HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister micraerophilus (GCA_946999455.1)

Select a Genome:
BAKTA Annotations for GCA_946999455.1
Genome Selected: Dialister micraerophilus
ContigsBases CDSrRNA tmRNAtRNA
64 1264431 1198 0 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2497 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 2497 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAMQDD010000017.1 GCA946999455_00740 gene open 7976-8488
1502 CAMQDD010000017.1 GCA946999455_00741 gene open 8503-8904
1503 CAMQDD010000017.1 GCA946999455_00742 gene open 8981-9322 rplS
1504 CAMQDD010000017.1 GCA946999455_00743 gene open 9431-10612 sigA
1505 CAMQDD010000017.1 GCA946999455_00744 gene open 11338-12585
1506 CAMQDD010000017.1 GCA946999455_00745 gene open 12603-14132 purH
1507 CAMQDD010000017.1 GCA946999455_00746 gene open 14134-14757 purN
1508 CAMQDD010000017.1 GCA946999455_00747 gene open 14754-16208 purF
1509 CAMQDD010000017.1 GCA946999455_00748 gene open 16195-16902 purC
1510 CAMQDD010000017.1 GCA946999455_00749 gene open 16906-20589
1511 CAMQDD010000017.1 GCA946999455_00750 gene open 20583-21611
1512 CAMQDD010000017.1 GCA946999455_00751 gene open 21625-22104
1513 CAMQDD010000017.1 GCA946999455_00752 gene open 22135-22812
1514 CAMQDD010000017.1 GCA946999455_00753 gene open 23284-23643
1515 CAMQDD010000017.1 GCA946999455_00756 gene open 23959-24393
1516 CAMQDD010000017.1 GCA946999455_00757 gene open 24390-25580
1517 CAMQDD010000017.1 GCA946999455_00758 gene open 25598-26683
1518 CAMQDD010000017.1 GCA946999455_00759 gene open 26707-27429 lptB
1519 CAMQDD010000017.1 GCA946999455_00760 gene open 27444-28148 ostA
1520 CAMQDD010000017.1 GCA946999455_00761 gene open 28153-28704 lptC
1521 CAMQDD010000017.1 GCA946999455_00729 gene open 59-133 trnQ
1522 CAMQDD010000017.1 GCA946999455_00730 gene open 135-210 trnN
1523 CAMQDD010000017.1 GCA946999455_00731 gene open 227-301 trnG
1524 CAMQDD010000017.1 GCA946999455_00754 gene open 23737-23813 trnR
1525 CAMQDD010000017.1 GCA946999455_00755 gene open 23821-23896 trnP
1526 CAMQDD010000017.1 GCA946999455_00729 tRNA open 59-133 trnQ tRNA-Gln(ctg)
1527 CAMQDD010000017.1 GCA946999455_00730 tRNA open 135-210 trnN tRNA-Asn(gtt)
1528 CAMQDD010000017.1 GCA946999455_00731 tRNA open 227-301 trnG tRNA-Gly(gcc)
1529 CAMQDD010000017.1 GCA946999455_00754 tRNA open 23737-23813 trnR tRNA-Arg(tct)
1530 CAMQDD010000017.1 GCA946999455_00755 tRNA open 23821-23896 trnP tRNA-Pro(tgg)
1531 CAMQDD010000018.1 regulatory_region open 6186-6420 T-box leader
1532 CAMQDD010000018.1 GCA946999455_00762 CDS open 186-878 _na     230_aa hypothetical protein
1533 CAMQDD010000018.1 GCA946999455_00763 CDS open 913-1821 _na     302_aa lysR LysR family transcriptional regulator
1534 CAMQDD010000018.1 GCA946999455_00764 CDS open 2131-2634 _na     167_aa Oxidized purine nucleoside triphosphate hydrolase
1535 CAMQDD010000018.1 GCA946999455_00765 CDS open 2661-3170 _na     169_aa Succinate dehydrogenase
1536 CAMQDD010000018.1 GCA946999455_00766 CDS open 3368-5806 _na     812_aa gyrA DNA gyrase subunit A
1537 CAMQDD010000018.1 GCA946999455_00767 CDS open 5853-6032 _na     59_aa Indole-3-glycerol-phosphate synthase
1538 CAMQDD010000018.1 GCA946999455_00768 CDS open 6500-7504 _na     334_aa Bile acid transporter
1539 CAMQDD010000018.1 GCA946999455_00769 CDS open 7551-8603 _na     350_aa Glycerol dehydrogenase
1540 CAMQDD010000018.1 GCA946999455_00770 CDS open 8809-9132 _na     107_aa ylxM YlxM family DNA-binding protein
1541 CAMQDD010000018.1 GCA946999455_00771 CDS open 9143-10501 _na     452_aa ffh signal recognition particle protein
1542 CAMQDD010000018.1 GCA946999455_00772 CDS open 10530-10793 _na     87_aa rpsP 30S ribosomal protein S16
1543 CAMQDD010000018.1 GCA946999455_00773 CDS open 10806-11033 _na     75_aa khpA RNA-binding protein KhpA
1544 CAMQDD010000018.1 GCA946999455_00774 CDS open 11044-11451 _na     135_aa rimM 16S rRNA processing protein RimM
1545 CAMQDD010000018.1 GCA946999455_00775 CDS open 11453-11950 _na     165_aa rimM ribosome maturation factor RimM
1546 CAMQDD010000018.1 GCA946999455_00776 CDS open 11952-12695 _na     247_aa trmD tRNA (guanosine(37)-N1)-methyltransferase TrmD
1547 CAMQDD010000018.1 GCA946999455_00777 CDS open 12695-13279 _na     194_aa tRNA (Guanine-N1)-methyltransferase
1548 CAMQDD010000018.1 GCA946999455_00778 CDS open 13298-14020 _na     240_aa YebC/PmpR family DNA-binding transcriptional regulator
1549 CAMQDD010000018.1 GCA946999455_00779 CDS open 14229-14531 _na     100_aa Nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
1550 CAMQDD010000018.1 GCA946999455_00780 CDS open 14606-15298 _na     230_aa queC 7-cyano-7-deazaguanine synthase QueC
1551 CAMQDD010000018.1 GCA946999455_00781 CDS open 15301-15630 _na     109_aa queD 6-carboxytetrahydropterin synthase QueD
1552 CAMQDD010000018.1 GCA946999455_00782 CDS open 15620-16300 _na     226_aa queE putative 7-carboxy-7-deazaguanine synthase QueE
1553 CAMQDD010000018.1 GCA946999455_00783 CDS open 16297-16863 _na     188_aa folE GTP cyclohydrolase I FolE
1554 CAMQDD010000018.1 GCA946999455_00784 CDS open 16864-17097 _na     77_aa hypothetical protein
1555 CAMQDD010000018.1 GCA946999455_00785 CDS open 17177-18088 _na     303_aa Pseudouridine synthase
1556 CAMQDD010000018.1 GCA946999455_00786 CDS open 18387-22244 _na     1285_aa addA helicase-exonuclease AddAB subunit AddA
1557 CAMQDD010000018.1 GCA946999455_00787 CDS open 22241-25657 _na     1138_aa Putative ATP-dependent deoxyribonuclease subunit B
1558 CAMQDD010000018.1 GCA946999455_00788 CDS open 25701-25805 _na     34_aa hypothetical protein
1559 CAMQDD010000018.1 GCA946999455_00789 CDS open 25944-26507 _na     187_aa ahpC alkyl hydroperoxide reductase subunit C
1560 CAMQDD010000018.1 GCA946999455_00790 CDS open 26521-28140 _na     539_aa Thioredoxin-disulfide reductase
1561 CAMQDD010000018.1 GCA946999455_00791 CDS open 28169-28396 _na     75_aa Polar amino acid transport system substrate-binding protein
1562 CAMQDD010000018.1 GCA946999455_00762 gene open 186-878
1563 CAMQDD010000018.1 GCA946999455_00763 gene open 913-1821 lysR
1564 CAMQDD010000018.1 GCA946999455_00764 gene open 2131-2634
1565 CAMQDD010000018.1 GCA946999455_00765 gene open 2661-3170
1566 CAMQDD010000018.1 GCA946999455_00766 gene open 3368-5806 gyrA
1567 CAMQDD010000018.1 GCA946999455_00767 gene open 5853-6032
1568 CAMQDD010000018.1 GCA946999455_00768 gene open 6500-7504
1569 CAMQDD010000018.1 GCA946999455_00769 gene open 7551-8603
1570 CAMQDD010000018.1 GCA946999455_00770 gene open 8809-9132 ylxM
1571 CAMQDD010000018.1 GCA946999455_00771 gene open 9143-10501 ffh
1572 CAMQDD010000018.1 GCA946999455_00772 gene open 10530-10793 rpsP
1573 CAMQDD010000018.1 GCA946999455_00773 gene open 10806-11033 khpA
1574 CAMQDD010000018.1 GCA946999455_00774 gene open 11044-11451 rimM
1575 CAMQDD010000018.1 GCA946999455_00775 gene open 11453-11950 rimM
1576 CAMQDD010000018.1 GCA946999455_00776 gene open 11952-12695 trmD
1577 CAMQDD010000018.1 GCA946999455_00777 gene open 12695-13279
1578 CAMQDD010000018.1 GCA946999455_00778 gene open 13298-14020
1579 CAMQDD010000018.1 GCA946999455_00779 gene open 14229-14531
1580 CAMQDD010000018.1 GCA946999455_00780 gene open 14606-15298 queC
1581 CAMQDD010000018.1 GCA946999455_00781 gene open 15301-15630 queD
1582 CAMQDD010000018.1 GCA946999455_00782 gene open 15620-16300 queE
1583 CAMQDD010000018.1 GCA946999455_00783 gene open 16297-16863 folE
1584 CAMQDD010000018.1 GCA946999455_00784 gene open 16864-17097
1585 CAMQDD010000018.1 GCA946999455_00785 gene open 17177-18088
1586 CAMQDD010000018.1 GCA946999455_00786 gene open 18387-22244 addA
1587 CAMQDD010000018.1 GCA946999455_00787 gene open 22241-25657
1588 CAMQDD010000018.1 GCA946999455_00788 gene open 25701-25805
1589 CAMQDD010000018.1 GCA946999455_00789 gene open 25944-26507 ahpC
1590 CAMQDD010000018.1 GCA946999455_00790 gene open 26521-28140
1591 CAMQDD010000018.1 GCA946999455_00791 gene open 28169-28396
1592 CAMQDD010000019.1 GCA946999455_00792 CDS open 424-1722 _na     432_aa tcyP L-cystine uptake protein TcyP
1593 CAMQDD010000019.1 GCA946999455_00793 CDS open 1998-3233 _na     411_aa clpX ATP-dependent protease ATP-binding subunit ClpX
1594 CAMQDD010000019.1 GCA946999455_00794 CDS open 3244-3843 _na     199_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
1595 CAMQDD010000019.1 GCA946999455_00795 CDS open 3918-5384 _na     488_aa tig trigger factor
1596 CAMQDD010000019.1 GCA946999455_00796 CDS open 5617-6483 _na     288_aa DUF2179 domain-containing protein
1597 CAMQDD010000019.1 GCA946999455_00798 CDS open 6700-7677 _na     325_aa Auxin efflux carrier family transporter
1598 CAMQDD010000019.1 GCA946999455_00799 CDS open 7679-8647 _na     322_aa Auxin efflux carrier family transporter
1599 CAMQDD010000019.1 GCA946999455_00800 CDS open 9217-9558 _na     113_aa rplQ 50S ribosomal protein L17
1600 CAMQDD010000019.1 GCA946999455_00801 CDS open 9576-10550 _na     324_aa DNA-directed RNA polymerase subunit alpha
1601 CAMQDD010000019.1 GCA946999455_00802 CDS open 10604-10987 _na     127_aa rpsK 30S ribosomal protein S11
1602 CAMQDD010000019.1 GCA946999455_00803 CDS open 11006-11383 _na     125_aa rpsM 30S ribosomal protein S13
1603 CAMQDD010000019.1 GCA946999455_00804 CDS open 11408-11521 _na     37_aa Large ribosomal subunit protein bL36
1604 CAMQDD010000019.1 GCA946999455_00805 CDS open 11538-11756 _na     72_aa infA translation initiation factor IF-1
1605 CAMQDD010000019.1 GCA946999455_00806 CDS open 11803-12555 _na     250_aa map type I methionyl aminopeptidase
1606 CAMQDD010000019.1 GCA946999455_00807 CDS open 12552-13205 _na     217_aa adenylate kinase
1607 CAMQDD010000019.1 GCA946999455_00808 CDS open 13232-14494 _na     420_aa secY preprotein translocase subunit SecY
1608 CAMQDD010000019.1 GCA946999455_00809 CDS open 14496-14936 _na     146_aa rplO 50S ribosomal protein L15
1609 CAMQDD010000019.1 GCA946999455_00810 CDS open 14954-15133 _na     59_aa rpmD 50S ribosomal protein L30
1610 CAMQDD010000019.1 GCA946999455_00811 CDS open 15147-15647 _na     166_aa rpsE 30S ribosomal protein S5
1611 CAMQDD010000019.1 GCA946999455_00812 CDS open 15665-16030 _na     121_aa rplR 50S ribosomal protein L18
1612 CAMQDD010000019.1 GCA946999455_00813 CDS open 16048-16590 _na     180_aa rplF 50S ribosomal protein L6
1613 CAMQDD010000019.1 GCA946999455_00814 CDS open 16608-17006 _na     132_aa rpsH 30S ribosomal protein S8
1614 CAMQDD010000019.1 GCA946999455_00815 CDS open 17034-17303 _na     89_aa rpsN 30S ribosomal protein S14
1615 CAMQDD010000019.1 GCA946999455_00816 CDS open 17317-17856 _na     179_aa rplE 50S ribosomal protein L5
1616 CAMQDD010000019.1 GCA946999455_00817 CDS open 17877-18209 _na     110_aa rplX 50S ribosomal protein L24
1617 CAMQDD010000019.1 GCA946999455_00818 CDS open 18222-18590 _na     122_aa rplN 50S ribosomal protein L14
1618 CAMQDD010000019.1 GCA946999455_00819 CDS open 18620-18880 _na     86_aa rpsQ 30S ribosomal protein S17
1619 CAMQDD010000019.1 GCA946999455_00820 CDS open 18908-19117 _na     69_aa rpmC 50S ribosomal protein L29
1620 CAMQDD010000019.1 GCA946999455_00821 CDS open 19119-19544 _na     141_aa rplP 50S ribosomal protein L16
1621 CAMQDD010000019.1 GCA946999455_00822 CDS open 19544-20293 _na     249_aa rpsC 30S ribosomal protein S3
1622 CAMQDD010000019.1 GCA946999455_00823 CDS open 20312-20647 _na     111_aa rplV 50S ribosomal protein L22
1623 CAMQDD010000019.1 GCA946999455_00824 CDS open 20662-20931 _na     89_aa rpsS 30S ribosomal protein S19
1624 CAMQDD010000019.1 GCA946999455_00825 CDS open 20949-21776 _na     275_aa rplB 50S ribosomal protein L2
1625 CAMQDD010000019.1 GCA946999455_00826 CDS open 21791-22072 _na     93_aa rplW 50S ribosomal protein L23
1626 CAMQDD010000019.1 GCA946999455_00827 CDS open 22072-22695 _na     207_aa rplD 50S ribosomal protein L4
1627 CAMQDD010000019.1 GCA946999455_00828 CDS open 22745-23386 _na     213_aa rplC 50S ribosomal protein L3
1628 CAMQDD010000019.1 GCA946999455_00829 CDS open 23398-23709 _na     103_aa rpsJ 30S ribosomal protein S10
1629 CAMQDD010000019.1 GCA946999455_00792 gene open 424-1722 tcyP
1630 CAMQDD010000019.1 GCA946999455_00793 gene open 1998-3233 clpX
1631 CAMQDD010000019.1 GCA946999455_00794 gene open 3244-3843 clpP
1632 CAMQDD010000019.1 GCA946999455_00795 gene open 3918-5384 tig
1633 CAMQDD010000019.1 GCA946999455_00796 gene open 5617-6483
1634 CAMQDD010000019.1 GCA946999455_00798 gene open 6700-7677
1635 CAMQDD010000019.1 GCA946999455_00799 gene open 7679-8647
1636 CAMQDD010000019.1 GCA946999455_00800 gene open 9217-9558 rplQ
1637 CAMQDD010000019.1 GCA946999455_00801 gene open 9576-10550
1638 CAMQDD010000019.1 GCA946999455_00802 gene open 10604-10987 rpsK
1639 CAMQDD010000019.1 GCA946999455_00803 gene open 11006-11383 rpsM
1640 CAMQDD010000019.1 GCA946999455_00804 gene open 11408-11521
1641 CAMQDD010000019.1 GCA946999455_00805 gene open 11538-11756 infA
1642 CAMQDD010000019.1 GCA946999455_00806 gene open 11803-12555 map
1643 CAMQDD010000019.1 GCA946999455_00807 gene open 12552-13205
1644 CAMQDD010000019.1 GCA946999455_00808 gene open 13232-14494 secY
1645 CAMQDD010000019.1 GCA946999455_00809 gene open 14496-14936 rplO
1646 CAMQDD010000019.1 GCA946999455_00810 gene open 14954-15133 rpmD
1647 CAMQDD010000019.1 GCA946999455_00811 gene open 15147-15647 rpsE
1648 CAMQDD010000019.1 GCA946999455_00812 gene open 15665-16030 rplR
1649 CAMQDD010000019.1 GCA946999455_00813 gene open 16048-16590 rplF
1650 CAMQDD010000019.1 GCA946999455_00814 gene open 16608-17006 rpsH
1651 CAMQDD010000019.1 GCA946999455_00815 gene open 17034-17303 rpsN
1652 CAMQDD010000019.1 GCA946999455_00816 gene open 17317-17856 rplE
1653 CAMQDD010000019.1 GCA946999455_00817 gene open 17877-18209 rplX
1654 CAMQDD010000019.1 GCA946999455_00818 gene open 18222-18590 rplN
1655 CAMQDD010000019.1 GCA946999455_00819 gene open 18620-18880 rpsQ
1656 CAMQDD010000019.1 GCA946999455_00820 gene open 18908-19117 rpmC
1657 CAMQDD010000019.1 GCA946999455_00821 gene open 19119-19544 rplP
1658 CAMQDD010000019.1 GCA946999455_00822 gene open 19544-20293 rpsC
1659 CAMQDD010000019.1 GCA946999455_00823 gene open 20312-20647 rplV
1660 CAMQDD010000019.1 GCA946999455_00824 gene open 20662-20931 rpsS
1661 CAMQDD010000019.1 GCA946999455_00825 gene open 20949-21776 rplB
1662 CAMQDD010000019.1 GCA946999455_00826 gene open 21791-22072 rplW
1663 CAMQDD010000019.1 GCA946999455_00827 gene open 22072-22695 rplD
1664 CAMQDD010000019.1 GCA946999455_00828 gene open 22745-23386 rplC
1665 CAMQDD010000019.1 GCA946999455_00829 gene open 23398-23709 rpsJ
1666 CAMQDD010000019.1 GCA946999455_00797 gene open 6537-6626 trnS
1667 CAMQDD010000019.1 GCA946999455_00797 tRNA open 6537-6626 trnS tRNA-Ser(tga)
1668 CAMQDD010000020.1 GCA946999455_00830 CDS open 82-1335 _na     417_aa nhaA Na+/H+ antiporter NhaA
1669 CAMQDD010000020.1 GCA946999455_00831 CDS open 1557-2816 _na     419_aa N-acetyltransferase domain-containing protein
1670 CAMQDD010000020.1 GCA946999455_00832 CDS open 2807-3091 _na     94_aa Excinuclease ABC subunit C
1671 CAMQDD010000020.1 GCA946999455_00833 CDS open 3088-3711 _na     207_aa DUF2232 domain-containing protein
1672 CAMQDD010000020.1 GCA946999455_00834 CDS open 3784-4122 _na     112_aa azlD LIV-E family branched chain amino acid permease AzlD
1673 CAMQDD010000020.1 GCA946999455_00835 CDS open 4119-4823 _na     234_aa azlC LIV-E family branched chain amino acid permease AzlC
1674 CAMQDD010000020.1 GCA946999455_00836 CDS open 5057-6793 _na     578_aa MAG1210 family protein
1675 CAMQDD010000020.1 GCA946999455_00837 CDS open 6798-7517 _na     239_aa lemA LemA family protein
1676 CAMQDD010000020.1 GCA946999455_00838 CDS open 8028-11807 _na     1259_aa rpoB DNA-directed RNA polymerase subunit beta
1677 CAMQDD010000020.1 GCA946999455_00839 CDS open 11829-15815 _na     1328_aa rpoC DNA-directed RNA polymerase subunit beta'
1678 CAMQDD010000020.1 GCA946999455_00840 CDS open 16129-16806 _na     225_aa hypothetical protein
1679 CAMQDD010000020.1 GCA946999455_00841 CDS open 16827-20564 _na     1245_aa phosphoribosylformylglycinamidine synthase
1680 CAMQDD010000020.1 GCA946999455_00842 CDS open 20569-21078 _na     169_aa DUF304 domain-containing protein
1681 CAMQDD010000020.1 GCA946999455_00843 CDS open 21211-21996 _na     261_aa Helix-turn-helix domain-containing protein
1682 CAMQDD010000020.1 GCA946999455_00844 CDS open 22166-22618 _na     150_aa N-acetyltransferase domain-containing protein
1683 CAMQDD010000020.1 GCA946999455_00830 gene open 82-1335 nhaA
1684 CAMQDD010000020.1 GCA946999455_00831 gene open 1557-2816
1685 CAMQDD010000020.1 GCA946999455_00832 gene open 2807-3091
1686 CAMQDD010000020.1 GCA946999455_00833 gene open 3088-3711
1687 CAMQDD010000020.1 GCA946999455_00834 gene open 3784-4122 azlD
1688 CAMQDD010000020.1 GCA946999455_00835 gene open 4119-4823 azlC
1689 CAMQDD010000020.1 GCA946999455_00836 gene open 5057-6793
1690 CAMQDD010000020.1 GCA946999455_00837 gene open 6798-7517 lemA
1691 CAMQDD010000020.1 GCA946999455_00838 gene open 8028-11807 rpoB
1692 CAMQDD010000020.1 GCA946999455_00839 gene open 11829-15815 rpoC
1693 CAMQDD010000020.1 GCA946999455_00840 gene open 16129-16806
1694 CAMQDD010000020.1 GCA946999455_00841 gene open 16827-20564
1695 CAMQDD010000020.1 GCA946999455_00842 gene open 20569-21078
1696 CAMQDD010000020.1 GCA946999455_00843 gene open 21211-21996
1697 CAMQDD010000020.1 GCA946999455_00844 gene open 22166-22618
1698 CAMQDD010000021.1 GCA946999455_00845 CDS open 295-528 _na     77_aa secE preprotein translocase subunit SecE
1699 CAMQDD010000021.1 GCA946999455_00846 CDS open 541-1164 _na     207_aa nusG transcription termination/antitermination protein NusG
1700 CAMQDD010000021.1 GCA946999455_00847 CDS open 1260-1685 _na     141_aa rplK 50S ribosomal protein L11
1701 CAMQDD010000021.1 GCA946999455_00848 CDS open 1727-2434 _na     235_aa rplA 50S ribosomal protein L1
1702 CAMQDD010000021.1 GCA946999455_00849 CDS open 2596-3135 _na     179_aa rplJ 50S ribosomal protein L10
1703 CAMQDD010000021.1 GCA946999455_00850 CDS open 3171-3542 _na     123_aa rplL 50S ribosomal protein L7/L12
1704 CAMQDD010000021.1 GCA946999455_00851 CDS open 3637-3894 _na     85_aa rpsT 30S ribosomal protein S20
1705 CAMQDD010000021.1 GCA946999455_00852 CDS open 4039-4407 _na     122_aa Holo-[acyl-carrier-protein] synthase
1706 CAMQDD010000021.1 GCA946999455_00853 CDS open 4410-5939 _na     509_aa Bifunctional NAD(P)H-hydrate repair enzyme
1707 CAMQDD010000021.1 GCA946999455_00854 CDS open 6000-6986 _na     328_aa diaminopimelate dehydrogenase
1708 CAMQDD010000021.1 GCA946999455_00856 CDS open 7293-7979 _na     228_aa hypothetical protein
1709 CAMQDD010000021.1 GCA946999455_00857 CDS open 8002-8553 _na     183_aa Adenine phosphoribosyltransferase
1710 CAMQDD010000021.1 GCA946999455_00858 CDS open 8960-9886 _na     308_aa cpsY Transcriptional regulator CpsY
1711 CAMQDD010000021.1 GCA946999455_00859 CDS open 9987-12269 _na     760_aa metE 5-methyltetrahydropteroyltriglutamate--homocysteine S-methyltransferase
1712 CAMQDD010000021.1 GCA946999455_00860 CDS open 12247-13131 _na     294_aa metF methylenetetrahydrofolate reductase [NAD(P)H]
1713 CAMQDD010000021.1 GCA946999455_00861 CDS open 13147-13335 _na     62_aa hypothetical protein
1714 CAMQDD010000021.1 GCA946999455_00862 CDS open 13489-14556 _na     355_aa NADP-dependent alcohol dehydrogenase
1715 CAMQDD010000021.1 GCA946999455_00863 CDS open 14731-16095 _na     454_aa APC family amino acid transporter
1716 CAMQDD010000021.1 GCA946999455_00864 CDS open 16241-17779 _na     512_aa guaA glutamine-hydrolyzing GMP synthase
1717 CAMQDD010000021.1 GCA946999455_00865 CDS open 18041-19198 _na     385_aa Transporter%2C major facilitator family protein
1718 CAMQDD010000021.1 GCA946999455_00866 CDS open 19724-20317 _na     197_aa hypothetical protein
1719 CAMQDD010000021.1 GCA946999455_00867 CDS open 20927-21403 _na     158_aa hypothetical protein
1720 CAMQDD010000021.1 GCA946999455_00845 gene open 295-528 secE
1721 CAMQDD010000021.1 GCA946999455_00846 gene open 541-1164 nusG
1722 CAMQDD010000021.1 GCA946999455_00847 gene open 1260-1685 rplK
1723 CAMQDD010000021.1 GCA946999455_00848 gene open 1727-2434 rplA
1724 CAMQDD010000021.1 GCA946999455_00849 gene open 2596-3135 rplJ
1725 CAMQDD010000021.1 GCA946999455_00850 gene open 3171-3542 rplL
1726 CAMQDD010000021.1 GCA946999455_00851 gene open 3637-3894 rpsT
1727 CAMQDD010000021.1 GCA946999455_00852 gene open 4039-4407
1728 CAMQDD010000021.1 GCA946999455_00853 gene open 4410-5939
1729 CAMQDD010000021.1 GCA946999455_00854 gene open 6000-6986
1730 CAMQDD010000021.1 GCA946999455_00856 gene open 7293-7979
1731 CAMQDD010000021.1 GCA946999455_00857 gene open 8002-8553
1732 CAMQDD010000021.1 GCA946999455_00858 gene open 8960-9886 cpsY
1733 CAMQDD010000021.1 GCA946999455_00859 gene open 9987-12269 metE
1734 CAMQDD010000021.1 GCA946999455_00860 gene open 12247-13131 metF
1735 CAMQDD010000021.1 GCA946999455_00861 gene open 13147-13335
1736 CAMQDD010000021.1 GCA946999455_00862 gene open 13489-14556
1737 CAMQDD010000021.1 GCA946999455_00863 gene open 14731-16095
1738 CAMQDD010000021.1 GCA946999455_00864 gene open 16241-17779 guaA
1739 CAMQDD010000021.1 GCA946999455_00865 gene open 18041-19198
1740 CAMQDD010000021.1 GCA946999455_00866 gene open 19724-20317
1741 CAMQDD010000021.1 GCA946999455_00867 gene open 20927-21403
1742 CAMQDD010000021.1 GCA946999455_00855 gene open 7066-7156 trnS
1743 CAMQDD010000021.1 GCA946999455_00855 tRNA open 7066-7156 trnS tRNA-Ser(gct)
1744 CAMQDD010000022.1 GCA946999455_00868 CDS open 102-3089 _na     995_aa YadA-like family protein
1745 CAMQDD010000022.1 GCA946999455_00869 CDS open 3212-4084 _na     290_aa Pseudouridine synthase
1746 CAMQDD010000022.1 GCA946999455_00870 CDS open 4062-4913 _na     283_aa pgeF peptidoglycan editing factor PgeF
1747 CAMQDD010000022.1 GCA946999455_00871 CDS open 4938-5750 _na     270_aa Oxidoreductase%2C aldo/keto reductase family protein
1748 CAMQDD010000022.1 GCA946999455_00872 CDS open 5796-6734 _na     312_aa araC AraC family transcriptional regulator
1749 CAMQDD010000022.1 GCA946999455_00873 CDS open 6861-8624 _na     587_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
1750 CAMQDD010000022.1 GCA946999455_00874 CDS open 8621-10342 _na     573_aa Cyclic beta-1%2C2-glucan ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
1751 CAMQDD010000022.1 GCA946999455_00875 CDS open 10398-10628 _na     76_aa hypothetical protein
1752 CAMQDD010000022.1 GCA946999455_00876 CDS open 10621-11334 _na     237_aa Ser/Thr protein phosphatase
1753 CAMQDD010000022.1 GCA946999455_00877 CDS open 11336-12097 _na     253_aa UTP-hexose-1-phosphate uridylyltransferase
1754 CAMQDD010000022.1 GCA946999455_00878 CDS open 12266-13063 _na     265_aa Amino acid ABC superfamily ATP binding cassette transporter%2C binding protein
1755 CAMQDD010000022.1 GCA946999455_00879 CDS open 13133-13786 _na     217_aa Amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein
1756 CAMQDD010000022.1 GCA946999455_00880 CDS open 13795-14550 _na     251_aa Glutamine ABC superfamily ATP binding cassette transporter%2C ABC protein
1757 CAMQDD010000022.1 GCA946999455_00881 CDS open 14663-15694 _na     343_aa efflux RND transporter periplasmic adaptor subunit
1758 CAMQDD010000022.1 GCA946999455_00882 CDS open 15795-19352 _na     1185_aa smc chromosome segregation protein SMC
1759 CAMQDD010000022.1 GCA946999455_00883 CDS open 19339-20280 _na     313_aa ftsY signal recognition particle-docking protein FtsY
1760 CAMQDD010000022.1 GCA946999455_00884 CDS open 20464-21330 _na     288_aa lysR LysR family transcriptional regulator
1761 CAMQDD010000022.1 GCA946999455_00868 gene open 102-3089
1762 CAMQDD010000022.1 GCA946999455_00869 gene open 3212-4084
1763 CAMQDD010000022.1 GCA946999455_00870 gene open 4062-4913 pgeF
1764 CAMQDD010000022.1 GCA946999455_00871 gene open 4938-5750
1765 CAMQDD010000022.1 GCA946999455_00872 gene open 5796-6734 araC
1766 CAMQDD010000022.1 GCA946999455_00873 gene open 6861-8624
1767 CAMQDD010000022.1 GCA946999455_00874 gene open 8621-10342
1768 CAMQDD010000022.1 GCA946999455_00875 gene open 10398-10628
1769 CAMQDD010000022.1 GCA946999455_00876 gene open 10621-11334
1770 CAMQDD010000022.1 GCA946999455_00877 gene open 11336-12097
1771 CAMQDD010000022.1 GCA946999455_00878 gene open 12266-13063
1772 CAMQDD010000022.1 GCA946999455_00879 gene open 13133-13786
1773 CAMQDD010000022.1 GCA946999455_00880 gene open 13795-14550
1774 CAMQDD010000022.1 GCA946999455_00881 gene open 14663-15694
1775 CAMQDD010000022.1 GCA946999455_00882 gene open 15795-19352 smc
1776 CAMQDD010000022.1 GCA946999455_00883 gene open 19339-20280 ftsY
1777 CAMQDD010000022.1 GCA946999455_00884 gene open 20464-21330 lysR
1778 CAMQDD010000022.1 GCA946999455_00885 gene open 21490-21565 trnV
1779 CAMQDD010000022.1 GCA946999455_00885 tRNA open 21490-21565 trnV tRNA-Val(tac)
1780 CAMQDD010000023.1 repeat_region open 7760-8134 CRISPR array with 6 repeats of length 35%2C consensus sequence GTTTTAGACATCTGTTGGATATAGGTAAACTGATA and spacer length 31
1781 CAMQDD010000023.1 GCA946999455_00886 CDS open 187-1452 _na     421_aa uraA uracil permease
1782 CAMQDD010000023.1 GCA946999455_00887 CDS open 1600-2022 _na     140_aa Putative acetyltransferase
1783 CAMQDD010000023.1 GCA946999455_00888 CDS open 1979-2635 _na     218_aa HTH tetR-type domain-containing protein
1784 CAMQDD010000023.1 GCA946999455_00889 CDS open 3139-6579 _na     1146_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1785 CAMQDD010000023.1 GCA946999455_00890 CDS open 6540-6818 _na     92_aa hypothetical protein
1786 CAMQDD010000023.1 GCA946999455_00891 CDS open 6797-7444 _na     215_aa cas1 type II CRISPR-associated endonuclease Cas1
1787 CAMQDD010000023.1 GCA946999455_00892 CDS open 7429-7749 _na     106_aa cas2 CRISPR-associated endonuclease Cas2
1788 CAMQDD010000023.1 GCA946999455_00893 CDS open 8278-8553 _na     91_aa hypothetical protein
1789 CAMQDD010000023.1 GCA946999455_00894 CDS open 8550-9107 _na     185_aa hypothetical protein
1790 CAMQDD010000023.1 GCA946999455_00895 CDS open 9236-9589 _na     117_aa hypothetical protein
1791 CAMQDD010000023.1 GCA946999455_00896 CDS open 9717-11117 _na     466_aa FAD dependent oxidoreductase
1792 CAMQDD010000023.1 GCA946999455_00897 CDS open 11110-12402 _na     430_aa purB adenylosuccinate lyase
1793 CAMQDD010000023.1 GCA946999455_00898 CDS open 12368-13708 _na     446_aa adenylosuccinate synthase
1794 CAMQDD010000023.1 GCA946999455_00899 CDS open 13825-14253 _na     142_aa eamA EamA domain-containing protein
1795 CAMQDD010000023.1 GCA946999455_00900 CDS open 14679-15935 _na     418_aa hisS histidine--tRNA ligase
1796 CAMQDD010000023.1 GCA946999455_00901 CDS open 16087-19311 _na     1074_aa Helicase domain/SNF2 family domain protein
1797 CAMQDD010000023.1 GCA946999455_00902 CDS open 19304-19900 _na     198_aa DUF4391 domain-containing protein
1798 CAMQDD010000023.1 GCA946999455_00886 gene open 187-1452 uraA
1799 CAMQDD010000023.1 GCA946999455_00887 gene open 1600-2022
1800 CAMQDD010000023.1 GCA946999455_00888 gene open 1979-2635
1801 CAMQDD010000023.1 GCA946999455_00889 gene open 3139-6579 cas9
1802 CAMQDD010000023.1 GCA946999455_00890 gene open 6540-6818
1803 CAMQDD010000023.1 GCA946999455_00891 gene open 6797-7444 cas1
1804 CAMQDD010000023.1 GCA946999455_00892 gene open 7429-7749 cas2
1805 CAMQDD010000023.1 GCA946999455_00893 gene open 8278-8553
1806 CAMQDD010000023.1 GCA946999455_00894 gene open 8550-9107
1807 CAMQDD010000023.1 GCA946999455_00895 gene open 9236-9589
1808 CAMQDD010000023.1 GCA946999455_00896 gene open 9717-11117
1809 CAMQDD010000023.1 GCA946999455_00897 gene open 11110-12402 purB
1810 CAMQDD010000023.1 GCA946999455_00898 gene open 12368-13708
1811 CAMQDD010000023.1 GCA946999455_00899 gene open 13825-14253 eamA
1812 CAMQDD010000023.1 GCA946999455_00900 gene open 14679-15935 hisS
1813 CAMQDD010000023.1 GCA946999455_00901 gene open 16087-19311
1814 CAMQDD010000023.1 GCA946999455_00902 gene open 19304-19900
1815 CAMQDD010000024.1 regulatory_region open 17452-17549 TPP riboswitch aptamer (THI element)
1816 CAMQDD010000024.1 GCA946999455_00903 CDS open 566-2404 _na     612_aa tdc tyrosine decarboxylase
1817 CAMQDD010000024.1 GCA946999455_00904 CDS open 2905-4272 _na     455_aa Na+/H+ antiporter
1818 CAMQDD010000024.1 GCA946999455_00905 CDS open 4586-5815 _na     409_aa Arsenic transporter
1819 CAMQDD010000024.1 GCA946999455_00906 CDS open 6192-7724 _na     510_aa AGCS family alanine or glycine:sodium (Na+) or proton (H+) symporter
1820 CAMQDD010000024.1 GCA946999455_00907 CDS open 7980-8426 _na     148_aa rplI 50S ribosomal protein L9
1821 CAMQDD010000024.1 GCA946999455_00908 CDS open 8429-10414 _na     661_aa Cyclic-di-AMP phosphodiesterase
1822 CAMQDD010000024.1 GCA946999455_00909 CDS open 10482-11435 _na     317_aa DUF2232 domain-containing protein
1823 CAMQDD010000024.1 GCA946999455_00910 CDS open 11485-13146 _na     553_aa Ribonuclease J
1824 CAMQDD010000024.1 GCA946999455_00911 CDS open 13495-15111 _na     538_aa CTP synthase
1825 CAMQDD010000024.1 GCA946999455_00912 CDS open 15122-16786 _na     554_aa argS arginine--tRNA ligase
1826 CAMQDD010000024.1 GCA946999455_00913 CDS open 16756-17208 _na     150_aa DUF1934 domain-containing protein
1827 CAMQDD010000024.1 GCA946999455_00914 CDS open 17587-18342 _na     251_aa 3-oxoacyl-ACP reductase
1828 CAMQDD010000024.1 GCA946999455_00903 gene open 566-2404 tdc
1829 CAMQDD010000024.1 GCA946999455_00904 gene open 2905-4272
1830 CAMQDD010000024.1 GCA946999455_00905 gene open 4586-5815
1831 CAMQDD010000024.1 GCA946999455_00906 gene open 6192-7724
1832 CAMQDD010000024.1 GCA946999455_00907 gene open 7980-8426 rplI
1833 CAMQDD010000024.1 GCA946999455_00908 gene open 8429-10414
1834 CAMQDD010000024.1 GCA946999455_00909 gene open 10482-11435
1835 CAMQDD010000024.1 GCA946999455_00910 gene open 11485-13146
1836 CAMQDD010000024.1 GCA946999455_00911 gene open 13495-15111
1837 CAMQDD010000024.1 GCA946999455_00912 gene open 15122-16786 argS
1838 CAMQDD010000024.1 GCA946999455_00913 gene open 16756-17208
1839 CAMQDD010000024.1 GCA946999455_00914 gene open 17587-18342
1840 CAMQDD010000025.1 regulatory_region open 10951-11156 raiA RNA
1841 CAMQDD010000025.1 GCA946999455_00915 CDS open 177-362 _na     61_aa hypothetical protein
1842 CAMQDD010000025.1 GCA946999455_00916 CDS open 460-573 _na     37_aa hypothetical protein
1843 CAMQDD010000025.1 GCA946999455_00917 CDS open 612-1712 _na     366_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
1844 CAMQDD010000025.1 GCA946999455_00918 CDS open 1888-2082 _na     64_aa hypothetical protein
1845 CAMQDD010000025.1 GCA946999455_00919 CDS open 2228-3328 _na     366_aa Histidinol-phosphate transaminase
1846 CAMQDD010000025.1 GCA946999455_00920 CDS open 3374-4480 _na     368_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
1847 CAMQDD010000025.1 GCA946999455_00921 CDS open 4540-5010 _na     156_aa smpB SsrA-binding protein SmpB
1848 CAMQDD010000025.1 GCA946999455_00922 CDS open 5031-7058 _na     675_aa rnr ribonuclease R
1849 CAMQDD010000025.1 GCA946999455_00923 CDS open 7134-7370 _na     78_aa secG preprotein translocase subunit SecG
1850 CAMQDD010000025.1 GCA946999455_00924 CDS open 7464-7973 _na     169_aa Tetracycline resistance protein
1851 CAMQDD010000025.1 GCA946999455_00925 CDS open 7975-8793 _na     272_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
1852 CAMQDD010000025.1 GCA946999455_00926 CDS open 8777-9217 _na     146_aa Mini-ribonuclease 3
1853 CAMQDD010000025.1 GCA946999455_00927 CDS open 9243-10688 _na     481_aa cysS cysteine--tRNA ligase
1854 CAMQDD010000025.1 GCA946999455_00928 CDS open 10913-11317 _na     134_aa hypothetical protein
1855 CAMQDD010000025.1 GCA946999455_00929 CDS open 11420-11848 _na     142_aa eamA EamA domain-containing protein
1856 CAMQDD010000025.1 GCA946999455_00930 CDS open 12006-13085 _na     359_aa citC [citrate (pro-3S)-lyase] ligase
1857 CAMQDD010000025.1 GCA946999455_00931 CDS open 13128-13361 _na     77_aa rpsR 30S ribosomal protein S18
1858 CAMQDD010000025.1 GCA946999455_00932 CDS open 13384-13806 _na     140_aa Single-stranded DNA-binding protein
1859 CAMQDD010000025.1 GCA946999455_00933 CDS open 13821-14105 _na     94_aa rpsF 30S ribosomal protein S6
1860 CAMQDD010000025.1 GCA946999455_00934 CDS open 14243-14989 _na     248_aa terC Integral membrane protein TerC
1861 CAMQDD010000025.1 GCA946999455_00936 CDS open 15261-16025 _na     254_aa ydfG NADP-dependent L-serine/L-allo-threonine dehydrogenase YdfG
1862 CAMQDD010000025.1 GCA946999455_00937 CDS open 16123-16740 _na     205_aa Tetratricopeptide repeat protein
1863 CAMQDD010000025.1 GCA946999455_00915 gene open 177-362
1864 CAMQDD010000025.1 GCA946999455_00916 gene open 460-573
1865 CAMQDD010000025.1 GCA946999455_00917 gene open 612-1712
1866 CAMQDD010000025.1 GCA946999455_00918 gene open 1888-2082
1867 CAMQDD010000025.1 GCA946999455_00919 gene open 2228-3328
1868 CAMQDD010000025.1 GCA946999455_00920 gene open 3374-4480
1869 CAMQDD010000025.1 GCA946999455_00921 gene open 4540-5010 smpB
1870 CAMQDD010000025.1 GCA946999455_00922 gene open 5031-7058 rnr
1871 CAMQDD010000025.1 GCA946999455_00923 gene open 7134-7370 secG
1872 CAMQDD010000025.1 GCA946999455_00924 gene open 7464-7973
1873 CAMQDD010000025.1 GCA946999455_00925 gene open 7975-8793 rlmB
1874 CAMQDD010000025.1 GCA946999455_00926 gene open 8777-9217
1875 CAMQDD010000025.1 GCA946999455_00927 gene open 9243-10688 cysS
1876 CAMQDD010000025.1 GCA946999455_00928 gene open 10913-11317
1877 CAMQDD010000025.1 GCA946999455_00929 gene open 11420-11848 eamA
1878 CAMQDD010000025.1 GCA946999455_00930 gene open 12006-13085 citC
1879 CAMQDD010000025.1 GCA946999455_00931 gene open 13128-13361 rpsR
1880 CAMQDD010000025.1 GCA946999455_00932 gene open 13384-13806
1881 CAMQDD010000025.1 GCA946999455_00933 gene open 13821-14105 rpsF
1882 CAMQDD010000025.1 GCA946999455_00934 gene open 14243-14989 terC
1883 CAMQDD010000025.1 GCA946999455_00936 gene open 15261-16025 ydfG
1884 CAMQDD010000025.1 GCA946999455_00937 gene open 16123-16740
1885 CAMQDD010000025.1 GCA946999455_00935 gene open 15135-15210 trnT
1886 CAMQDD010000025.1 GCA946999455_00935 tRNA open 15135-15210 trnT tRNA-Thr(cgt)
1887 CAMQDD010000026.1 GCA946999455_00938 CDS open 86-586 _na     166_aa type II secretion system protein
1888 CAMQDD010000026.1 GCA946999455_00939 CDS open 586-954 _na     122_aa hypothetical protein
1889 CAMQDD010000026.1 GCA946999455_00940 CDS open 951-1466 _na     171_aa type II secretion system protein
1890 CAMQDD010000026.1 GCA946999455_00941 CDS open 1459-1854 _na     131_aa pilX Type 4 fimbrial biogenesis protein PilX N-terminal domain-containing protein
1891 CAMQDD010000026.1 GCA946999455_00942 CDS open 1856-3175 _na     439_aa pilN Fimbrial assembly protein PilN
1892 CAMQDD010000026.1 GCA946999455_00943 CDS open 3168-3617 _na     149_aa Prepilin-type cleavage/methylation N-terminal domain protein
1893 CAMQDD010000026.1 GCA946999455_00944 CDS open 3620-4222 _na     200_aa Shikimate kinase
1894 CAMQDD010000026.1 GCA946999455_00945 CDS open 4226-5584 _na     452_aa CBS domain protein
1895 CAMQDD010000026.1 GCA946999455_00946 CDS open 5568-6005 _na     145_aa hypothetical protein
1896 CAMQDD010000026.1 GCA946999455_00947 CDS open 6201-6524 _na     107_aa trxA thioredoxin
1897 CAMQDD010000026.1 GCA946999455_00948 CDS open 6915-7676 _na     253_aa Sporulation initiation inhibitor protein Soj
1898 CAMQDD010000026.1 GCA946999455_00949 CDS open 7669-8520 _na     283_aa Chromosome partitioning protein SpoOJ
1899 CAMQDD010000026.1 GCA946999455_00950 CDS open 8522-9106 _na     194_aa DUF4446 domain-containing protein
1900 CAMQDD010000026.1 GCA946999455_00951 CDS open 9103-9996 _na     297_aa M23 peptidase domain protein
1901 CAMQDD010000026.1 GCA946999455_00952 CDS open 10043-10726 _na     227_aa DNA alkylation repair enzyme
1902 CAMQDD010000026.1 GCA946999455_00953 CDS open 10783-11916 _na     377_aa Type II general secretion pathway (GSP) E protein
1903 CAMQDD010000026.1 GCA946999455_00954 CDS open 11926-12930 _na     334_aa 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase
1904 CAMQDD010000026.1 GCA946999455_00955 CDS open 12931-14109 _na     392_aa Type IV pilus assembly protein
1905 CAMQDD010000026.1 GCA946999455_00957 CDS open 14252-15385 _na     377_aa SAP domain-containing protein
1906 CAMQDD010000026.1 GCA946999455_00958 CDS open 15693-16145 _na     150_aa hypothetical protein
1907 CAMQDD010000026.1 GCA946999455_00938 gene open 86-586
1908 CAMQDD010000026.1 GCA946999455_00939 gene open 586-954
1909 CAMQDD010000026.1 GCA946999455_00940 gene open 951-1466
1910 CAMQDD010000026.1 GCA946999455_00941 gene open 1459-1854 pilX
1911 CAMQDD010000026.1 GCA946999455_00942 gene open 1856-3175 pilN
1912 CAMQDD010000026.1 GCA946999455_00943 gene open 3168-3617
1913 CAMQDD010000026.1 GCA946999455_00944 gene open 3620-4222
1914 CAMQDD010000026.1 GCA946999455_00945 gene open 4226-5584
1915 CAMQDD010000026.1 GCA946999455_00946 gene open 5568-6005
1916 CAMQDD010000026.1 GCA946999455_00947 gene open 6201-6524 trxA
1917 CAMQDD010000026.1 GCA946999455_00948 gene open 6915-7676
1918 CAMQDD010000026.1 GCA946999455_00949 gene open 7669-8520
1919 CAMQDD010000026.1 GCA946999455_00950 gene open 8522-9106
1920 CAMQDD010000026.1 GCA946999455_00951 gene open 9103-9996
1921 CAMQDD010000026.1 GCA946999455_00952 gene open 10043-10726
1922 CAMQDD010000026.1 GCA946999455_00953 gene open 10783-11916
1923 CAMQDD010000026.1 GCA946999455_00954 gene open 11926-12930
1924 CAMQDD010000026.1 GCA946999455_00955 gene open 12931-14109
1925 CAMQDD010000026.1 GCA946999455_00957 gene open 14252-15385
1926 CAMQDD010000026.1 GCA946999455_00958 gene open 15693-16145
1927 CAMQDD010000026.1 GCA946999455_00956 gene open 14146-14222 trnR
1928 CAMQDD010000026.1 GCA946999455_00956 tRNA open 14146-14222 trnR tRNA-Arg(cct)
1929 CAMQDD010000027.1 GCA946999455_00959 CDS open 356-820 _na     154_aa hypothetical protein
1930 CAMQDD010000027.1 GCA946999455_00960 CDS open 2228-4423 _na     731_aa Ornithine decarboxylase
1931 CAMQDD010000027.1 GCA946999455_00961 CDS open 4497-5189 _na     230_aa Type VII secretion system protein EssD-like domain-containing protein
1932 CAMQDD010000027.1 GCA946999455_00962 CDS open 5244-6113 _na     289_aa sdaAA L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha
1933 CAMQDD010000027.1 GCA946999455_00963 CDS open 6124-6786 _na     220_aa sdaAB L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta
1934 CAMQDD010000027.1 GCA946999455_00964 CDS open 6812-8143 _na     443_aa LPO_1073/Vpar_1526 family protein
1935 CAMQDD010000027.1 GCA946999455_00965 CDS open 8421-9437 _na     338_aa UDP-N-acetylglucosamine kinase
1936 CAMQDD010000027.1 GCA946999455_00966 CDS open 9554-10546 _na     330_aa Diacylglycerol kinase catalytic domain protein
1937 CAMQDD010000027.1 GCA946999455_00967 CDS open 10598-11809 _na     403_aa Spermidine synthase
1938 CAMQDD010000027.1 GCA946999455_00968 CDS open 11883-13487 _na     534_aa peptide chain release factor 3
1939 CAMQDD010000027.1 GCA946999455_00969 CDS open 13829-14281 _na     150_aa YadA-like family protein
1940 CAMQDD010000027.1 GCA946999455_00959 gene open 356-820
1941 CAMQDD010000027.1 GCA946999455_00960 gene open 2228-4423
1942 CAMQDD010000027.1 GCA946999455_00961 gene open 4497-5189
1943 CAMQDD010000027.1 GCA946999455_00962 gene open 5244-6113 sdaAA
1944 CAMQDD010000027.1 GCA946999455_00963 gene open 6124-6786 sdaAB
1945 CAMQDD010000027.1 GCA946999455_00964 gene open 6812-8143
1946 CAMQDD010000027.1 GCA946999455_00965 gene open 8421-9437
1947 CAMQDD010000027.1 GCA946999455_00966 gene open 9554-10546
1948 CAMQDD010000027.1 GCA946999455_00967 gene open 10598-11809
1949 CAMQDD010000027.1 GCA946999455_00968 gene open 11883-13487
1950 CAMQDD010000027.1 GCA946999455_00969 gene open 13829-14281
1951 CAMQDD010000028.1 GCA946999455_00970 CDS open 40-735 _na     231_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
1952 CAMQDD010000028.1 GCA946999455_00971 CDS open 732-2606 _na     624_aa mnmG tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG
1953 CAMQDD010000028.1 GCA946999455_00972 CDS open 2655-3425 _na     256_aa tatD Deoxyribonuclease TatD
1954 CAMQDD010000028.1 GCA946999455_00973 CDS open 3434-4813 _na     459_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1955 CAMQDD010000028.1 GCA946999455_00974 CDS open 5224-6276 _na     350_aa Zinc ABC superfamily ATP binding cassette transporter%2C binding protein
1956 CAMQDD010000028.1 GCA946999455_00975 CDS open 6276-6986 _na     236_aa Zinc ABC superfamily ATP binding cassette transporter%2C ABC protein
1957 CAMQDD010000028.1 GCA946999455_00976 CDS open 6986-7804 _na     272_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
1958 CAMQDD010000028.1 GCA946999455_00977 CDS open 7804-8415 _na     203_aa DUF1980 domain-containing protein
1959 CAMQDD010000028.1 GCA946999455_00978 CDS open 8694-9518 _na     274_aa pyridoxal kinase
1960 CAMQDD010000028.1 GCA946999455_00979 CDS open 9607-9873 _na     88_aa relE Toxin-antitoxin stability system protein RelE
1961 CAMQDD010000028.1 GCA946999455_00980 CDS open 9870-10094 _na     74_aa relB type II toxin-antitoxin system RelB family antitoxin
1962 CAMQDD010000028.1 GCA946999455_00981 CDS open 10220-10612 _na     130_aa hypothetical protein
1963 CAMQDD010000028.1 GCA946999455_00982 CDS open 10732-11292 _na     186_aa DNA-directed RNA polymerase specialized sigma subunit
1964 CAMQDD010000028.1 GCA946999455_00983 CDS open 11344-11550 _na     68_aa DUF2922 domain-containing protein
1965 CAMQDD010000028.1 GCA946999455_00984 CDS open 11586-11810 _na     74_aa hypothetical protein
1966 CAMQDD010000028.1 GCA946999455_00985 CDS open 11810-11938 _na     42_aa hypothetical protein
1967 CAMQDD010000028.1 GCA946999455_00986 CDS open 12093-12341 _na     82_aa type II toxin-antitoxin system Phd/YefM family antitoxin
1968 CAMQDD010000028.1 GCA946999455_00987 CDS open 12341-12601 _na     86_aa Txe/YoeB family addiction module toxin
1969 CAMQDD010000028.1 GCA946999455_00988 CDS open 12654-13643 _na     329_aa porin
1970 CAMQDD010000028.1 GCA946999455_00970 gene open 40-735 rsmG
1971 CAMQDD010000028.1 GCA946999455_00971 gene open 732-2606 mnmG
1972 CAMQDD010000028.1 GCA946999455_00972 gene open 2655-3425 tatD
1973 CAMQDD010000028.1 GCA946999455_00973 gene open 3434-4813 mnmE
1974 CAMQDD010000028.1 GCA946999455_00974 gene open 5224-6276
1975 CAMQDD010000028.1 GCA946999455_00975 gene open 6276-6986
1976 CAMQDD010000028.1 GCA946999455_00976 gene open 6986-7804
1977 CAMQDD010000028.1 GCA946999455_00977 gene open 7804-8415
1978 CAMQDD010000028.1 GCA946999455_00978 gene open 8694-9518
1979 CAMQDD010000028.1 GCA946999455_00979 gene open 9607-9873 relE
1980 CAMQDD010000028.1 GCA946999455_00980 gene open 9870-10094 relB
1981 CAMQDD010000028.1 GCA946999455_00981 gene open 10220-10612
1982 CAMQDD010000028.1 GCA946999455_00982 gene open 10732-11292
1983 CAMQDD010000028.1 GCA946999455_00983 gene open 11344-11550
1984 CAMQDD010000028.1 GCA946999455_00984 gene open 11586-11810
1985 CAMQDD010000028.1 GCA946999455_00985 gene open 11810-11938
1986 CAMQDD010000028.1 GCA946999455_00986 gene open 12093-12341
1987 CAMQDD010000028.1 GCA946999455_00987 gene open 12341-12601
1988 CAMQDD010000028.1 GCA946999455_00988 gene open 12654-13643
1989 CAMQDD010000029.1 GCA946999455_00989 CDS open 18-2015 _na     665_aa Arylsulfatase
1990 CAMQDD010000029.1 GCA946999455_00990 CDS open 2135-3577 _na     480_aa Trk family K+ transporter%2C membrane protein
1991 CAMQDD010000029.1 GCA946999455_00991 CDS open 3587-5026 _na     479_aa Trk family K+ transporter%2C membrane protein
1992 CAMQDD010000029.1 GCA946999455_00992 CDS open 5026-6375 _na     449_aa trkA Trk system potassium transporter TrkA
1993 CAMQDD010000029.1 GCA946999455_00993 CDS open 6498-7304 _na     268_aa tcmP Tetracenomycin polyketide synthesis O-methyltransferase TcmP
1994 CAMQDD010000029.1 GCA946999455_00994 CDS open 7368-8252 _na     294_aa DMT superfamily drug/metabolite transporter
1995 CAMQDD010000029.1 GCA946999455_00995 CDS open 8322-8894 _na     190_aa Flavoredoxin
1996 CAMQDD010000029.1 GCA946999455_00989 gene open 18-2015
1997 CAMQDD010000029.1 GCA946999455_00990 gene open 2135-3577
1998 CAMQDD010000029.1 GCA946999455_00991 gene open 3587-5026
1999 CAMQDD010000029.1 GCA946999455_00992 gene open 5026-6375 trkA
2000 CAMQDD010000029.1 GCA946999455_00993 gene open 6498-7304 tcmP