214_aa luxR Transcriptional regulator%2C LuxR family
3376 CAMPVT010000039.1 GCA946997545_01686 CDS open 1473-1649 _na     58_aa hypothetical protein
3377 CAMPVT010000039.1 GCA946997545_01687 CDS open 2077-6534 _na     1485_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
3378 CAMPVT010000039.1 GCA946997545_01688 CDS open 6544-7476 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
3379 CAMPVT010000039.1 GCA946997545_01689 CDS open 7478-7819 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
3380 CAMPVT010000039.1 GCA946997545_01685 gene open 773-1417 luxR
3381 CAMPVT010000039.1 GCA946997545_01686 gene open 1473-1649
3382 CAMPVT010000039.1 GCA946997545_01687 gene open 2077-6534 cas9
3383 CAMPVT010000039.1 GCA946997545_01688 gene open 6544-7476 cas1
3384 CAMPVT010000039.1 GCA946997545_01689 gene open 7478-7819 cas2
3385 CAMPVT010000040.1 GCA946997545_01690 CDS open 673-2151 _na     492_aa Periplasmic serine protease%2C Do/DeqQ family
3386 CAMPVT010000040.1 GCA946997545_01691 CDS open 2265-4232 _na     655_aa putative potassium transport system protein Kup
3387 CAMPVT010000040.1 GCA946997545_01692 CDS open 4349-5545 _na     398_aa Aminopeptidase
3388 CAMPVT010000040.1 GCA946997545_01693 CDS open 5900-7135 _na     411_aa xerD Recombinase
3389 CAMPVT010000040.1 GCA946997545_01694 CDS open 7147-7509 _na     120_aa rhuM RhuM protein
3390 CAMPVT010000040.1 GCA946997545_01695 CDS open 7587-7862 _na     91_aa Helix-turn-helix domain-containing protein
3391 CAMPVT010000040.1 GCA946997545_01690 gene open 673-2151
3392 CAMPVT010000040.1 GCA946997545_01691 gene open 2265-4232
3393 CAMPVT010000040.1 GCA946997545_01692 gene open 4349-5545
3394 CAMPVT010000040.1 GCA946997545_01693 gene open 5900-7135 xerD
3395 CAMPVT010000040.1 GCA946997545_01694 gene open 7147-7509 rhuM
3396 CAMPVT010000040.1 GCA946997545_01695 gene open 7587-7862
3397 CAMPVT010000041.1 GCA946997545_01696 CDS open 162-1034 _na     290_aa sucD succinate--CoA ligase subunit alpha
3398 CAMPVT010000041.1 GCA946997545_01697 CDS open 1054-2187 _na     377_aa sucC ADP-forming succinate--CoA ligase subunit beta
3399 CAMPVT010000041.1 GCA946997545_01698 CDS open 2223-3287 _na     354_aa buk butyrate kinase
3400 CAMPVT010000041.1 GCA946997545_01699 CDS open 3277-4200 _na     307_aa Phosphotransacetylase
3401 CAMPVT010000041.1 GCA946997545_01700 CDS open 4346-5656 _na     436_aa MORN repeat protein
3402 CAMPVT010000041.1 GCA946997545_01701 CDS open 5815-7749 _na     644_aa wbiI Epimerase/dehydratase WbiI family protein
3403 CAMPVT010000041.1 GCA946997545_01696 gene open 162-1034 sucD
3404 CAMPVT010000041.1 GCA946997545_01697 gene open 1054-2187 sucC
3405 CAMPVT010000041.1 GCA946997545_01698 gene open 2223-3287 buk
3406 CAMPVT010000041.1 GCA946997545_01699 gene open 3277-4200
3407 CAMPVT010000041.1 GCA946997545_01700 gene open 4346-5656
3408 CAMPVT010000041.1 GCA946997545_01701 gene open 5815-7749 wbiI
3409 CAMPVT010000042.1 GCA946997545_01703 CDS open 298-954 _na     218_aa Glycine transporter domain-containing protein
3410 CAMPVT010000042.1 GCA946997545_01704 CDS open 976-1935 _na     319_aa Lactate dehydrogenase-like oxidoreductase
3411 CAMPVT010000042.1 GCA946997545_01705 CDS open 1963-3234 _na     423_aa ATPase%2C AAA family
3412 CAMPVT010000042.1 GCA946997545_01706 CDS open 3372-5531 _na     719_aa Membrane protein
3413 CAMPVT010000042.1 GCA946997545_01707 CDS open 5873-6586 _na     237_aa TIGR02453 family protein
3414 CAMPVT010000042.1 GCA946997545_01708 CDS open 6588-7208 _na     206_aa nth endonuclease III
3415 CAMPVT010000042.1 GCA946997545_01703 gene open 298-954
3416 CAMPVT010000042.1 GCA946997545_01704 gene open 976-1935
3417 CAMPVT010000042.1 GCA946997545_01705 gene open 1963-3234
3418 CAMPVT010000042.1 GCA946997545_01706 gene open 3372-5531
3419 CAMPVT010000042.1 GCA946997545_01707 gene open 5873-6586
3420 CAMPVT010000042.1 GCA946997545_01708 gene open 6588-7208 nth
3421 CAMPVT010000042.1 GCA946997545_01702 gene open 140-213 trnR
3422 CAMPVT010000042.1 GCA946997545_01702 tRNA open 140-213 trnR tRNA-Arg(acg)
3423 CAMPVT010000043.1 GCA946997545_01709 CDS open 178-1629 _na     483_aa ATP-dependent endonuclease
3424 CAMPVT010000043.1 GCA946997545_01710 CDS open 1643-2500 _na     285_aa Endonuclease
3425 CAMPVT010000043.1 GCA946997545_01711 CDS open 2515-3216 _na     233_aa Membrane protein
3426 CAMPVT010000043.1 GCA946997545_01712 CDS open 3238-3726 _na     162_aa lrgA LrgA
3427 CAMPVT010000043.1 GCA946997545_01713 CDS open 3870-4715 _na     281_aa DUF3822 domain-containing protein
3428 CAMPVT010000043.1 GCA946997545_01714 CDS open 4734-5264 _na     176_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
3429 CAMPVT010000043.1 GCA946997545_01715 CDS open 5434-5823 _na     129_aa Transposase DDE domain-containing protein
3430 CAMPVT010000043.1 GCA946997545_01709 gene open 178-1629
3431 CAMPVT010000043.1 GCA946997545_01710 gene open 1643-2500
3432 CAMPVT010000043.1 GCA946997545_01711 gene open 2515-3216
3433 CAMPVT010000043.1 GCA946997545_01712 gene open 3238-3726 lrgA
3434 CAMPVT010000043.1 GCA946997545_01713 gene open 3870-4715
3435 CAMPVT010000043.1 GCA946997545_01714 gene open 4734-5264 rsmD
3436 CAMPVT010000043.1 GCA946997545_01715 gene open 5434-5823
3437 CAMPVT010000044.1 GCA946997545_01716 CDS open 258-2630 _na     790_aa DUF4906 domain-containing protein
3438 CAMPVT010000044.1 GCA946997545_01717 CDS open 2664-2903 _na     79_aa hypothetical protein
3439 CAMPVT010000044.1 GCA946997545_01718 CDS open 3971-4471 _na     166_aa Bacterial transferase hexapeptide repeat protein
3440 CAMPVT010000044.1 GCA946997545_01719 CDS open 4713-4814 _na     33_aa hypothetical protein
3441 CAMPVT010000044.1 GCA946997545_01716 gene open 258-2630
3442 CAMPVT010000044.1 GCA946997545_01717 gene open 2664-2903
3443 CAMPVT010000044.1 GCA946997545_01718 gene open 3971-4471
3444 CAMPVT010000044.1 GCA946997545_01719 gene open 4713-4814
3445 CAMPVT010000045.1 GCA946997545_01720 CDS open 208-723 _na     171_aa bacteriocin fulvocin C-related protein
3446 CAMPVT010000045.1 GCA946997545_01721 CDS open 828-1262 _na     144_aa hypothetical protein
3447 CAMPVT010000045.1 GCA946997545_01722 CDS open 1896-2597 _na     233_aa rsmI 16S rRNA (cytidine(1402)-2'-O)-methyltransferase
3448 CAMPVT010000045.1 GCA946997545_01723 CDS open 2621-3535 _na     304_aa Lipoprotein
3449 CAMPVT010000045.1 GCA946997545_01724 CDS open 4018-4359 _na     113_aa Transposase DDE domain-containing protein
3450 CAMPVT010000045.1 GCA946997545_01720 gene open 208-723
3451 CAMPVT010000045.1 GCA946997545_01721 gene open 828-1262
3452 CAMPVT010000045.1 GCA946997545_01722 gene open 1896-2597 rsmI
3453 CAMPVT010000045.1 GCA946997545_01723 gene open 2621-3535
3454 CAMPVT010000045.1 GCA946997545_01724 gene open 4018-4359
3455 CAMPVT010000046.1 GCA946997545_01725 CDS open 159-1907 _na     582_aa 5'-nucleotidase/2'%2C3'-cyclic phosphodiesterase-like hydrolase
3456 CAMPVT010000046.1 GCA946997545_01726 CDS open 1963-2730 _na     255_aa nudC NAD(+) diphosphatase
3457 CAMPVT010000046.1 GCA946997545_01727 CDS open 2757-4058 _na     433_aa Permease
3458 CAMPVT010000046.1 GCA946997545_01725 gene open 159-1907
3459 CAMPVT010000046.1 GCA946997545_01726 gene open 1963-2730 nudC
3460 CAMPVT010000046.1 GCA946997545_01727 gene open 2757-4058
3461 CAMPVT010000047.1 GCA946997545_01728 CDS open 8-658 _na     216_aa hypothetical protein
3462 CAMPVT010000047.1 GCA946997545_01730 CDS open 1337-1723 _na     128_aa START-like domain-containing protein
3463 CAMPVT010000047.1 GCA946997545_01728 gene open 8-658
3464 CAMPVT010000047.1 GCA946997545_01730 gene open 1337-1723
3465 CAMPVT010000047.1 GCA946997545_01729 gene open 1118-1191 trnM
3466 CAMPVT010000047.1 GCA946997545_01729 tRNA open 1118-1191 trnM tRNA-Met(cat)