HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Megasphaera lornae (GCA_946997615.1)

Select a Genome:
BAKTA Annotations for GCA_946997615.1
Genome Selected: Megasphaera lornae
ContigsBases CDSrRNA tmRNAtRNA
14 1,649,515 1521 0 1 44
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3170 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3170 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAMPVW010000012.1 GCA946997615_01491 CDS open 2335-3588 _na     417_aa Diaminopimelate decarboxylase
3002 CAMPVW010000012.1 GCA946997615_01492 CDS open 3734-4591 _na     285_aa lysR Transcriptional regulator%2C LysR family
3003 CAMPVW010000012.1 GCA946997615_01493 CDS open 4935-5192 _na     85_aa copZ Copper chaperone CopZ
3004 CAMPVW010000012.1 GCA946997615_01494 CDS open 5297-6184 _na     295_aa dapA 4-hydroxy-tetrahydrodipicolinate synthase
3005 CAMPVW010000012.1 GCA946997615_01495 CDS open 6205-7239 _na     344_aa aspartate-semialdehyde dehydrogenase
3006 CAMPVW010000012.1 GCA946997615_01496 CDS open 7261-8058 _na     265_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
3007 CAMPVW010000012.1 GCA946997615_01497 CDS open 8125-9831 _na     568_aa recN DNA repair protein RecN
3008 CAMPVW010000012.1 GCA946997615_01498 CDS open 9839-10294 _na     151_aa argR arginine repressor
3009 CAMPVW010000012.1 GCA946997615_01499 CDS open 10334-10906 _na     190_aa rRNA methylase
3010 CAMPVW010000012.1 GCA946997615_01500 CDS open 10908-11780 _na     290_aa NAD kinase
3011 CAMPVW010000012.1 GCA946997615_01501 CDS open 11792-12589 _na     265_aa Ribosomal RNA large subunit methyltransferase J
3012 CAMPVW010000012.1 GCA946997615_01502 CDS open 12606-13493 _na     295_aa Polyprenyl synthetase
3013 CAMPVW010000012.1 GCA946997615_01503 CDS open 13480-13728 _na     82_aa xseB exodeoxyribonuclease VII small subunit
3014 CAMPVW010000012.1 GCA946997615_01504 CDS open 13715-14920 _na     401_aa xseA exodeoxyribonuclease VII large subunit
3015 CAMPVW010000012.1 GCA946997615_01505 CDS open 14922-15869 _na     315_aa N(6)-L-threonylcarbamoyladenine synthase
3016 CAMPVW010000012.1 GCA946997615_01506 CDS open 15866-16291 _na     141_aa nusB transcription antitermination factor NusB
3017 CAMPVW010000012.1 GCA946997615_01507 CDS open 16301-16606 _na     101_aa Asp23/Gls24 family envelope stress response protein
3018 CAMPVW010000012.1 GCA946997615_01508 CDS open 16590-16979 _na     129_aa Asp23/Gls24 family envelope stress response protein
3019 CAMPVW010000012.1 GCA946997615_01509 CDS open 17055-17612 _na     185_aa efp elongation factor P
3020 CAMPVW010000012.1 GCA946997615_01510 CDS open 17627-18688 _na     353_aa Creatinase
3021 CAMPVW010000012.1 GCA946997615_01511 CDS open 18750-19466 _na     238_aa Pseudouridine synthase
3022 CAMPVW010000012.1 GCA946997615_01512 CDS open 19476-20129 _na     217_aa cobC alpha-ribazole phosphatase
3023 CAMPVW010000012.1 GCA946997615_01513 CDS open 20278-20766 _na     162_aa Molybdenum cofactor biosynthesis protein B
3024 CAMPVW010000012.1 GCA946997615_01514 CDS open 21001-21966 _na     321_aa Exonuclease domain-containing protein
3025 CAMPVW010000012.1 GCA946997615_01515 CDS open 21874-22119 _na     81_aa hypothetical protein
3026 CAMPVW010000012.1 GCA946997615_01516 CDS open 22058-27019 _na     1653_aa TonB-dependent receptor
3027 CAMPVW010000012.1 GCA946997615_01517 CDS open 27235-27933 _na     232_aa TVP38/TMEM64 family membrane protein
3028 CAMPVW010000012.1 GCA946997615_01518 CDS open 28164-31382 _na     1072_aa Hep/Hag repeat protein
3029 CAMPVW010000012.1 GCA946997615_01519 CDS open 31812-32426 _na     204_aa DUF4125 domain-containing protein
3030 CAMPVW010000012.1 GCA946997615_01520 CDS open 32502-32852 _na     116_aa rplT 50S ribosomal protein L20
3031 CAMPVW010000012.1 GCA946997615_01521 CDS open 32893-33090 _na     65_aa rpmI 50S ribosomal protein L35
3032 CAMPVW010000012.1 GCA946997615_01522 CDS open 33109-33573 _na     154_aa infC translation initiation factor IF-3
3033 CAMPVW010000012.1 GCA946997615_01523 CDS open 33839-33994 _na     51_aa hypothetical protein
3034 CAMPVW010000012.1 GCA946997615_01524 CDS open 34263-35444 _na     393_aa acetyl-CoA C-acetyltransferase
3035 CAMPVW010000012.1 GCA946997615_01525 CDS open 35635-36960 _na     441_aa potE putrescine-ornithine antiporter
3036 CAMPVW010000012.1 GCA946997615_01526 CDS open 37289-39226 _na     645_aa OPT family oligopeptide transporter
3037 CAMPVW010000012.1 GCA946997615_01527 CDS open 39309-39740 _na     143_aa hypothetical protein
3038 CAMPVW010000012.1 GCA946997615_01528 CDS open 40226-41512 _na     428_aa O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase
3039 CAMPVW010000012.1 GCA946997615_01529 CDS open 41532-42458 _na     308_aa metA homoserine O-succinyltransferase
3040 CAMPVW010000012.1 GCA946997615_01530 CDS open 42508-43905 _na     465_aa glcD Glycolate oxidase%2C subunit GlcD
3041 CAMPVW010000012.1 GCA946997615_01531 CDS open 43957-44124 _na     55_aa hypothetical protein
3042 CAMPVW010000012.1 GCA946997615_01532 CDS open 44136-44864 _na     242_aa FCD domain protein
3043 CAMPVW010000012.1 GCA946997615_01533 CDS open 44857-45732 _na     291_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
3044 CAMPVW010000012.1 GCA946997615_01534 CDS open 45910-46845 _na     311_aa DUF2179 domain-containing protein
3045 CAMPVW010000012.1 GCA946997615_01489 gene open 286-1602
3046 CAMPVW010000012.1 GCA946997615_01490 gene open 1696-2211
3047 CAMPVW010000012.1 GCA946997615_01491 gene open 2335-3588
3048 CAMPVW010000012.1 GCA946997615_01492 gene open 3734-4591 lysR
3049 CAMPVW010000012.1 GCA946997615_01493 gene open 4935-5192 copZ
3050 CAMPVW010000012.1 GCA946997615_01494 gene open 5297-6184 dapA
3051 CAMPVW010000012.1 GCA946997615_01495 gene open 6205-7239
3052 CAMPVW010000012.1 GCA946997615_01496 gene open 7261-8058 dapB
3053 CAMPVW010000012.1 GCA946997615_01497 gene open 8125-9831 recN
3054 CAMPVW010000012.1 GCA946997615_01498 gene open 9839-10294 argR
3055 CAMPVW010000012.1 GCA946997615_01499 gene open 10334-10906
3056 CAMPVW010000012.1 GCA946997615_01500 gene open 10908-11780
3057 CAMPVW010000012.1 GCA946997615_01501 gene open 11792-12589
3058 CAMPVW010000012.1 GCA946997615_01502 gene open 12606-13493
3059 CAMPVW010000012.1 GCA946997615_01503 gene open 13480-13728 xseB
3060 CAMPVW010000012.1 GCA946997615_01504 gene open 13715-14920 xseA
3061 CAMPVW010000012.1 GCA946997615_01505 gene open 14922-15869
3062 CAMPVW010000012.1 GCA946997615_01506 gene open 15866-16291 nusB
3063 CAMPVW010000012.1 GCA946997615_01507 gene open 16301-16606
3064 CAMPVW010000012.1 GCA946997615_01508 gene open 16590-16979
3065 CAMPVW010000012.1 GCA946997615_01509 gene open 17055-17612 efp
3066 CAMPVW010000012.1 GCA946997615_01510 gene open 17627-18688
3067 CAMPVW010000012.1 GCA946997615_01511 gene open 18750-19466
3068 CAMPVW010000012.1 GCA946997615_01512 gene open 19476-20129 cobC
3069 CAMPVW010000012.1 GCA946997615_01513 gene open 20278-20766
3070 CAMPVW010000012.1 GCA946997615_01514 gene open 21001-21966
3071 CAMPVW010000012.1 GCA946997615_01515 gene open 21874-22119
3072 CAMPVW010000012.1 GCA946997615_01516 gene open 22058-27019
3073 CAMPVW010000012.1 GCA946997615_01517 gene open 27235-27933
3074 CAMPVW010000012.1 GCA946997615_01518 gene open 28164-31382
3075 CAMPVW010000012.1 GCA946997615_01519 gene open 31812-32426
3076 CAMPVW010000012.1 GCA946997615_01520 gene open 32502-32852 rplT
3077 CAMPVW010000012.1 GCA946997615_01521 gene open 32893-33090 rpmI
3078 CAMPVW010000012.1 GCA946997615_01522 gene open 33109-33573 infC
3079 CAMPVW010000012.1 GCA946997615_01523 gene open 33839-33994
3080 CAMPVW010000012.1 GCA946997615_01524 gene open 34263-35444
3081 CAMPVW010000012.1 GCA946997615_01525 gene open 35635-36960 potE
3082 CAMPVW010000012.1 GCA946997615_01526 gene open 37289-39226
3083 CAMPVW010000012.1 GCA946997615_01527 gene open 39309-39740
3084 CAMPVW010000012.1 GCA946997615_01528 gene open 40226-41512
3085 CAMPVW010000012.1 GCA946997615_01529 gene open 41532-42458 metA
3086 CAMPVW010000012.1 GCA946997615_01530 gene open 42508-43905 glcD
3087 CAMPVW010000012.1 GCA946997615_01531 gene open 43957-44124
3088 CAMPVW010000012.1 GCA946997615_01532 gene open 44136-44864
3089 CAMPVW010000012.1 GCA946997615_01533 gene open 44857-45732 ispE
3090 CAMPVW010000012.1 GCA946997615_01534 gene open 45910-46845
3091 CAMPVW010000013.1 regulatory_region open 21451-21548 SAM riboswitch aptamer (S box leader)
3092 CAMPVW010000013.1 repeat_region open 28-981 CRISPR array with 16 repeats of length 28%2C consensus sequence GGATCACCCCCGCGTGTGCGGGAAGAAC and spacer length 33
3093 CAMPVW010000013.1 GCA946997615_01535 CDS open 990-1844 _na     284_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
3094 CAMPVW010000013.1 GCA946997615_01536 CDS open 1835-2785 _na     316_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
3095 CAMPVW010000013.1 GCA946997615_01537 CDS open 2782-3435 _na     217_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
3096 CAMPVW010000013.1 GCA946997615_01538 CDS open 3407-4168 _na     253_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
3097 CAMPVW010000013.1 GCA946997615_01539 CDS open 4178-5251 _na     357_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
3098 CAMPVW010000013.1 GCA946997615_01540 CDS open 5238-5825 _na     195_aa casB type I-E CRISPR-associated protein Cse2/CasB
3099 CAMPVW010000013.1 GCA946997615_01541 CDS open 5840-7588 _na     582_aa casA CRISPR system CASCADE complex protein CasA
3100 CAMPVW010000013.1 GCA946997615_01542 CDS open 7554-10328 _na     924_aa CRISPR-associated helicase Cas3
3101 CAMPVW010000013.1 GCA946997615_01543 CDS open 10577-10921 _na     114_aa Histidine triad domain protein
3102 CAMPVW010000013.1 GCA946997615_01544 CDS open 10918-12240 _na     440_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
3103 CAMPVW010000013.1 GCA946997615_01545 CDS open 12244-12969 _na     241_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
3104 CAMPVW010000013.1 GCA946997615_01546 CDS open 12970-13851 _na     293_aa prmA 50S ribosomal protein L11 methyltransferase
3105 CAMPVW010000013.1 GCA946997615_01547 CDS open 13869-15101 _na     410_aa dnaJ molecular chaperone DnaJ
3106 CAMPVW010000013.1 GCA946997615_01548 CDS open 15128-16981 _na     617_aa dnaK molecular chaperone DnaK
3107 CAMPVW010000013.1 GCA946997615_01549 CDS open 17012-17584 _na     190_aa grpE nucleotide exchange factor GrpE
3108 CAMPVW010000013.1 GCA946997615_01550 CDS open 17599-18630 _na     343_aa hrcA heat-inducible transcriptional repressor HrcA
3109 CAMPVW010000013.1 GCA946997615_01551 CDS open 18851-20134 _na     427_aa M18 family aminopeptidase
3110 CAMPVW010000013.1 GCA946997615_01552 CDS open 20329-20682 _na     117_aa DNA-binding helix-turn-helix protein
3111 CAMPVW010000013.1 GCA946997615_01553 CDS open 20709-21377 _na     222_aa yigZ YigZ family protein
3112 CAMPVW010000013.1 GCA946997615_01554 CDS open 21449-22666 _na     405_aa Methionine ABC transporter ATP-binding protein
3113 CAMPVW010000013.1 GCA946997615_01555 CDS open 22647-23300 _na     217_aa ABC transporter%2C permease protein
3114 CAMPVW010000013.1 GCA946997615_01557 CDS open 23891-24085 _na     64_aa hypothetical protein
3115 CAMPVW010000013.1 GCA946997615_01558 CDS open 24085-24243 _na     52_aa hypothetical protein
3116 CAMPVW010000013.1 GCA946997615_01535 gene open 990-1844 cas2e
3117 CAMPVW010000013.1 GCA946997615_01536 gene open 1835-2785 cas1e
3118 CAMPVW010000013.1 GCA946997615_01537 gene open 2782-3435 cas6e
3119 CAMPVW010000013.1 GCA946997615_01538 gene open 3407-4168 cas5e
3120 CAMPVW010000013.1 GCA946997615_01539 gene open 4178-5251 cas7e
3121 CAMPVW010000013.1 GCA946997615_01540 gene open 5238-5825 casB
3122 CAMPVW010000013.1 GCA946997615_01541 gene open 5840-7588 casA
3123 CAMPVW010000013.1 GCA946997615_01542 gene open 7554-10328
3124 CAMPVW010000013.1 GCA946997615_01543 gene open 10577-10921
3125 CAMPVW010000013.1 GCA946997615_01544 gene open 10918-12240 mtaB
3126 CAMPVW010000013.1 GCA946997615_01545 gene open 12244-12969
3127 CAMPVW010000013.1 GCA946997615_01546 gene open 12970-13851 prmA
3128 CAMPVW010000013.1 GCA946997615_01547 gene open 13869-15101 dnaJ
3129 CAMPVW010000013.1 GCA946997615_01548 gene open 15128-16981 dnaK
3130 CAMPVW010000013.1 GCA946997615_01549 gene open 17012-17584 grpE
3131 CAMPVW010000013.1 GCA946997615_01550 gene open 17599-18630 hrcA
3132 CAMPVW010000013.1 GCA946997615_01551 gene open 18851-20134
3133 CAMPVW010000013.1 GCA946997615_01552 gene open 20329-20682
3134 CAMPVW010000013.1 GCA946997615_01553 gene open 20709-21377 yigZ
3135 CAMPVW010000013.1 GCA946997615_01554 gene open 21449-22666
3136 CAMPVW010000013.1 GCA946997615_01555 gene open 22647-23300
3137 CAMPVW010000013.1 GCA946997615_01557 gene open 23891-24085
3138 CAMPVW010000013.1 GCA946997615_01558 gene open 24085-24243
3139 CAMPVW010000013.1 GCA946997615_01556 gene open 23416-23504 trnS
3140 CAMPVW010000013.1 GCA946997615_01556 tRNA open 23416-23504 trnS tRNA-Ser(cga)
3141 CAMPVW010000014.1 GCA946997615_01559 CDS open 320-1099 _na     259_aa ABC transporter%2C substrate-binding protein%2C family 3
3142 CAMPVW010000014.1 GCA946997615_01560 CDS open 1099-1743 _na     214_aa Haloacid dehalogenase-like hydrolase
3143 CAMPVW010000014.1 GCA946997615_01561 CDS open 1835-3067 _na     410_aa Copper amine oxidase
3144 CAMPVW010000014.1 GCA946997615_01562 CDS open 3054-3989 _na     311_aa whiA DNA-binding protein WhiA
3145 CAMPVW010000014.1 GCA946997615_01563 CDS open 3999-5345 _na     448_aa Putative gluconeogenesis factor
3146 CAMPVW010000014.1 GCA946997615_01564 CDS open 5361-6263 _na     300_aa rapZ RNase adapter RapZ
3147 CAMPVW010000014.1 GCA946997615_01565 CDS open 6275-7084 _na     269_aa Cof-like hydrolase
3148 CAMPVW010000014.1 GCA946997615_01566 CDS open 7081-7443 _na     120_aa SLH domain-containing protein
3149 CAMPVW010000014.1 GCA946997615_01567 CDS open 7521-8027 _na     168_aa DivIVA domain protein
3150 CAMPVW010000014.1 GCA946997615_01568 CDS open 8074-8859 _na     261_aa S4 domain protein
3151 CAMPVW010000014.1 GCA946997615_01569 CDS open 8869-9381 _na     170_aa sepF Cell division protein SepF
3152 CAMPVW010000014.1 GCA946997615_01570 CDS open 9395-10078 _na     227_aa Pyridoxal phosphate homeostasis protein
3153 CAMPVW010000014.1 GCA946997615_01571 CDS open 10203-11051 _na     282_aa pgeF peptidoglycan editing factor PgeF
3154 CAMPVW010000014.1 GCA946997615_01573 CDS open 11301-11726 _na     141_aa Integrase catalytic domain-containing protein
3155 CAMPVW010000014.1 GCA946997615_01559 gene open 320-1099
3156 CAMPVW010000014.1 GCA946997615_01560 gene open 1099-1743
3157 CAMPVW010000014.1 GCA946997615_01561 gene open 1835-3067
3158 CAMPVW010000014.1 GCA946997615_01562 gene open 3054-3989 whiA
3159 CAMPVW010000014.1 GCA946997615_01563 gene open 3999-5345
3160 CAMPVW010000014.1 GCA946997615_01564 gene open 5361-6263 rapZ
3161 CAMPVW010000014.1 GCA946997615_01565 gene open 6275-7084
3162 CAMPVW010000014.1 GCA946997615_01566 gene open 7081-7443
3163 CAMPVW010000014.1 GCA946997615_01567 gene open 7521-8027
3164 CAMPVW010000014.1 GCA946997615_01568 gene open 8074-8859
3165 CAMPVW010000014.1 GCA946997615_01569 gene open 8869-9381 sepF
3166 CAMPVW010000014.1 GCA946997615_01570 gene open 9395-10078
3167 CAMPVW010000014.1 GCA946997615_01571 gene open 10203-11051 pgeF
3168 CAMPVW010000014.1 GCA946997615_01573 gene open 11301-11726
3169 CAMPVW010000014.1 GCA946997615_01572 gene open 11129-11219 trnS
3170 CAMPVW010000014.1 GCA946997615_01572 tRNA open 11129-11219 trnS tRNA-Ser(gct)