HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Sneathia vaginalis (GCA_946997945.1)

Select a Genome:
BAKTA Annotations for GCA_946997945.1
Genome Selected: Sneathia vaginalis
ContigsBases CDSrRNA tmRNAtRNA
16 1258649 1185 0 1 25
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2441 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 2441 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAMPXN010000001.1 GCA946997945_00152 gene open 149593-149937
502 CAMPXN010000001.1 GCA946997945_00153 gene open 149940-150569 eNDO3c
503 CAMPXN010000001.1 GCA946997945_00154 gene open 150577-152544 ftsH
504 CAMPXN010000001.1 GCA946997945_00155 gene open 152544-153677 ttcA
505 CAMPXN010000001.1 GCA946997945_00156 gene open 153677-154555 spoIID
506 CAMPXN010000001.1 GCA946997945_00157 gene open 154543-155499 mltG
507 CAMPXN010000001.1 GCA946997945_00158 gene open 155492-156586 ytvI
508 CAMPXN010000001.1 GCA946997945_00159 gene open 156591-159416 uvrA
509 CAMPXN010000001.1 GCA946997945_00160 gene open 159436-161241 dinG
510 CAMPXN010000001.1 GCA946997945_00161 gene open 161207-161980 thiN
511 CAMPXN010000001.1 GCA946997945_00162 gene open 162110-163294 folC
512 CAMPXN010000001.1 GCA946997945_00163 gene open 163190-164647 pepD
513 CAMPXN010000001.1 GCA946997945_00164 gene open 164714-166168 yfcC
514 CAMPXN010000001.1 GCA946997945_00165 gene open 166192-167124 arcC
515 CAMPXN010000001.1 GCA946997945_00166 gene open 167126-168118 argF
516 CAMPXN010000001.1 GCA946997945_00167 gene open 168150-169367 arcA
517 CAMPXN010000001.1 GCA946997945_00168 gene open 169593-170030 yjhB
518 CAMPXN010000001.1 GCA946997945_00169 gene open 170081-171475 alsT
519 CAMPXN010000001.1 GCA946997945_00170 gene open 171522-172727 ilvA
520 CAMPXN010000001.1 GCA946997945_00171 gene open 172827-173999 gltP
521 CAMPXN010000001.1 GCA946997945_00172 gene open 174154-174822
522 CAMPXN010000001.1 GCA946997945_00173 gene open 174809-176536 manB
523 CAMPXN010000001.1 GCA946997945_00174 gene open 176553-177692
524 CAMPXN010000001.1 GCA946997945_00175 gene open 177692-181132 smc
525 CAMPXN010000001.1 GCA946997945_00176 gene open 181123-182046 wcaG
526 CAMPXN010000001.1 GCA946997945_00177 gene open 182201-184063
527 CAMPXN010000001.1 GCA946997945_00178 gene open 184238-185503 wcaJ
528 CAMPXN010000001.1 GCA946997945_00179 gene open 185504-186247 wcaA
529 CAMPXN010000001.1 GCA946997945_00180 gene open 186250-187338 tagB
530 CAMPXN010000001.1 GCA946997945_00181 gene open 187331-188158 wcaA
531 CAMPXN010000001.1 GCA946997945_00182 gene open 188160-188873 oCH1
532 CAMPXN010000001.1 GCA946997945_00183 gene open 188834-190195
533 CAMPXN010000001.1 GCA946997945_00184 gene open 190182-191042 wcaA
534 CAMPXN010000001.1 GCA946997945_00185 gene open 190988-192424 rfbX
535 CAMPXN010000001.1 GCA946997945_00186 gene open 192414-193379 cpsB
536 CAMPXN010000001.1 GCA946997945_00187 gene open 193370-194290 panE
537 CAMPXN010000001.1 GCA946997945_00188 gene open 194464-197103 valS
538 CAMPXN010000001.1 GCA946997945_00189 gene open 197113-197532 ybbJ
539 CAMPXN010000001.1 GCA946997945_00190 gene open 197534-198412 hflC
540 CAMPXN010000001.1 GCA946997945_00191 gene open 198418-198816
541 CAMPXN010000001.1 GCA946997945_00192 gene open 198809-199369 acrR
542 CAMPXN010000001.1 GCA946997945_00193 gene open 199564-200304 cof
543 CAMPXN010000001.1 GCA946997945_00194 gene open 200304-201953 ptsG2
544 CAMPXN010000001.1 GCA946997945_00195 gene open 201943-202476
545 CAMPXN010000001.1 GCA946997945_00196 gene open 202686-203630
546 CAMPXN010000001.1 GCA946997945_00197 gene open 203712-215174
547 CAMPXN010000001.1 GCA946997945_00198 gene open 215162-215683
548 CAMPXN010000001.1 GCA946997945_00199 gene open 215943-216062
549 CAMPXN010000001.1 GCA946997945_00200 gene open 216182-216481
550 CAMPXN010000001.1 GCA946997945_00201 gene open 216668-217408 rpiR
551 CAMPXN010000001.1 GCA946997945_00202 gene open 217421-218743
552 CAMPXN010000001.1 GCA946997945_00203 gene open 218763-220472 argS
553 CAMPXN010000001.1 GCA946997945_00204 gene open 220538-221983 mgtE
554 CAMPXN010000001.1 GCA946997945_00205 gene open 222222-223406 tuf
555 CAMPXN010000001.1 GCA946997945_00206 gene open 223303-223884
556 CAMPXN010000001.1 GCA946997945_00207 gene open 223916-224101 hicA
557 CAMPXN010000001.1 GCA946997945_00208 gene open 224192-224758
558 CAMPXN010000001.1 GCA946997945_00209 gene open 224851-225084 rpsR
559 CAMPXN010000001.1 GCA946997945_00210 gene open 225100-225495 ssb
560 CAMPXN010000001.1 GCA946997945_00211 gene open 225514-225801 rpsF
561 CAMPXN010000001.1 GCA946997945_00212 gene open 225886-226521 acrR
562 CAMPXN010000001.1 GCA946997945_00217 gene open 227021-227701
563 CAMPXN010000001.1 GCA946997945_00218 gene open 227977-228543 nrdG
564 CAMPXN010000001.1 GCA946997945_00219 gene open 228528-230756 nrdD
565 CAMPXN010000001.1 GCA946997945_00220 gene open 230848-231624
566 CAMPXN010000001.1 GCA946997945_00221 gene open 231618-232901
567 CAMPXN010000001.1 GCA946997945_00222 gene open 232937-234811 metG
568 CAMPXN010000001.1 GCA946997945_00223 gene open 234821-235279 trmL
569 CAMPXN010000001.1 GCA946997945_00224 gene open 235289-235855 ruvC
570 CAMPXN010000001.1 GCA946997945_00225 gene open 235989-238151
571 CAMPXN010000001.1 GCA946997945_00226 gene open 238298-239452 malY
572 CAMPXN010000001.1 GCA946997945_00227 gene open 239457-240350 lysR
573 CAMPXN010000001.1 GCA946997945_00228 gene open 240352-240978
574 CAMPXN010000001.1 GCA946997945_00230 gene open 241302-241700
575 CAMPXN010000001.1 GCA946997945_00231 gene open 241700-243523 typA
576 CAMPXN010000001.1 GCA946997945_00232 gene open 243539-244195 acm
577 CAMPXN010000001.1 GCA946997945_00233 gene open 244228-245514 serS
578 CAMPXN010000001.1 GCA946997945_00234 gene open 245524-246123
579 CAMPXN010000001.1 GCA946997945_00235 gene open 246080-246982 whiA
580 CAMPXN010000001.1 GCA946997945_00236 gene open 246972-248312 norM
581 CAMPXN010000001.1 GCA946997945_00237 gene open 248385-248882 nagE
582 CAMPXN010000001.1 GCA946997945_00238 gene open 248943-249893
583 CAMPXN010000001.1 GCA946997945_00239 gene open 249868-250296 dut
584 CAMPXN010000001.1 GCA946997945_00240 gene open 250296-251333 mreB
585 CAMPXN010000001.1 GCA946997945_00241 gene open 251344-251901 frr
586 CAMPXN010000001.1 GCA946997945_00242 gene open 251915-252619 pyrH
587 CAMPXN010000001.1 GCA946997945_00243 gene open 252677-253585 tsf
588 CAMPXN010000001.1 GCA946997945_00244 gene open 253588-254364 rpsB
589 CAMPXN010000001.1 GCA946997945_00245 gene open 254494-256341
590 CAMPXN010000001.1 GCA946997945_00246 gene open 256535-258895
591 CAMPXN010000001.1 GCA946997945_00247 gene open 259153-260646
592 CAMPXN010000001.1 GCA946997945_00248 gene open 261117-272669
593 CAMPXN010000001.1 GCA946997945_00249 gene open 272850-273641
594 CAMPXN010000001.1 GCA946997945_00250 gene open 273922-274602 dapB
595 CAMPXN010000001.1 GCA946997945_00251 gene open 274688-274948 ptsH
596 CAMPXN010000001.1 GCA946997945_00252 gene open 274967-275755 rluA
597 CAMPXN010000001.1 GCA946997945_00253 gene open 275757-276857 rodA
598 CAMPXN010000001.1 GCA946997945_00254 gene open 276847-277404 cvpA
599 CAMPXN010000001.1 GCA946997945_00255 gene open 277415-278437 alr
600 CAMPXN010000001.1 GCA946997945_00256 gene open 278427-279056 cmk
601 CAMPXN010000001.1 GCA946997945_00257 gene open 279050-279967 prmA
602 CAMPXN010000001.1 GCA946997945_00258 gene open 279958-280743 ymdB
603 CAMPXN010000001.1 GCA946997945_00259 gene open 280786-282360 rny
604 CAMPXN010000001.1 GCA946997945_00260 gene open 282373-282795
605 CAMPXN010000001.1 GCA946997945_00261 gene open 283146-285107
606 CAMPXN010000001.1 GCA946997945_00262 gene open 285151-285867 nlpA
607 CAMPXN010000001.1 GCA946997945_00263 gene open 286387-287226 abcC
608 CAMPXN010000001.1 GCA946997945_00264 gene open 287468-290170
609 CAMPXN010000001.1 GCA946997945_00265 gene open 290171-290527 rimI
610 CAMPXN010000001.1 GCA946997945_00266 gene open 290517-291782 lepB
611 CAMPXN010000001.1 GCA946997945_00269 gene open 292147-293295 fieF
612 CAMPXN010000001.1 GCA946997945_00270 gene open 293307-295619 rlhA
613 CAMPXN010000001.1 GCA946997945_00271 gene open 295427-296659 yesN
614 CAMPXN010000001.1 GCA946997945_00272 gene open 296721-298226 cstA
615 CAMPXN010000001.1 GCA946997945_00273 gene open 298427-300148 mdlB
616 CAMPXN010000001.1 GCA946997945_00274 gene open 300132-301886 mdlB
617 CAMPXN010000001.1 GCA946997945_00275 gene open 302031-302999 araC
618 CAMPXN010000001.1 GCA946997945_00276 gene open 303027-303446
619 CAMPXN010000001.1 GCA946997945_00277 gene open 303714-303878
620 CAMPXN010000001.1 GCA946997945_00278 gene open 303953-304402
621 CAMPXN010000001.1 GCA946997945_00279 gene open 304404-304604 xRE
622 CAMPXN010000001.1 GCA946997945_00280 gene open 305417-308014
623 CAMPXN010000001.1 GCA946997945_00281 gene open 308014-308931
624 CAMPXN010000001.1 GCA946997945_00282 gene open 308961-310223
625 CAMPXN010000001.1 GCA946997945_00283 gene open 310311-310745
626 CAMPXN010000001.1 GCA946997945_00284 gene open 310738-313275
627 CAMPXN010000001.1 GCA946997945_00285 gene open 313224-313550
628 CAMPXN010000001.1 GCA946997945_00286 gene open 314420-315055
629 CAMPXN010000001.1 GCA946997945_00287 gene open 315055-315435
630 CAMPXN010000001.1 GCA946997945_00288 gene open 315750-315923
631 CAMPXN010000001.1 GCA946997945_00289 gene open 316036-316230
632 CAMPXN010000001.1 GCA946997945_00290 gene open 316223-316636
633 CAMPXN010000001.1 GCA946997945_00291 gene open 316688-316903
634 CAMPXN010000001.1 GCA946997945_00292 gene open 317405-318940 guaA
635 CAMPXN010000001.1 GCA946997945_00293 gene open 318922-320928 zntA
636 CAMPXN010000001.1 GCA946997945_00294 gene open 320915-322321 rsbU
637 CAMPXN010000001.1 GCA946997945_00295 gene open 322323-322721 nusB
638 CAMPXN010000001.1 GCA946997945_00296 gene open 322729-323325 amaP
639 CAMPXN010000001.1 GCA946997945_00297 gene open 323335-323679 yloU
640 CAMPXN010000001.1 GCA946997945_00298 gene open 323725-326682 dnaE
641 CAMPXN010000001.1 GCA946997945_00299 gene open 326683-327783 nifS
642 CAMPXN010000001.1 GCA946997945_00300 gene open 327881-328453 pth
643 CAMPXN010000001.1 GCA946997945_00301 gene open 328434-328949
644 CAMPXN010000001.1 GCA946997945_00302 gene open 328939-330564 nptA
645 CAMPXN010000001.1 GCA946997945_00303 gene open 330574-331995 pepB
646 CAMPXN010000001.1 GCA946997945_00304 gene open 332104-333090 purR
647 CAMPXN010000001.1 GCA946997945_00305 gene open 333092-334060 rbsK
648 CAMPXN010000001.1 GCA946997945_00306 gene open 334042-334668 eda
649 CAMPXN010000001.1 GCA946997945_00307 gene open 334689-335669
650 CAMPXN010000001.1 GCA946997945_00308 gene open 335650-336450
651 CAMPXN010000001.1 GCA946997945_00309 gene open 336452-337258
652 CAMPXN010000001.1 GCA946997945_00310 gene open 337548-339302 uidA
653 CAMPXN010000001.1 GCA946997945_00311 gene open 339315-341027 bglX
654 CAMPXN010000001.1 GCA946997945_00312 gene open 341011-341814 gph
655 CAMPXN010000001.1 GCA946997945_00313 gene open 341804-343222 melB
656 CAMPXN010000001.1 GCA946997945_00314 gene open 343226-344035 fabG
657 CAMPXN010000001.1 GCA946997945_00315 gene open 344025-345080 uxuA
658 CAMPXN010000001.1 GCA946997945_00316 gene open 345082-346470 uxaC
659 CAMPXN010000001.1 GCA946997945_00317 gene open 346577-347560 purR
660 CAMPXN010000001.1 GCA946997945_00318 gene open 348118-348807 gpmA
661 CAMPXN010000001.1 GCA946997945_00319 gene open 348915-349886 pfkA
662 CAMPXN010000001.1 GCA946997945_00320 gene open 349917-351368 pykF
663 CAMPXN010000001.1 GCA946997945_00321 gene open 351432-352022 recR
664 CAMPXN010000001.1 GCA946997945_00322 gene open 352012-353166 metK
665 CAMPXN010000001.1 GCA946997945_00323 gene open 353159-354706 oppA
666 CAMPXN010000001.1 GCA946997945_00324 gene open 354715-356040
667 CAMPXN010000001.1 GCA946997945_00325 gene open 356247-357707
668 CAMPXN010000001.1 GCA946997945_00326 gene open 357815-358774 nagC
669 CAMPXN010000001.1 GCA946997945_00327 gene open 358786-360153 adhE
670 CAMPXN010000001.1 GCA946997945_00328 gene open 360146-361027 pldB
671 CAMPXN010000001.1 GCA946997945_00329 gene open 361469-362602 gerE
672 CAMPXN010000001.1 GCA946997945_00330 gene open 362586-363482 dusA
673 CAMPXN010000001.1 GCA946997945_00331 gene open 363507-363839 trxA
674 CAMPXN010000001.1 GCA946997945_00332 gene open 363850-365178 nox
675 CAMPXN010000001.1 GCA946997945_00333 gene open 365225-366169 dusA
676 CAMPXN010000001.1 GCA946997945_00334 gene open 366170-367378 rarA
677 CAMPXN010000001.1 GCA946997945_00335 gene open 367380-368828 malQ
678 CAMPXN010000001.1 GCA946997945_00336 gene open 368874-369959 hemW
679 CAMPXN010000001.1 GCA946997945_00338 gene open 370535-372616 mtlA2
680 CAMPXN010000001.1 GCA946997945_00339 gene open 372597-373025 ptsN
681 CAMPXN010000001.1 GCA946997945_00340 gene open 373041-373358 frwB
682 CAMPXN010000001.1 GCA946997945_00341 gene open 373370-374563 frwC
683 CAMPXN010000001.1 GCA946997945_00342 gene open 374553-375746 malY
684 CAMPXN010000001.1 GCA946997945_00343 gene open 375721-376704 frvX
685 CAMPXN010000001.1 GCA946997945_00344 gene open 377015-378985 yadA
686 CAMPXN010000001.1 GCA946997945_00345 gene open 379130-380758
687 CAMPXN010000001.1 GCA946997945_00346 gene open 381055-381828 nIF3
688 CAMPXN010000001.1 GCA946997945_00347 gene open 381819-382682
689 CAMPXN010000001.1 GCA946997945_00348 gene open 382658-383131
690 CAMPXN010000001.1 GCA946997945_00349 gene open 383098-384558 purB
691 CAMPXN010000001.1 GCA946997945_00350 gene open 384561-385841 purA
692 CAMPXN010000001.1 GCA946997945_00351 gene open 386060-386590 hpt
693 CAMPXN010000001.1 GCA946997945_00213 gene open 226608-226690 trnL
694 CAMPXN010000001.1 GCA946997945_00214 gene open 226705-226780 trnH
695 CAMPXN010000001.1 GCA946997945_00215 gene open 226787-226862 trnG
696 CAMPXN010000001.1 GCA946997945_00216 gene open 226864-226940 trnP
697 CAMPXN010000001.1 GCA946997945_00229 gene open 241070-241146 trnM
698 CAMPXN010000001.1 GCA946997945_00213 tRNA open 226608-226690 trnL tRNA-Leu(tag)
699 CAMPXN010000001.1 GCA946997945_00214 tRNA open 226705-226780 trnH tRNA-His(gtg)
700 CAMPXN010000001.1 GCA946997945_00215 tRNA open 226787-226862 trnG tRNA-Gly(tcc)
701 CAMPXN010000001.1 GCA946997945_00216 tRNA open 226864-226940 trnP tRNA-Pro(tgg)
702 CAMPXN010000001.1 GCA946997945_00229 tRNA open 241070-241146 trnM tRNA-Met(cat)
703 CAMPXN010000002.1 GCA946997945_00430 gene open 77798-77921 DUF3800-I
704 CAMPXN010000002.1 GCA946997945_00430 ncRNA open 77798-77921 DUF3800-I RNA
705 CAMPXN010000002.1 regulatory_region open 29412-29501 TPP riboswitch aptamer (THI element)
706 CAMPXN010000002.1 regulatory_region open 88243-88368 glmS glucosamine-6-phosphate activated ribozyme aptamer
707 CAMPXN010000002.1 regulatory_region open 185693-185765 S4-Fusobacteriales ribosomal protein leader
708 CAMPXN010000002.1 repeat_region open 237739-237971 CRISPR array with 4 repeats of length 36%2C consensus sequence ATTTGAAAGCATCTTTTAATTTCTACTATTGTAGAT and spacer length 26
709 CAMPXN010000002.1 repeat_region open 238112-238295 CRISPR array with 3 repeats of length 39%2C consensus sequence ATTTGAAAGCATCTTTTAATTTCTACTATTGTAGATATA and spacer length 25
710 CAMPXN010000002.1 GCA946997945_00352 CDS open 121-618 _na     165_aa nfnB Nitroreductase domain-containing protein
711 CAMPXN010000002.1 GCA946997945_00353 CDS open 715-2649 _na     644_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
712 CAMPXN010000002.1 GCA946997945_00354 CDS open 2659-5151 _na     830_aa gyrA DNA gyrase subunit A
713 CAMPXN010000002.1 GCA946997945_00355 CDS open 5144-5947 _na     267_aa uspA UspA domain-containing protein
714 CAMPXN010000002.1 GCA946997945_00356 CDS open 5902-7260 _na     452_aa hypothetical protein
715 CAMPXN010000002.1 GCA946997945_00357 CDS open 7276-8292 _na     338_aa pheS phenylalanine--tRNA ligase subunit alpha
716 CAMPXN010000002.1 GCA946997945_00358 CDS open 8305-10665 _na     786_aa pheT phenylalanine--tRNA ligase subunit beta
717 CAMPXN010000002.1 GCA946997945_00359 CDS open 10678-11169 _na     163_aa Lipoprotein
718 CAMPXN010000002.1 GCA946997945_00360 CDS open 11174-12946 _na     590_aa pepF oligoendopeptidase F
719 CAMPXN010000002.1 GCA946997945_00361 CDS open 12965-14275 _na     436_aa eno phosphopyruvate hydratase
720 CAMPXN010000002.1 GCA946997945_00362 CDS open 14385-16289 _na     634_aa thrS threonine--tRNA ligase
721 CAMPXN010000002.1 GCA946997945_00363 CDS open 16306-16998 _na     230_aa ybhL BAX inhibitor (BI)-1/YccA family protein
722 CAMPXN010000002.1 GCA946997945_00364 CDS open 17021-18595 _na     524_aa Glycoside hydrolase
723 CAMPXN010000002.1 GCA946997945_00365 CDS open 18597-19715 _na     372_aa nifS cysteine desulfurase
724 CAMPXN010000002.1 GCA946997945_00366 CDS open 19827-20537 _na     236_aa glpR HTH deoR-type domain-containing protein
725 CAMPXN010000002.1 GCA946997945_00367 CDS open 20515-21441 _na     308_aa pfkB 1-phosphofructokinase
726 CAMPXN010000002.1 GCA946997945_00368 CDS open 21419-23281 _na     620_aa ptsN PTS fructose transporter subunit IIC
727 CAMPXN010000002.1 GCA946997945_00369 CDS open 23446-24993 _na     515_aa mdlB ABC transporter ATP-binding protein
728 CAMPXN010000002.1 GCA946997945_00370 CDS open 25025-26563 _na     512_aa mdlB ABC transporter ATP-binding protein
729 CAMPXN010000002.1 GCA946997945_00371 CDS open 26644-27777 _na     377_aa nagC ROK family protein
730 CAMPXN010000002.1 GCA946997945_00372 CDS open 27903-28532 _na     209_aa yoaK DUF1275 domain-containing protein
731 CAMPXN010000002.1 GCA946997945_00373 CDS open 28569-29285 _na     238_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
732 CAMPXN010000002.1 GCA946997945_00374 CDS open 29554-30282 _na     242_aa tauC Nitrate ABC transporter permease
733 CAMPXN010000002.1 GCA946997945_00375 CDS open 30292-31263 _na     323_aa tauA Nitrate ABC transporter substrate-binding protein
734 CAMPXN010000002.1 GCA946997945_00376 CDS open 31244-31972 _na     242_aa tauB Nitrate ABC transporter ATP-binding protein
735 CAMPXN010000002.1 GCA946997945_00377 CDS open 32095-33129 _na     344_aa hypothetical protein
736 CAMPXN010000002.1 GCA946997945_00378 CDS open 33122-33688 _na     188_aa hypothetical protein
737 CAMPXN010000002.1 GCA946997945_00379 CDS open 33673-34065 _na     130_aa hypothetical protein
738 CAMPXN010000002.1 GCA946997945_00380 CDS open 34043-35395 _na     450_aa Gp5/Type VI secretion system Vgr protein OB-fold domain-containing protein
739 CAMPXN010000002.1 GCA946997945_00381 CDS open 35355-38414 _na     1019_aa PAAR-like protein
740 CAMPXN010000002.1 GCA946997945_00382 CDS open 38424-39359 _na     311_aa Autotransporter domain-containing protein
741 CAMPXN010000002.1 GCA946997945_00383 CDS open 39478-40485 _na     335_aa dppD Peptide ABC transporter ATPase
742 CAMPXN010000002.1 GCA946997945_00384 CDS open 40478-41434 _na     318_aa yejF Peptide ABC transporter substrate-binding protein
743 CAMPXN010000002.1 GCA946997945_00385 CDS open 41436-42398 _na     320_aa opp4B oligopeptide ABC transporter permease
744 CAMPXN010000002.1 GCA946997945_00386 CDS open 42408-43298 _na     296_aa dppC Peptide ABC transporter permease
745 CAMPXN010000002.1 GCA946997945_00387 CDS open 43331-43822 _na     163_aa DUF1439 domain-containing protein
746 CAMPXN010000002.1 GCA946997945_00388 CDS open 43911-44267 _na     118_aa yhfA Osmotically inducible protein OsmC
747 CAMPXN010000002.1 GCA946997945_00389 CDS open 44269-46011 _na     580_aa uvrC excinuclease ABC subunit UvrC
748 CAMPXN010000002.1 GCA946997945_00390 CDS open 46076-47602 _na     508_aa nupO ABC transporter ATP-binding protein
749 CAMPXN010000002.1 GCA946997945_00391 CDS open 47595-48668 _na     357_aa nupP ABC transporter permease
750 CAMPXN010000002.1 GCA946997945_00392 CDS open 48670-49530 _na     286_aa nupQ Branched-chain amino acid ABC transporter permease
751 CAMPXN010000002.1 GCA946997945_00393 CDS open 49598-50614 _na     338_aa med Membrane protein
752 CAMPXN010000002.1 GCA946997945_00394 CDS open 50709-52013 _na     434_aa deoA thymidine phosphorylase
753 CAMPXN010000002.1 GCA946997945_00395 CDS open 52022-52675 _na     217_aa deoC deoxyribose-phosphate aldolase
754 CAMPXN010000002.1 GCA946997945_00396 CDS open 52676-53386 _na     236_aa deoD purine-nucleoside phosphorylase
755 CAMPXN010000002.1 GCA946997945_00397 CDS open 53399-53806 _na     135_aa cdd cytidine deaminase
756 CAMPXN010000002.1 GCA946997945_00398 CDS open 53897-55462 _na     521_aa amyA Glycosyl hydrolase family 13 catalytic domain-containing protein
757 CAMPXN010000002.1 GCA946997945_00399 CDS open 55473-55934 _na     153_aa hypothetical protein
758 CAMPXN010000002.1 GCA946997945_00400 CDS open 56015-56830 _na     271_aa mreC rod shape-determining protein MreC
759 CAMPXN010000002.1 GCA946997945_00401 CDS open 56875-57303 _na     142_aa hypothetical protein
760 CAMPXN010000002.1 GCA946997945_00402 CDS open 57291-57902 _na     203_aa recO DNA repair protein RecO
761 CAMPXN010000002.1 GCA946997945_00403 CDS open 57878-58339 _na     153_aa ptsN PTS sugar transporter subunit IIA
762 CAMPXN010000002.1 GCA946997945_00404 CDS open 58340-58795 _na     151_aa nrdR transcriptional regulator NrdR
763 CAMPXN010000002.1 GCA946997945_00405 CDS open 58799-59164 _na     121_aa Septum formation initiator
764 CAMPXN010000002.1 GCA946997945_00406 CDS open 59175-59558 _na     127_aa DUF304 domain-containing protein
765 CAMPXN010000002.1 GCA946997945_00407 CDS open 59558-60712 _na     384_aa lolE ABC transporter permease
766 CAMPXN010000002.1 GCA946997945_00408 CDS open 60700-61368 _na     222_aa lolD Lipoprotein ABC transporter ATP-binding protein
767 CAMPXN010000002.1 GCA946997945_00409 CDS open 61420-61722 _na     100_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
768 CAMPXN010000002.1 GCA946997945_00410 CDS open 61734-62162 _na     142_aa dps Ferritin
769 CAMPXN010000002.1 GCA946997945_00411 CDS open 62176-62940 _na     254_aa yqjQ Short-chain dehydrogenase
770 CAMPXN010000002.1 GCA946997945_00412 CDS open 63052-63396 _na     114_aa sepF cell division protein SepF
771 CAMPXN010000002.1 GCA946997945_00413 CDS open 63453-64724 _na     423_aa obgE GTPase ObgE
772 CAMPXN010000002.1 GCA946997945_00414 CDS open 64717-65568 _na     283_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
773 CAMPXN010000002.1 GCA946997945_00415 CDS open 65558-66016 _na     152_aa ptsN PTS sugar transporter subunit IIA
774 CAMPXN010000002.1 GCA946997945_00416 CDS open 66025-66651 _na     208_aa udk uridine kinase
775 CAMPXN010000002.1 GCA946997945_00417 CDS open 66660-67430 _na     256_aa hypothetical protein
776 CAMPXN010000002.1 GCA946997945_00418 CDS open 67480-67998 _na     172_aa hypothetical protein
777 CAMPXN010000002.1 GCA946997945_00419 CDS open 67980-68408 _na     142_aa HD domain-containing protein
778 CAMPXN010000002.1 GCA946997945_00420 CDS open 68410-69285 _na     291_aa rluA Pseudouridine synthase
779 CAMPXN010000002.1 GCA946997945_00421 CDS open 69279-69863 _na     194_aa rnhB ribonuclease HII
780 CAMPXN010000002.1 GCA946997945_00422 CDS open 69865-70071 _na     68_aa ypzJ putative nucleic-acid-binding protein%2C contains Zn-ribbon domain
781 CAMPXN010000002.1 GCA946997945_00423 CDS open 70058-70675 _na     205_aa comFC ComF family protein
782 CAMPXN010000002.1 GCA946997945_00424 CDS open 70717-72210 _na     497_aa ypwA Metal-dependent carboxypeptidase
783 CAMPXN010000002.1 GCA946997945_00425 CDS open 72219-73520 _na     433_aa lAP4 M18 family aminopeptidase
784 CAMPXN010000002.1 GCA946997945_00426 CDS open 73531-74631 _na     366_aa potA Spermidine/putrescine import ATP-binding protein PotA
785 CAMPXN010000002.1 GCA946997945_00427 CDS open 74632-75465 _na     277_aa potB Spermidine/putrescine ABC transporter permease
786 CAMPXN010000002.1 GCA946997945_00428 CDS open 75458-76240 _na     260_aa potC Spermidine/putrescine ABC transporter permease
787 CAMPXN010000002.1 GCA946997945_00429 CDS open 76311-77789 _na     492_aa ptsG2 PTS glucose transporter subunit IIBC
788 CAMPXN010000002.1 GCA946997945_00431 CDS open 77930-78604 _na     224_aa DUF3800 domain-containing protein
789 CAMPXN010000002.1 GCA946997945_00433 CDS open 78729-79565 _na     278_aa ttcA Potassium ABC transporter ATPase
790 CAMPXN010000002.1 GCA946997945_00434 CDS open 79553-80545 _na     330_aa Glucose-1-phosphatase
791 CAMPXN010000002.1 GCA946997945_00435 CDS open 80726-81820 _na     364_aa livK ABC transporter substrate-binding protein
792 CAMPXN010000002.1 GCA946997945_00436 CDS open 81822-82727 _na     301_aa livH ABC transporter permease
793 CAMPXN010000002.1 GCA946997945_00437 CDS open 82715-83686 _na     323_aa livM ABC transporter permease
794 CAMPXN010000002.1 GCA946997945_00438 CDS open 83671-84426 _na     251_aa livG ABC transporter domain-containing protein
795 CAMPXN010000002.1 GCA946997945_00439 CDS open 84427-85134 _na     235_aa livF Amino acid ABC transporter ATPase
796 CAMPXN010000002.1 GCA946997945_00440 CDS open 85368-88163 _na     931_aa Autotransporter domain-containing protein
797 CAMPXN010000002.1 GCA946997945_00441 CDS open 88380-90161 _na     593_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
798 CAMPXN010000002.1 GCA946997945_00442 CDS open 90161-90808 _na     215_aa ung uracil-DNA glycosylase
799 CAMPXN010000002.1 GCA946997945_00443 CDS open 90821-92242 _na     473_aa murE UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase
800 CAMPXN010000002.1 GCA946997945_00444 CDS open 92260-93306 _na     348_aa potD Spermidine/putrescine ABC transporter substrate-binding protein
801 CAMPXN010000002.1 GCA946997945_00445 CDS open 93517-96348 _na     943_aa hia Trimeric autotransporter adhesin YadA-like C-terminal membrane anchor domain-containing protein
802 CAMPXN010000002.1 GCA946997945_00446 CDS open 96441-97685 _na     414_aa Major facilitator superfamily (MFS) profile domain-containing protein
803 CAMPXN010000002.1 GCA946997945_00447 CDS open 97650-98171 _na     173_aa Peptidoglycan peptidase
804 CAMPXN010000002.1 GCA946997945_00448 CDS open 98180-100288 _na     702_aa uvrD DNA 3'-5' helicase
805 CAMPXN010000002.1 GCA946997945_00449 CDS open 100390-102438 _na     682_aa pgpH HD domain-containing protein
806 CAMPXN010000002.1 GCA946997945_00450 CDS open 102449-102907 _na     152_aa ybeY rRNA maturation RNase YbeY
807 CAMPXN010000002.1 GCA946997945_00451 CDS open 102885-103637 _na     250_aa dgkA Diacylglycerol kinase
808 CAMPXN010000002.1 GCA946997945_00452 CDS open 103646-104581 _na     311_aa pPX1 manganese-dependent inorganic pyrophosphatase
809 CAMPXN010000002.1 GCA946997945_00453 CDS open 104604-105368 _na     254_aa pgpB phosphatase PAP2 family protein
810 CAMPXN010000002.1 GCA946997945_00457 CDS open 105793-106482 _na     229_aa trmN6 Methyltransferase small domain-containing protein
811 CAMPXN010000002.1 GCA946997945_00459 CDS open 106581-107957 _na     458_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
812 CAMPXN010000002.1 GCA946997945_00460 CDS open 108236-108616 _na     126_aa recombinase family protein
813 CAMPXN010000002.1 GCA946997945_00461 CDS open 108803-109213 _na     136_aa recombinase family protein
814 CAMPXN010000002.1 GCA946997945_00462 CDS open 109763-110629 _na     288_aa Restriction endonuclease type IV Mrr domain-containing protein
815 CAMPXN010000002.1 GCA946997945_00463 CDS open 110571-111281 _na     236_aa restriction endonuclease
816 CAMPXN010000002.1 GCA946997945_00464 CDS open 111457-111975 _na     172_aa hypothetical protein
817 CAMPXN010000002.1 GCA946997945_00465 CDS open 112211-112834 _na     207_aa HTH araC/xylS-type domain-containing protein
818 CAMPXN010000002.1 GCA946997945_00466 CDS open 113269-113820 _na     183_aa sugar O-acetyltransferase
819 CAMPXN010000002.1 GCA946997945_00467 CDS open 114213-114617 _na     134_aa hypothetical protein
820 CAMPXN010000002.1 GCA946997945_00468 CDS open 114811-115317 _na     168_aa Integral membrane protein
821 CAMPXN010000002.1 GCA946997945_00469 CDS open 115782-117260 _na     492_aa lsa Lsa family ABC-F type ribosomal protection protein
822 CAMPXN010000002.1 GCA946997945_00470 CDS open 117811-118542 _na     243_aa soxR Multidrug transporter activation protein
823 CAMPXN010000002.1 GCA946997945_00471 CDS open 119192-120031 _na     279_aa hypothetical protein
824 CAMPXN010000002.1 GCA946997945_00472 CDS open 120234-121262 _na     342_aa purR LacI family DNA-binding transcriptional regulator
825 CAMPXN010000002.1 GCA946997945_00473 CDS open 121310-122617 _na     435_aa xylA xylose isomerase
826 CAMPXN010000002.1 GCA946997945_00474 CDS open 122634-124151 _na     505_aa xylB xylulokinase
827 CAMPXN010000002.1 GCA946997945_00475 CDS open 124132-126213 _na     693_aa yicI Family 31 glucosidase
828 CAMPXN010000002.1 GCA946997945_00476 CDS open 126230-128266 _na     678_aa yicI Glycosyl hydrolase family 31
829 CAMPXN010000002.1 GCA946997945_00477 CDS open 128284-128760 _na     158_aa agaB PTS mannose transporter subunit IIC
830 CAMPXN010000002.1 GCA946997945_00478 CDS open 128779-129570 _na     263_aa manY PTS N-acetylgalactosamine transporter subunit IIA
831 CAMPXN010000002.1 GCA946997945_00479 CDS open 129563-130369 _na     268_aa manZ PTS fructose transporter subunit IID
832 CAMPXN010000002.1 GCA946997945_00480 CDS open 130374-130793 _na     139_aa manX PTS N-acetylglucosamine transporter subunit IIBC
833 CAMPXN010000002.1 GCA946997945_00481 CDS open 130812-133196 _na     794_aa yicI Alpha-xylosidase
834 CAMPXN010000002.1 GCA946997945_00482 CDS open 133439-134614 _na     391_aa hypothetical protein
835 CAMPXN010000002.1 GCA946997945_00483 CDS open 134809-135030 _na     73_aa PTS system fructose IIA component
836 CAMPXN010000002.1 GCA946997945_00484 CDS open 135260-136093 _na     277_aa manY PTS sorbose-specific transporter subunit IIC
837 CAMPXN010000002.1 GCA946997945_00485 CDS open 136062-136895 _na     277_aa manZ PTS system mannose/fructose/sorbose family transporter subunit IID
838 CAMPXN010000002.1 GCA946997945_00486 CDS open 136905-137387 _na     160_aa agaB PTS mannose transporter subunit IIAB
839 CAMPXN010000002.1 GCA946997945_00487 CDS open 137390-139258 _na     622_aa DUF3604 domain-containing protein
840 CAMPXN010000002.1 GCA946997945_00488 CDS open 139752-139952 _na     66_aa Membrane protein
841 CAMPXN010000002.1 GCA946997945_00489 CDS open 139952-140887 _na     311_aa rbbA ABC transporter ATP-binding protein
842 CAMPXN010000002.1 GCA946997945_00490 CDS open 140863-141630 _na     255_aa ABC transporter permease
843 CAMPXN010000002.1 GCA946997945_00491 CDS open 141645-142748 _na     367_aa hipB DNA-binding protein
844 CAMPXN010000002.1 GCA946997945_00492 CDS open 143733-144026 _na     97_aa hypothetical protein
845 CAMPXN010000002.1 GCA946997945_00493 CDS open 144649-144909 _na     86_aa DUF4143 domain-containing protein
846 CAMPXN010000002.1 GCA946997945_00494 CDS open 145019-145525 _na     168_aa N-acetyltransferase domain-containing protein
847 CAMPXN010000002.1 GCA946997945_00495 CDS open 145563-146339 _na     258_aa alkD DNA alkylation repair protein
848 CAMPXN010000002.1 GCA946997945_00496 CDS open 146308-147510 _na     400_aa gltP Sodium:proton antiporter
849 CAMPXN010000002.1 GCA946997945_00497 CDS open 147668-148261 _na     197_aa Trep-Strep domain-containing protein
850 CAMPXN010000002.1 GCA946997945_00498 CDS open 148263-148958 _na     231_aa ecfT Cobalt transport protein
851 CAMPXN010000002.1 GCA946997945_00499 CDS open 148951-150318 _na     455_aa ccmA heme ABC exporter ATP-binding protein CcmA
852 CAMPXN010000002.1 GCA946997945_00500 CDS open 150503-152737 _na     744_aa pflB formate C-acetyltransferase
853 CAMPXN010000002.1 GCA946997945_00501 CDS open 152800-153534 _na     244_aa pflA pyruvate formate-lyase-activating protein
854 CAMPXN010000002.1 GCA946997945_00502 CDS open 153636-154628 _na     330_aa fba class II fructose-bisphosphate aldolase
855 CAMPXN010000002.1 GCA946997945_00503 CDS open 154678-156162 _na     494_aa hypothetical protein
856 CAMPXN010000002.1 GCA946997945_00504 CDS open 156102-157391 _na     429_aa clcA Sodium:proton antiporter
857 CAMPXN010000002.1 GCA946997945_00505 CDS open 157537-159564 _na     675_aa bglG HTH domain-containing protein
858 CAMPXN010000002.1 GCA946997945_00506 CDS open 159579-160034 _na     151_aa ptsN PTS EIIA type-2 domain-containing protein
859 CAMPXN010000002.1 GCA946997945_00507 CDS open 160047-160325 _na     92_aa sgaB PTS galactitol transporter subunit IIB
860 CAMPXN010000002.1 GCA946997945_00508 CDS open 160339-161685 _na     448_aa sgcC PTS galactitol transporter subunit IIC
861 CAMPXN010000002.1 GCA946997945_00509 CDS open 161670-162326 _na     218_aa araD Aldolase
862 CAMPXN010000002.1 GCA946997945_00510 CDS open 162339-163922 _na     527_aa hypothetical protein
863 CAMPXN010000002.1 GCA946997945_00511 CDS open 163986-165296 _na     436_aa nCS2 Guanine permease
864 CAMPXN010000002.1 GCA946997945_00512 CDS open 165709-167031 _na     440_aa nhaC Sodium:proton antiporter
865 CAMPXN010000002.1 GCA946997945_00513 CDS open 167149-168045 _na     298_aa znuA ABC transporter substrate-binding protein
866 CAMPXN010000002.1 GCA946997945_00514 CDS open 168015-168482 _na     155_aa ybaK Cys-tRNA(Pro) deacylase
867 CAMPXN010000002.1 GCA946997945_00515 CDS open 168512-169120 _na     202_aa rsmC Methyltransferase
868 CAMPXN010000002.1 GCA946997945_00516 CDS open 169120-169557 _na     145_aa rimI N-acetyltransferase domain-containing protein
869 CAMPXN010000002.1 GCA946997945_00517 CDS open 169547-170266 _na     239_aa truA tRNA pseudouridine(38-40) synthase TruA
870 CAMPXN010000002.1 GCA946997945_00518 CDS open 170257-170853 _na     198_aa serB HAD-IB family hydrolase
871 CAMPXN010000002.1 GCA946997945_00519 CDS open 170822-171865 _na     347_aa gspE Bacterial type II secretion system protein E domain-containing protein
872 CAMPXN010000002.1 GCA946997945_00520 CDS open 171888-172346 _na     152_aa viral A-type inclusion protein
873 CAMPXN010000002.1 GCA946997945_00521 CDS open 172333-172929 _na     198_aa tsaC L-threonylcarbamoyladenylate synthase
874 CAMPXN010000002.1 GCA946997945_00522 CDS open 172916-173899 _na     327_aa prsA Ribose-phosphate pyrophosphokinase
875 CAMPXN010000002.1 GCA946997945_00523 CDS open 173919-175244 _na     441_aa glmU bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU
876 CAMPXN010000002.1 GCA946997945_00524 CDS open 175297-176232 _na     311_aa mdh L-lactate dehydrogenase
877 CAMPXN010000002.1 GCA946997945_00525 CDS open 176196-176855 _na     219_aa dppF ABC transporter ATP-binding protein
878 CAMPXN010000002.1 GCA946997945_00526 CDS open 176974-177450 _na     158_aa tpx thiol peroxidase
879 CAMPXN010000002.1 GCA946997945_00527 CDS open 177468-179588 _na     706_aa dAP2 Peptidase S9 prolyl oligopeptidase catalytic domain-containing protein
880 CAMPXN010000002.1 GCA946997945_00528 CDS open 179691-180311 _na     206_aa trmR Methyltransferase
881 CAMPXN010000002.1 GCA946997945_00529 CDS open 180338-181558 _na     406_aa digH Glycosyl hydrolase-like 10 domain-containing protein
882 CAMPXN010000002.1 GCA946997945_00530 CDS open 181558-183519 _na     653_aa uvrB excinuclease ABC subunit UvrB
883 CAMPXN010000002.1 GCA946997945_00531 CDS open 183519-184706 _na     395_aa xseA exodeoxyribonuclease VII large subunit
884 CAMPXN010000002.1 GCA946997945_00532 CDS open 184706-185191 _na     161_aa comEB Cytidine deaminase
885 CAMPXN010000002.1 GCA946997945_00533 CDS open 185293-185511 _na     72_aa infA translation initiation factor IF-1
886 CAMPXN010000002.1 GCA946997945_00534 CDS open 185525-185638 _na     37_aa rpmJ 50S ribosomal protein L36
887 CAMPXN010000002.1 GCA946997945_00535 CDS open 185703-186161 _na     152_aa Small ribosomal subunit protein uS13
888 CAMPXN010000002.1 GCA946997945_00536 CDS open 186184-186570 _na     128_aa rpsK 30S ribosomal protein S11
889 CAMPXN010000002.1 GCA946997945_00537 CDS open 186597-187187 _na     196_aa rpsD 30S ribosomal protein S4
890 CAMPXN010000002.1 GCA946997945_00538 CDS open 187232-188188 _na     318_aa rpoA DNA-directed RNA polymerase subunit alpha
891 CAMPXN010000002.1 GCA946997945_00539 CDS open 188211-188585 _na     124_aa rplQ 50S ribosomal protein L17
892 CAMPXN010000002.1 GCA946997945_00540 CDS open 188629-189174 _na     181_aa rimL N-acetyltransferase domain-containing protein
893 CAMPXN010000002.1 GCA946997945_00541 CDS open 189203-189637 _na     144_aa mraZ division/cell wall cluster transcriptional repressor MraZ
894 CAMPXN010000002.1 GCA946997945_00542 CDS open 189646-190587 _na     313_aa rsmH 16S rRNA (cytosine(1402)-N(4))-methyltransferase RsmH
895 CAMPXN010000002.1 GCA946997945_00543 CDS open 190566-190889 _na     107_aa ftsL Cell division protein FtsL
896 CAMPXN010000002.1 GCA946997945_00544 CDS open 191087-194098 _na     1003_aa pulA pullulanase
897 CAMPXN010000002.1 GCA946997945_00545 CDS open 194178-194564 _na     128_aa hipB helix-turn-helix domain-containing protein
898 CAMPXN010000002.1 GCA946997945_00546 CDS open 194558-194959 _na     133_aa immA ImmA/IrrE family metallo-endopeptidase
899 CAMPXN010000002.1 GCA946997945_00547 CDS open 195036-196196 _na     386_aa abgB Peptidase M20
900 CAMPXN010000002.1 GCA946997945_00548 CDS open 196190-197548 _na     452_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
901 CAMPXN010000002.1 GCA946997945_00549 CDS open 197550-198140 _na     196_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
902 CAMPXN010000002.1 GCA946997945_00550 CDS open 198149-199144 _na     331_aa gpsA Glycerol-3-phosphate dehydrogenase [NAD(P)+]
903 CAMPXN010000002.1 GCA946997945_00551 CDS open 199154-199987 _na     277_aa rpoD RNA polymerase sigma factor
904 CAMPXN010000002.1 GCA946997945_00552 CDS open 199974-201083 _na     369_aa dnaN DNA polymerase III subunit beta
905 CAMPXN010000002.1 GCA946997945_00553 CDS open 201100-201648 _na     182_aa ptsG2 PTS EIIB type-1 domain-containing protein
906 CAMPXN010000002.1 GCA946997945_00554 CDS open 201755-202471 _na     238_aa cps2a Transcriptional regulator
907 CAMPXN010000002.1 GCA946997945_00555 CDS open 202487-203287 _na     266_aa cof Cof-type HAD-IIB family hydrolase
908 CAMPXN010000002.1 GCA946997945_00556 CDS open 203375-204130 _na     251_aa tpiA triose-phosphate isomerase
909 CAMPXN010000002.1 GCA946997945_00557 CDS open 204139-204339 _na     66_aa secG preprotein translocase subunit SecG
910 CAMPXN010000002.1 GCA946997945_00558 CDS open 204366-204644 _na     92_aa hupA DNA-binding protein
911 CAMPXN010000002.1 GCA946997945_00559 CDS open 204812-205855 _na     347_aa ABC transporter ATP-binding protein
912 CAMPXN010000002.1 GCA946997945_00560 CDS open 206276-207817 _na     513_aa mdlB ABC transporter ATP-binding protein
913 CAMPXN010000002.1 GCA946997945_00561 CDS open 207810-209084 _na     424_aa mpfA Hemolysin
914 CAMPXN010000002.1 GCA946997945_00562 CDS open 209228-210127 _na     299_aa uRH1 Inosine/uridine-preferring nucleoside hydrolase domain-containing protein
915 CAMPXN010000002.1 GCA946997945_00563 CDS open 210136-212604 _na     822_aa glgP Alpha-1%2C4 glucan phosphorylase
916 CAMPXN010000002.1 GCA946997945_00564 CDS open 212610-213695 _na     361_aa hypothetical protein
917 CAMPXN010000002.1 GCA946997945_00565 CDS open 213697-215004 _na     435_aa CheW-like domain-containing protein
918 CAMPXN010000002.1 GCA946997945_00566 CDS open 214989-215777 _na     262_aa cdsA phosphatidate cytidylyltransferase
919 CAMPXN010000002.1 GCA946997945_00567 CDS open 215764-216465 _na     233_aa uppS polyprenyl diphosphate synthase
920 CAMPXN010000002.1 GCA946997945_00568 CDS open 216625-218820 _na     731_aa pnp polyribonucleotide nucleotidyltransferase
921 CAMPXN010000002.1 GCA946997945_00569 CDS open 218804-219361 _na     185_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
922 CAMPXN010000002.1 GCA946997945_00570 CDS open 219354-219902 _na     182_aa hypothetical protein
923 CAMPXN010000002.1 GCA946997945_00571 CDS open 219889-222543 _na     884_aa mgtA ATPase
924 CAMPXN010000002.1 GCA946997945_00572 CDS open 222501-223415 _na     304_aa tPR Beta-lactamase
925 CAMPXN010000002.1 GCA946997945_00573 CDS open 223408-224271 _na     287_aa dacC Peptidase S11 D-alanyl-D-alanine carboxypeptidase A N-terminal domain-containing protein
926 CAMPXN010000002.1 GCA946997945_00574 CDS open 224247-225116 _na     289_aa lgt prolipoprotein diacylglyceryl transferase
927 CAMPXN010000002.1 GCA946997945_00575 CDS open 225224-226024 _na     266_aa iclR IclR family transcriptional regulator
928 CAMPXN010000002.1 GCA946997945_00576 CDS open 225976-228123 _na     715_aa spoT Guanosine-3'%2C5'-bis(Diphosphate) 3'-pyrophosphohydrolase
929 CAMPXN010000002.1 GCA946997945_00577 CDS open 228131-229279 _na     382_aa tgt tRNA guanosine(34) transglycosylase Tgt
930 CAMPXN010000002.1 GCA946997945_00578 CDS open 229292-230596 _na     434_aa pepC Aminopeptidase
931 CAMPXN010000002.1 GCA946997945_00579 CDS open 230659-231747 _na     362_aa abgB Peptidase M20 dimerisation domain-containing protein
932 CAMPXN010000002.1 GCA946997945_00580 CDS open 231898-235695 _na     1265_aa cas12a type V CRISPR-associated protein Cas12a/Cpf1
933 CAMPXN010000002.1 GCA946997945_00581 CDS open 235699-236259 _na     186_aa cas4 type V CRISPR-associated protein Cas4
934 CAMPXN010000002.1 GCA946997945_00582 CDS open 236253-237245 _na     330_aa cas1 type V CRISPR-associated endonuclease Cas1
935 CAMPXN010000002.1 GCA946997945_00583 CDS open 237250-237534 _na     94_aa cas2 CRISPR-associated endonuclease Cas2
936 CAMPXN010000002.1 GCA946997945_00584 CDS open 239318-240715 _na     465_aa sWIM SWIM-type domain-containing protein
937 CAMPXN010000002.1 GCA946997945_00585 CDS open 241295-243034 _na     579_aa mdlB ABC transporter
938 CAMPXN010000002.1 GCA946997945_00586 CDS open 243024-244706 _na     560_aa mdlB ABC transporter ATP-binding protein
939 CAMPXN010000002.1 GCA946997945_00587 CDS open 244838-245014 _na     58_aa pspC PspC domain-containing protein
940 CAMPXN010000002.1 GCA946997945_00588 CDS open 245046-246008 _na     320_aa hypothetical protein
941 CAMPXN010000002.1 GCA946997945_00589 CDS open 246163-246312 _na     49_aa rpmG 50S ribosomal protein L33
942 CAMPXN010000002.1 GCA946997945_00591 CDS open 246415-246624 _na     69_aa secE preprotein translocase subunit SecE
943 CAMPXN010000002.1 GCA946997945_00592 CDS open 246636-247205 _na     189_aa nusG Transcription termination/antitermination protein NusG
944 CAMPXN010000002.1 GCA946997945_00593 CDS open 247254-247679 _na     141_aa rplK 50S ribosomal protein L11
945 CAMPXN010000002.1 GCA946997945_00594 CDS open 247730-248437 _na     235_aa rplA 50S ribosomal protein L1
946 CAMPXN010000002.1 GCA946997945_00595 CDS open 248550-248930 _na     126_aa hypothetical protein
947 CAMPXN010000002.1 GCA946997945_00596 CDS open 249085-249489 _na     134_aa fimT Prepilin-type N-terminal cleavage/methylation domain-containing protein
948 CAMPXN010000002.1 GCA946997945_00597 CDS open 249474-249926 _na     150_aa Prepilin type IV endopeptidase peptidase domain-containing protein
949 CAMPXN010000002.1 GCA946997945_00598 CDS open 249902-250219 _na     105_aa hypothetical protein
950 CAMPXN010000002.1 GCA946997945_00599 CDS open 250197-250637 _na     146_aa hypothetical protein
951 CAMPXN010000002.1 GCA946997945_00600 CDS open 250607-251290 _na     227_aa hypothetical protein
952 CAMPXN010000002.1 GCA946997945_00601 CDS open 251283-252185 _na     300_aa gspL GspL periplasmic domain-containing protein
953 CAMPXN010000002.1 GCA946997945_00602 CDS open 252178-252711 _na     177_aa pilO Pilus assembly protein PilO
954 CAMPXN010000002.1 GCA946997945_00603 CDS open 252712-253731 _na     339_aa gspD Type II/III secretion system secretin-like domain-containing protein
955 CAMPXN010000002.1 GCA946997945_00604 CDS open 253689-254693 _na     334_aa gspF Type II secretion system protein GspF domain-containing protein
956 CAMPXN010000002.1 GCA946997945_00605 CDS open 254865-255428 _na     187_aa KilA-N domain-containing protein
957 CAMPXN010000002.1 GCA946997945_00352 gene open 121-618 nfnB
958 CAMPXN010000002.1 GCA946997945_00353 gene open 715-2649 gyrB
959 CAMPXN010000002.1 GCA946997945_00354 gene open 2659-5151 gyrA
960 CAMPXN010000002.1 GCA946997945_00355 gene open 5144-5947 uspA
961 CAMPXN010000002.1 GCA946997945_00356 gene open 5902-7260
962 CAMPXN010000002.1 GCA946997945_00357 gene open 7276-8292 pheS
963 CAMPXN010000002.1 GCA946997945_00358 gene open 8305-10665 pheT
964 CAMPXN010000002.1 GCA946997945_00359 gene open 10678-11169
965 CAMPXN010000002.1 GCA946997945_00360 gene open 11174-12946 pepF
966 CAMPXN010000002.1 GCA946997945_00361 gene open 12965-14275 eno
967 CAMPXN010000002.1 GCA946997945_00362 gene open 14385-16289 thrS
968 CAMPXN010000002.1 GCA946997945_00363 gene open 16306-16998 ybhL
969 CAMPXN010000002.1 GCA946997945_00364 gene open 17021-18595
970 CAMPXN010000002.1 GCA946997945_00365 gene open 18597-19715 nifS
971 CAMPXN010000002.1 GCA946997945_00366 gene open 19827-20537 glpR
972 CAMPXN010000002.1 GCA946997945_00367 gene open 20515-21441 pfkB
973 CAMPXN010000002.1 GCA946997945_00368 gene open 21419-23281 ptsN
974 CAMPXN010000002.1 GCA946997945_00369 gene open 23446-24993 mdlB
975 CAMPXN010000002.1 GCA946997945_00370 gene open 25025-26563 mdlB
976 CAMPXN010000002.1 GCA946997945_00371 gene open 26644-27777 nagC
977 CAMPXN010000002.1 GCA946997945_00372 gene open 27903-28532 yoaK
978 CAMPXN010000002.1 GCA946997945_00373 gene open 28569-29285 tACO1
979 CAMPXN010000002.1 GCA946997945_00374 gene open 29554-30282 tauC
980 CAMPXN010000002.1 GCA946997945_00375 gene open 30292-31263 tauA
981 CAMPXN010000002.1 GCA946997945_00376 gene open 31244-31972 tauB
982 CAMPXN010000002.1 GCA946997945_00377 gene open 32095-33129
983 CAMPXN010000002.1 GCA946997945_00378 gene open 33122-33688
984 CAMPXN010000002.1 GCA946997945_00379 gene open 33673-34065
985 CAMPXN010000002.1 GCA946997945_00380 gene open 34043-35395
986 CAMPXN010000002.1 GCA946997945_00381 gene open 35355-38414
987 CAMPXN010000002.1 GCA946997945_00382 gene open 38424-39359
988 CAMPXN010000002.1 GCA946997945_00383 gene open 39478-40485 dppD
989 CAMPXN010000002.1 GCA946997945_00384 gene open 40478-41434 yejF
990 CAMPXN010000002.1 GCA946997945_00385 gene open 41436-42398 opp4B
991 CAMPXN010000002.1 GCA946997945_00386 gene open 42408-43298 dppC
992 CAMPXN010000002.1 GCA946997945_00387 gene open 43331-43822
993 CAMPXN010000002.1 GCA946997945_00388 gene open 43911-44267 yhfA
994 CAMPXN010000002.1 GCA946997945_00389 gene open 44269-46011 uvrC
995 CAMPXN010000002.1 GCA946997945_00390 gene open 46076-47602 nupO
996 CAMPXN010000002.1 GCA946997945_00391 gene open 47595-48668 nupP
997 CAMPXN010000002.1 GCA946997945_00392 gene open 48670-49530 nupQ
998 CAMPXN010000002.1 GCA946997945_00393 gene open 49598-50614 med
999 CAMPXN010000002.1 GCA946997945_00394 gene open 50709-52013 deoA
1000 CAMPXN010000002.1 GCA946997945_00395 gene open 52022-52675 deoC