BAKTAGenome Explorer: Megasphaera lornae (GCA_947039735.1)
Select a Genome:
|
BAKTA Annotations for GCA_947039735.1
|
Search & Sort all 2987 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | CAMQZS010000001.1 | regulatory_region | open | 7384-7476 | PyrR binding site | |||
| 2 | CAMQZS010000001.1 | regulatory_region | open | 68598-68698 | SAM riboswitch aptamer (S box leader) | |||
| 3 | CAMQZS010000001.1 | GCA947039735_00001 | CDS | open | 891-4097 | _na 1068_aa | carB | carbamoyl-phosphate synthase large subunit |
| 4 | CAMQZS010000001.1 | GCA947039735_00002 | CDS | open | 4099-5157 | _na 352_aa | carbamoyl phosphate synthase small subunit | |
| 5 | CAMQZS010000001.1 | GCA947039735_00003 | CDS | open | 5154-6449 | _na 431_aa | Dihydroorotase | |
| 6 | CAMQZS010000001.1 | GCA947039735_00004 | CDS | open | 6427-7368 | _na 313_aa | aspartate carbamoyltransferase catalytic subunit | |
| 7 | CAMQZS010000001.1 | GCA947039735_00005 | CDS | open | 7604-8152 | _na 182_aa | pyrR | bifunctional pyr operon transcriptional regulator/uracil phosphoribosyltransferase PyrR |
| 8 | CAMQZS010000001.1 | GCA947039735_00006 | CDS | open | 8165-9082 | _na 305_aa | Pseudouridine synthase | |
| 9 | CAMQZS010000001.1 | GCA947039735_00007 | CDS | open | 9092-9529 | _na 145_aa | lspA | signal peptidase II |
| 10 | CAMQZS010000001.1 | GCA947039735_00008 | CDS | open | 9595-9906 | _na 103_aa | Thiamine-binding protein domain-containing protein | |
| 11 | CAMQZS010000001.1 | GCA947039735_00009 | CDS | open | 10027-10509 | _na 160_aa | Oxidized purine nucleoside triphosphate hydrolase | |
| 12 | CAMQZS010000001.1 | GCA947039735_00010 | CDS | open | 10506-10949 | _na 147_aa | DUF3783 domain-containing protein | |
| 13 | CAMQZS010000001.1 | GCA947039735_00011 | CDS | open | 11046-11384 | _na 112_aa | rplQ | 50S ribosomal protein L17 |
| 14 | CAMQZS010000001.1 | GCA947039735_00012 | CDS | open | 11402-12379 | _na 325_aa | DNA-directed RNA polymerase subunit alpha | |
| 15 | CAMQZS010000001.1 | GCA947039735_00013 | CDS | open | 12424-12816 | _na 130_aa | rpsK | 30S ribosomal protein S11 |
| 16 | CAMQZS010000001.1 | GCA947039735_00014 | CDS | open | 12845-13213 | _na 122_aa | rpsM | 30S ribosomal protein S13 |
| 17 | CAMQZS010000001.1 | GCA947039735_00015 | CDS | open | 13236-13349 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 18 | CAMQZS010000001.1 | GCA947039735_00016 | CDS | open | 13374-13592 | _na 72_aa | infA | translation initiation factor IF-1 |
| 19 | CAMQZS010000001.1 | GCA947039735_00017 | CDS | open | 13585-13881 | _na 98_aa | RNA-binding protein | |
| 20 | CAMQZS010000001.1 | GCA947039735_00018 | CDS | open | 13878-14672 | _na 264_aa | map | type I methionyl aminopeptidase |
| 21 | CAMQZS010000001.1 | GCA947039735_00019 | CDS | open | 14626-15276 | _na 216_aa | adenylate kinase | |
| 22 | CAMQZS010000001.1 | GCA947039735_00020 | CDS | open | 15291-16553 | _na 420_aa | secY | preprotein translocase subunit SecY |
| 23 | CAMQZS010000001.1 | GCA947039735_00021 | CDS | open | 16555-16995 | _na 146_aa | rplO | 50S ribosomal protein L15 |
| 24 | CAMQZS010000001.1 | GCA947039735_00022 | CDS | open | 17017-17196 | _na 59_aa | rpmD | 50S ribosomal protein L30 |
| 25 | CAMQZS010000001.1 | GCA947039735_00023 | CDS | open | 17214-17714 | _na 166_aa | rpsE | 30S ribosomal protein S5 |
| 26 | CAMQZS010000001.1 | GCA947039735_00024 | CDS | open | 17733-18092 | _na 119_aa | rplR | 50S ribosomal protein L18 |
| 27 | CAMQZS010000001.1 | GCA947039735_00025 | CDS | open | 18127-18669 | _na 180_aa | rplF | 50S ribosomal protein L6 |
| 28 | CAMQZS010000001.1 | GCA947039735_00026 | CDS | open | 18687-19079 | _na 130_aa | rpsH | 30S ribosomal protein S8 |
| 29 | CAMQZS010000001.1 | GCA947039735_00027 | CDS | open | 19109-19378 | _na 89_aa | rpsN | 30S ribosomal protein S14 |
| 30 | CAMQZS010000001.1 | GCA947039735_00028 | CDS | open | 19394-19936 | _na 180_aa | rplE | 50S ribosomal protein L5 |
| 31 | CAMQZS010000001.1 | GCA947039735_00029 | CDS | open | 19959-20276 | _na 105_aa | rplX | 50S ribosomal protein L24 |
| 32 | CAMQZS010000001.1 | GCA947039735_00030 | CDS | open | 20295-20663 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 33 | CAMQZS010000001.1 | GCA947039735_00031 | CDS | open | 20690-20944 | _na 84_aa | rpsQ | 30S ribosomal protein S17 |
| 34 | CAMQZS010000001.1 | GCA947039735_00032 | CDS | open | 20982-21182 | _na 66_aa | rpmC | 50S ribosomal protein L29 |
| 35 | CAMQZS010000001.1 | GCA947039735_00033 | CDS | open | 21172-21609 | _na 145_aa | rplP | 50S ribosomal protein L16 |
| 36 | CAMQZS010000001.1 | GCA947039735_00034 | CDS | open | 21609-22280 | _na 223_aa | rpsC | 30S ribosomal protein S3 |
| 37 | CAMQZS010000001.1 | GCA947039735_00035 | CDS | open | 22294-22629 | _na 111_aa | rplV | 50S ribosomal protein L22 |
| 38 | CAMQZS010000001.1 | GCA947039735_00036 | CDS | open | 22644-22922 | _na 92_aa | rpsS | 30S ribosomal protein S19 |
| 39 | CAMQZS010000001.1 | GCA947039735_00037 | CDS | open | 22945-23772 | _na 275_aa | rplB | 50S ribosomal protein L2 |
| 40 | CAMQZS010000001.1 | GCA947039735_00038 | CDS | open | 23804-24088 | _na 94_aa | rplW | 50S ribosomal protein L23 |
| 41 | CAMQZS010000001.1 | GCA947039735_00039 | CDS | open | 24088-24711 | _na 207_aa | rplD | 50S ribosomal protein L4 |
| 42 | CAMQZS010000001.1 | GCA947039735_00040 | CDS | open | 24744-25382 | _na 212_aa | rplC | 50S ribosomal protein L3 |
| 43 | CAMQZS010000001.1 | GCA947039735_00041 | CDS | open | 25397-25708 | _na 103_aa | rpsJ | 30S ribosomal protein S10 |
| 44 | CAMQZS010000001.1 | GCA947039735_00042 | CDS | open | 26053-27240 | _na 395_aa | tuf | elongation factor Tu |
| 45 | CAMQZS010000001.1 | GCA947039735_00043 | CDS | open | 27273-29345 | _na 690_aa | fusA | elongation factor G |
| 46 | CAMQZS010000001.1 | GCA947039735_00044 | CDS | open | 29377-29847 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 47 | CAMQZS010000001.1 | GCA947039735_00045 | CDS | open | 29893-30264 | _na 123_aa | rpsL | 30S ribosomal protein S12 |
| 48 | CAMQZS010000001.1 | GCA947039735_00046 | CDS | open | 30343-30588 | _na 81_aa | Ribosomal protein L7ae family protein | |
| 49 | CAMQZS010000001.1 | GCA947039735_00047 | CDS | open | 30829-35058 | _na 1409_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 50 | CAMQZS010000001.1 | GCA947039735_00048 | CDS | open | 35080-38796 | _na 1238_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 51 | CAMQZS010000001.1 | GCA947039735_00049 | CDS | open | 39006-40262 | _na 418_aa | tyrS | tyrosine--tRNA ligase |
| 52 | CAMQZS010000001.1 | GCA947039735_00050 | CDS | open | 40330-42261 | _na 643_aa | Fructose-1%2C6-bisphosphatase class 3 | |
| 53 | CAMQZS010000001.1 | GCA947039735_00051 | CDS | open | 42453-43691 | _na 412_aa | Metallo-beta-lactamase domain protein | |
| 54 | CAMQZS010000001.1 | GCA947039735_00052 | CDS | open | 43832-45073 | _na 413_aa | hypothetical protein | |
| 55 | CAMQZS010000001.1 | GCA947039735_00053 | CDS | open | 45122-45778 | _na 218_aa | GDYXXLXY protein | |
| 56 | CAMQZS010000001.1 | GCA947039735_00054 | CDS | open | 45775-47475 | _na 566_aa | DUF2157 domain-containing protein | |
| 57 | CAMQZS010000001.1 | GCA947039735_00055 | CDS | open | 47691-48137 | _na 148_aa | Universal stress family protein | |
| 58 | CAMQZS010000001.1 | GCA947039735_00056 | CDS | open | 48436-49875 | _na 479_aa | Citrate transporter | |
| 59 | CAMQZS010000001.1 | GCA947039735_00060 | CDS | open | 50461-51312 | _na 283_aa | speE | polyamine aminopropyltransferase |
| 60 | CAMQZS010000001.1 | GCA947039735_00061 | CDS | open | 51587-55915 | _na 1442_aa | CoA-substrate-specific enzyme activase | |
| 61 | CAMQZS010000001.1 | GCA947039735_00062 | CDS | open | 56026-57210 | _na 394_aa | Bacterial type II and III secretion system protein | |
| 62 | CAMQZS010000001.1 | GCA947039735_00063 | CDS | open | 57221-57775 | _na 184_aa | hypothetical protein | |
| 63 | CAMQZS010000001.1 | GCA947039735_00064 | CDS | open | 57896-58663 | _na 255_aa | ABC transporter%2C ATP-binding protein | |
| 64 | CAMQZS010000001.1 | GCA947039735_00065 | CDS | open | 58672-59322 | _na 216_aa | ABC transporter%2C permease protein | |
| 65 | CAMQZS010000001.1 | GCA947039735_00066 | CDS | open | 59353-60153 | _na 266_aa | ABC transporter%2C substrate-binding protein%2C family 3 | |
| 66 | CAMQZS010000001.1 | GCA947039735_00067 | CDS | open | 60302-60805 | _na 167_aa | YcxB-like protein domain-containing protein | |
| 67 | CAMQZS010000001.1 | GCA947039735_00068 | CDS | open | 60760-60849 | _na 29_aa | hypothetical protein | |
| 68 | CAMQZS010000001.1 | GCA947039735_00069 | CDS | open | 60839-61168 | _na 109_aa | hypothetical protein | |
| 69 | CAMQZS010000001.1 | GCA947039735_00070 | CDS | open | 61181-62089 | _na 302_aa | DUF5050 domain-containing protein | |
| 70 | CAMQZS010000001.1 | GCA947039735_00071 | CDS | open | 62099-63043 | _na 314_aa | Phosphodiester glycosidase domain-containing protein | |
| 71 | CAMQZS010000001.1 | GCA947039735_00072 | CDS | open | 63167-64144 | _na 325_aa | 4-phosphoerythronate dehydrogenase | |
| 72 | CAMQZS010000001.1 | GCA947039735_00073 | CDS | open | 64296-65597 | _na 433_aa | eno | phosphopyruvate hydratase |
| 73 | CAMQZS010000001.1 | GCA947039735_00074 | CDS | open | 65678-66478 | _na 266_aa | CpXC domain-containing protein | |
| 74 | CAMQZS010000001.1 | GCA947039735_00075 | CDS | open | 66662-68008 | _na 448_aa | Transporter%2C major facilitator family protein | |
| 75 | CAMQZS010000001.1 | GCA947039735_00076 | CDS | open | 68105-68536 | _na 143_aa | Tat pathway signal sequence domain protein | |
| 76 | CAMQZS010000001.1 | GCA947039735_00077 | CDS | open | 68777-69583 | _na 268_aa | Lipoprotein | |
| 77 | CAMQZS010000001.1 | GCA947039735_00078 | CDS | open | 69707-70012 | _na 101_aa | trxA | thioredoxin |
| 78 | CAMQZS010000001.1 | GCA947039735_00079 | CDS | open | 70062-70460 | _na 132_aa | Acyl-coenzyme A thioesterase THEM4 | |
| 79 | CAMQZS010000001.1 | GCA947039735_00080 | CDS | open | 70609-71022 | _na 137_aa | flavodoxin | |
| 80 | CAMQZS010000001.1 | GCA947039735_00081 | CDS | open | 71037-71594 | _na 185_aa | DUF3793 domain-containing protein | |
| 81 | CAMQZS010000001.1 | GCA947039735_00082 | CDS | open | 71904-72569 | _na 221_aa | Exonuclease | |
| 82 | CAMQZS010000001.1 | GCA947039735_00083 | CDS | open | 72600-72989 | _na 129_aa | nusG | NusG domain-containing protein |
| 83 | CAMQZS010000001.1 | GCA947039735_00084 | CDS | open | 73000-73524 | _na 174_aa | Heptaprenyl diphosphate synthase component I | |
| 84 | CAMQZS010000001.1 | GCA947039735_00085 | CDS | open | 73591-74157 | _na 188_aa | Phosphoheptose isomerase | |
| 85 | CAMQZS010000001.1 | GCA947039735_00086 | CDS | open | 74173-74733 | _na 186_aa | Carbonate dehydratase | |
| 86 | CAMQZS010000001.1 | GCA947039735_00087 | CDS | open | 74744-76093 | _na 449_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 87 | CAMQZS010000001.1 | GCA947039735_00089 | CDS | open | 76815-77849 | _na 344_aa | pta | phosphate acetyltransferase |
| 88 | CAMQZS010000001.1 | GCA947039735_00090 | CDS | open | 78062-78601 | _na 179_aa | 2-oxoacid:acceptor oxidoreductase%2C gamma subunit%2C pyruvate/2-ketoisovalerate family | |
| 89 | CAMQZS010000001.1 | GCA947039735_00091 | CDS | open | 78603-79349 | _na 248_aa | Thiamine pyrophosphate enzyme%2C TPP binding domain protein | |
| 90 | CAMQZS010000001.1 | GCA947039735_00092 | CDS | open | 79351-80418 | _na 355_aa | 3-methyl-2-oxobutanoate dehydrogenase | |
| 91 | CAMQZS010000001.1 | GCA947039735_00093 | CDS | open | 80433-80642 | _na 69_aa | 4Fe-4S binding domain protein | |
| 92 | CAMQZS010000001.1 | GCA947039735_00094 | CDS | open | 80672-81349 | _na 225_aa | CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein | |
| 93 | CAMQZS010000001.1 | GCA947039735_00095 | CDS | open | 81786-82331 | _na 181_aa | Glutathione peroxidase | |
| 94 | CAMQZS010000001.1 | GCA947039735_00096 | CDS | open | 82790-84073 | _na 427_aa | DUF445 domain-containing protein | |
| 95 | CAMQZS010000001.1 | GCA947039735_00097 | CDS | open | 84075-85346 | _na 423_aa | DUF445 domain-containing protein | |
| 96 | CAMQZS010000001.1 | GCA947039735_00098 | CDS | open | 85346-86083 | _na 245_aa | Metallo-beta-lactamase domain-containing protein | |
| 97 | CAMQZS010000001.1 | GCA947039735_00099 | CDS | open | 86294-87247 | _na 317_aa | Iron-sulfur cluster-binding protein | |
| 98 | CAMQZS010000001.1 | GCA947039735_00100 | CDS | open | 87164-87724 | _na 186_aa | Yip1 domain-containing protein | |
| 99 | CAMQZS010000001.1 | GCA947039735_00101 | CDS | open | 87718-88665 | _na 315_aa | Signal peptide peptidase SppA%2C 36K type | |
| 100 | CAMQZS010000001.1 | GCA947039735_00102 | CDS | open | 88720-90045 | _na 441_aa | dnaB | replicative DNA helicase |
| 101 | CAMQZS010000001.1 | GCA947039735_00103 | CDS | open | 90057-91964 | _na 635_aa | lonC | Lon family ATP-dependent protease |
| 102 | CAMQZS010000001.1 | GCA947039735_00104 | CDS | open | 91981-92427 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 103 | CAMQZS010000001.1 | GCA947039735_00105 | CDS | open | 92424-94445 | _na 673_aa | Cyclic-di-AMP phosphodiesterase | |
| 104 | CAMQZS010000001.1 | GCA947039735_00106 | CDS | open | 94464-95408 | _na 314_aa | DUF2232 domain-containing protein | |
| 105 | CAMQZS010000001.1 | GCA947039735_00107 | CDS | open | 95507-97168 | _na 553_aa | Ribonuclease J | |
| 106 | CAMQZS010000001.1 | GCA947039735_00108 | CDS | open | 97394-98320 | _na 308_aa | Tat pathway signal sequence domain protein | |
| 107 | CAMQZS010000001.1 | GCA947039735_00109 | CDS | open | 98351-99151 | _na 266_aa | Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase | |
| 108 | CAMQZS010000001.1 | GCA947039735_00110 | CDS | open | 99165-99665 | _na 166_aa | sixA | Phosphohistidine phosphatase SixA |
| 109 | CAMQZS010000001.1 | GCA947039735_00111 | CDS | open | 99683-100060 | _na 125_aa | arsR | Transcriptional regulator%2C ArsR family |
| 110 | CAMQZS010000001.1 | GCA947039735_00112 | CDS | open | 100167-100667 | _na 166_aa | Transcriptional regulator%2C Fur family | |
| 111 | CAMQZS010000001.1 | GCA947039735_00113 | CDS | open | 100673-101485 | _na 270_aa | ABC 3 transport family protein | |
| 112 | CAMQZS010000001.1 | GCA947039735_00114 | CDS | open | 101478-102152 | _na 224_aa | ABC transporter%2C ATP-binding protein | |
| 113 | CAMQZS010000001.1 | GCA947039735_00115 | CDS | open | 102343-103263 | _na 306_aa | ABC transporter%2C substrate-binding protein | |
| 114 | CAMQZS010000001.1 | GCA947039735_00116 | CDS | open | 103369-103995 | _na 208_aa | N-acetylmuramoyl-L-alanine amidase | |
| 115 | CAMQZS010000001.1 | GCA947039735_00117 | CDS | open | 104367-104651 | _na 94_aa | fixX | Ferredoxin-like protein FixX family protein |
| 116 | CAMQZS010000001.1 | GCA947039735_00118 | CDS | open | 104653-105948 | _na 431_aa | FAD dependent oxidoreductase | |
| 117 | CAMQZS010000001.1 | GCA947039735_00119 | CDS | open | 105995-106708 | _na 237_aa | Demethylmenaquinone methyltransferase | |
| 118 | CAMQZS010000001.1 | GCA947039735_00120 | CDS | open | 106701-107609 | _na 302_aa | 1%2C4-dihydroxy-2-naphthoate octaprenyltransferase | |
| 119 | CAMQZS010000001.1 | GCA947039735_00121 | CDS | open | 107633-108646 | _na 337_aa | Octaprenyl pyrophosphate synthetase family protein | |
| 120 | CAMQZS010000001.1 | GCA947039735_00122 | CDS | open | 108677-110839 | _na 720_aa | ldhH | L-lactate dehydrogenase (quinone) large subunit LdhH |
| 121 | CAMQZS010000001.1 | GCA947039735_00123 | CDS | open | 110855-111400 | _na 181_aa | LUD domain-containing protein | |
| 122 | CAMQZS010000001.1 | GCA947039735_00124 | CDS | open | 111922-112293 | _na 123_aa | 4Fe-4S Mo/W bis-MGD-type domain-containing protein | |
| 123 | CAMQZS010000001.1 | GCA947039735_00125 | CDS | open | 112295-113563 | _na 422_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 124 | CAMQZS010000001.1 | GCA947039735_00126 | CDS | open | 113563-115029 | _na 488_aa | FAD dependent oxidoreductase | |
| 125 | CAMQZS010000001.1 | GCA947039735_00127 | CDS | open | 115258-115983 | _na 241_aa | Channel protein%2C MIP family | |
| 126 | CAMQZS010000001.1 | GCA947039735_00128 | CDS | open | 116014-117516 | _na 500_aa | glpK | glycerol kinase GlpK |
| 127 | CAMQZS010000001.1 | GCA947039735_00129 | CDS | open | 117832-118779 | _na 315_aa | Deoxyribonucleoside regulator | |
| 128 | CAMQZS010000001.1 | GCA947039735_00130 | CDS | open | 118919-119194 | _na 91_aa | GIY-YIG catalytic domain protein | |
| 129 | CAMQZS010000001.1 | GCA947039735_00131 | CDS | open | 119194-119670 | _na 158_aa | Peptidyl-prolyl cis-trans isomerase | |
| 130 | CAMQZS010000001.1 | GCA947039735_00132 | CDS | open | 120075-120515 | _na 146_aa | marR | Transcriptional regulator%2C MarR family |
| 131 | CAMQZS010000001.1 | GCA947039735_00133 | CDS | open | 120667-122235 | _na 522_aa | hcp | hydroxylamine reductase |
| 132 | CAMQZS010000001.1 | GCA947039735_00134 | CDS | open | 122317-123726 | _na 469_aa | Hep/Hag repeat protein | |
| 133 | CAMQZS010000001.1 | GCA947039735_00135 | CDS | open | 123989-124996 | _na 335_aa | Hep/Hag repeat protein | |
| 134 | CAMQZS010000001.1 | GCA947039735_00136 | CDS | open | 125170-126141 | _na 323_aa | NlpC/P60 family protein | |
| 135 | CAMQZS010000001.1 | GCA947039735_00137 | CDS | open | 126508-127326 | _na 272_aa | DUF4116 domain-containing protein | |
| 136 | CAMQZS010000001.1 | GCA947039735_00138 | CDS | open | 127338-128453 | _na 371_aa | ATPase family associated with various cellular activities (AAA) | |
| 137 | CAMQZS010000001.1 | GCA947039735_00139 | CDS | open | 128455-129846 | _na 463_aa | VWA-like domain-containing protein | |
| 138 | CAMQZS010000001.1 | GCA947039735_00140 | CDS | open | 129889-131322 | _na 477_aa | Na+/H+ antiporter family protein | |
| 139 | CAMQZS010000001.1 | GCA947039735_00141 | CDS | open | 131430-132197 | _na 255_aa | tatD | Hydrolase%2C TatD family |
| 140 | CAMQZS010000001.1 | GCA947039735_00142 | CDS | open | 132199-134136 | _na 645_aa | metG | methionine--tRNA ligase |
| 141 | CAMQZS010000001.1 | GCA947039735_00143 | CDS | open | 134177-135019 | _na 280_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 142 | CAMQZS010000001.1 | GCA947039735_00144 | CDS | open | 135003-135761 | _na 252_aa | Methyltransferase small domain protein | |
| 143 | CAMQZS010000001.1 | GCA947039735_00145 | CDS | open | 135751-136593 | _na 280_aa | PSP1 protein | |
| 144 | CAMQZS010000001.1 | GCA947039735_00146 | CDS | open | 136594-137586 | _na 330_aa | AAA+ ATPase domain-containing protein | |
| 145 | CAMQZS010000001.1 | GCA947039735_00147 | CDS | open | 137728-138426 | _na 232_aa | Thymidylate kinase | |
| 146 | CAMQZS010000001.1 | GCA947039735_00148 | CDS | open | 138431-139885 | _na 484_aa | Putative arginine 2-monooxygenase | |
| 147 | CAMQZS010000001.1 | GCA947039735_00149 | CDS | open | 140353-141198 | _na 281_aa | pyridoxamine kinase | |
| 148 | CAMQZS010000001.1 | GCA947039735_00150 | CDS | open | 141258-141704 | _na 148_aa | GtrA-like protein | |
| 149 | CAMQZS010000001.1 | GCA947039735_00151 | CDS | open | 141880-142314 | _na 144_aa | marR | Transcriptional regulator%2C MarR family |
| 150 | CAMQZS010000001.1 | GCA947039735_00152 | CDS | open | 142368-143507 | _na 379_aa | sfsA | DNA/RNA nuclease SfsA |
| 151 | CAMQZS010000001.1 | GCA947039735_00153 | CDS | open | 144341-144976 | _na 211_aa | hypothetical protein | |
| 152 | CAMQZS010000001.1 | GCA947039735_00154 | CDS | open | 144997-145563 | _na 188_aa | Phage minor structural protein GP20 | |
| 153 | CAMQZS010000001.1 | GCA947039735_00155 | CDS | open | 145695-146087 | _na 130_aa | hypothetical protein | |
| 154 | CAMQZS010000001.1 | GCA947039735_00156 | CDS | open | 146094-146318 | _na 74_aa | hypothetical protein | |
| 155 | CAMQZS010000001.1 | GCA947039735_00157 | CDS | open | 146311-147363 | _na 350_aa | minor capsid protein | |
| 156 | CAMQZS010000001.1 | GCA947039735_00158 | CDS | open | 147424-147849 | _na 141_aa | Integrase catalytic domain-containing protein | |
| 157 | CAMQZS010000001.1 | GCA947039735_00159 | CDS | open | 147978-150431 | _na 817_aa | gyrA | DNA gyrase subunit A |
| 158 | CAMQZS010000001.1 | GCA947039735_00160 | CDS | open | 150703-151425 | _na 240_aa | Glycerophosphodiester phosphodiesterase family protein | |
| 159 | CAMQZS010000001.1 | GCA947039735_00161 | CDS | open | 151431-152795 | _na 454_aa | Amino acid carrier protein | |
| 160 | CAMQZS010000001.1 | GCA947039735_00162 | CDS | open | 152916-153347 | _na 143_aa | ybaN | Inner membrane protein YbaN |
| 161 | CAMQZS010000001.1 | GCA947039735_00163 | CDS | open | 153442-154896 | _na 484_aa | Xaa-His dipeptidase | |
| 162 | CAMQZS010000001.1 | GCA947039735_00164 | CDS | open | 155163-157235 | _na 690_aa | OPT family oligopeptide transporter | |
| 163 | CAMQZS010000001.1 | GCA947039735_00165 | CDS | open | 157462-158289 | _na 275_aa | 4Fe-4S binding domain protein | |
| 164 | CAMQZS010000001.1 | GCA947039735_00166 | CDS | open | 158670-159248 | _na 192_aa | PAP2 family protein | |
| 165 | CAMQZS010000001.1 | GCA947039735_00167 | CDS | open | 159453-160277 | _na 274_aa | Glutamine ABC transporter periplasmic protein | |
| 166 | CAMQZS010000001.1 | GCA947039735_00168 | CDS | open | 160395-161075 | _na 226_aa | queC | 7-cyano-7-deazaguanine synthase QueC |
| 167 | CAMQZS010000001.1 | GCA947039735_00169 | CDS | open | 161244-162989 | _na 581_aa | pyk | pyruvate kinase |
| 168 | CAMQZS010000001.1 | GCA947039735_00170 | CDS | open | 163048-165276 | _na 742_aa | fusA | elongation factor G |
| 169 | CAMQZS010000001.1 | GCA947039735_00171 | CDS | open | 165486-167081 | _na 531_aa | site-specific DNA-methyltransferase | |
| 170 | CAMQZS010000001.1 | GCA947039735_00172 | CDS | open | 167074-169743 | _na 889_aa | DEAD/DEAH box helicase | |
| 171 | CAMQZS010000001.1 | GCA947039735_00173 | CDS | open | 170008-171375 | _na 455_aa | aminopeptidase | |
| 172 | CAMQZS010000001.1 | GCA947039735_00174 | CDS | open | 171542-172432 | _na 296_aa | Lipid kinase%2C YegS/Rv2252/BmrU family | |
| 173 | CAMQZS010000001.1 | GCA947039735_00175 | CDS | open | 172496-173815 | _na 439_aa | High-affinity gluconate transporter | |
| 174 | CAMQZS010000001.1 | GCA947039735_00176 | CDS | open | 173767-173886 | _na 39_aa | hypothetical protein | |
| 175 | CAMQZS010000001.1 | GCA947039735_00177 | CDS | open | 174080-174982 | _na 300_aa | Radical SAM domain protein | |
| 176 | CAMQZS010000001.1 | GCA947039735_00178 | CDS | open | 175071-176003 | _na 310_aa | Transporter%2C auxin efflux carrier (AEC) family protein | |
| 177 | CAMQZS010000001.1 | GCA947039735_00179 | CDS | open | 176034-177011 | _na 325_aa | Metallo-beta-lactamase domain protein | |
| 178 | CAMQZS010000001.1 | GCA947039735_00180 | CDS | open | 177124-177690 | _na 188_aa | pth | aminoacyl-tRNA hydrolase |
| 179 | CAMQZS010000001.1 | GCA947039735_00181 | CDS | open | 177709-178674 | _na 321_aa | Ribose-phosphate pyrophosphokinase | |
| 180 | CAMQZS010000001.1 | GCA947039735_00182 | CDS | open | 178749-180122 | _na 457_aa | glmU | bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU |
| 181 | CAMQZS010000001.1 | GCA947039735_00183 | CDS | open | 180292-180876 | _na 194_aa | 3D domain protein | |
| 182 | CAMQZS010000001.1 | GCA947039735_00184 | CDS | open | 181105-182688 | _na 527_aa | Chloride transporter%2C ClC family | |
| 183 | CAMQZS010000001.1 | GCA947039735_00185 | CDS | open | 182842-184032 | _na 396_aa | Amidohydrolase | |
| 184 | CAMQZS010000001.1 | GCA947039735_00186 | CDS | open | 184272-187253 | _na 993_aa | yhaN | putative protein YhaN AAA domain-containing protein |
| 185 | CAMQZS010000001.1 | GCA947039735_00187 | CDS | open | 187259-188524 | _na 421_aa | Ser/Thr phosphatase family protein | |
| 186 | CAMQZS010000001.1 | GCA947039735_00188 | CDS | open | 188517-189920 | _na 467_aa | gntR | Transcriptional regulator%2C GntR family |
| 187 | CAMQZS010000001.1 | GCA947039735_00189 | CDS | open | 190111-191103 | _na 330_aa | bioB | biotin synthase BioB |
| 188 | CAMQZS010000001.1 | GCA947039735_00190 | CDS | open | 191088-192392 | _na 434_aa | Hexokinase | |
| 189 | CAMQZS010000001.1 | GCA947039735_00191 | CDS | open | 192646-192840 | _na 64_aa | thiS | sulfur carrier protein ThiS |
| 190 | CAMQZS010000001.1 | GCA947039735_00192 | CDS | open | 192894-193664 | _na 256_aa | Thiazole synthase | |
| 191 | CAMQZS010000001.1 | GCA947039735_00193 | CDS | open | 193679-194842 | _na 387_aa | thiH | 2-iminoacetate synthase ThiH |
| 192 | CAMQZS010000001.1 | GCA947039735_00194 | CDS | open | 195083-195691 | _na 202_aa | Thiamine-phosphate diphosphorylase | |
| 193 | CAMQZS010000001.1 | GCA947039735_00195 | CDS | open | 195694-196197 | _na 167_aa | Isochorismatase-like domain-containing protein | |
| 194 | CAMQZS010000001.1 | GCA947039735_00196 | CDS | open | 196244-196843 | _na 199_aa | hypothetical protein | |
| 195 | CAMQZS010000001.1 | GCA947039735_00197 | CDS | open | 196858-198297 | _na 479_aa | Permease | |
| 196 | CAMQZS010000001.1 | GCA947039735_00198 | CDS | open | 198360-199664 | _na 434_aa | 4-hydroxybutyrate coenzyme A transferase | |
| 197 | CAMQZS010000001.1 | GCA947039735_00199 | CDS | open | 199756-201207 | _na 483_aa | yoaI | Gamma-aminobutyrate metabolism dehydratase/isomerase |
| 198 | CAMQZS010000001.1 | GCA947039735_00200 | CDS | open | 201616-201909 | _na 97_aa | NifU-like protein | |
| 199 | CAMQZS010000001.1 | GCA947039735_00201 | CDS | open | 201906-202568 | _na 220_aa | 4Fe-4S ferredoxin-type domain-containing protein | |
| 200 | CAMQZS010000001.1 | GCA947039735_00202 | CDS | open | 202592-202828 | _na 78_aa | Acyl carrier protein | |
| 201 | CAMQZS010000001.1 | GCA947039735_00203 | CDS | open | 202831-203502 | _na 223_aa | Metallo-beta-lactamase domain protein | |
| 202 | CAMQZS010000001.1 | GCA947039735_00204 | CDS | open | 203486-204553 | _na 355_aa | luxE | Acyl-protein synthetase%2C LuxE |
| 203 | CAMQZS010000001.1 | GCA947039735_00205 | CDS | open | 204540-205721 | _na 393_aa | Acyl-CoA reductase (LuxC) | |
| 204 | CAMQZS010000001.1 | GCA947039735_00206 | CDS | open | 205734-207143 | _na 469_aa | AMP-binding enzyme | |
| 205 | CAMQZS010000001.1 | GCA947039735_00207 | CDS | open | 207242-208702 | _na 486_aa | PAS domain S-box protein | |
| 206 | CAMQZS010000001.1 | GCA947039735_00208 | CDS | open | 208767-209132 | _na 121_aa | DUF134 domain-containing protein | |
| 207 | CAMQZS010000001.1 | GCA947039735_00209 | CDS | open | 209125-209961 | _na 278_aa | Iron-sulfur cluster carrier protein | |
| 208 | CAMQZS010000001.1 | GCA947039735_00210 | CDS | open | 210037-210648 | _na 203_aa | Amidohydrolase 3 domain-containing protein | |
| 209 | CAMQZS010000001.1 | GCA947039735_00211 | CDS | open | 210803-210946 | _na 47_aa | hypothetical protein | |
| 210 | CAMQZS010000001.1 | GCA947039735_00212 | CDS | open | 211000-211296 | _na 98_aa | hypothetical protein | |
| 211 | CAMQZS010000001.1 | GCA947039735_00213 | CDS | open | 211315-212481 | _na 388_aa | DNA polymerase IV | |
| 212 | CAMQZS010000001.1 | GCA947039735_00214 | CDS | open | 212797-213702 | _na 301_aa | lysR | LysR substrate binding domain protein |
| 213 | CAMQZS010000001.1 | GCA947039735_00215 | CDS | open | 214141-215019 | _na 292_aa | Type VII secretion system protein EssD-like domain-containing protein | |
| 214 | CAMQZS010000001.1 | GCA947039735_00216 | CDS | open | 215050-215469 | _na 139_aa | Positive regulator of sigma(E)%2C RseC/MucC | |
| 215 | CAMQZS010000001.1 | GCA947039735_00001 | gene | open | 891-4097 | carB | ||
| 216 | CAMQZS010000001.1 | GCA947039735_00002 | gene | open | 4099-5157 | |||
| 217 | CAMQZS010000001.1 | GCA947039735_00003 | gene | open | 5154-6449 | |||
| 218 | CAMQZS010000001.1 | GCA947039735_00004 | gene | open | 6427-7368 | |||
| 219 | CAMQZS010000001.1 | GCA947039735_00005 | gene | open | 7604-8152 | pyrR | ||
| 220 | CAMQZS010000001.1 | GCA947039735_00006 | gene | open | 8165-9082 | |||
| 221 | CAMQZS010000001.1 | GCA947039735_00007 | gene | open | 9092-9529 | lspA | ||
| 222 | CAMQZS010000001.1 | GCA947039735_00008 | gene | open | 9595-9906 | |||
| 223 | CAMQZS010000001.1 | GCA947039735_00009 | gene | open | 10027-10509 | |||
| 224 | CAMQZS010000001.1 | GCA947039735_00010 | gene | open | 10506-10949 | |||
| 225 | CAMQZS010000001.1 | GCA947039735_00011 | gene | open | 11046-11384 | rplQ | ||
| 226 | CAMQZS010000001.1 | GCA947039735_00012 | gene | open | 11402-12379 | |||
| 227 | CAMQZS010000001.1 | GCA947039735_00013 | gene | open | 12424-12816 | rpsK | ||
| 228 | CAMQZS010000001.1 | GCA947039735_00014 | gene | open | 12845-13213 | rpsM | ||
| 229 | CAMQZS010000001.1 | GCA947039735_00015 | gene | open | 13236-13349 | rpmJ | ||
| 230 | CAMQZS010000001.1 | GCA947039735_00016 | gene | open | 13374-13592 | infA | ||
| 231 | CAMQZS010000001.1 | GCA947039735_00017 | gene | open | 13585-13881 | |||
| 232 | CAMQZS010000001.1 | GCA947039735_00018 | gene | open | 13878-14672 | map | ||
| 233 | CAMQZS010000001.1 | GCA947039735_00019 | gene | open | 14626-15276 | |||
| 234 | CAMQZS010000001.1 | GCA947039735_00020 | gene | open | 15291-16553 | secY | ||
| 235 | CAMQZS010000001.1 | GCA947039735_00021 | gene | open | 16555-16995 | rplO | ||
| 236 | CAMQZS010000001.1 | GCA947039735_00022 | gene | open | 17017-17196 | rpmD | ||
| 237 | CAMQZS010000001.1 | GCA947039735_00023 | gene | open | 17214-17714 | rpsE | ||
| 238 | CAMQZS010000001.1 | GCA947039735_00024 | gene | open | 17733-18092 | rplR | ||
| 239 | CAMQZS010000001.1 | GCA947039735_00025 | gene | open | 18127-18669 | rplF | ||
| 240 | CAMQZS010000001.1 | GCA947039735_00026 | gene | open | 18687-19079 | rpsH | ||
| 241 | CAMQZS010000001.1 | GCA947039735_00027 | gene | open | 19109-19378 | rpsN | ||
| 242 | CAMQZS010000001.1 | GCA947039735_00028 | gene | open | 19394-19936 | rplE | ||
| 243 | CAMQZS010000001.1 | GCA947039735_00029 | gene | open | 19959-20276 | rplX | ||
| 244 | CAMQZS010000001.1 | GCA947039735_00030 | gene | open | 20295-20663 | rplN | ||
| 245 | CAMQZS010000001.1 | GCA947039735_00031 | gene | open | 20690-20944 | rpsQ | ||
| 246 | CAMQZS010000001.1 | GCA947039735_00032 | gene | open | 20982-21182 | rpmC | ||
| 247 | CAMQZS010000001.1 | GCA947039735_00033 | gene | open | 21172-21609 | rplP | ||
| 248 | CAMQZS010000001.1 | GCA947039735_00034 | gene | open | 21609-22280 | rpsC | ||
| 249 | CAMQZS010000001.1 | GCA947039735_00035 | gene | open | 22294-22629 | rplV | ||
| 250 | CAMQZS010000001.1 | GCA947039735_00036 | gene | open | 22644-22922 | rpsS | ||
| 251 | CAMQZS010000001.1 | GCA947039735_00037 | gene | open | 22945-23772 | rplB | ||
| 252 | CAMQZS010000001.1 | GCA947039735_00038 | gene | open | 23804-24088 | rplW | ||
| 253 | CAMQZS010000001.1 | GCA947039735_00039 | gene | open | 24088-24711 | rplD | ||
| 254 | CAMQZS010000001.1 | GCA947039735_00040 | gene | open | 24744-25382 | rplC | ||
| 255 | CAMQZS010000001.1 | GCA947039735_00041 | gene | open | 25397-25708 | rpsJ | ||
| 256 | CAMQZS010000001.1 | GCA947039735_00042 | gene | open | 26053-27240 | tuf | ||
| 257 | CAMQZS010000001.1 | GCA947039735_00043 | gene | open | 27273-29345 | fusA | ||
| 258 | CAMQZS010000001.1 | GCA947039735_00044 | gene | open | 29377-29847 | rpsG | ||
| 259 | CAMQZS010000001.1 | GCA947039735_00045 | gene | open | 29893-30264 | rpsL | ||
| 260 | CAMQZS010000001.1 | GCA947039735_00046 | gene | open | 30343-30588 | |||
| 261 | CAMQZS010000001.1 | GCA947039735_00047 | gene | open | 30829-35058 | rpoC | ||
| 262 | CAMQZS010000001.1 | GCA947039735_00048 | gene | open | 35080-38796 | rpoB | ||
| 263 | CAMQZS010000001.1 | GCA947039735_00049 | gene | open | 39006-40262 | tyrS | ||
| 264 | CAMQZS010000001.1 | GCA947039735_00050 | gene | open | 40330-42261 | |||
| 265 | CAMQZS010000001.1 | GCA947039735_00051 | gene | open | 42453-43691 | |||
| 266 | CAMQZS010000001.1 | GCA947039735_00052 | gene | open | 43832-45073 | |||
| 267 | CAMQZS010000001.1 | GCA947039735_00053 | gene | open | 45122-45778 | |||
| 268 | CAMQZS010000001.1 | GCA947039735_00054 | gene | open | 45775-47475 | |||
| 269 | CAMQZS010000001.1 | GCA947039735_00055 | gene | open | 47691-48137 | |||
| 270 | CAMQZS010000001.1 | GCA947039735_00056 | gene | open | 48436-49875 | |||
| 271 | CAMQZS010000001.1 | GCA947039735_00060 | gene | open | 50461-51312 | speE | ||
| 272 | CAMQZS010000001.1 | GCA947039735_00061 | gene | open | 51587-55915 | |||
| 273 | CAMQZS010000001.1 | GCA947039735_00062 | gene | open | 56026-57210 | |||
| 274 | CAMQZS010000001.1 | GCA947039735_00063 | gene | open | 57221-57775 | |||
| 275 | CAMQZS010000001.1 | GCA947039735_00064 | gene | open | 57896-58663 | |||
| 276 | CAMQZS010000001.1 | GCA947039735_00065 | gene | open | 58672-59322 | |||
| 277 | CAMQZS010000001.1 | GCA947039735_00066 | gene | open | 59353-60153 | |||
| 278 | CAMQZS010000001.1 | GCA947039735_00067 | gene | open | 60302-60805 | |||
| 279 | CAMQZS010000001.1 | GCA947039735_00068 | gene | open | 60760-60849 | |||
| 280 | CAMQZS010000001.1 | GCA947039735_00069 | gene | open | 60839-61168 | |||
| 281 | CAMQZS010000001.1 | GCA947039735_00070 | gene | open | 61181-62089 | |||
| 282 | CAMQZS010000001.1 | GCA947039735_00071 | gene | open | 62099-63043 | |||
| 283 | CAMQZS010000001.1 | GCA947039735_00072 | gene | open | 63167-64144 | |||
| 284 | CAMQZS010000001.1 | GCA947039735_00073 | gene | open | 64296-65597 | eno | ||
| 285 | CAMQZS010000001.1 | GCA947039735_00074 | gene | open | 65678-66478 | |||
| 286 | CAMQZS010000001.1 | GCA947039735_00075 | gene | open | 66662-68008 | |||
| 287 | CAMQZS010000001.1 | GCA947039735_00076 | gene | open | 68105-68536 | |||
| 288 | CAMQZS010000001.1 | GCA947039735_00077 | gene | open | 68777-69583 | |||
| 289 | CAMQZS010000001.1 | GCA947039735_00078 | gene | open | 69707-70012 | trxA | ||
| 290 | CAMQZS010000001.1 | GCA947039735_00079 | gene | open | 70062-70460 | |||
| 291 | CAMQZS010000001.1 | GCA947039735_00080 | gene | open | 70609-71022 | |||
| 292 | CAMQZS010000001.1 | GCA947039735_00081 | gene | open | 71037-71594 | |||
| 293 | CAMQZS010000001.1 | GCA947039735_00082 | gene | open | 71904-72569 | |||
| 294 | CAMQZS010000001.1 | GCA947039735_00083 | gene | open | 72600-72989 | nusG | ||
| 295 | CAMQZS010000001.1 | GCA947039735_00084 | gene | open | 73000-73524 | |||
| 296 | CAMQZS010000001.1 | GCA947039735_00085 | gene | open | 73591-74157 | |||
| 297 | CAMQZS010000001.1 | GCA947039735_00086 | gene | open | 74173-74733 | |||
| 298 | CAMQZS010000001.1 | GCA947039735_00087 | gene | open | 74744-76093 | |||
| 299 | CAMQZS010000001.1 | GCA947039735_00089 | gene | open | 76815-77849 | pta | ||
| 300 | CAMQZS010000001.1 | GCA947039735_00090 | gene | open | 78062-78601 | |||
| 301 | CAMQZS010000001.1 | GCA947039735_00091 | gene | open | 78603-79349 | |||
| 302 | CAMQZS010000001.1 | GCA947039735_00092 | gene | open | 79351-80418 | |||
| 303 | CAMQZS010000001.1 | GCA947039735_00093 | gene | open | 80433-80642 | |||
| 304 | CAMQZS010000001.1 | GCA947039735_00094 | gene | open | 80672-81349 | |||
| 305 | CAMQZS010000001.1 | GCA947039735_00095 | gene | open | 81786-82331 | |||
| 306 | CAMQZS010000001.1 | GCA947039735_00096 | gene | open | 82790-84073 | |||
| 307 | CAMQZS010000001.1 | GCA947039735_00097 | gene | open | 84075-85346 | |||
| 308 | CAMQZS010000001.1 | GCA947039735_00098 | gene | open | 85346-86083 | |||
| 309 | CAMQZS010000001.1 | GCA947039735_00099 | gene | open | 86294-87247 | |||
| 310 | CAMQZS010000001.1 | GCA947039735_00100 | gene | open | 87164-87724 | |||
| 311 | CAMQZS010000001.1 | GCA947039735_00101 | gene | open | 87718-88665 | |||
| 312 | CAMQZS010000001.1 | GCA947039735_00102 | gene | open | 88720-90045 | dnaB | ||
| 313 | CAMQZS010000001.1 | GCA947039735_00103 | gene | open | 90057-91964 | lonC | ||
| 314 | CAMQZS010000001.1 | GCA947039735_00104 | gene | open | 91981-92427 | rplI | ||
| 315 | CAMQZS010000001.1 | GCA947039735_00105 | gene | open | 92424-94445 | |||
| 316 | CAMQZS010000001.1 | GCA947039735_00106 | gene | open | 94464-95408 | |||
| 317 | CAMQZS010000001.1 | GCA947039735_00107 | gene | open | 95507-97168 | |||
| 318 | CAMQZS010000001.1 | GCA947039735_00108 | gene | open | 97394-98320 | |||
| 319 | CAMQZS010000001.1 | GCA947039735_00109 | gene | open | 98351-99151 | |||
| 320 | CAMQZS010000001.1 | GCA947039735_00110 | gene | open | 99165-99665 | sixA | ||
| 321 | CAMQZS010000001.1 | GCA947039735_00111 | gene | open | 99683-100060 | arsR | ||
| 322 | CAMQZS010000001.1 | GCA947039735_00112 | gene | open | 100167-100667 | |||
| 323 | CAMQZS010000001.1 | GCA947039735_00113 | gene | open | 100673-101485 | |||
| 324 | CAMQZS010000001.1 | GCA947039735_00114 | gene | open | 101478-102152 | |||
| 325 | CAMQZS010000001.1 | GCA947039735_00115 | gene | open | 102343-103263 | |||
| 326 | CAMQZS010000001.1 | GCA947039735_00116 | gene | open | 103369-103995 | |||
| 327 | CAMQZS010000001.1 | GCA947039735_00117 | gene | open | 104367-104651 | fixX | ||
| 328 | CAMQZS010000001.1 | GCA947039735_00118 | gene | open | 104653-105948 | |||
| 329 | CAMQZS010000001.1 | GCA947039735_00119 | gene | open | 105995-106708 | |||
| 330 | CAMQZS010000001.1 | GCA947039735_00120 | gene | open | 106701-107609 | |||
| 331 | CAMQZS010000001.1 | GCA947039735_00121 | gene | open | 107633-108646 | |||
| 332 | CAMQZS010000001.1 | GCA947039735_00122 | gene | open | 108677-110839 | ldhH | ||
| 333 | CAMQZS010000001.1 | GCA947039735_00123 | gene | open | 110855-111400 | |||
| 334 | CAMQZS010000001.1 | GCA947039735_00124 | gene | open | 111922-112293 | |||
| 335 | CAMQZS010000001.1 | GCA947039735_00125 | gene | open | 112295-113563 | |||
| 336 | CAMQZS010000001.1 | GCA947039735_00126 | gene | open | 113563-115029 | |||
| 337 | CAMQZS010000001.1 | GCA947039735_00127 | gene | open | 115258-115983 | |||
| 338 | CAMQZS010000001.1 | GCA947039735_00128 | gene | open | 116014-117516 | glpK | ||
| 339 | CAMQZS010000001.1 | GCA947039735_00129 | gene | open | 117832-118779 | |||
| 340 | CAMQZS010000001.1 | GCA947039735_00130 | gene | open | 118919-119194 | |||
| 341 | CAMQZS010000001.1 | GCA947039735_00131 | gene | open | 119194-119670 | |||
| 342 | CAMQZS010000001.1 | GCA947039735_00132 | gene | open | 120075-120515 | marR | ||
| 343 | CAMQZS010000001.1 | GCA947039735_00133 | gene | open | 120667-122235 | hcp | ||
| 344 | CAMQZS010000001.1 | GCA947039735_00134 | gene | open | 122317-123726 | |||
| 345 | CAMQZS010000001.1 | GCA947039735_00135 | gene | open | 123989-124996 | |||
| 346 | CAMQZS010000001.1 | GCA947039735_00136 | gene | open | 125170-126141 | |||
| 347 | CAMQZS010000001.1 | GCA947039735_00137 | gene | open | 126508-127326 | |||
| 348 | CAMQZS010000001.1 | GCA947039735_00138 | gene | open | 127338-128453 | |||
| 349 | CAMQZS010000001.1 | GCA947039735_00139 | gene | open | 128455-129846 | |||
| 350 | CAMQZS010000001.1 | GCA947039735_00140 | gene | open | 129889-131322 | |||
| 351 | CAMQZS010000001.1 | GCA947039735_00141 | gene | open | 131430-132197 | tatD | ||
| 352 | CAMQZS010000001.1 | GCA947039735_00142 | gene | open | 132199-134136 | metG | ||
| 353 | CAMQZS010000001.1 | GCA947039735_00143 | gene | open | 134177-135019 | rsmI | ||
| 354 | CAMQZS010000001.1 | GCA947039735_00144 | gene | open | 135003-135761 | |||
| 355 | CAMQZS010000001.1 | GCA947039735_00145 | gene | open | 135751-136593 | |||
| 356 | CAMQZS010000001.1 | GCA947039735_00146 | gene | open | 136594-137586 | |||
| 357 | CAMQZS010000001.1 | GCA947039735_00147 | gene | open | 137728-138426 | |||
| 358 | CAMQZS010000001.1 | GCA947039735_00148 | gene | open | 138431-139885 | |||
| 359 | CAMQZS010000001.1 | GCA947039735_00149 | gene | open | 140353-141198 | |||
| 360 | CAMQZS010000001.1 | GCA947039735_00150 | gene | open | 141258-141704 | |||
| 361 | CAMQZS010000001.1 | GCA947039735_00151 | gene | open | 141880-142314 | marR | ||
| 362 | CAMQZS010000001.1 | GCA947039735_00152 | gene | open | 142368-143507 | sfsA | ||
| 363 | CAMQZS010000001.1 | GCA947039735_00153 | gene | open | 144341-144976 | |||
| 364 | CAMQZS010000001.1 | GCA947039735_00154 | gene | open | 144997-145563 | |||
| 365 | CAMQZS010000001.1 | GCA947039735_00155 | gene | open | 145695-146087 | |||
| 366 | CAMQZS010000001.1 | GCA947039735_00156 | gene | open | 146094-146318 | |||
| 367 | CAMQZS010000001.1 | GCA947039735_00157 | gene | open | 146311-147363 | |||
| 368 | CAMQZS010000001.1 | GCA947039735_00158 | gene | open | 147424-147849 | |||
| 369 | CAMQZS010000001.1 | GCA947039735_00159 | gene | open | 147978-150431 | gyrA | ||
| 370 | CAMQZS010000001.1 | GCA947039735_00160 | gene | open | 150703-151425 | |||
| 371 | CAMQZS010000001.1 | GCA947039735_00161 | gene | open | 151431-152795 | |||
| 372 | CAMQZS010000001.1 | GCA947039735_00162 | gene | open | 152916-153347 | ybaN | ||
| 373 | CAMQZS010000001.1 | GCA947039735_00163 | gene | open | 153442-154896 | |||
| 374 | CAMQZS010000001.1 | GCA947039735_00164 | gene | open | 155163-157235 | |||
| 375 | CAMQZS010000001.1 | GCA947039735_00165 | gene | open | 157462-158289 | |||
| 376 | CAMQZS010000001.1 | GCA947039735_00166 | gene | open | 158670-159248 | |||
| 377 | CAMQZS010000001.1 | GCA947039735_00167 | gene | open | 159453-160277 | |||
| 378 | CAMQZS010000001.1 | GCA947039735_00168 | gene | open | 160395-161075 | queC | ||
| 379 | CAMQZS010000001.1 | GCA947039735_00169 | gene | open | 161244-162989 | pyk | ||
| 380 | CAMQZS010000001.1 | GCA947039735_00170 | gene | open | 163048-165276 | fusA | ||
| 381 | CAMQZS010000001.1 | GCA947039735_00171 | gene | open | 165486-167081 | |||
| 382 | CAMQZS010000001.1 | GCA947039735_00172 | gene | open | 167074-169743 | |||
| 383 | CAMQZS010000001.1 | GCA947039735_00173 | gene | open | 170008-171375 | |||
| 384 | CAMQZS010000001.1 | GCA947039735_00174 | gene | open | 171542-172432 | |||
| 385 | CAMQZS010000001.1 | GCA947039735_00175 | gene | open | 172496-173815 | |||
| 386 | CAMQZS010000001.1 | GCA947039735_00176 | gene | open | 173767-173886 | |||
| 387 | CAMQZS010000001.1 | GCA947039735_00177 | gene | open | 174080-174982 | |||
| 388 | CAMQZS010000001.1 | GCA947039735_00178 | gene | open | 175071-176003 | |||
| 389 | CAMQZS010000001.1 | GCA947039735_00179 | gene | open | 176034-177011 | |||
| 390 | CAMQZS010000001.1 | GCA947039735_00180 | gene | open | 177124-177690 | pth | ||
| 391 | CAMQZS010000001.1 | GCA947039735_00181 | gene | open | 177709-178674 | |||
| 392 | CAMQZS010000001.1 | GCA947039735_00182 | gene | open | 178749-180122 | glmU | ||
| 393 | CAMQZS010000001.1 | GCA947039735_00183 | gene | open | 180292-180876 | |||
| 394 | CAMQZS010000001.1 | GCA947039735_00184 | gene | open | 181105-182688 | |||
| 395 | CAMQZS010000001.1 | GCA947039735_00185 | gene | open | 182842-184032 | |||
| 396 | CAMQZS010000001.1 | GCA947039735_00186 | gene | open | 184272-187253 | yhaN | ||
| 397 | CAMQZS010000001.1 | GCA947039735_00187 | gene | open | 187259-188524 | |||
| 398 | CAMQZS010000001.1 | GCA947039735_00188 | gene | open | 188517-189920 | gntR | ||
| 399 | CAMQZS010000001.1 | GCA947039735_00189 | gene | open | 190111-191103 | bioB | ||
| 400 | CAMQZS010000001.1 | GCA947039735_00190 | gene | open | 191088-192392 | |||
| 401 | CAMQZS010000001.1 | GCA947039735_00191 | gene | open | 192646-192840 | thiS | ||
| 402 | CAMQZS010000001.1 | GCA947039735_00192 | gene | open | 192894-193664 | |||
| 403 | CAMQZS010000001.1 | GCA947039735_00193 | gene | open | 193679-194842 | thiH | ||
| 404 | CAMQZS010000001.1 | GCA947039735_00194 | gene | open | 195083-195691 | |||
| 405 | CAMQZS010000001.1 | GCA947039735_00195 | gene | open | 195694-196197 | |||
| 406 | CAMQZS010000001.1 | GCA947039735_00196 | gene | open | 196244-196843 | |||
| 407 | CAMQZS010000001.1 | GCA947039735_00197 | gene | open | 196858-198297 | |||
| 408 | CAMQZS010000001.1 | GCA947039735_00198 | gene | open | 198360-199664 | |||
| 409 | CAMQZS010000001.1 | GCA947039735_00199 | gene | open | 199756-201207 | yoaI | ||
| 410 | CAMQZS010000001.1 | GCA947039735_00200 | gene | open | 201616-201909 | |||
| 411 | CAMQZS010000001.1 | GCA947039735_00201 | gene | open | 201906-202568 | |||
| 412 | CAMQZS010000001.1 | GCA947039735_00202 | gene | open | 202592-202828 | |||
| 413 | CAMQZS010000001.1 | GCA947039735_00203 | gene | open | 202831-203502 | |||
| 414 | CAMQZS010000001.1 | GCA947039735_00204 | gene | open | 203486-204553 | luxE | ||
| 415 | CAMQZS010000001.1 | GCA947039735_00205 | gene | open | 204540-205721 | |||
| 416 | CAMQZS010000001.1 | GCA947039735_00206 | gene | open | 205734-207143 | |||
| 417 | CAMQZS010000001.1 | GCA947039735_00207 | gene | open | 207242-208702 | |||
| 418 | CAMQZS010000001.1 | GCA947039735_00208 | gene | open | 208767-209132 | |||
| 419 | CAMQZS010000001.1 | GCA947039735_00209 | gene | open | 209125-209961 | |||
| 420 | CAMQZS010000001.1 | GCA947039735_00210 | gene | open | 210037-210648 | |||
| 421 | CAMQZS010000001.1 | GCA947039735_00211 | gene | open | 210803-210946 | |||
| 422 | CAMQZS010000001.1 | GCA947039735_00212 | gene | open | 211000-211296 | |||
| 423 | CAMQZS010000001.1 | GCA947039735_00213 | gene | open | 211315-212481 | |||
| 424 | CAMQZS010000001.1 | GCA947039735_00214 | gene | open | 212797-213702 | lysR | ||
| 425 | CAMQZS010000001.1 | GCA947039735_00215 | gene | open | 214141-215019 | |||
| 426 | CAMQZS010000001.1 | GCA947039735_00216 | gene | open | 215050-215469 | |||
| 427 | CAMQZS010000001.1 | GCA947039735_00057 | gene | open | 50140-50215 | trnK | ||
| 428 | CAMQZS010000001.1 | GCA947039735_00058 | gene | open | 50219-50293 | trnQ | ||
| 429 | CAMQZS010000001.1 | GCA947039735_00059 | gene | open | 50295-50370 | trnH | ||
| 430 | CAMQZS010000001.1 | GCA947039735_00088 | gene | open | 76360-76436 | trnR | ||
| 431 | CAMQZS010000001.1 | GCA947039735_00057 | tRNA | open | 50140-50215 | trnK | tRNA-Lys(ttt) | |
| 432 | CAMQZS010000001.1 | GCA947039735_00058 | tRNA | open | 50219-50293 | trnQ | tRNA-Gln(ttg) | |
| 433 | CAMQZS010000001.1 | GCA947039735_00059 | tRNA | open | 50295-50370 | trnH | tRNA-His(gtg) | |
| 434 | CAMQZS010000001.1 | GCA947039735_00088 | tRNA | open | 76360-76436 | trnR | tRNA-Arg(cct) | |
| 435 | CAMQZS010000002.1 | GCA947039735_00263 | gene | open | 53941-54071 | SpR18_sRNA | ||
| 436 | CAMQZS010000002.1 | GCA947039735_00269 | gene | open | 62075-62205 | SpR18_sRNA | ||
| 437 | CAMQZS010000002.1 | GCA947039735_00263 | ncRNA | open | 53941-54071 | Streptococcus sRNA SpR18 | ||
| 438 | CAMQZS010000002.1 | GCA947039735_00269 | ncRNA | open | 62075-62205 | Streptococcus sRNA SpR18 | ||
| 439 | CAMQZS010000002.1 | regulatory_region | open | 71703-71907 | T-box leader | |||
| 440 | CAMQZS010000002.1 | regulatory_region | open | 77119-77359 | T-box leader | |||
| 441 | CAMQZS010000002.1 | regulatory_region | open | 169290-169378 | Glycine riboswitch aptamer | |||
| 442 | CAMQZS010000002.1 | regulatory_region | open | 189081-189332 | T-box leader | |||
| 443 | CAMQZS010000002.1 | regulatory_region | open | 189497-189592 | SAM riboswitch aptamer (S box leader) | |||
| 444 | CAMQZS010000002.1 | repeat_region | open | 42597-44030 | CRISPR array with 22 repeats of length 36%2C consensus sequence GTTTTAGACATTTATAGAATTACATTACTCTCAAAC and spacer length 30 | |||
| 445 | CAMQZS010000002.1 | GCA947039735_00217 | CDS | open | 901-1689 | _na 262_aa | fhuC | Ferrichrome ABC transporter%2C ATP-binding protein FhuC |
| 446 | CAMQZS010000002.1 | GCA947039735_00218 | CDS | open | 1682-2695 | _na 337_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 447 | CAMQZS010000002.1 | GCA947039735_00219 | CDS | open | 2692-3657 | _na 321_aa | Periplasmic binding protein | |
| 448 | CAMQZS010000002.1 | GCA947039735_00220 | CDS | open | 3901-4332 | _na 143_aa | Bacterial sensory transduction regulator | |
| 449 | CAMQZS010000002.1 | GCA947039735_00221 | CDS | open | 4775-5209 | _na 144_aa | Very short patch repair endonuclease | |
| 450 | CAMQZS010000002.1 | GCA947039735_00222 | CDS | open | 5422-5970 | _na 182_aa | RNA polymerase sigma factor%2C sigma-70 family | |
| 451 | CAMQZS010000002.1 | GCA947039735_00223 | CDS | open | 6159-6392 | _na 77_aa | DUF2922 domain-containing protein | |
| 452 | CAMQZS010000002.1 | GCA947039735_00224 | CDS | open | 6425-6622 | _na 65_aa | DUF1659 domain-containing protein | |
| 453 | CAMQZS010000002.1 | GCA947039735_00225 | CDS | open | 6647-7180 | _na 177_aa | N-acetylmuramoyl-L-alanine amidase | |
| 454 | CAMQZS010000002.1 | GCA947039735_00226 | CDS | open | 7152-7400 | _na 82_aa | hypothetical protein | |
| 455 | CAMQZS010000002.1 | GCA947039735_00227 | CDS | open | 7454-8761 | _na 435_aa | Phage replisome organizer N-terminal domain protein | |
| 456 | CAMQZS010000002.1 | GCA947039735_00228 | CDS | open | 9316-11223 | _na 635_aa | thrS | threonine--tRNA ligase |
| 457 | CAMQZS010000002.1 | GCA947039735_00229 | CDS | open | 11550-12371 | _na 273_aa | Putative pyruvate%2C phosphate dikinase regulatory protein | |
| 458 | CAMQZS010000002.1 | GCA947039735_00230 | CDS | open | 12373-13017 | _na 214_aa | HTH domain protein | |
| 459 | CAMQZS010000002.1 | GCA947039735_00231 | CDS | open | 13110-15479 | _na 789_aa | ppsA | phosphoenolpyruvate synthase |
| 460 | CAMQZS010000002.1 | GCA947039735_00232 | CDS | open | 15769-17871 | _na 700_aa | peptidoglycan glycosyltransferase | |
| 461 | CAMQZS010000002.1 | GCA947039735_00233 | CDS | open | 17929-19113 | _na 394_aa | cytX | Hydroxymethylpyrimidine transporter CytX |
| 462 | CAMQZS010000002.1 | GCA947039735_00234 | CDS | open | 19324-20424 | _na 366_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 463 | CAMQZS010000002.1 | GCA947039735_00235 | CDS | open | 20434-21141 | _na 235_aa | ABC transporter%2C ATP-binding protein | |
| 464 | CAMQZS010000002.1 | GCA947039735_00236 | CDS | open | 21131-22348 | _na 405_aa | Efflux ABC transporter%2C permease protein | |
| 465 | CAMQZS010000002.1 | GCA947039735_00237 | CDS | open | 22495-23736 | _na 413_aa | LL-diaminopimelate aminotransferase | |
| 466 | CAMQZS010000002.1 | GCA947039735_00238 | CDS | open | 23750-24856 | _na 368_aa | ychF | redox-regulated ATPase YchF |
| 467 | CAMQZS010000002.1 | GCA947039735_00239 | CDS | open | 25151-25360 | _na 69_aa | helix-turn-helix transcriptional regulator | |
| 468 | CAMQZS010000002.1 | GCA947039735_00240 | CDS | open | 25362-27182 | _na 606_aa | class I SAM-dependent DNA methyltransferase | |
| 469 | CAMQZS010000002.1 | GCA947039735_00241 | CDS | open | 27179-28345 | _na 388_aa | restriction endonuclease subunit S | |
| 470 | CAMQZS010000002.1 | GCA947039735_00242 | CDS | open | 28361-31513 | _na 1050_aa | type I restriction endonuclease subunit R | |
| 471 | CAMQZS010000002.1 | GCA947039735_00243 | CDS | open | 31636-31815 | _na 59_aa | hypothetical protein | |
| 472 | CAMQZS010000002.1 | GCA947039735_00244 | CDS | open | 31928-32296 | _na 122_aa | Type II toxin-antitoxin system RelE/ParE family toxin | |
| 473 | CAMQZS010000002.1 | GCA947039735_00245 | CDS | open | 32293-32571 | _na 92_aa | XRE family transcriptional regulator | |
| 474 | CAMQZS010000002.1 | GCA947039735_00246 | CDS | open | 32578-33324 | _na 248_aa | terL | terminase TerL endonuclease subunit |
| 475 | CAMQZS010000002.1 | GCA947039735_00247 | CDS | open | 33744-34367 | _na 207_aa | Formiminotransferase-cyclodeaminase | |
| 476 | CAMQZS010000002.1 | GCA947039735_00248 | CDS | open | 34367-36043 | _na 558_aa | formate--tetrahydrofolate ligase | |
| 477 | CAMQZS010000002.1 | GCA947039735_00249 | CDS | open | 36311-38212 | _na 633_aa | Glutamate--ammonia ligase%2C catalytic domain protein | |
| 478 | CAMQZS010000002.1 | GCA947039735_00250 | CDS | open | 38362-38808 | _na 148_aa | YqeY-like protein | |
| 479 | CAMQZS010000002.1 | GCA947039735_00251 | CDS | open | 38834-39013 | _na 59_aa | rpsU | 30S ribosomal protein S21 |
| 480 | CAMQZS010000002.1 | GCA947039735_00252 | CDS | open | 39176-40984 | _na 602_aa | DUF4127 domain-containing protein | |
| 481 | CAMQZS010000002.1 | GCA947039735_00253 | CDS | open | 41032-41706 | _na 224_aa | Glycine transporter domain-containing protein | |
| 482 | CAMQZS010000002.1 | GCA947039735_00254 | CDS | open | 41825-42298 | _na 157_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 483 | CAMQZS010000002.1 | GCA947039735_00255 | CDS | open | 44094-44768 | _na 224_aa | csn2 | type II-A CRISPR-associated protein Csn2 |
| 484 | CAMQZS010000002.1 | GCA947039735_00256 | CDS | open | 44765-45070 | _na 101_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 485 | CAMQZS010000002.1 | GCA947039735_00257 | CDS | open | 45075-45950 | _na 291_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 486 | CAMQZS010000002.1 | GCA947039735_00258 | CDS | open | 45963-50003 | _na 1346_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 487 | CAMQZS010000002.1 | GCA947039735_00260 | CDS | open | 51292-52173 | _na 293_aa | Abortive infection bacteriophage resistance protein | |
| 488 | CAMQZS010000002.1 | GCA947039735_00261 | CDS | open | 52447-53448 | _na 333_aa | Cytosine-specific methyltransferase | |
| 489 | CAMQZS010000002.1 | GCA947039735_00262 | CDS | open | 53546-53656 | _na 36_aa | hypothetical protein | |
| 490 | CAMQZS010000002.1 | GCA947039735_00264 | CDS | open | 54041-54232 | _na 63_aa | hypothetical protein | |
| 491 | CAMQZS010000002.1 | GCA947039735_00265 | CDS | open | 54284-56455 | _na 723_aa | AAA family ATPase | |
| 492 | CAMQZS010000002.1 | GCA947039735_00266 | CDS | open | 56969-57409 | _na 146_aa | DNA adenine methylase | |
| 493 | CAMQZS010000002.1 | GCA947039735_00267 | CDS | open | 57573-59555 | _na 660_aa | alwI | AlwI restriction endonuclease |
| 494 | CAMQZS010000002.1 | GCA947039735_00268 | CDS | open | 59556-61724 | _na 722_aa | Site-specific DNA-methyltransferase (adenine-specific) | |
| 495 | CAMQZS010000002.1 | GCA947039735_00270 | CDS | open | 62233-63768 | _na 511_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 496 | CAMQZS010000002.1 | GCA947039735_00271 | CDS | open | 63979-64374 | _na 131_aa | rpsI | 30S ribosomal protein S9 |
| 497 | CAMQZS010000002.1 | GCA947039735_00272 | CDS | open | 64393-64833 | _na 146_aa | rplM | 50S ribosomal protein L13 |
| 498 | CAMQZS010000002.1 | GCA947039735_00273 | CDS | open | 64973-65728 | _na 251_aa | rex | redox-sensing transcriptional repressor Rex |
| 499 | CAMQZS010000002.1 | GCA947039735_00274 | CDS | open | 65718-66983 | _na 421_aa | O-antigen polymerase | |
| 500 | CAMQZS010000002.1 | GCA947039735_00275 | CDS | open | 67124-67537 | _na 137_aa | Toxin-antitoxin system%2C antitoxin component%2C Xre domain protein |

