BAKTAGenome Explorer: Prevotella timonensis (GCA_947000095.1)
Select a Genome:
|
BAKTA Annotations for GCA_947000095.1
|
Search & Sort all 5063 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CAMQFS010000038.1 | GCA947000095_01742 | gene | open | 10730-11896 | |||
| 3502 | CAMQFS010000038.1 | GCA947000095_01743 | gene | open | 12586-12795 | |||
| 3503 | CAMQFS010000038.1 | GCA947000095_01744 | gene | open | 13116-13373 | |||
| 3504 | CAMQFS010000038.1 | GCA947000095_01745 | gene | open | 13482-14000 | |||
| 3505 | CAMQFS010000038.1 | GCA947000095_01746 | gene | open | 14317-14532 | |||
| 3506 | CAMQFS010000038.1 | GCA947000095_01747 | gene | open | 14668-14955 | |||
| 3507 | CAMQFS010000038.1 | GCA947000095_01748 | gene | open | 14930-15190 | |||
| 3508 | CAMQFS010000038.1 | GCA947000095_01749 | gene | open | 15154-15297 | |||
| 3509 | CAMQFS010000038.1 | GCA947000095_01750 | gene | open | 15501-16562 | lpxD | ||
| 3510 | CAMQFS010000038.1 | GCA947000095_01751 | gene | open | 16564-17955 | |||
| 3511 | CAMQFS010000038.1 | GCA947000095_01752 | gene | open | 18017-18787 | lpxA | ||
| 3512 | CAMQFS010000038.1 | GCA947000095_01753 | gene | open | 18788-19690 | miaA | ||
| 3513 | CAMQFS010000038.1 | GCA947000095_01754 | gene | open | 19732-22221 | |||
| 3514 | CAMQFS010000038.1 | GCA947000095_01755 | gene | open | 22221-23960 | |||
| 3515 | CAMQFS010000038.1 | GCA947000095_01756 | gene | open | 24514-26814 | |||
| 3516 | CAMQFS010000038.1 | GCA947000095_01757 | gene | open | 26823-27011 | |||
| 3517 | CAMQFS010000039.1 | GCA947000095_01758 | CDS | open | 864-1163 | _na 99_aa | hypothetical protein | |
| 3518 | CAMQFS010000039.1 | GCA947000095_01759 | CDS | open | 1387-4140 | _na 917_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3519 | CAMQFS010000039.1 | GCA947000095_01760 | CDS | open | 5147-5896 | _na 249_aa | porT | PorT family protein |
| 3520 | CAMQFS010000039.1 | GCA947000095_01761 | CDS | open | 5951-6796 | _na 281_aa | Ser/Thr phosphatase family protein | |
| 3521 | CAMQFS010000039.1 | GCA947000095_01762 | CDS | open | 6824-7588 | _na 254_aa | 5'-Nucleotidase C-terminal domain-containing protein | |
| 3522 | CAMQFS010000039.1 | GCA947000095_01763 | CDS | open | 8133-8507 | _na 124_aa | rplS | 50S ribosomal protein L19 |
| 3523 | CAMQFS010000039.1 | GCA947000095_01764 | CDS | open | 8567-8869 | _na 100_aa | hypothetical protein | |
| 3524 | CAMQFS010000039.1 | GCA947000095_01765 | CDS | open | 9241-10422 | _na 393_aa | phosphoribosylaminoimidazolecarboxamide formyltransferase | |
| 3525 | CAMQFS010000039.1 | GCA947000095_01766 | CDS | open | 10481-10702 | _na 73_aa | RNA-binding protein | |
| 3526 | CAMQFS010000039.1 | GCA947000095_01767 | CDS | open | 10719-11879 | _na 386_aa | Peptidase%2C M23 family | |
| 3527 | CAMQFS010000039.1 | GCA947000095_01768 | CDS | open | 11921-12778 | _na 285_aa | pgeF | peptidoglycan editing factor PgeF |
| 3528 | CAMQFS010000039.1 | GCA947000095_01769 | CDS | open | 12720-13886 | _na 388_aa | obgE | GTPase ObgE |
| 3529 | CAMQFS010000039.1 | GCA947000095_01770 | CDS | open | 13986-14558 | _na 190_aa | adenylate kinase | |
| 3530 | CAMQFS010000039.1 | GCA947000095_01771 | CDS | open | 14555-15094 | _na 179_aa | hpt | hypoxanthine phosphoribosyltransferase |
| 3531 | CAMQFS010000039.1 | GCA947000095_01772 | CDS | open | 15184-15294 | _na 36_aa | hypothetical protein | |
| 3532 | CAMQFS010000039.1 | GCA947000095_01773 | CDS | open | 16165-20766 | _na 1533_aa | cTD-A | Secretion system C-terminal sorting domain-containing protein |
| 3533 | CAMQFS010000039.1 | GCA947000095_01774 | CDS | open | 20875-21039 | _na 54_aa | hypothetical protein | |
| 3534 | CAMQFS010000039.1 | GCA947000095_01775 | CDS | open | 21036-21149 | _na 37_aa | hypothetical protein | |
| 3535 | CAMQFS010000039.1 | GCA947000095_01776 | CDS | open | 21320-21448 | _na 42_aa | hypothetical protein | |
| 3536 | CAMQFS010000039.1 | GCA947000095_01777 | CDS | open | 21556-23079 | _na 507_aa | Bifunctional NAD(P)H-hydrate repair enzyme | |
| 3537 | CAMQFS010000039.1 | GCA947000095_01778 | CDS | open | 23118-24164 | _na 348_aa | DUF4831 domain-containing protein | |
| 3538 | CAMQFS010000039.1 | GCA947000095_01779 | CDS | open | 24290-25300 | _na 336_aa | fba | class II fructose-bisphosphate aldolase |
| 3539 | CAMQFS010000039.1 | GCA947000095_01758 | gene | open | 864-1163 | |||
| 3540 | CAMQFS010000039.1 | GCA947000095_01759 | gene | open | 1387-4140 | |||
| 3541 | CAMQFS010000039.1 | GCA947000095_01760 | gene | open | 5147-5896 | porT | ||
| 3542 | CAMQFS010000039.1 | GCA947000095_01761 | gene | open | 5951-6796 | |||
| 3543 | CAMQFS010000039.1 | GCA947000095_01762 | gene | open | 6824-7588 | |||
| 3544 | CAMQFS010000039.1 | GCA947000095_01763 | gene | open | 8133-8507 | rplS | ||
| 3545 | CAMQFS010000039.1 | GCA947000095_01764 | gene | open | 8567-8869 | |||
| 3546 | CAMQFS010000039.1 | GCA947000095_01765 | gene | open | 9241-10422 | |||
| 3547 | CAMQFS010000039.1 | GCA947000095_01766 | gene | open | 10481-10702 | |||
| 3548 | CAMQFS010000039.1 | GCA947000095_01767 | gene | open | 10719-11879 | |||
| 3549 | CAMQFS010000039.1 | GCA947000095_01768 | gene | open | 11921-12778 | pgeF | ||
| 3550 | CAMQFS010000039.1 | GCA947000095_01769 | gene | open | 12720-13886 | obgE | ||
| 3551 | CAMQFS010000039.1 | GCA947000095_01770 | gene | open | 13986-14558 | |||
| 3552 | CAMQFS010000039.1 | GCA947000095_01771 | gene | open | 14555-15094 | hpt | ||
| 3553 | CAMQFS010000039.1 | GCA947000095_01772 | gene | open | 15184-15294 | |||
| 3554 | CAMQFS010000039.1 | GCA947000095_01773 | gene | open | 16165-20766 | cTD-A | ||
| 3555 | CAMQFS010000039.1 | GCA947000095_01774 | gene | open | 20875-21039 | |||
| 3556 | CAMQFS010000039.1 | GCA947000095_01775 | gene | open | 21036-21149 | |||
| 3557 | CAMQFS010000039.1 | GCA947000095_01776 | gene | open | 21320-21448 | |||
| 3558 | CAMQFS010000039.1 | GCA947000095_01777 | gene | open | 21556-23079 | |||
| 3559 | CAMQFS010000039.1 | GCA947000095_01778 | gene | open | 23118-24164 | |||
| 3560 | CAMQFS010000039.1 | GCA947000095_01779 | gene | open | 24290-25300 | fba | ||
| 3561 | CAMQFS010000040.1 | GCA947000095_01780 | CDS | open | 1324-3081 | _na 585_aa | Rhs element Vgr protein | |
| 3562 | CAMQFS010000040.1 | GCA947000095_01781 | CDS | open | 3180-3578 | _na 132_aa | Type VI secretion system needle protein Hcp | |
| 3563 | CAMQFS010000040.1 | GCA947000095_01782 | CDS | open | 3864-4637 | _na 257_aa | DUF5457 domain-containing protein | |
| 3564 | CAMQFS010000040.1 | GCA947000095_01783 | CDS | open | 4641-7001 | _na 786_aa | hypothetical protein | |
| 3565 | CAMQFS010000040.1 | GCA947000095_01784 | CDS | open | 6956-7906 | _na 316_aa | PKD domain-containing protein | |
| 3566 | CAMQFS010000040.1 | GCA947000095_01785 | CDS | open | 7909-8361 | _na 150_aa | tssO | Type VI secretion system transmembrane protein TssO |
| 3567 | CAMQFS010000040.1 | GCA947000095_01786 | CDS | open | 8345-8851 | _na 168_aa | DUF4363 domain-containing protein | |
| 3568 | CAMQFS010000040.1 | GCA947000095_01787 | CDS | open | 8856-10019 | _na 387_aa | Type VI secretion protein%2C VC_A0114 family | |
| 3569 | CAMQFS010000040.1 | GCA947000095_01788 | CDS | open | 9988-10878 | _na 296_aa | tssN | Type VI secretion system transmembrane protein TssN |
| 3570 | CAMQFS010000040.1 | GCA947000095_01789 | CDS | open | 10897-11829 | _na 310_aa | Restriction endonuclease | |
| 3571 | CAMQFS010000040.1 | GCA947000095_01790 | CDS | open | 11808-14258 | _na 816_aa | clpA | ATP-dependent Clp protease ATP-binding subunit |
| 3572 | CAMQFS010000040.1 | GCA947000095_01791 | CDS | open | 14255-16039 | _na 594_aa | Baseplate protein J-like domain-containing protein | |
| 3573 | CAMQFS010000040.1 | GCA947000095_01792 | CDS | open | 16051-16473 | _na 140_aa | Gene 25-like lysozyme | |
| 3574 | CAMQFS010000040.1 | GCA947000095_01793 | CDS | open | 16724-18133 | _na 469_aa | DUF3945 domain-containing protein | |
| 3575 | CAMQFS010000040.1 | GCA947000095_01794 | CDS | open | 18155-20236 | _na 693_aa | DNA topoisomerase | |
| 3576 | CAMQFS010000040.1 | GCA947000095_01795 | CDS | open | 20328-24857 | _na 1509_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3577 | CAMQFS010000040.1 | GCA947000095_01780 | gene | open | 1324-3081 | |||
| 3578 | CAMQFS010000040.1 | GCA947000095_01781 | gene | open | 3180-3578 | |||
| 3579 | CAMQFS010000040.1 | GCA947000095_01782 | gene | open | 3864-4637 | |||
| 3580 | CAMQFS010000040.1 | GCA947000095_01783 | gene | open | 4641-7001 | |||
| 3581 | CAMQFS010000040.1 | GCA947000095_01784 | gene | open | 6956-7906 | |||
| 3582 | CAMQFS010000040.1 | GCA947000095_01785 | gene | open | 7909-8361 | tssO | ||
| 3583 | CAMQFS010000040.1 | GCA947000095_01786 | gene | open | 8345-8851 | |||
| 3584 | CAMQFS010000040.1 | GCA947000095_01787 | gene | open | 8856-10019 | |||
| 3585 | CAMQFS010000040.1 | GCA947000095_01788 | gene | open | 9988-10878 | tssN | ||
| 3586 | CAMQFS010000040.1 | GCA947000095_01789 | gene | open | 10897-11829 | |||
| 3587 | CAMQFS010000040.1 | GCA947000095_01790 | gene | open | 11808-14258 | clpA | ||
| 3588 | CAMQFS010000040.1 | GCA947000095_01791 | gene | open | 14255-16039 | |||
| 3589 | CAMQFS010000040.1 | GCA947000095_01792 | gene | open | 16051-16473 | |||
| 3590 | CAMQFS010000040.1 | GCA947000095_01793 | gene | open | 16724-18133 | |||
| 3591 | CAMQFS010000040.1 | GCA947000095_01794 | gene | open | 18155-20236 | |||
| 3592 | CAMQFS010000040.1 | GCA947000095_01795 | gene | open | 20328-24857 | |||
| 3593 | CAMQFS010000041.1 | regulatory_region | open | 18621-18655 | DUF805b RNA | |||
| 3594 | CAMQFS010000041.1 | GCA947000095_01796 | CDS | open | 7-4590 | _na 1527_aa | Cell wall-associated polypeptide CWBP200 | |
| 3595 | CAMQFS010000041.1 | GCA947000095_01797 | CDS | open | 4664-5533 | _na 289_aa | hypothetical protein | |
| 3596 | CAMQFS010000041.1 | GCA947000095_01798 | CDS | open | 6194-8395 | _na 733_aa | RHS repeat-associated core domain-containing protein | |
| 3597 | CAMQFS010000041.1 | GCA947000095_01799 | CDS | open | 8467-8682 | _na 71_aa | hypothetical protein | |
| 3598 | CAMQFS010000041.1 | GCA947000095_01800 | CDS | open | 8779-10302 | _na 507_aa | hypothetical protein | |
| 3599 | CAMQFS010000041.1 | GCA947000095_01801 | CDS | open | 10312-10707 | _na 131_aa | hypothetical protein | |
| 3600 | CAMQFS010000041.1 | GCA947000095_01802 | CDS | open | 11052-11810 | _na 252_aa | hypothetical protein | |
| 3601 | CAMQFS010000041.1 | GCA947000095_01803 | CDS | open | 11874-14066 | _na 730_aa | hypothetical protein | |
| 3602 | CAMQFS010000041.1 | GCA947000095_01804 | CDS | open | 14913-15191 | _na 92_aa | hypothetical protein | |
| 3603 | CAMQFS010000041.1 | GCA947000095_01805 | CDS | open | 15295-15456 | _na 53_aa | hypothetical protein | |
| 3604 | CAMQFS010000041.1 | GCA947000095_01806 | CDS | open | 15763-18621 | _na 952_aa | lanM | type 2 lanthipeptide synthetase LanM |
| 3605 | CAMQFS010000041.1 | GCA947000095_01807 | CDS | open | 18678-18902 | _na 74_aa | Bacteriocin | |
| 3606 | CAMQFS010000041.1 | GCA947000095_01808 | CDS | open | 19060-21120 | _na 686_aa | Outer membrane receptor protein involved in Fe transport | |
| 3607 | CAMQFS010000041.1 | GCA947000095_01809 | CDS | open | 21255-23438 | _na 727_aa | peptidase domain-containing ABC transporter | |
| 3608 | CAMQFS010000041.1 | GCA947000095_01810 | CDS | open | 23440-23931 | _na 163_aa | hlyD | HlyD family secretion protein |
| 3609 | CAMQFS010000041.1 | GCA947000095_01811 | CDS | open | 23948-24367 | _na 139_aa | Bacterial mobilisation domain-containing protein | |
| 3610 | CAMQFS010000041.1 | GCA947000095_01796 | gene | open | 7-4590 | |||
| 3611 | CAMQFS010000041.1 | GCA947000095_01797 | gene | open | 4664-5533 | |||
| 3612 | CAMQFS010000041.1 | GCA947000095_01798 | gene | open | 6194-8395 | |||
| 3613 | CAMQFS010000041.1 | GCA947000095_01799 | gene | open | 8467-8682 | |||
| 3614 | CAMQFS010000041.1 | GCA947000095_01800 | gene | open | 8779-10302 | |||
| 3615 | CAMQFS010000041.1 | GCA947000095_01801 | gene | open | 10312-10707 | |||
| 3616 | CAMQFS010000041.1 | GCA947000095_01802 | gene | open | 11052-11810 | |||
| 3617 | CAMQFS010000041.1 | GCA947000095_01803 | gene | open | 11874-14066 | |||
| 3618 | CAMQFS010000041.1 | GCA947000095_01804 | gene | open | 14913-15191 | |||
| 3619 | CAMQFS010000041.1 | GCA947000095_01805 | gene | open | 15295-15456 | |||
| 3620 | CAMQFS010000041.1 | GCA947000095_01806 | gene | open | 15763-18621 | lanM | ||
| 3621 | CAMQFS010000041.1 | GCA947000095_01807 | gene | open | 18678-18902 | |||
| 3622 | CAMQFS010000041.1 | GCA947000095_01808 | gene | open | 19060-21120 | |||
| 3623 | CAMQFS010000041.1 | GCA947000095_01809 | gene | open | 21255-23438 | |||
| 3624 | CAMQFS010000041.1 | GCA947000095_01810 | gene | open | 23440-23931 | hlyD | ||
| 3625 | CAMQFS010000041.1 | GCA947000095_01811 | gene | open | 23948-24367 | |||
| 3626 | CAMQFS010000042.1 | GCA947000095_01812 | CDS | open | 94-1035 | _na 313_aa | hypothetical protein | |
| 3627 | CAMQFS010000042.1 | GCA947000095_01813 | CDS | open | 1081-1563 | _na 160_aa | Acetyltransferase%2C GNAT family | |
| 3628 | CAMQFS010000042.1 | GCA947000095_01814 | CDS | open | 1718-2188 | _na 156_aa | Ribonuclease H | |
| 3629 | CAMQFS010000042.1 | GCA947000095_01815 | CDS | open | 2203-4023 | _na 606_aa | argS | arginine--tRNA ligase |
| 3630 | CAMQFS010000042.1 | GCA947000095_01816 | CDS | open | 4421-4873 | _na 150_aa | Septicolysin | |
| 3631 | CAMQFS010000042.1 | GCA947000095_01817 | CDS | open | 5099-5614 | _na 171_aa | ves | HutD-family protein |
| 3632 | CAMQFS010000042.1 | GCA947000095_01818 | CDS | open | 5681-5848 | _na 55_aa | hypothetical protein | |
| 3633 | CAMQFS010000042.1 | GCA947000095_01819 | CDS | open | 5893-7068 | _na 391_aa | Thioredoxin domain-containing protein | |
| 3634 | CAMQFS010000042.1 | GCA947000095_01820 | CDS | open | 7165-8244 | _na 359_aa | 1-phosphatidylinositol phosphodiesterase | |
| 3635 | CAMQFS010000042.1 | GCA947000095_01821 | CDS | open | 8276-9100 | _na 274_aa | BD-FAE-like domain-containing protein | |
| 3636 | CAMQFS010000042.1 | GCA947000095_01822 | CDS | open | 9981-11210 | _na 409_aa | Nucleoside transporter/FeoB GTPase Gate domain-containing protein | |
| 3637 | CAMQFS010000042.1 | GCA947000095_01823 | CDS | open | 11426-12928 | _na 500_aa | Polysaccharide biosynthesis protein | |
| 3638 | CAMQFS010000042.1 | GCA947000095_01824 | CDS | open | 12934-15045 | _na 703_aa | Dipeptidyl-peptidase | |
| 3639 | CAMQFS010000042.1 | GCA947000095_01825 | CDS | open | 15254-15733 | _na 159_aa | DUF4252 domain-containing protein | |
| 3640 | CAMQFS010000042.1 | GCA947000095_01826 | CDS | open | 15768-16277 | _na 169_aa | Sigma-70 region 2 | |
| 3641 | CAMQFS010000042.1 | GCA947000095_01827 | CDS | open | 16267-16737 | _na 156_aa | Anti-sigma factor | |
| 3642 | CAMQFS010000042.1 | GCA947000095_01828 | CDS | open | 16724-17203 | _na 159_aa | DUF4252 domain-containing protein | |
| 3643 | CAMQFS010000042.1 | GCA947000095_01829 | CDS | open | 17490-19817 | _na 775_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 3644 | CAMQFS010000042.1 | GCA947000095_01830 | CDS | open | 20668-21879 | _na 403_aa | Glycosyl hydrolase family 25 | |
| 3645 | CAMQFS010000042.1 | GCA947000095_01831 | CDS | open | 21876-22886 | _na 336_aa | DUF4369 domain-containing protein | |
| 3646 | CAMQFS010000042.1 | GCA947000095_01832 | CDS | open | 22989-23165 | _na 58_aa | hypothetical protein | |
| 3647 | CAMQFS010000042.1 | GCA947000095_01833 | CDS | open | 23249-23341 | _na 30_aa | hypothetical protein | |
| 3648 | CAMQFS010000042.1 | GCA947000095_01812 | gene | open | 94-1035 | |||
| 3649 | CAMQFS010000042.1 | GCA947000095_01813 | gene | open | 1081-1563 | |||
| 3650 | CAMQFS010000042.1 | GCA947000095_01814 | gene | open | 1718-2188 | |||
| 3651 | CAMQFS010000042.1 | GCA947000095_01815 | gene | open | 2203-4023 | argS | ||
| 3652 | CAMQFS010000042.1 | GCA947000095_01816 | gene | open | 4421-4873 | |||
| 3653 | CAMQFS010000042.1 | GCA947000095_01817 | gene | open | 5099-5614 | ves | ||
| 3654 | CAMQFS010000042.1 | GCA947000095_01818 | gene | open | 5681-5848 | |||
| 3655 | CAMQFS010000042.1 | GCA947000095_01819 | gene | open | 5893-7068 | |||
| 3656 | CAMQFS010000042.1 | GCA947000095_01820 | gene | open | 7165-8244 | |||
| 3657 | CAMQFS010000042.1 | GCA947000095_01821 | gene | open | 8276-9100 | |||
| 3658 | CAMQFS010000042.1 | GCA947000095_01822 | gene | open | 9981-11210 | |||
| 3659 | CAMQFS010000042.1 | GCA947000095_01823 | gene | open | 11426-12928 | |||
| 3660 | CAMQFS010000042.1 | GCA947000095_01824 | gene | open | 12934-15045 | |||
| 3661 | CAMQFS010000042.1 | GCA947000095_01825 | gene | open | 15254-15733 | |||
| 3662 | CAMQFS010000042.1 | GCA947000095_01826 | gene | open | 15768-16277 | |||
| 3663 | CAMQFS010000042.1 | GCA947000095_01827 | gene | open | 16267-16737 | |||
| 3664 | CAMQFS010000042.1 | GCA947000095_01828 | gene | open | 16724-17203 | |||
| 3665 | CAMQFS010000042.1 | GCA947000095_01829 | gene | open | 17490-19817 | pnp | ||
| 3666 | CAMQFS010000042.1 | GCA947000095_01830 | gene | open | 20668-21879 | |||
| 3667 | CAMQFS010000042.1 | GCA947000095_01831 | gene | open | 21876-22886 | |||
| 3668 | CAMQFS010000042.1 | GCA947000095_01832 | gene | open | 22989-23165 | |||
| 3669 | CAMQFS010000042.1 | GCA947000095_01833 | gene | open | 23249-23341 | |||
| 3670 | CAMQFS010000043.1 | GCA947000095_01834 | CDS | open | 332-1324 | _na 330_aa | Cell surface protein | |
| 3671 | CAMQFS010000043.1 | GCA947000095_01835 | CDS | open | 1417-2523 | _na 368_aa | DUF4876 domain-containing protein | |
| 3672 | CAMQFS010000043.1 | GCA947000095_01836 | CDS | open | 2582-3967 | _na 461_aa | Lipoprotein | |
| 3673 | CAMQFS010000043.1 | GCA947000095_01837 | CDS | open | 4025-5482 | _na 485_aa | Lipoprotein | |
| 3674 | CAMQFS010000043.1 | GCA947000095_01838 | CDS | open | 5649-7154 | _na 501_aa | Lipoprotein | |
| 3675 | CAMQFS010000043.1 | GCA947000095_01839 | CDS | open | 7159-9669 | _na 836_aa | TonB-dependent receptor | |
| 3676 | CAMQFS010000043.1 | GCA947000095_01840 | CDS | open | 9947-11149 | _na 400_aa | Transporter%2C major facilitator family protein | |
| 3677 | CAMQFS010000043.1 | GCA947000095_01841 | CDS | open | 11531-11785 | _na 84_aa | hypothetical protein | |
| 3678 | CAMQFS010000043.1 | GCA947000095_01842 | CDS | open | 11858-13147 | _na 429_aa | Lipocalin-like domain-containing protein | |
| 3679 | CAMQFS010000043.1 | GCA947000095_01843 | CDS | open | 13193-13444 | _na 83_aa | hypothetical protein | |
| 3680 | CAMQFS010000043.1 | GCA947000095_01844 | CDS | open | 13505-14959 | _na 484_aa | cpdA | Putative phosphohydrolase |
| 3681 | CAMQFS010000043.1 | GCA947000095_01845 | CDS | open | 14990-15817 | _na 275_aa | nagC | ROK family transcriptional regulator |
| 3682 | CAMQFS010000043.1 | GCA947000095_01846 | CDS | open | 15856-17526 | _na 556_aa | gDB1 | Mannosylglycerate hydrolase MGH1-like glycoside hydrolase domain-containing protein |
| 3683 | CAMQFS010000043.1 | GCA947000095_01847 | CDS | open | 17615-18742 | _na 375_aa | phoA | Alkaline phosphatase 4 |
| 3684 | CAMQFS010000043.1 | GCA947000095_01848 | CDS | open | 18848-20485 | _na 545_aa | RagB/SusD family protein | |
| 3685 | CAMQFS010000043.1 | GCA947000095_01849 | CDS | open | 20512-23697 | _na 1061_aa | btuB | TonB-linked outer membrane protein%2C SusC/RagA family |
| 3686 | CAMQFS010000043.1 | GCA947000095_01834 | gene | open | 332-1324 | |||
| 3687 | CAMQFS010000043.1 | GCA947000095_01835 | gene | open | 1417-2523 | |||
| 3688 | CAMQFS010000043.1 | GCA947000095_01836 | gene | open | 2582-3967 | |||
| 3689 | CAMQFS010000043.1 | GCA947000095_01837 | gene | open | 4025-5482 | |||
| 3690 | CAMQFS010000043.1 | GCA947000095_01838 | gene | open | 5649-7154 | |||
| 3691 | CAMQFS010000043.1 | GCA947000095_01839 | gene | open | 7159-9669 | |||
| 3692 | CAMQFS010000043.1 | GCA947000095_01840 | gene | open | 9947-11149 | |||
| 3693 | CAMQFS010000043.1 | GCA947000095_01841 | gene | open | 11531-11785 | |||
| 3694 | CAMQFS010000043.1 | GCA947000095_01842 | gene | open | 11858-13147 | |||
| 3695 | CAMQFS010000043.1 | GCA947000095_01843 | gene | open | 13193-13444 | |||
| 3696 | CAMQFS010000043.1 | GCA947000095_01844 | gene | open | 13505-14959 | cpdA | ||
| 3697 | CAMQFS010000043.1 | GCA947000095_01845 | gene | open | 14990-15817 | nagC | ||
| 3698 | CAMQFS010000043.1 | GCA947000095_01846 | gene | open | 15856-17526 | gDB1 | ||
| 3699 | CAMQFS010000043.1 | GCA947000095_01847 | gene | open | 17615-18742 | phoA | ||
| 3700 | CAMQFS010000043.1 | GCA947000095_01848 | gene | open | 18848-20485 | |||
| 3701 | CAMQFS010000043.1 | GCA947000095_01849 | gene | open | 20512-23697 | btuB | ||
| 3702 | CAMQFS010000044.1 | GCA947000095_01850 | CDS | open | 75-4580 | _na 1501_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3703 | CAMQFS010000044.1 | GCA947000095_01851 | CDS | open | 4672-5259 | _na 195_aa | DNA topoisomerase type IA central domain-containing protein | |
| 3704 | CAMQFS010000044.1 | GCA947000095_01852 | CDS | open | 5302-5820 | _na 172_aa | DNA topoisomerase type IA DNA-binding domain-containing protein | |
| 3705 | CAMQFS010000044.1 | GCA947000095_01853 | CDS | open | 6114-7334 | _na 406_aa | xerD | Tyr recombinase domain-containing protein |
| 3706 | CAMQFS010000044.1 | GCA947000095_01854 | CDS | open | 7338-8600 | _na 420_aa | xerD | Tyrosine recombinase XerD |
| 3707 | CAMQFS010000044.1 | GCA947000095_01855 | CDS | open | 8621-9109 | _na 162_aa | DUF1896 domain-containing protein | |
| 3708 | CAMQFS010000044.1 | GCA947000095_01856 | CDS | open | 9792-10061 | _na 89_aa | Helix-turn-helix domain-containing protein | |
| 3709 | CAMQFS010000044.1 | GCA947000095_01857 | CDS | open | 10082-10393 | _na 103_aa | Helix-turn-helix domain-containing protein | |
| 3710 | CAMQFS010000044.1 | GCA947000095_01858 | CDS | open | 10756-11181 | _na 141_aa | Bacterial mobilisation domain-containing protein | |
| 3711 | CAMQFS010000044.1 | GCA947000095_01859 | CDS | open | 11198-11680 | _na 160_aa | hlyD | HlyD family secretion protein |
| 3712 | CAMQFS010000044.1 | GCA947000095_01860 | CDS | open | 11682-13907 | _na 741_aa | ABC transporter ATP-binding protein | |
| 3713 | CAMQFS010000044.1 | GCA947000095_01861 | CDS | open | 13914-14885 | _na 323_aa | hypothetical protein | |
| 3714 | CAMQFS010000044.1 | GCA947000095_01862 | CDS | open | 14869-15111 | _na 80_aa | hypothetical protein | |
| 3715 | CAMQFS010000044.1 | GCA947000095_01863 | CDS | open | 15075-16049 | _na 324_aa | gwsG | grasp-with-spasm system ATP-grasp peptide maturase |
| 3716 | CAMQFS010000044.1 | GCA947000095_01864 | CDS | open | 16128-16346 | _na 72_aa | Bacteriocin-like protein | |
| 3717 | CAMQFS010000044.1 | GCA947000095_01865 | CDS | open | 16555-17502 | _na 315_aa | IS30 family transposase | |
| 3718 | CAMQFS010000044.1 | GCA947000095_01866 | CDS | open | 17531-19723 | _na 730_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3719 | CAMQFS010000044.1 | GCA947000095_01867 | CDS | open | 20018-20977 | _na 319_aa | Omega-protein | |
| 3720 | CAMQFS010000044.1 | GCA947000095_01868 | CDS | open | 20999-22402 | _na 467_aa | DUF3945 domain-containing protein | |
| 3721 | CAMQFS010000044.1 | GCA947000095_01869 | CDS | open | 22639-23103 | _na 154_aa | hypothetical protein | |
| 3722 | CAMQFS010000044.1 | GCA947000095_01850 | gene | open | 75-4580 | |||
| 3723 | CAMQFS010000044.1 | GCA947000095_01851 | gene | open | 4672-5259 | |||
| 3724 | CAMQFS010000044.1 | GCA947000095_01852 | gene | open | 5302-5820 | |||
| 3725 | CAMQFS010000044.1 | GCA947000095_01853 | gene | open | 6114-7334 | xerD | ||
| 3726 | CAMQFS010000044.1 | GCA947000095_01854 | gene | open | 7338-8600 | xerD | ||
| 3727 | CAMQFS010000044.1 | GCA947000095_01855 | gene | open | 8621-9109 | |||
| 3728 | CAMQFS010000044.1 | GCA947000095_01856 | gene | open | 9792-10061 | |||
| 3729 | CAMQFS010000044.1 | GCA947000095_01857 | gene | open | 10082-10393 | |||
| 3730 | CAMQFS010000044.1 | GCA947000095_01858 | gene | open | 10756-11181 | |||
| 3731 | CAMQFS010000044.1 | GCA947000095_01859 | gene | open | 11198-11680 | hlyD | ||
| 3732 | CAMQFS010000044.1 | GCA947000095_01860 | gene | open | 11682-13907 | |||
| 3733 | CAMQFS010000044.1 | GCA947000095_01861 | gene | open | 13914-14885 | |||
| 3734 | CAMQFS010000044.1 | GCA947000095_01862 | gene | open | 14869-15111 | |||
| 3735 | CAMQFS010000044.1 | GCA947000095_01863 | gene | open | 15075-16049 | gwsG | ||
| 3736 | CAMQFS010000044.1 | GCA947000095_01864 | gene | open | 16128-16346 | |||
| 3737 | CAMQFS010000044.1 | GCA947000095_01865 | gene | open | 16555-17502 | |||
| 3738 | CAMQFS010000044.1 | GCA947000095_01866 | gene | open | 17531-19723 | |||
| 3739 | CAMQFS010000044.1 | GCA947000095_01867 | gene | open | 20018-20977 | |||
| 3740 | CAMQFS010000044.1 | GCA947000095_01868 | gene | open | 20999-22402 | |||
| 3741 | CAMQFS010000044.1 | GCA947000095_01869 | gene | open | 22639-23103 | |||
| 3742 | CAMQFS010000045.1 | GCA947000095_01870 | CDS | open | 388-7974 | _na 2528_aa | sprA | cell surface protein SprA |
| 3743 | CAMQFS010000045.1 | GCA947000095_01871 | CDS | open | 8017-8631 | _na 204_aa | ruvA | Holliday junction branch migration protein RuvA |
| 3744 | CAMQFS010000045.1 | GCA947000095_01872 | CDS | open | 8990-9952 | _na 320_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 3745 | CAMQFS010000045.1 | GCA947000095_01873 | CDS | open | 9990-11447 | _na 485_aa | trkH | Potassium uptake protein%2C TrkH family |
| 3746 | CAMQFS010000045.1 | GCA947000095_01874 | CDS | open | 11467-12810 | _na 447_aa | trkA | Trk system potassium transporter TrkA |
| 3747 | CAMQFS010000045.1 | GCA947000095_01875 | CDS | open | 12846-14783 | _na 645_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 3748 | CAMQFS010000045.1 | GCA947000095_01876 | CDS | open | 14803-16278 | _na 491_aa | Aminopeptidase | |
| 3749 | CAMQFS010000045.1 | GCA947000095_01877 | CDS | open | 16291-18753 | _na 820_aa | Peptidase%2C S9A/B/C family%2C catalytic domain protein | |
| 3750 | CAMQFS010000045.1 | GCA947000095_01878 | CDS | open | 18717-18896 | _na 59_aa | hypothetical protein | |
| 3751 | CAMQFS010000045.1 | GCA947000095_01879 | CDS | open | 18904-19803 | _na 299_aa | diaminopimelate dehydrogenase | |
| 3752 | CAMQFS010000045.1 | GCA947000095_01880 | CDS | open | 20058-21053 | _na 331_aa | DUF4435 domain-containing protein | |
| 3753 | CAMQFS010000045.1 | GCA947000095_01881 | CDS | open | 21085-21906 | _na 273_aa | AAA+ ATPase domain-containing protein | |
| 3754 | CAMQFS010000045.1 | GCA947000095_01870 | gene | open | 388-7974 | sprA | ||
| 3755 | CAMQFS010000045.1 | GCA947000095_01871 | gene | open | 8017-8631 | ruvA | ||
| 3756 | CAMQFS010000045.1 | GCA947000095_01872 | gene | open | 8990-9952 | manA | ||
| 3757 | CAMQFS010000045.1 | GCA947000095_01873 | gene | open | 9990-11447 | trkH | ||
| 3758 | CAMQFS010000045.1 | GCA947000095_01874 | gene | open | 11467-12810 | trkA | ||
| 3759 | CAMQFS010000045.1 | GCA947000095_01875 | gene | open | 12846-14783 | dxs | ||
| 3760 | CAMQFS010000045.1 | GCA947000095_01876 | gene | open | 14803-16278 | |||
| 3761 | CAMQFS010000045.1 | GCA947000095_01877 | gene | open | 16291-18753 | |||
| 3762 | CAMQFS010000045.1 | GCA947000095_01878 | gene | open | 18717-18896 | |||
| 3763 | CAMQFS010000045.1 | GCA947000095_01879 | gene | open | 18904-19803 | |||
| 3764 | CAMQFS010000045.1 | GCA947000095_01880 | gene | open | 20058-21053 | |||
| 3765 | CAMQFS010000045.1 | GCA947000095_01881 | gene | open | 21085-21906 | |||
| 3766 | CAMQFS010000046.1 | GCA947000095_01882 | CDS | open | 759-1295 | _na 178_aa | Leucine rich repeat-containing protein | |
| 3767 | CAMQFS010000046.1 | GCA947000095_01883 | CDS | open | 1897-2658 | _na 253_aa | Calcineurin-like phosphoesterase | |
| 3768 | CAMQFS010000046.1 | GCA947000095_01884 | CDS | open | 2655-3440 | _na 261_aa | Nucleotidyltransferase | |
| 3769 | CAMQFS010000046.1 | GCA947000095_01885 | CDS | open | 3428-4390 | _na 320_aa | marR | MarR family transcriptional regulator |
| 3770 | CAMQFS010000046.1 | GCA947000095_01886 | CDS | open | 4698-5018 | _na 106_aa | HTH cro/C1-type domain-containing protein | |
| 3771 | CAMQFS010000046.1 | GCA947000095_01887 | CDS | open | 5067-9542 | _na 1491_aa | hypothetical protein | |
| 3772 | CAMQFS010000046.1 | GCA947000095_01888 | CDS | open | 9554-10558 | _na 334_aa | hypothetical protein | |
| 3773 | CAMQFS010000046.1 | GCA947000095_01889 | CDS | open | 10577-11086 | _na 169_aa | hypothetical protein | |
| 3774 | CAMQFS010000046.1 | GCA947000095_01890 | CDS | open | 11477-11797 | _na 106_aa | Helix-turn-helix domain-containing protein | |
| 3775 | CAMQFS010000046.1 | GCA947000095_01891 | CDS | open | 11801-13057 | _na 418_aa | hipA | Serine/threonine-protein kinase HipA |
| 3776 | CAMQFS010000046.1 | GCA947000095_01892 | CDS | open | 13215-13691 | _na 158_aa | Nitroreductase family protein | |
| 3777 | CAMQFS010000046.1 | GCA947000095_01893 | CDS | open | 14012-15946 | _na 644_aa | DUF262 domain-containing protein | |
| 3778 | CAMQFS010000046.1 | GCA947000095_01894 | CDS | open | 16165-17067 | _na 300_aa | PD-(D/E)XK nuclease-like domain-containing protein | |
| 3779 | CAMQFS010000046.1 | GCA947000095_01895 | CDS | open | 17077-17475 | _na 132_aa | Peptidyl-prolyl cis-trans isomerase | |
| 3780 | CAMQFS010000046.1 | GCA947000095_01896 | CDS | open | 17472-17954 | _na 160_aa | N-acetyltransferase domain-containing protein | |
| 3781 | CAMQFS010000046.1 | GCA947000095_01897 | CDS | open | 17964-18311 | _na 115_aa | putative DNA-binding protein%2C MmcQ/YjbR family | |
| 3782 | CAMQFS010000046.1 | GCA947000095_01898 | CDS | open | 18554-19249 | _na 231_aa | DUF1810 domain-containing protein | |
| 3783 | CAMQFS010000046.1 | GCA947000095_01899 | CDS | open | 19463-19795 | _na 110_aa | DUF6717 domain-containing protein | |
| 3784 | CAMQFS010000046.1 | GCA947000095_01900 | CDS | open | 19822-21771 | _na 649_aa | hypothetical protein | |
| 3785 | CAMQFS010000046.1 | GCA947000095_01901 | CDS | open | 21790-21951 | _na 53_aa | hypothetical protein | |
| 3786 | CAMQFS010000046.1 | GCA947000095_01902 | CDS | open | 21930-22718 | _na 262_aa | hypothetical protein | |
| 3787 | CAMQFS010000046.1 | GCA947000095_01882 | gene | open | 759-1295 | |||
| 3788 | CAMQFS010000046.1 | GCA947000095_01883 | gene | open | 1897-2658 | |||
| 3789 | CAMQFS010000046.1 | GCA947000095_01884 | gene | open | 2655-3440 | |||
| 3790 | CAMQFS010000046.1 | GCA947000095_01885 | gene | open | 3428-4390 | marR | ||
| 3791 | CAMQFS010000046.1 | GCA947000095_01886 | gene | open | 4698-5018 | |||
| 3792 | CAMQFS010000046.1 | GCA947000095_01887 | gene | open | 5067-9542 | |||
| 3793 | CAMQFS010000046.1 | GCA947000095_01888 | gene | open | 9554-10558 | |||
| 3794 | CAMQFS010000046.1 | GCA947000095_01889 | gene | open | 10577-11086 | |||
| 3795 | CAMQFS010000046.1 | GCA947000095_01890 | gene | open | 11477-11797 | |||
| 3796 | CAMQFS010000046.1 | GCA947000095_01891 | gene | open | 11801-13057 | hipA | ||
| 3797 | CAMQFS010000046.1 | GCA947000095_01892 | gene | open | 13215-13691 | |||
| 3798 | CAMQFS010000046.1 | GCA947000095_01893 | gene | open | 14012-15946 | |||
| 3799 | CAMQFS010000046.1 | GCA947000095_01894 | gene | open | 16165-17067 | |||
| 3800 | CAMQFS010000046.1 | GCA947000095_01895 | gene | open | 17077-17475 | |||
| 3801 | CAMQFS010000046.1 | GCA947000095_01896 | gene | open | 17472-17954 | |||
| 3802 | CAMQFS010000046.1 | GCA947000095_01897 | gene | open | 17964-18311 | |||
| 3803 | CAMQFS010000046.1 | GCA947000095_01898 | gene | open | 18554-19249 | |||
| 3804 | CAMQFS010000046.1 | GCA947000095_01899 | gene | open | 19463-19795 | |||
| 3805 | CAMQFS010000046.1 | GCA947000095_01900 | gene | open | 19822-21771 | |||
| 3806 | CAMQFS010000046.1 | GCA947000095_01901 | gene | open | 21790-21951 | |||
| 3807 | CAMQFS010000046.1 | GCA947000095_01902 | gene | open | 21930-22718 | |||
| 3808 | CAMQFS010000047.1 | GCA947000095_01903 | CDS | open | 273-434 | _na 53_aa | hypothetical protein | |
| 3809 | CAMQFS010000047.1 | GCA947000095_01904 | CDS | open | 574-990 | _na 138_aa | Death-on-curing family protein | |
| 3810 | CAMQFS010000047.1 | GCA947000095_01905 | CDS | open | 1040-2056 | _na 338_aa | DNA-binding protein | |
| 3811 | CAMQFS010000047.1 | GCA947000095_01906 | CDS | open | 2098-3570 | _na 490_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3812 | CAMQFS010000047.1 | GCA947000095_01907 | CDS | open | 3699-6056 | _na 785_aa | type I site-specific deoxyribonuclease | |
| 3813 | CAMQFS010000047.1 | GCA947000095_01908 | CDS | open | 6211-6330 | _na 39_aa | hypothetical protein | |
| 3814 | CAMQFS010000047.1 | GCA947000095_01909 | CDS | open | 6632-7297 | _na 221_aa | clpP | ATP-dependent Clp endopeptidase proteolytic subunit ClpP |
| 3815 | CAMQFS010000047.1 | GCA947000095_01910 | CDS | open | 7308-8552 | _na 414_aa | clpX | ATP-dependent Clp protease ATP-binding subunit ClpX |
| 3816 | CAMQFS010000047.1 | GCA947000095_01911 | CDS | open | 8680-10857 | _na 725_aa | recQ | DNA helicase RecQ |
| 3817 | CAMQFS010000047.1 | GCA947000095_01912 | CDS | open | 11031-12518 | _na 495_aa | guaB | IMP dehydrogenase |
| 3818 | CAMQFS010000047.1 | GCA947000095_01913 | CDS | open | 12568-14004 | _na 478_aa | Peptidylprolyl isomerase | |
| 3819 | CAMQFS010000047.1 | GCA947000095_01914 | CDS | open | 14045-15514 | _na 489_aa | PPIC-type PPIASE domain protein | |
| 3820 | CAMQFS010000047.1 | GCA947000095_01915 | CDS | open | 15523-17190 | _na 555_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 3821 | CAMQFS010000047.1 | GCA947000095_01916 | CDS | open | 17187-17483 | _na 98_aa | Ubiquitin carboxyl-hydrolase | |
| 3822 | CAMQFS010000047.1 | GCA947000095_01917 | CDS | open | 17498-19312 | _na 604_aa | mutL | DNA mismatch repair endonuclease MutL |
| 3823 | CAMQFS010000047.1 | GCA947000095_01918 | CDS | open | 19483-20637 | _na 384_aa | ompA | OmpA family protein |
| 3824 | CAMQFS010000047.1 | GCA947000095_01919 | CDS | open | 21048-22037 | _na 329_aa | trpS | tryptophan--tRNA ligase |
| 3825 | CAMQFS010000047.1 | GCA947000095_01903 | gene | open | 273-434 | |||
| 3826 | CAMQFS010000047.1 | GCA947000095_01904 | gene | open | 574-990 | |||
| 3827 | CAMQFS010000047.1 | GCA947000095_01905 | gene | open | 1040-2056 | |||
| 3828 | CAMQFS010000047.1 | GCA947000095_01906 | gene | open | 2098-3570 | |||
| 3829 | CAMQFS010000047.1 | GCA947000095_01907 | gene | open | 3699-6056 | |||
| 3830 | CAMQFS010000047.1 | GCA947000095_01908 | gene | open | 6211-6330 | |||
| 3831 | CAMQFS010000047.1 | GCA947000095_01909 | gene | open | 6632-7297 | clpP | ||
| 3832 | CAMQFS010000047.1 | GCA947000095_01910 | gene | open | 7308-8552 | clpX | ||
| 3833 | CAMQFS010000047.1 | GCA947000095_01911 | gene | open | 8680-10857 | recQ | ||
| 3834 | CAMQFS010000047.1 | GCA947000095_01912 | gene | open | 11031-12518 | guaB | ||
| 3835 | CAMQFS010000047.1 | GCA947000095_01913 | gene | open | 12568-14004 | |||
| 3836 | CAMQFS010000047.1 | GCA947000095_01914 | gene | open | 14045-15514 | |||
| 3837 | CAMQFS010000047.1 | GCA947000095_01915 | gene | open | 15523-17190 | lptC | ||
| 3838 | CAMQFS010000047.1 | GCA947000095_01916 | gene | open | 17187-17483 | |||
| 3839 | CAMQFS010000047.1 | GCA947000095_01917 | gene | open | 17498-19312 | mutL | ||
| 3840 | CAMQFS010000047.1 | GCA947000095_01918 | gene | open | 19483-20637 | ompA | ||
| 3841 | CAMQFS010000047.1 | GCA947000095_01919 | gene | open | 21048-22037 | trpS | ||
| 3842 | CAMQFS010000047.1 | GCA947000095_01920 | gene | open | 22166-22240 | trnV | ||
| 3843 | CAMQFS010000047.1 | GCA947000095_01920 | tRNA | open | 22166-22240 | trnV | tRNA-Val(tac) | |
| 3844 | CAMQFS010000048.1 | GCA947000095_01922 | CDS | open | 536-2530 | _na 664_aa | OPT family oligopeptide transporter | |
| 3845 | CAMQFS010000048.1 | GCA947000095_01923 | CDS | open | 2749-4887 | _na 712_aa | M6 family metalloprotease domain protein | |
| 3846 | CAMQFS010000048.1 | GCA947000095_01924 | CDS | open | 5017-7608 | _na 863_aa | clpB | ATP-dependent chaperone ClpB |
| 3847 | CAMQFS010000048.1 | GCA947000095_01925 | CDS | open | 7884-8180 | _na 98_aa | Helix-turn-helix transcriptional regulator | |
| 3848 | CAMQFS010000048.1 | GCA947000095_01926 | CDS | open | 8177-8527 | _na 116_aa | relE | Toxin RelE |
| 3849 | CAMQFS010000048.1 | GCA947000095_01927 | CDS | open | 9369-14894 | _na 1841_aa | Alpha-2-macroglobulin | |
| 3850 | CAMQFS010000048.1 | GCA947000095_01928 | CDS | open | 14891-15955 | _na 354_aa | HYDIN/VesB/CFA65-like Ig-like domain-containing protein | |
| 3851 | CAMQFS010000048.1 | GCA947000095_01929 | CDS | open | 15960-16826 | _na 288_aa | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase | |
| 3852 | CAMQFS010000048.1 | GCA947000095_01930 | CDS | open | 16823-17596 | _na 257_aa | thiF | Thiamine biosynthesis protein ThiF |
| 3853 | CAMQFS010000048.1 | GCA947000095_01931 | CDS | open | 17766-18746 | _na 326_aa | Iron ABC transporter | |
| 3854 | CAMQFS010000048.1 | GCA947000095_01932 | CDS | open | 19307-20101 | _na 264_aa | transposase | |
| 3855 | CAMQFS010000048.1 | GCA947000095_01922 | gene | open | 536-2530 | |||
| 3856 | CAMQFS010000048.1 | GCA947000095_01923 | gene | open | 2749-4887 | |||
| 3857 | CAMQFS010000048.1 | GCA947000095_01924 | gene | open | 5017-7608 | clpB | ||
| 3858 | CAMQFS010000048.1 | GCA947000095_01925 | gene | open | 7884-8180 | |||
| 3859 | CAMQFS010000048.1 | GCA947000095_01926 | gene | open | 8177-8527 | relE | ||
| 3860 | CAMQFS010000048.1 | GCA947000095_01927 | gene | open | 9369-14894 | |||
| 3861 | CAMQFS010000048.1 | GCA947000095_01928 | gene | open | 14891-15955 | |||
| 3862 | CAMQFS010000048.1 | GCA947000095_01929 | gene | open | 15960-16826 | |||
| 3863 | CAMQFS010000048.1 | GCA947000095_01930 | gene | open | 16823-17596 | thiF | ||
| 3864 | CAMQFS010000048.1 | GCA947000095_01931 | gene | open | 17766-18746 | |||
| 3865 | CAMQFS010000048.1 | GCA947000095_01932 | gene | open | 19307-20101 | |||
| 3866 | CAMQFS010000048.1 | GCA947000095_01921 | gene | open | 194-267 | trnP | ||
| 3867 | CAMQFS010000048.1 | GCA947000095_01933 | gene | open | 20653-20729 | trnD | ||
| 3868 | CAMQFS010000048.1 | GCA947000095_01934 | gene | open | 20758-20831 | trnD | ||
| 3869 | CAMQFS010000048.1 | GCA947000095_01921 | tRNA | open | 194-267 | trnP | tRNA-Pro(tgg) | |
| 3870 | CAMQFS010000048.1 | GCA947000095_01933 | tRNA | open | 20653-20729 | trnD | tRNA-Asp(gtc) | |
| 3871 | CAMQFS010000048.1 | GCA947000095_01934 | tRNA | open | 20758-20831 | trnD | tRNA-Asp(gtc) | |
| 3872 | CAMQFS010000049.1 | GCA947000095_01935 | CDS | open | 26-952 | _na 308_aa | Mannosyl-glycoprotein endo-beta-N-acetylglucosamidase-like domain-containing protein | |
| 3873 | CAMQFS010000049.1 | GCA947000095_01936 | CDS | open | 1047-1814 | _na 255_aa | DUF3945 domain-containing protein | |
| 3874 | CAMQFS010000049.1 | GCA947000095_01937 | CDS | open | 1962-3746 | _na 594_aa | DNA mismatch repair protein MutS-like N-terminal domain-containing protein | |
| 3875 | CAMQFS010000049.1 | GCA947000095_01938 | CDS | open | 3796-4023 | _na 75_aa | hypothetical protein | |
| 3876 | CAMQFS010000049.1 | GCA947000095_01939 | CDS | open | 4004-5323 | _na 439_aa | ardC | DNA primase TraC |
| 3877 | CAMQFS010000049.1 | GCA947000095_01940 | CDS | open | 5345-6544 | _na 399_aa | DUF3991 domain-containing protein | |
| 3878 | CAMQFS010000049.1 | GCA947000095_01941 | CDS | open | 6592-7263 | _na 223_aa | gldM | Gliding motility-associated protein GldM N-terminal domain-containing protein |
| 3879 | CAMQFS010000049.1 | GCA947000095_01942 | CDS | open | 7386-8183 | _na 265_aa | Topoisomerase DNA-binding C4 zinc finger domain protein | |
| 3880 | CAMQFS010000049.1 | GCA947000095_01943 | CDS | open | 8197-8700 | _na 167_aa | Lipoprotein | |
| 3881 | CAMQFS010000049.1 | GCA947000095_01944 | CDS | open | 8799-10052 | _na 417_aa | AAA domain-containing protein | |
| 3882 | CAMQFS010000049.1 | GCA947000095_01945 | CDS | open | 10489-10968 | _na 159_aa | Immunity protein 22 | |
| 3883 | CAMQFS010000049.1 | GCA947000095_01946 | CDS | open | 10973-11194 | _na 73_aa | nrfD | NrfD family oxidoreductase membrane subunit |
| 3884 | CAMQFS010000049.1 | GCA947000095_01947 | CDS | open | 12534-12977 | _na 147_aa | DUF2958 domain-containing protein | |
| 3885 | CAMQFS010000049.1 | GCA947000095_01948 | CDS | open | 13442-13561 | _na 39_aa | hypothetical protein | |
| 3886 | CAMQFS010000049.1 | GCA947000095_01949 | CDS | open | 13558-13866 | _na 102_aa | vapI | Helix-turn-helix protein |
| 3887 | CAMQFS010000049.1 | GCA947000095_01950 | CDS | open | 13881-14429 | _na 182_aa | relE | Toxin-antitoxin system%2C toxin component%2C RelE family |
| 3888 | CAMQFS010000049.1 | GCA947000095_01951 | CDS | open | 14493-17606 | _na 1037_aa | dnaG | DNA primase |
| 3889 | CAMQFS010000049.1 | GCA947000095_01952 | CDS | open | 17714-17917 | _na 67_aa | helix-turn-helix domain-containing protein | |
| 3890 | CAMQFS010000049.1 | GCA947000095_01953 | CDS | open | 17910-18242 | _na 110_aa | hypothetical protein | |
| 3891 | CAMQFS010000049.1 | GCA947000095_01954 | CDS | open | 18239-18352 | _na 37_aa | hypothetical protein | |
| 3892 | CAMQFS010000049.1 | GCA947000095_01955 | CDS | open | 18627-19916 | _na 429_aa | ATP-binding protein | |
| 3893 | CAMQFS010000049.1 | GCA947000095_01956 | CDS | open | 20529-20687 | _na 52_aa | hypothetical protein | |
| 3894 | CAMQFS010000049.1 | GCA947000095_01935 | gene | open | 26-952 | |||
| 3895 | CAMQFS010000049.1 | GCA947000095_01936 | gene | open | 1047-1814 | |||
| 3896 | CAMQFS010000049.1 | GCA947000095_01937 | gene | open | 1962-3746 | |||
| 3897 | CAMQFS010000049.1 | GCA947000095_01938 | gene | open | 3796-4023 | |||
| 3898 | CAMQFS010000049.1 | GCA947000095_01939 | gene | open | 4004-5323 | ardC | ||
| 3899 | CAMQFS010000049.1 | GCA947000095_01940 | gene | open | 5345-6544 | |||
| 3900 | CAMQFS010000049.1 | GCA947000095_01941 | gene | open | 6592-7263 | gldM | ||
| 3901 | CAMQFS010000049.1 | GCA947000095_01942 | gene | open | 7386-8183 | |||
| 3902 | CAMQFS010000049.1 | GCA947000095_01943 | gene | open | 8197-8700 | |||
| 3903 | CAMQFS010000049.1 | GCA947000095_01944 | gene | open | 8799-10052 | |||
| 3904 | CAMQFS010000049.1 | GCA947000095_01945 | gene | open | 10489-10968 | |||
| 3905 | CAMQFS010000049.1 | GCA947000095_01946 | gene | open | 10973-11194 | nrfD | ||
| 3906 | CAMQFS010000049.1 | GCA947000095_01947 | gene | open | 12534-12977 | |||
| 3907 | CAMQFS010000049.1 | GCA947000095_01948 | gene | open | 13442-13561 | |||
| 3908 | CAMQFS010000049.1 | GCA947000095_01949 | gene | open | 13558-13866 | vapI | ||
| 3909 | CAMQFS010000049.1 | GCA947000095_01950 | gene | open | 13881-14429 | relE | ||
| 3910 | CAMQFS010000049.1 | GCA947000095_01951 | gene | open | 14493-17606 | dnaG | ||
| 3911 | CAMQFS010000049.1 | GCA947000095_01952 | gene | open | 17714-17917 | |||
| 3912 | CAMQFS010000049.1 | GCA947000095_01953 | gene | open | 17910-18242 | |||
| 3913 | CAMQFS010000049.1 | GCA947000095_01954 | gene | open | 18239-18352 | |||
| 3914 | CAMQFS010000049.1 | GCA947000095_01955 | gene | open | 18627-19916 | |||
| 3915 | CAMQFS010000049.1 | GCA947000095_01956 | gene | open | 20529-20687 | |||
| 3916 | CAMQFS010000050.1 | GCA947000095_01957 | CDS | open | 189-914 | _na 241_aa | Methyltransferase type 11 domain-containing protein | |
| 3917 | CAMQFS010000050.1 | GCA947000095_01958 | CDS | open | 925-1293 | _na 122_aa | VOC domain-containing protein | |
| 3918 | CAMQFS010000050.1 | GCA947000095_01959 | CDS | open | 1454-1597 | _na 47_aa | hypothetical protein | |
| 3919 | CAMQFS010000050.1 | GCA947000095_01960 | CDS | open | 1771-2610 | _na 279_aa | DUF4738 domain-containing protein | |
| 3920 | CAMQFS010000050.1 | GCA947000095_01961 | CDS | open | 2622-3179 | _na 185_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 3921 | CAMQFS010000050.1 | GCA947000095_01962 | CDS | open | 3321-4433 | _na 370_aa | SPOR domain-containing protein | |
| 3922 | CAMQFS010000050.1 | GCA947000095_01963 | CDS | open | 4394-4975 | _na 193_aa | FHA domain-containing protein | |
| 3923 | CAMQFS010000050.1 | GCA947000095_01964 | CDS | open | 5244-5981 | _na 245_aa | ABC transporter%2C ATP-binding protein | |
| 3924 | CAMQFS010000050.1 | GCA947000095_01965 | CDS | open | 6046-7377 | _na 443_aa | Aspartokinase | |
| 3925 | CAMQFS010000050.1 | GCA947000095_01966 | CDS | open | 7392-8570 | _na 392_aa | lysA | diaminopimelate decarboxylase |
| 3926 | CAMQFS010000050.1 | GCA947000095_01967 | CDS | open | 8572-9804 | _na 410_aa | Glycosyltransferase 2-like domain-containing protein | |
| 3927 | CAMQFS010000050.1 | GCA947000095_01968 | CDS | open | 10004-10840 | _na 278_aa | hypothetical protein | |
| 3928 | CAMQFS010000050.1 | GCA947000095_01969 | CDS | open | 10847-12844 | _na 665_aa | Fructose-1%2C6-bisphosphatase class 3 | |
| 3929 | CAMQFS010000050.1 | GCA947000095_01970 | CDS | open | 13162-14424 | _na 420_aa | hutI | imidazolonepropionase |
| 3930 | CAMQFS010000050.1 | GCA947000095_01971 | CDS | open | 14483-15958 | _na 491_aa | hutH | histidine ammonia-lyase |
| 3931 | CAMQFS010000050.1 | GCA947000095_01972 | CDS | open | 16041-18038 | _na 665_aa | urocanate hydratase | |
| 3932 | CAMQFS010000050.1 | GCA947000095_01973 | CDS | open | 18058-19761 | _na 567_aa | ftcD | glutamate formimidoyltransferase |
| 3933 | CAMQFS010000050.1 | GCA947000095_01974 | CDS | open | 19853-20269 | _na 138_aa | hypothetical protein | |
| 3934 | CAMQFS010000050.1 | GCA947000095_01957 | gene | open | 189-914 | |||
| 3935 | CAMQFS010000050.1 | GCA947000095_01958 | gene | open | 925-1293 | |||
| 3936 | CAMQFS010000050.1 | GCA947000095_01959 | gene | open | 1454-1597 | |||
| 3937 | CAMQFS010000050.1 | GCA947000095_01960 | gene | open | 1771-2610 | |||
| 3938 | CAMQFS010000050.1 | GCA947000095_01961 | gene | open | 2622-3179 | rfbC | ||
| 3939 | CAMQFS010000050.1 | GCA947000095_01962 | gene | open | 3321-4433 | |||
| 3940 | CAMQFS010000050.1 | GCA947000095_01963 | gene | open | 4394-4975 | |||
| 3941 | CAMQFS010000050.1 | GCA947000095_01964 | gene | open | 5244-5981 | |||
| 3942 | CAMQFS010000050.1 | GCA947000095_01965 | gene | open | 6046-7377 | |||
| 3943 | CAMQFS010000050.1 | GCA947000095_01966 | gene | open | 7392-8570 | lysA | ||
| 3944 | CAMQFS010000050.1 | GCA947000095_01967 | gene | open | 8572-9804 | |||
| 3945 | CAMQFS010000050.1 | GCA947000095_01968 | gene | open | 10004-10840 | |||
| 3946 | CAMQFS010000050.1 | GCA947000095_01969 | gene | open | 10847-12844 | |||
| 3947 | CAMQFS010000050.1 | GCA947000095_01970 | gene | open | 13162-14424 | hutI | ||
| 3948 | CAMQFS010000050.1 | GCA947000095_01971 | gene | open | 14483-15958 | hutH | ||
| 3949 | CAMQFS010000050.1 | GCA947000095_01972 | gene | open | 16041-18038 | |||
| 3950 | CAMQFS010000050.1 | GCA947000095_01973 | gene | open | 18058-19761 | ftcD | ||
| 3951 | CAMQFS010000050.1 | GCA947000095_01974 | gene | open | 19853-20269 | |||
| 3952 | CAMQFS010000051.1 | GCA947000095_01975 | CDS | open | 520-4806 | _na 1428_aa | N-6 DNA Methylase | |
| 3953 | CAMQFS010000051.1 | GCA947000095_01976 | CDS | open | 4796-5380 | _na 194_aa | DUF1896 domain-containing protein | |
| 3954 | CAMQFS010000051.1 | GCA947000095_01977 | CDS | open | 5413-7503 | _na 696_aa | topA | DNA topoisomerase |
| 3955 | CAMQFS010000051.1 | GCA947000095_01978 | CDS | open | 7564-9123 | _na 519_aa | DUF3945 domain-containing protein | |
| 3956 | CAMQFS010000051.1 | GCA947000095_01979 | CDS | open | 9144-9494 | _na 116_aa | Helix-turn-helix domain-containing protein | |
| 3957 | CAMQFS010000051.1 | GCA947000095_01980 | CDS | open | 9498-9917 | _na 139_aa | Helix-turn-helix domain-containing protein | |
| 3958 | CAMQFS010000051.1 | GCA947000095_01981 | CDS | open | 9997-10356 | _na 119_aa | hypothetical protein | |
| 3959 | CAMQFS010000051.1 | GCA947000095_01982 | CDS | open | 10388-10693 | _na 101_aa | Helix-turn-helix domain-containing protein | |
| 3960 | CAMQFS010000051.1 | GCA947000095_01983 | CDS | open | 10768-11130 | _na 120_aa | rhuM | RhuM protein |
| 3961 | CAMQFS010000051.1 | GCA947000095_01984 | CDS | open | 11143-12378 | _na 411_aa | xerD | Recombinase |
| 3962 | CAMQFS010000051.1 | GCA947000095_01985 | CDS | open | 12856-14022 | _na 388_aa | xseA | exodeoxyribonuclease VII large subunit |
| 3963 | CAMQFS010000051.1 | GCA947000095_01986 | CDS | open | 14129-14680 | _na 183_aa | Exonuclease | |
| 3964 | CAMQFS010000051.1 | GCA947000095_01987 | CDS | open | 14682-15641 | _na 319_aa | WYL domain-containing protein | |
| 3965 | CAMQFS010000051.1 | GCA947000095_01988 | CDS | open | 15750-17804 | _na 684_aa | AAA+ ATPase domain-containing protein | |
| 3966 | CAMQFS010000051.1 | GCA947000095_01989 | CDS | open | 18741-18935 | _na 64_aa | xseB | exodeoxyribonuclease VII small subunit |
| 3967 | CAMQFS010000051.1 | GCA947000095_01990 | CDS | open | 19192-19962 | _na 256_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 3968 | CAMQFS010000051.1 | GCA947000095_01975 | gene | open | 520-4806 | |||
| 3969 | CAMQFS010000051.1 | GCA947000095_01976 | gene | open | 4796-5380 | |||
| 3970 | CAMQFS010000051.1 | GCA947000095_01977 | gene | open | 5413-7503 | topA | ||
| 3971 | CAMQFS010000051.1 | GCA947000095_01978 | gene | open | 7564-9123 | |||
| 3972 | CAMQFS010000051.1 | GCA947000095_01979 | gene | open | 9144-9494 | |||
| 3973 | CAMQFS010000051.1 | GCA947000095_01980 | gene | open | 9498-9917 | |||
| 3974 | CAMQFS010000051.1 | GCA947000095_01981 | gene | open | 9997-10356 | |||
| 3975 | CAMQFS010000051.1 | GCA947000095_01982 | gene | open | 10388-10693 | |||
| 3976 | CAMQFS010000051.1 | GCA947000095_01983 | gene | open | 10768-11130 | rhuM | ||
| 3977 | CAMQFS010000051.1 | GCA947000095_01984 | gene | open | 11143-12378 | xerD | ||
| 3978 | CAMQFS010000051.1 | GCA947000095_01985 | gene | open | 12856-14022 | xseA | ||
| 3979 | CAMQFS010000051.1 | GCA947000095_01986 | gene | open | 14129-14680 | |||
| 3980 | CAMQFS010000051.1 | GCA947000095_01987 | gene | open | 14682-15641 | |||
| 3981 | CAMQFS010000051.1 | GCA947000095_01988 | gene | open | 15750-17804 | |||
| 3982 | CAMQFS010000051.1 | GCA947000095_01989 | gene | open | 18741-18935 | xseB | ||
| 3983 | CAMQFS010000051.1 | GCA947000095_01990 | gene | open | 19192-19962 | trmB | ||
| 3984 | CAMQFS010000052.1 | repeat_region | open | 3718-4092 | CRISPR array with 6 repeats of length 36%2C consensus sequence GTTGCTTCATATTTTGATTCTACATCAAACCACAAC and spacer length 29 | |||
| 3985 | CAMQFS010000052.1 | repeat_region | open | 4767-6057 | CRISPR array with 20 repeats of length 36%2C consensus sequence GTTGCTTCATATTTTGATTCTACATCAAACCACAAC and spacer length 29 | |||
| 3986 | CAMQFS010000052.1 | GCA947000095_01991 | CDS | open | 119-1066 | _na 315_aa | trxB | thioredoxin-disulfide reductase |
| 3987 | CAMQFS010000052.1 | GCA947000095_01992 | CDS | open | 1217-2440 | _na 407_aa | pepT | peptidase T |
| 3988 | CAMQFS010000052.1 | GCA947000095_01993 | CDS | open | 3548-3655 | _na 35_aa | hypothetical protein | |
| 3989 | CAMQFS010000052.1 | GCA947000095_01994 | CDS | open | 6139-6477 | _na 112_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3990 | CAMQFS010000052.1 | GCA947000095_01995 | CDS | open | 6474-7361 | _na 295_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 3991 | CAMQFS010000052.1 | GCA947000095_01996 | CDS | open | 7368-11024 | _na 1218_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 3992 | CAMQFS010000052.1 | GCA947000095_01997 | CDS | open | 11359-13650 | _na 763_aa | Alpha-mannosidase | |
| 3993 | CAMQFS010000052.1 | GCA947000095_01998 | CDS | open | 13760-13999 | _na 79_aa | abrB | Toxin-antitoxin system%2C antitoxin component%2C AbrB family |
| 3994 | CAMQFS010000052.1 | GCA947000095_01999 | CDS | open | 14002-16536 | _na 844_aa | Leucine-rich repeat domain-containing protein | |
| 3995 | CAMQFS010000052.1 | GCA947000095_02000 | CDS | open | 17578-18948 | _na 456_aa | hemN | oxygen-independent coproporphyrinogen III oxidase |
| 3996 | CAMQFS010000052.1 | GCA947000095_01991 | gene | open | 119-1066 | trxB | ||
| 3997 | CAMQFS010000052.1 | GCA947000095_01992 | gene | open | 1217-2440 | pepT | ||
| 3998 | CAMQFS010000052.1 | GCA947000095_01993 | gene | open | 3548-3655 | |||
| 3999 | CAMQFS010000052.1 | GCA947000095_01994 | gene | open | 6139-6477 | cas2 | ||
| 4000 | CAMQFS010000052.1 | GCA947000095_01995 | gene | open | 6474-7361 | cas1 |

