HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella pallens (GCA_947062025.1)

Select a Genome:
BAKTA Annotations for GCA_947062025.1
Genome Selected: Prevotella pallens
ContigsBases CDSrRNA tmRNAtRNA
123 2520277 1986 0 1 27
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4047 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:8]    |    Number of Records Found: 4047 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3501 CAMSPR010000073.1 GCA947062025_01746 gene open 312-3671
3502 CAMSPR010000073.1 GCA947062025_01747 gene open 3668-4663
3503 CAMSPR010000073.1 GCA947062025_01748 gene open 4676-6016
3504 CAMSPR010000073.1 GCA947062025_01749 gene open 6139-6576 dut
3505 CAMSPR010000073.1 GCA947062025_01750 gene open 6633-8336
3506 CAMSPR010000073.1 GCA947062025_01751 gene open 8333-9232
3507 CAMSPR010000073.1 GCA947062025_01752 gene open 9233-11194
3508 CAMSPR010000074.1 GCA947062025_01753 CDS open 396-686 _na     96_aa DUF721 domain-containing protein
3509 CAMSPR010000074.1 GCA947062025_01754 CDS open 679-1794 _na     371_aa recF DNA replication/repair protein RecF
3510 CAMSPR010000074.1 GCA947062025_01755 CDS open 1924-2220 _na     98_aa Glutaredoxin-related protein
3511 CAMSPR010000074.1 GCA947062025_01756 CDS open 2231-2464 _na     77_aa Metal-binding protein
3512 CAMSPR010000074.1 GCA947062025_01757 CDS open 2825-7366 _na     1513_aa Lys-gingipain W83
3513 CAMSPR010000074.1 GCA947062025_01758 CDS open 7565-9958 _na     797_aa 50S ribosomal protein L7/L12
3514 CAMSPR010000074.1 GCA947062025_01753 gene open 396-686
3515 CAMSPR010000074.1 GCA947062025_01754 gene open 679-1794 recF
3516 CAMSPR010000074.1 GCA947062025_01755 gene open 1924-2220
3517 CAMSPR010000074.1 GCA947062025_01756 gene open 2231-2464
3518 CAMSPR010000074.1 GCA947062025_01757 gene open 2825-7366
3519 CAMSPR010000074.1 GCA947062025_01758 gene open 7565-9958
3520 CAMSPR010000075.1 GCA947062025_01759 CDS open 592-3936 _na     1114_aa DNA 3'-5' helicase
3521 CAMSPR010000075.1 GCA947062025_01760 CDS open 3953-6814 _na     953_aa PD-(D/E)XK endonuclease-like domain-containing protein
3522 CAMSPR010000075.1 GCA947062025_01761 CDS open 6845-7024 _na     59_aa hypothetical protein
3523 CAMSPR010000075.1 GCA947062025_01762 CDS open 7783-10263 _na     826_aa DNA 3'-5' helicase
3524 CAMSPR010000075.1 GCA947062025_01763 CDS open 10287-11096 _na     269_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
3525 CAMSPR010000075.1 GCA947062025_01759 gene open 592-3936
3526 CAMSPR010000075.1 GCA947062025_01760 gene open 3953-6814
3527 CAMSPR010000075.1 GCA947062025_01761 gene open 6845-7024
3528 CAMSPR010000075.1 GCA947062025_01762 gene open 7783-10263
3529 CAMSPR010000075.1 GCA947062025_01763 gene open 10287-11096 mtgA
3530 CAMSPR010000076.1 GCA947062025_01764 CDS open 54-413 _na     119_aa hypothetical protein
3531 CAMSPR010000076.1 GCA947062025_01765 CDS open 401-691 _na     96_aa hypothetical protein
3532 CAMSPR010000076.1 GCA947062025_01766 CDS open 691-1077 _na     128_aa radical SAM protein
3533 CAMSPR010000076.1 GCA947062025_01767 CDS open 1197-1901 _na     234_aa TonB-linked outer membrane protein%2C SusC/RagA family
3534 CAMSPR010000076.1 GCA947062025_01768 CDS open 1889-2545 _na     218_aa Pyruvate formate-lyase activating enzyme
3535 CAMSPR010000076.1 GCA947062025_01769 CDS open 3292-3735 _na     147_aa HIRAN domain
3536 CAMSPR010000076.1 GCA947062025_01770 CDS open 4076-9715 _na     1879_aa Alpha-2-macroglobulin domain-containing protein
3537 CAMSPR010000076.1 GCA947062025_01771 CDS open 9702-10637 _na     311_aa 4-hydroxy-3-methylbut-2-enyl diphosphate reductase
3538 CAMSPR010000076.1 GCA947062025_01764 gene open 54-413
3539 CAMSPR010000076.1 GCA947062025_01765 gene open 401-691
3540 CAMSPR010000076.1 GCA947062025_01766 gene open 691-1077
3541 CAMSPR010000076.1 GCA947062025_01767 gene open 1197-1901
3542 CAMSPR010000076.1 GCA947062025_01768 gene open 1889-2545
3543 CAMSPR010000076.1 GCA947062025_01769 gene open 3292-3735
3544 CAMSPR010000076.1 GCA947062025_01770 gene open 4076-9715
3545 CAMSPR010000076.1 GCA947062025_01771 gene open 9702-10637
3546 CAMSPR010000077.1 GCA947062025_01772 CDS open 240-566 _na     108_aa hypothetical protein
3547 CAMSPR010000077.1 GCA947062025_01773 CDS open 580-6495 _na     1971_aa ADP-Ribosyltransferase in polyvalent proteins
3548 CAMSPR010000077.1 GCA947062025_01774 CDS open 6723-8240 _na     505_aa DUF4301 domain-containing protein
3549 CAMSPR010000077.1 GCA947062025_01775 CDS open 8393-10591 _na     732_aa GTP pyrophosphokinase
3550 CAMSPR010000077.1 GCA947062025_01772 gene open 240-566
3551 CAMSPR010000077.1 GCA947062025_01773 gene open 580-6495
3552 CAMSPR010000077.1 GCA947062025_01774 gene open 6723-8240
3553 CAMSPR010000077.1 GCA947062025_01775 gene open 8393-10591
3554 CAMSPR010000078.1 GCA947062025_01776 CDS open 351-3350 _na     999_aa Secretion system C-terminal sorting domain-containing protein
3555 CAMSPR010000078.1 GCA947062025_01777 CDS open 4351-7218 _na     955_aa CARDB domain-containing protein
3556 CAMSPR010000078.1 GCA947062025_01778 CDS open 9659-10522 _na     287_aa argI Arginine-specific protease ArgI polyprotein
3557 CAMSPR010000078.1 GCA947062025_01776 gene open 351-3350
3558 CAMSPR010000078.1 GCA947062025_01777 gene open 4351-7218
3559 CAMSPR010000078.1 GCA947062025_01778 gene open 9659-10522 argI
3560 CAMSPR010000079.1 GCA947062025_01779 CDS open 407-2923 _na     838_aa feoB ferrous iron transport protein B
3561 CAMSPR010000079.1 GCA947062025_01780 CDS open 2972-3127 _na     51_aa hypothetical protein
3562 CAMSPR010000079.1 GCA947062025_01781 CDS open 3356-4393 _na     345_aa yeiH YeiH family sulfate export transporter
3563 CAMSPR010000079.1 GCA947062025_01782 CDS open 4508-5515 _na     335_aa lpsA Lipopolysaccharide core biosynthesis protein LpsA
3564 CAMSPR010000079.1 GCA947062025_01783 CDS open 6201-8438 _na     745_aa GLUG domain protein subfamily
3565 CAMSPR010000079.1 GCA947062025_01784 CDS open 8464-8607 _na     47_aa hypothetical protein
3566 CAMSPR010000079.1 GCA947062025_01785 CDS open 8721-9131 _na     136_aa hypothetical protein
3567 CAMSPR010000079.1 GCA947062025_01786 CDS open 9262-10053 _na     263_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3568 CAMSPR010000079.1 GCA947062025_01787 CDS open 10002-10172 _na     56_aa hypothetical protein
3569 CAMSPR010000079.1 GCA947062025_01788 CDS open 10236-10826 _na     196_aa Immunity protein 43 domain-containing protein
3570 CAMSPR010000079.1 GCA947062025_01779 gene open 407-2923 feoB
3571 CAMSPR010000079.1 GCA947062025_01780 gene open 2972-3127
3572 CAMSPR010000079.1 GCA947062025_01781 gene open 3356-4393 yeiH
3573 CAMSPR010000079.1 GCA947062025_01782 gene open 4508-5515 lpsA
3574 CAMSPR010000079.1 GCA947062025_01783 gene open 6201-8438
3575 CAMSPR010000079.1 GCA947062025_01784 gene open 8464-8607
3576 CAMSPR010000079.1 GCA947062025_01785 gene open 8721-9131
3577 CAMSPR010000079.1 GCA947062025_01786 gene open 9262-10053 trmB
3578 CAMSPR010000079.1 GCA947062025_01787 gene open 10002-10172
3579 CAMSPR010000079.1 GCA947062025_01788 gene open 10236-10826
3580 CAMSPR010000080.1 GCA947062025_01797 gene open 8710-8746 abiF
3581 CAMSPR010000080.1 GCA947062025_01799 gene open 10650-10686 abiF
3582 CAMSPR010000080.1 GCA947062025_01797 ncRNA open 8710-8746 abiF abiF RNA
3583 CAMSPR010000080.1 GCA947062025_01799 ncRNA open 10650-10686 abiF abiF RNA
3584 CAMSPR010000080.1 GCA947062025_01789 CDS open 105-413 _na     102_aa hypothetical protein
3585 CAMSPR010000080.1 GCA947062025_01790 CDS open 986-1939 _na     317_aa NAD-dependent epimerase/dehydratase domain-containing protein
3586 CAMSPR010000080.1 GCA947062025_01791 CDS open 2124-3311 _na     395_aa kbl glycine C-acetyltransferase
3587 CAMSPR010000080.1 GCA947062025_01792 CDS open 3841-4479 _na     212_aa O-methyltransferase
3588 CAMSPR010000080.1 GCA947062025_01793 CDS open 4499-4930 _na     143_aa aroQ type II 3-dehydroquinate dehydratase
3589 CAMSPR010000080.1 GCA947062025_01794 CDS open 4962-5924 _na     320_aa xerA site-specific tyrosine recombinase/integron integrase
3590 CAMSPR010000080.1 GCA947062025_01795 CDS open 5949-7106 _na     385_aa hydroxymethylpyrimidine kinase
3591 CAMSPR010000080.1 GCA947062025_01796 CDS open 7771-8688 _na     305_aa abiF Abi family protein
3592 CAMSPR010000080.1 GCA947062025_01798 CDS open 9711-10628 _na     305_aa abiF Abi family protein
3593 CAMSPR010000080.1 GCA947062025_01789 gene open 105-413
3594 CAMSPR010000080.1 GCA947062025_01790 gene open 986-1939
3595 CAMSPR010000080.1 GCA947062025_01791 gene open 2124-3311 kbl
3596 CAMSPR010000080.1 GCA947062025_01792 gene open 3841-4479
3597 CAMSPR010000080.1 GCA947062025_01793 gene open 4499-4930 aroQ
3598 CAMSPR010000080.1 GCA947062025_01794 gene open 4962-5924 xerA
3599 CAMSPR010000080.1 GCA947062025_01795 gene open 5949-7106
3600 CAMSPR010000080.1 GCA947062025_01796 gene open 7771-8688 abiF
3601 CAMSPR010000080.1 GCA947062025_01798 gene open 9711-10628 abiF
3602 CAMSPR010000081.1 GCA947062025_01800 CDS open 25-2784 _na     919_aa CARDB domain-containing protein
3603 CAMSPR010000081.1 GCA947062025_01801 CDS open 3254-3844 _na     196_aa Outer membrane protein beta-barrel domain-containing protein
3604 CAMSPR010000081.1 GCA947062025_01802 CDS open 4874-6865 _na     663_aa DNA-binding protein
3605 CAMSPR010000081.1 GCA947062025_01803 CDS open 6893-7438 _na     181_aa nicotinamidase
3606 CAMSPR010000081.1 GCA947062025_01804 CDS open 7739-8575 _na     278_aa Fatty acyl-CoA reductase
3607 CAMSPR010000081.1 GCA947062025_01805 CDS open 8572-10074 _na     500_aa 2-succinylbenzoate--CoA ligase
3608 CAMSPR010000081.1 GCA947062025_01800 gene open 25-2784
3609 CAMSPR010000081.1 GCA947062025_01801 gene open 3254-3844
3610 CAMSPR010000081.1 GCA947062025_01802 gene open 4874-6865
3611 CAMSPR010000081.1 GCA947062025_01803 gene open 6893-7438
3612 CAMSPR010000081.1 GCA947062025_01804 gene open 7739-8575
3613 CAMSPR010000081.1 GCA947062025_01805 gene open 8572-10074
3614 CAMSPR010000082.1 GCA947062025_01806 CDS open 818-4384 _na     1188_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
3615 CAMSPR010000082.1 GCA947062025_01807 CDS open 4493-5677 _na     394_aa AAA domain-containing protein
3616 CAMSPR010000082.1 GCA947062025_01808 CDS open 5932-7017 _na     361_aa ATP-grasp domain-containing protein
3617 CAMSPR010000082.1 GCA947062025_01809 CDS open 7263-8363 _na     366_aa Porin domain-containing protein
3618 CAMSPR010000082.1 GCA947062025_01810 CDS open 8623-10047 _na     474_aa rlmD 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD
3619 CAMSPR010000082.1 GCA947062025_01806 gene open 818-4384 nifJ
3620 CAMSPR010000082.1 GCA947062025_01807 gene open 4493-5677
3621 CAMSPR010000082.1 GCA947062025_01808 gene open 5932-7017
3622 CAMSPR010000082.1 GCA947062025_01809 gene open 7263-8363
3623 CAMSPR010000082.1 GCA947062025_01810 gene open 8623-10047 rlmD
3624 CAMSPR010000083.1 GCA947062025_01811 CDS open 92-1645 _na     517_aa Extracellular ribonuclease
3625 CAMSPR010000083.1 GCA947062025_01812 CDS open 1716-2294 _na     192_aa CHR family chromate ion efflux pump
3626 CAMSPR010000083.1 GCA947062025_01813 CDS open 2297-2908 _na     203_aa Chromate transporter%2C chromate ion transporter (CHR) family
3627 CAMSPR010000083.1 GCA947062025_01814 CDS open 3002-6745 _na     1247_aa purL phosphoribosylformylglycinamidine synthase
3628 CAMSPR010000083.1 GCA947062025_01815 CDS open 8279-8812 _na     177_aa DUF4369 domain-containing protein
3629 CAMSPR010000083.1 GCA947062025_01816 CDS open 8850-9206 _na     118_aa hypothetical protein
3630 CAMSPR010000083.1 GCA947062025_01817 CDS open 9229-9627 _na     132_aa DUF2750 domain-containing protein
3631 CAMSPR010000083.1 GCA947062025_01818 CDS open 9632-9892 _na     86_aa SMI1/KNR4 family protein
3632 CAMSPR010000083.1 GCA947062025_01811 gene open 92-1645
3633 CAMSPR010000083.1 GCA947062025_01812 gene open 1716-2294
3634 CAMSPR010000083.1 GCA947062025_01813 gene open 2297-2908
3635 CAMSPR010000083.1 GCA947062025_01814 gene open 3002-6745 purL
3636 CAMSPR010000083.1 GCA947062025_01815 gene open 8279-8812
3637 CAMSPR010000083.1 GCA947062025_01816 gene open 8850-9206
3638 CAMSPR010000083.1 GCA947062025_01817 gene open 9229-9627
3639 CAMSPR010000083.1 GCA947062025_01818 gene open 9632-9892
3640 CAMSPR010000084.1 GCA947062025_01828 gene open 9429-9827 ssrA
3641 CAMSPR010000084.1 GCA947062025_01828 tmRNA open 9429-9827 ssrA transfer-messenger RNA%2C SsrA
3642 CAMSPR010000084.1 GCA947062025_01819 CDS open 199-1539 _na     446_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
3643 CAMSPR010000084.1 GCA947062025_01820 CDS open 1536-2537 _na     333_aa dTDP-Rha:alpha-D-GlcNAc-pyrophosphate polyprenol%2C alpha-3-L-rhamnosyltransferase
3644 CAMSPR010000084.1 GCA947062025_01821 CDS open 2684-3487 _na     267_aa gldB Gliding motility protein GldB
3645 CAMSPR010000084.1 GCA947062025_01822 CDS open 3725-4177 _na     150_aa tRNA-specific adenosine deaminase
3646 CAMSPR010000084.1 GCA947062025_01823 CDS open 4310-4672 _na     120_aa yraN YraN family protein
3647 CAMSPR010000084.1 GCA947062025_01824 CDS open 4672-5499 _na     275_aa Biotin-acetyl-CoA-carboxylase ligase
3648 CAMSPR010000084.1 GCA947062025_01825 CDS open 5486-6196 _na     236_aa pyrH UMP kinase
3649 CAMSPR010000084.1 GCA947062025_01826 CDS open 6677-7759 _na     360_aa leucine-rich repeat domain-containing protein
3650 CAMSPR010000084.1 GCA947062025_01827 CDS open 7874-9241 _na     455_aa dipeptidase
3651 CAMSPR010000084.1 GCA947062025_01819 gene open 199-1539 mtaB
3652 CAMSPR010000084.1 GCA947062025_01820 gene open 1536-2537
3653 CAMSPR010000084.1 GCA947062025_01821 gene open 2684-3487 gldB
3654 CAMSPR010000084.1 GCA947062025_01822 gene open 3725-4177
3655 CAMSPR010000084.1 GCA947062025_01823 gene open 4310-4672 yraN
3656 CAMSPR010000084.1 GCA947062025_01824 gene open 4672-5499
3657 CAMSPR010000084.1 GCA947062025_01825 gene open 5486-6196 pyrH
3658 CAMSPR010000084.1 GCA947062025_01826 gene open 6677-7759
3659 CAMSPR010000084.1 GCA947062025_01827 gene open 7874-9241
3660 CAMSPR010000085.1 GCA947062025_01829 CDS open 174-1901 _na     575_aa Fimbrillin family protein
3661 CAMSPR010000085.1 GCA947062025_01830 CDS open 2077-2250 _na     57_aa Natural product%2C GG-Bacteroidales family
3662 CAMSPR010000085.1 GCA947062025_01831 CDS open 2359-2562 _na     67_aa hypothetical protein
3663 CAMSPR010000085.1 GCA947062025_01832 CDS open 2893-3378 _na     161_aa Secretion system C-terminal sorting domain-containing protein
3664 CAMSPR010000085.1 GCA947062025_01833 CDS open 3375-4676 _na     433_aa Fibronectin type-III domain-containing protein
3665 CAMSPR010000085.1 GCA947062025_01834 CDS open 4820-6382 _na     520_aa T9SS C-terminal target domain-containing protein
3666 CAMSPR010000085.1 GCA947062025_01835 CDS open 7003-7842 _na     279_aa BRO family%2C N-terminal domain
3667 CAMSPR010000085.1 GCA947062025_01836 CDS open 8048-8518 _na     156_aa Phage tail protein
3668 CAMSPR010000085.1 GCA947062025_01829 gene open 174-1901
3669 CAMSPR010000085.1 GCA947062025_01830 gene open 2077-2250
3670 CAMSPR010000085.1 GCA947062025_01831 gene open 2359-2562
3671 CAMSPR010000085.1 GCA947062025_01832 gene open 2893-3378
3672 CAMSPR010000085.1 GCA947062025_01833 gene open 3375-4676
3673 CAMSPR010000085.1 GCA947062025_01834 gene open 4820-6382
3674 CAMSPR010000085.1 GCA947062025_01835 gene open 7003-7842
3675 CAMSPR010000085.1 GCA947062025_01836 gene open 8048-8518
3676 CAMSPR010000086.1 GCA947062025_01837 CDS open 282-1268 _na     328_aa mutY A/G-specific adenine glycosylase
3677 CAMSPR010000086.1 GCA947062025_01838 CDS open 1859-2452 _na     197_aa purH Bifunctional purine biosynthesis protein PurH
3678 CAMSPR010000086.1 GCA947062025_01839 CDS open 2601-3590 _na     329_aa mreB Cell shape-determining protein MreB
3679 CAMSPR010000086.1 GCA947062025_01840 CDS open 3676-4557 _na     293_aa mreC rod shape-determining protein MreC
3680 CAMSPR010000086.1 GCA947062025_01841 CDS open 4639-5142 _na     167_aa mreD rod shape-determining protein MreD
3681 CAMSPR010000086.1 GCA947062025_01842 CDS open 5139-7292 _na     717_aa mrdA penicillin-binding protein 2
3682 CAMSPR010000086.1 GCA947062025_01843 CDS open 7325-8800 _na     491_aa rodA Rod shape-determining protein RodA
3683 CAMSPR010000086.1 GCA947062025_01837 gene open 282-1268 mutY
3684 CAMSPR010000086.1 GCA947062025_01838 gene open 1859-2452 purH
3685 CAMSPR010000086.1 GCA947062025_01839 gene open 2601-3590 mreB
3686 CAMSPR010000086.1 GCA947062025_01840 gene open 3676-4557 mreC
3687 CAMSPR010000086.1 GCA947062025_01841 gene open 4639-5142 mreD
3688 CAMSPR010000086.1 GCA947062025_01842 gene open 5139-7292 mrdA
3689 CAMSPR010000086.1 GCA947062025_01843 gene open 7325-8800 rodA
3690 CAMSPR010000087.1 GCA947062025_01845 CDS open 384-1082 _na     232_aa DUF421 domain-containing protein
3691 CAMSPR010000087.1 GCA947062025_01846 CDS open 1243-1890 _na     215_aa hypothetical protein
3692 CAMSPR010000087.1 GCA947062025_01847 CDS open 1869-2636 _na     255_aa Restriction endonuclease
3693 CAMSPR010000087.1 GCA947062025_01848 CDS open 2910-3266 _na     118_aa DUF2798 domain-containing protein
3694 CAMSPR010000087.1 GCA947062025_01849 CDS open 3272-3919 _na     215_aa GAD-like domain protein
3695 CAMSPR010000087.1 GCA947062025_01850 CDS open 4049-4192 _na     47_aa hypothetical protein
3696 CAMSPR010000087.1 GCA947062025_01851 CDS open 4313-4873 _na     186_aa Immunity MXAN-0049 protein domain-containing protein
3697 CAMSPR010000087.1 GCA947062025_01852 CDS open 4921-5406 _na     161_aa Immunity protein 26
3698 CAMSPR010000087.1 GCA947062025_01853 CDS open 5443-5850 _na     135_aa SMI1/KNR4 family protein
3699 CAMSPR010000087.1 GCA947062025_01854 CDS open 6041-6607 _na     188_aa Immunity MXAN-0049 protein domain-containing protein
3700 CAMSPR010000087.1 GCA947062025_01855 CDS open 6907-7428 _na     173_aa SMI1/KNR4 family protein
3701 CAMSPR010000087.1 GCA947062025_01856 CDS open 7537-8070 _na     177_aa Imm15 family immunity protein
3702 CAMSPR010000087.1 GCA947062025_01857 CDS open 8134-8565 _na     143_aa NTF2 fold immunity protein domain-containing protein
3703 CAMSPR010000087.1 GCA947062025_01845 gene open 384-1082
3704 CAMSPR010000087.1 GCA947062025_01846 gene open 1243-1890
3705 CAMSPR010000087.1 GCA947062025_01847 gene open 1869-2636
3706 CAMSPR010000087.1 GCA947062025_01848 gene open 2910-3266
3707 CAMSPR010000087.1 GCA947062025_01849 gene open 3272-3919
3708 CAMSPR010000087.1 GCA947062025_01850 gene open 4049-4192
3709 CAMSPR010000087.1 GCA947062025_01851 gene open 4313-4873
3710 CAMSPR010000087.1 GCA947062025_01852 gene open 4921-5406
3711 CAMSPR010000087.1 GCA947062025_01853 gene open 5443-5850
3712 CAMSPR010000087.1 GCA947062025_01854 gene open 6041-6607
3713 CAMSPR010000087.1 GCA947062025_01855 gene open 6907-7428
3714 CAMSPR010000087.1 GCA947062025_01856 gene open 7537-8070
3715 CAMSPR010000087.1 GCA947062025_01857 gene open 8134-8565
3716 CAMSPR010000087.1 GCA947062025_01844 gene open 2-86 trnS
3717 CAMSPR010000087.1 GCA947062025_01844 tRNA open 2-86 trnS tRNA-Ser(tga)
3718 CAMSPR010000088.1 GCA947062025_01858 CDS open 268-1134 _na     288_aa Transmembrane protein
3719 CAMSPR010000088.1 GCA947062025_01859 CDS open 1290-3389 _na     699_aa aprX Serine protease AprX
3720 CAMSPR010000088.1 GCA947062025_01860 CDS open 3695-5293 _na     532_aa nadB L-aspartate oxidase
3721 CAMSPR010000088.1 GCA947062025_01861 CDS open 5325-6317 _na     330_aa nadA quinolinate synthase NadA
3722 CAMSPR010000088.1 GCA947062025_01862 CDS open 6365-7240 _na     291_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
3723 CAMSPR010000088.1 GCA947062025_01863 CDS open 7579-8067 _na     162_aa fldA flavodoxin FldA
3724 CAMSPR010000088.1 GCA947062025_01864 CDS open 8115-8462 _na     115_aa DUF2023 domain-containing protein
3725 CAMSPR010000088.1 GCA947062025_01858 gene open 268-1134
3726 CAMSPR010000088.1 GCA947062025_01859 gene open 1290-3389 aprX
3727 CAMSPR010000088.1 GCA947062025_01860 gene open 3695-5293 nadB
3728 CAMSPR010000088.1 GCA947062025_01861 gene open 5325-6317 nadA
3729 CAMSPR010000088.1 GCA947062025_01862 gene open 6365-7240 nadC
3730 CAMSPR010000088.1 GCA947062025_01863 gene open 7579-8067 fldA
3731 CAMSPR010000088.1 GCA947062025_01864 gene open 8115-8462
3732 CAMSPR010000089.1 GCA947062025_01865 CDS open 313-1134 _na     273_aa Phospholipid/glycerol acyltransferase domain-containing protein
3733 CAMSPR010000089.1 GCA947062025_01866 CDS open 1157-2329 _na     390_aa Ser/Thr protein phosphatase
3734 CAMSPR010000089.1 GCA947062025_01867 CDS open 2332-3687 _na     451_aa dihydroorotase
3735 CAMSPR010000089.1 GCA947062025_01868 CDS open 3722-4561 _na     279_aa DUF4369 domain-containing protein
3736 CAMSPR010000089.1 GCA947062025_01869 CDS open 4751-5182 _na     143_aa DUF4199 domain-containing protein
3737 CAMSPR010000089.1 GCA947062025_01870 CDS open 5166-5510 _na     114_aa Septum formation initiator
3738 CAMSPR010000089.1 GCA947062025_01871 CDS open 5731-7509 _na     592_aa DNA polymerase III subunit gamma/tau
3739 CAMSPR010000089.1 GCA947062025_01872 CDS open 7586-8269 _na     227_aa hypothetical protein
3740 CAMSPR010000089.1 GCA947062025_01873 CDS open 8292-8579 _na     95_aa hypothetical protein
3741 CAMSPR010000089.1 GCA947062025_01865 gene open 313-1134
3742 CAMSPR010000089.1 GCA947062025_01866 gene open 1157-2329
3743 CAMSPR010000089.1 GCA947062025_01867 gene open 2332-3687
3744 CAMSPR010000089.1 GCA947062025_01868 gene open 3722-4561
3745 CAMSPR010000089.1 GCA947062025_01869 gene open 4751-5182
3746 CAMSPR010000089.1 GCA947062025_01870 gene open 5166-5510
3747 CAMSPR010000089.1 GCA947062025_01871 gene open 5731-7509
3748 CAMSPR010000089.1 GCA947062025_01872 gene open 7586-8269
3749 CAMSPR010000089.1 GCA947062025_01873 gene open 8292-8579
3750 CAMSPR010000090.1 GCA947062025_01874 CDS open 316-966 _na     216_aa Lipocalin-like domain-containing protein
3751 CAMSPR010000090.1 GCA947062025_01875 CDS open 997-1764 _na     255_aa Outer membrane lipoprotein Omp28
3752 CAMSPR010000090.1 GCA947062025_01876 CDS open 1777-3450 _na     557_aa TonB-dependent receptor-like beta-barrel domain-containing protein
3753 CAMSPR010000090.1 GCA947062025_01877 CDS open 3460-3948 _na     162_aa Thioredoxin domain-containing protein
3754 CAMSPR010000090.1 GCA947062025_01878 CDS open 4467-5537 _na     356_aa site-specific DNA-methyltransferase (adenine-specific)
3755 CAMSPR010000090.1 GCA947062025_01880 CDS open 6104-6208 _na     34_aa hypothetical protein
3756 CAMSPR010000090.1 GCA947062025_01881 CDS open 6483-8396 _na     637_aa Internalin-related protein
3757 CAMSPR010000090.1 GCA947062025_01882 CDS open 8310-8483 _na     57_aa hypothetical protein
3758 CAMSPR010000090.1 GCA947062025_01874 gene open 316-966
3759 CAMSPR010000090.1 GCA947062025_01875 gene open 997-1764
3760 CAMSPR010000090.1 GCA947062025_01876 gene open 1777-3450
3761 CAMSPR010000090.1 GCA947062025_01877 gene open 3460-3948
3762 CAMSPR010000090.1 GCA947062025_01878 gene open 4467-5537
3763 CAMSPR010000090.1 GCA947062025_01880 gene open 6104-6208
3764 CAMSPR010000090.1 GCA947062025_01881 gene open 6483-8396
3765 CAMSPR010000090.1 GCA947062025_01882 gene open 8310-8483
3766 CAMSPR010000090.1 GCA947062025_01879 gene open 6013-6086 trnN
3767 CAMSPR010000090.1 GCA947062025_01879 tRNA open 6013-6086 trnN tRNA-Asn(gtt)
3768 CAMSPR010000091.1 GCA947062025_01883 CDS open 139-1260 _na     373_aa Glycerate kinase
3769 CAMSPR010000091.1 GCA947062025_01884 CDS open 1260-2204 _na     314_aa Transmembrane protein
3770 CAMSPR010000091.1 GCA947062025_01885 CDS open 2230-4293 _na     687_aa 1%2C4-alpha-glucan branching enzyme
3771 CAMSPR010000091.1 GCA947062025_01886 CDS open 4312-5388 _na     358_aa hypothetical protein
3772 CAMSPR010000091.1 GCA947062025_01887 CDS open 5496-6008 _na     170_aa 4'-phosphopantetheinyl transferase
3773 CAMSPR010000091.1 GCA947062025_01888 CDS open 5992-7314 _na     440_aa gldE Gliding motility-associated protein GldE
3774 CAMSPR010000091.1 GCA947062025_01889 CDS open 7323-7712 _na     129_aa Single-stranded DNA-binding protein
3775 CAMSPR010000091.1 GCA947062025_01890 CDS open 7762-8298 _na     178_aa Phage protein
3776 CAMSPR010000091.1 GCA947062025_01883 gene open 139-1260
3777 CAMSPR010000091.1 GCA947062025_01884 gene open 1260-2204
3778 CAMSPR010000091.1 GCA947062025_01885 gene open 2230-4293
3779 CAMSPR010000091.1 GCA947062025_01886 gene open 4312-5388
3780 CAMSPR010000091.1 GCA947062025_01887 gene open 5496-6008
3781 CAMSPR010000091.1 GCA947062025_01888 gene open 5992-7314 gldE
3782 CAMSPR010000091.1 GCA947062025_01889 gene open 7323-7712
3783 CAMSPR010000091.1 GCA947062025_01890 gene open 7762-8298
3784 CAMSPR010000091.1 GCA947062025_01891 gene open 8335-8407 trnG
3785 CAMSPR010000091.1 GCA947062025_01891 tRNA open 8335-8407 trnG tRNA-Gly(gcc)
3786 CAMSPR010000092.1 GCA947062025_01892 CDS open 155-1402 _na     415_aa serB phosphoserine phosphatase SerB
3787 CAMSPR010000092.1 GCA947062025_01893 CDS open 1469-2257 _na     262_aa DUF4738 domain-containing protein
3788 CAMSPR010000092.1 GCA947062025_01894 CDS open 2275-2826 _na     183_aa rfbC dTDP-4-dehydrorhamnose 3%2C5-epimerase
3789 CAMSPR010000092.1 GCA947062025_01895 CDS open 3044-6067 _na     1007_aa Lys-gingipain W83
3790 CAMSPR010000092.1 GCA947062025_01896 CDS open 6129-7778 _na     549_aa Peptidase
3791 CAMSPR010000092.1 GCA947062025_01892 gene open 155-1402 serB
3792 CAMSPR010000092.1 GCA947062025_01893 gene open 1469-2257
3793 CAMSPR010000092.1 GCA947062025_01894 gene open 2275-2826 rfbC
3794 CAMSPR010000092.1 GCA947062025_01895 gene open 3044-6067
3795 CAMSPR010000092.1 GCA947062025_01896 gene open 6129-7778
3796 CAMSPR010000093.1 GCA947062025_01897 CDS open 379-489 _na     36_aa hypothetical protein
3797 CAMSPR010000093.1 GCA947062025_01898 CDS open 1167-1472 _na     101_aa hypothetical protein
3798 CAMSPR010000093.1 GCA947062025_01899 CDS open 1480-3285 _na     601_aa mutS DNA mismatch repair proteins mutS family domain-containing protein
3799 CAMSPR010000093.1 GCA947062025_01900 CDS open 3648-4991 _na     447_aa gdhA NADP-specific glutamate dehydrogenase
3800 CAMSPR010000093.1 GCA947062025_01901 CDS open 5087-5770 _na     227_aa rlpA putative endolytic peptidoglycan transglycosylase RlpA
3801 CAMSPR010000093.1 GCA947062025_01902 CDS open 6037-7041 _na     334_aa Glycine zipper domain-containing protein
3802 CAMSPR010000093.1 GCA947062025_01903 CDS open 7103-7459 _na     118_aa Inhibitor I9 domain-containing protein
3803 CAMSPR010000093.1 GCA947062025_01897 gene open 379-489
3804 CAMSPR010000093.1 GCA947062025_01898 gene open 1167-1472
3805 CAMSPR010000093.1 GCA947062025_01899 gene open 1480-3285 mutS
3806 CAMSPR010000093.1 GCA947062025_01900 gene open 3648-4991 gdhA
3807 CAMSPR010000093.1 GCA947062025_01901 gene open 5087-5770 rlpA
3808 CAMSPR010000093.1 GCA947062025_01902 gene open 6037-7041
3809 CAMSPR010000093.1 GCA947062025_01903 gene open 7103-7459
3810 CAMSPR010000094.1 GCA947062025_01904 CDS open 210-1469 _na     419_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
3811 CAMSPR010000094.1 GCA947062025_01905 CDS open 1482-1880 _na     132_aa Phospholipase
3812 CAMSPR010000094.1 GCA947062025_01906 CDS open 1952-5569 _na     1205_aa Tetratricopeptide repeat protein
3813 CAMSPR010000094.1 GCA947062025_01907 CDS open 5642-7237 _na     531_aa Response regulatory domain-containing protein
3814 CAMSPR010000094.1 GCA947062025_01908 CDS open 7243-7653 _na     136_aa tsaE tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE
3815 CAMSPR010000094.1 GCA947062025_01904 gene open 210-1469 aroA
3816 CAMSPR010000094.1 GCA947062025_01905 gene open 1482-1880
3817 CAMSPR010000094.1 GCA947062025_01906 gene open 1952-5569
3818 CAMSPR010000094.1 GCA947062025_01907 gene open 5642-7237
3819 CAMSPR010000094.1 GCA947062025_01908 gene open 7243-7653 tsaE
3820 CAMSPR010000095.1 GCA947062025_01909 CDS open 120-569 _na     149_aa hypothetical protein
3821 CAMSPR010000095.1 GCA947062025_01910 CDS open 695-1243 _na     182_aa hypothetical protein
3822 CAMSPR010000095.1 GCA947062025_01911 CDS open 1847-2125 _na     92_aa Transmembrane protein
3823 CAMSPR010000095.1 GCA947062025_01912 CDS open 2451-2714 _na     87_aa hypothetical protein
3824 CAMSPR010000095.1 GCA947062025_01913 CDS open 4728-5279 _na     183_aa hypothetical protein
3825 CAMSPR010000095.1 GCA947062025_01914 CDS open 6656-7342 _na     228_aa DUF4386 domain-containing protein
3826 CAMSPR010000095.1 GCA947062025_01909 gene open 120-569
3827 CAMSPR010000095.1 GCA947062025_01910 gene open 695-1243
3828 CAMSPR010000095.1 GCA947062025_01911 gene open 1847-2125
3829 CAMSPR010000095.1 GCA947062025_01912 gene open 2451-2714
3830 CAMSPR010000095.1 GCA947062025_01913 gene open 4728-5279
3831 CAMSPR010000095.1 GCA947062025_01914 gene open 6656-7342
3832 CAMSPR010000096.1 repeat_region open 212-719 CRISPR array with 8 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTTCAAACAGAAGGCAGATACAAC and spacer length 29
3833 CAMSPR010000096.1 GCA947062025_01915 CDS open 1299-4658 _na     1119_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
3834 CAMSPR010000096.1 GCA947062025_01916 CDS open 5090-7396 _na     768_aa Outer membrane protein beta-barrel domain-containing protein
3835 CAMSPR010000096.1 GCA947062025_01915 gene open 1299-4658 cas13b
3836 CAMSPR010000096.1 GCA947062025_01916 gene open 5090-7396
3837 CAMSPR010000097.1 GCA947062025_01917 CDS open 267-812 _na     181_aa hypothetical protein
3838 CAMSPR010000097.1 GCA947062025_01918 CDS open 880-1125 _na     81_aa DUF3853 domain-containing protein
3839 CAMSPR010000097.1 GCA947062025_01919 CDS open 1685-3598 _na     637_aa site-specific DNA-methyltransferase (adenine-specific)
3840 CAMSPR010000097.1 GCA947062025_01920 CDS open 3591-4331 _na     246_aa restriction endonuclease subunit S
3841 CAMSPR010000097.1 GCA947062025_01921 CDS open 4448-5167 _na     239_aa restriction endonuclease subunit S
3842 CAMSPR010000097.1 GCA947062025_01922 CDS open 5164-7512 _na     782_aa AAA domain protein
3843 CAMSPR010000097.1 GCA947062025_01917 gene open 267-812
3844 CAMSPR010000097.1 GCA947062025_01918 gene open 880-1125
3845 CAMSPR010000097.1 GCA947062025_01919 gene open 1685-3598
3846 CAMSPR010000097.1 GCA947062025_01920 gene open 3591-4331
3847 CAMSPR010000097.1 GCA947062025_01921 gene open 4448-5167
3848 CAMSPR010000097.1 GCA947062025_01922 gene open 5164-7512
3849 CAMSPR010000098.1 rep_origin open 3477-3881
3850 CAMSPR010000098.1 GCA947062025_01923 CDS open 97-2562 _na     821_aa outer membrane beta-barrel family protein
3851 CAMSPR010000098.1 GCA947062025_01924 CDS open 2667-3476 _na     269_aa DUF3108 domain-containing protein
3852 CAMSPR010000098.1 GCA947062025_01925 CDS open 4028-7018 _na     996_aa choice-of-anchor J domain-containing protein
3853 CAMSPR010000098.1 GCA947062025_01923 gene open 97-2562
3854 CAMSPR010000098.1 GCA947062025_01924 gene open 2667-3476
3855 CAMSPR010000098.1 GCA947062025_01925 gene open 4028-7018
3856 CAMSPR010000099.1 GCA947062025_01926 CDS open 430-2115 _na     561_aa Carboxy-terminal processing protease
3857 CAMSPR010000099.1 GCA947062025_01927 CDS open 2228-2698 _na     156_aa Carboxypeptidase regulatory-like domain-containing protein
3858 CAMSPR010000099.1 GCA947062025_01928 CDS open 2896-4548 _na     550_aa Glycosyltransferase family alpha-glycosyltransferase
3859 CAMSPR010000099.1 GCA947062025_01929 CDS open 4634-7192 _na     852_aa Maltodextrin phosphorylase
3860 CAMSPR010000099.1 GCA947062025_01930 CDS open 7189-7284 _na     31_aa hypothetical protein
3861 CAMSPR010000099.1 GCA947062025_01926 gene open 430-2115
3862 CAMSPR010000099.1 GCA947062025_01927 gene open 2228-2698
3863 CAMSPR010000099.1 GCA947062025_01928 gene open 2896-4548
3864 CAMSPR010000099.1 GCA947062025_01929 gene open 4634-7192
3865 CAMSPR010000099.1 GCA947062025_01930 gene open 7189-7284
3866 CAMSPR010000100.1 GCA947062025_01931 CDS open 269-1633 _na     454_aa mepA Multidrug export protein MepA
3867 CAMSPR010000100.1 GCA947062025_01932 CDS open 1651-2277 _na     208_aa Cytidylate kinase
3868 CAMSPR010000100.1 GCA947062025_01933 CDS open 2285-2791 _na     168_aa Phosphoesterase
3869 CAMSPR010000100.1 GCA947062025_01934 CDS open 2817-3965 _na     382_aa rfbB dTDP-glucose 4%2C6-dehydratase
3870 CAMSPR010000100.1 GCA947062025_01935 CDS open 4022-4432 _na     136_aa qdtA Sugar 3%2C4-ketoisomerase QdtA cupin domain-containing protein
3871 CAMSPR010000100.1 GCA947062025_01936 CDS open 4528-5481 _na     317_aa GNAT family N-acetyltransferase
3872 CAMSPR010000100.1 GCA947062025_01937 CDS open 5478-6575 _na     365_aa UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase
3873 CAMSPR010000100.1 GCA947062025_01931 gene open 269-1633 mepA
3874 CAMSPR010000100.1 GCA947062025_01932 gene open 1651-2277
3875 CAMSPR010000100.1 GCA947062025_01933 gene open 2285-2791
3876 CAMSPR010000100.1 GCA947062025_01934 gene open 2817-3965 rfbB
3877 CAMSPR010000100.1 GCA947062025_01935 gene open 4022-4432 qdtA
3878 CAMSPR010000100.1 GCA947062025_01936 gene open 4528-5481
3879 CAMSPR010000100.1 GCA947062025_01937 gene open 5478-6575
3880 CAMSPR010000101.1 GCA947062025_01938 CDS open 698-1612 _na     304_aa DUF1911 domain-containing protein
3881 CAMSPR010000101.1 GCA947062025_01939 CDS open 1802-2134 _na     110_aa Transposase
3882 CAMSPR010000101.1 GCA947062025_01940 CDS open 2167-2598 _na     143_aa Immunity protein 30 domain-containing protein
3883 CAMSPR010000101.1 GCA947062025_01941 CDS open 2787-3422 _na     211_aa DKNYY family protein
3884 CAMSPR010000101.1 GCA947062025_01942 CDS open 3483-4571 _na     362_aa hypothetical protein
3885 CAMSPR010000101.1 GCA947062025_01943 CDS open 4579-4923 _na     114_aa hypothetical protein
3886 CAMSPR010000101.1 GCA947062025_01944 CDS open 5310-5969 _na     219_aa hypothetical protein
3887 CAMSPR010000101.1 GCA947062025_01945 CDS open 6147-6560 _na     137_aa DUF6756 domain-containing protein
3888 CAMSPR010000101.1 GCA947062025_01938 gene open 698-1612
3889 CAMSPR010000101.1 GCA947062025_01939 gene open 1802-2134
3890 CAMSPR010000101.1 GCA947062025_01940 gene open 2167-2598
3891 CAMSPR010000101.1 GCA947062025_01941 gene open 2787-3422
3892 CAMSPR010000101.1 GCA947062025_01942 gene open 3483-4571
3893 CAMSPR010000101.1 GCA947062025_01943 gene open 4579-4923
3894 CAMSPR010000101.1 GCA947062025_01944 gene open 5310-5969
3895 CAMSPR010000101.1 GCA947062025_01945 gene open 6147-6560
3896 CAMSPR010000102.1 GCA947062025_01947 CDS open 513-1589 _na     358_aa RND efflux pump membrane fusion protein barrel-sandwich domain-containing protein
3897 CAMSPR010000102.1 GCA947062025_01948 CDS open 1593-4790 _na     1065_aa SSD domain-containing protein
3898 CAMSPR010000102.1 GCA947062025_01949 CDS open 4777-6195 _na     472_aa ibeB Outer membrane efflux lipoprotein IbeB
3899 CAMSPR010000102.1 GCA947062025_01947 gene open 513-1589
3900 CAMSPR010000102.1 GCA947062025_01948 gene open 1593-4790
3901 CAMSPR010000102.1 GCA947062025_01949 gene open 4777-6195 ibeB
3902 CAMSPR010000102.1 GCA947062025_01946 gene open 131-206 trnK
3903 CAMSPR010000102.1 GCA947062025_01946 tRNA open 131-206 trnK tRNA-Lys(ttt)
3904 CAMSPR010000103.1 GCA947062025_01950 CDS open 348-1691 _na     447_aa yihY YihY family protein
3905 CAMSPR010000103.1 GCA947062025_01951 CDS open 2412-2507 _na     31_aa Secreted protein with PEP-CTERM sorting signal
3906 CAMSPR010000103.1 GCA947062025_01952 CDS open 2509-2700 _na     63_aa DUF6722 domain-containing protein
3907 CAMSPR010000103.1 GCA947062025_01953 CDS open 2881-4938 _na     685_aa htpG molecular chaperone HtpG
3908 CAMSPR010000103.1 GCA947062025_01954 CDS open 5375-5911 _na     178_aa Corrinoid adenosyltransferase
3909 CAMSPR010000103.1 GCA947062025_01950 gene open 348-1691 yihY
3910 CAMSPR010000103.1 GCA947062025_01951 gene open 2412-2507
3911 CAMSPR010000103.1 GCA947062025_01952 gene open 2509-2700
3912 CAMSPR010000103.1 GCA947062025_01953 gene open 2881-4938 htpG
3913 CAMSPR010000103.1 GCA947062025_01954 gene open 5375-5911
3914 CAMSPR010000104.1 GCA947062025_01955 CDS open 230-3691 _na     1153_aa mfd transcription-repair coupling factor
3915 CAMSPR010000104.1 GCA947062025_01956 CDS open 3772-4269 _na     165_aa PEGA domain-containing protein
3916 CAMSPR010000104.1 GCA947062025_01957 CDS open 4661-5116 _na     151_aa DUF6078 domain-containing protein
3917 CAMSPR010000104.1 GCA947062025_01955 gene open 230-3691 mfd
3918 CAMSPR010000104.1 GCA947062025_01956 gene open 3772-4269
3919 CAMSPR010000104.1 GCA947062025_01957 gene open 4661-5116
3920 CAMSPR010000105.1 GCA947062025_01958 CDS open 320-574 _na     84_aa Filament-A percursor
3921 CAMSPR010000105.1 GCA947062025_01959 CDS open 585-1139 _na     184_aa Transmembrane protein
3922 CAMSPR010000105.1 GCA947062025_01960 CDS open 1601-2614 _na     337_aa DUF3298 domain-containing protein
3923 CAMSPR010000105.1 GCA947062025_01961 CDS open 2886-3275 _na     129_aa DUF3098 domain-containing protein
3924 CAMSPR010000105.1 GCA947062025_01962 CDS open 3293-4420 _na     375_aa sugar transporter
3925 CAMSPR010000105.1 GCA947062025_01958 gene open 320-574
3926 CAMSPR010000105.1 GCA947062025_01959 gene open 585-1139
3927 CAMSPR010000105.1 GCA947062025_01960 gene open 1601-2614
3928 CAMSPR010000105.1 GCA947062025_01961 gene open 2886-3275
3929 CAMSPR010000105.1 GCA947062025_01962 gene open 3293-4420
3930 CAMSPR010000106.1 GCA947062025_01963 CDS open 61-1089 _na     342_aa HNH endonuclease
3931 CAMSPR010000106.1 GCA947062025_01964 CDS open 1264-1470 _na     68_aa hypothetical protein
3932 CAMSPR010000106.1 GCA947062025_01965 CDS open 1527-3272 _na     581_aa Lysozyme M1
3933 CAMSPR010000106.1 GCA947062025_01966 CDS open 3536-4549 _na     337_aa class II fructose-bisphosphate aldolase
3934 CAMSPR010000106.1 GCA947062025_01967 CDS open 5009-5272 _na     87_aa hypothetical protein
3935 CAMSPR010000106.1 GCA947062025_01963 gene open 61-1089
3936 CAMSPR010000106.1 GCA947062025_01964 gene open 1264-1470
3937 CAMSPR010000106.1 GCA947062025_01965 gene open 1527-3272
3938 CAMSPR010000106.1 GCA947062025_01966 gene open 3536-4549
3939 CAMSPR010000106.1 GCA947062025_01967 gene open 5009-5272
3940 CAMSPR010000107.1 GCA947062025_01968 CDS open 388-1818 _na     476_aa Glycoside hydrolase family 57 N-terminal domain-containing protein
3941 CAMSPR010000107.1 GCA947062025_01969 CDS open 1873-3132 _na     419_aa Glycosyl transferase family 1 domain-containing protein
3942 CAMSPR010000107.1 GCA947062025_01970 CDS open 3162-5105 _na     647_aa Glycogen debranching enzyme%2C archaeal type
3943 CAMSPR010000107.1 GCA947062025_01968 gene open 388-1818
3944 CAMSPR010000107.1 GCA947062025_01969 gene open 1873-3132
3945 CAMSPR010000107.1 GCA947062025_01970 gene open 3162-5105
3946 CAMSPR010000108.1 GCA947062025_01971 CDS open 31-543 _na     170_aa Lipoprotein
3947 CAMSPR010000108.1 GCA947062025_01972 CDS open 951-1880 _na     309_aa Peptidoglycan hydrolase
3948 CAMSPR010000108.1 GCA947062025_01973 CDS open 2061-4394 _na     777_aa Outer membrane protein beta-barrel domain-containing protein
3949 CAMSPR010000108.1 GCA947062025_01974 CDS open 4751-5233 _na     160_aa hypothetical protein
3950 CAMSPR010000108.1 GCA947062025_01971 gene open 31-543
3951 CAMSPR010000108.1 GCA947062025_01972 gene open 951-1880
3952 CAMSPR010000108.1 GCA947062025_01973 gene open 2061-4394
3953 CAMSPR010000108.1 GCA947062025_01974 gene open 4751-5233
3954 CAMSPR010000109.1 GCA947062025_01975 CDS open 428-658 _na     76_aa Cardiolipin synthase N-terminal domain-containing protein
3955 CAMSPR010000109.1 GCA947062025_01976 CDS open 945-2417 _na     490_aa Polysaccharide biosynthesis protein C-terminal domain-containing protein
3956 CAMSPR010000109.1 GCA947062025_01977 CDS open 2459-3040 _na     193_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
3957 CAMSPR010000109.1 GCA947062025_01978 CDS open 3047-3619 _na     190_aa gmk guanylate kinase
3958 CAMSPR010000109.1 GCA947062025_01979 CDS open 3631-4509 _na     292_aa yicC YicC family protein
3959 CAMSPR010000109.1 GCA947062025_01980 CDS open 4624-4980 _na     118_aa LexA-binding%2C inner membrane-associated hydrolase
3960 CAMSPR010000109.1 GCA947062025_01975 gene open 428-658
3961 CAMSPR010000109.1 GCA947062025_01976 gene open 945-2417
3962 CAMSPR010000109.1 GCA947062025_01977 gene open 2459-3040 nadD
3963 CAMSPR010000109.1 GCA947062025_01978 gene open 3047-3619 gmk
3964 CAMSPR010000109.1 GCA947062025_01979 gene open 3631-4509 yicC
3965 CAMSPR010000109.1 GCA947062025_01980 gene open 4624-4980
3966 CAMSPR010000110.1 GCA947062025_01981 CDS open 565-1422 _na     285_aa yiaD Inner membrane lipoprotein YiaD
3967 CAMSPR010000110.1 GCA947062025_01982 CDS open 1608-2012 _na     134_aa tonB Energy transducer TonB
3968 CAMSPR010000110.1 GCA947062025_01983 CDS open 2116-2577 _na     153_aa Serum opacity factor
3969 CAMSPR010000110.1 GCA947062025_01984 CDS open 2627-3409 _na     260_aa Glycosyltransferase 2-like domain-containing protein
3970 CAMSPR010000110.1 GCA947062025_01985 CDS open 3406-4680 _na     424_aa Group 1 glycosyl transferase
3971 CAMSPR010000110.1 GCA947062025_01981 gene open 565-1422 yiaD
3972 CAMSPR010000110.1 GCA947062025_01982 gene open 1608-2012 tonB
3973 CAMSPR010000110.1 GCA947062025_01983 gene open 2116-2577
3974 CAMSPR010000110.1 GCA947062025_01984 gene open 2627-3409
3975 CAMSPR010000110.1 GCA947062025_01985 gene open 3406-4680
3976 CAMSPR010000111.1 GCA947062025_01986 CDS open 436-2007 _na     523_aa dnaB replicative DNA helicase
3977 CAMSPR010000111.1 GCA947062025_01987 CDS open 2128-2973 _na     281_aa ispE 4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase
3978 CAMSPR010000111.1 GCA947062025_01988 CDS open 3678-3941 _na     87_aa rpmB 50S ribosomal protein L28
3979 CAMSPR010000111.1 GCA947062025_01989 CDS open 3946-4134 _na     62_aa rpmG 50S ribosomal protein L33
3980 CAMSPR010000111.1 GCA947062025_01990 CDS open 4171-4329 _na     52_aa DUF4295 domain-containing protein
3981 CAMSPR010000111.1 GCA947062025_01986 gene open 436-2007 dnaB
3982 CAMSPR010000111.1 GCA947062025_01987 gene open 2128-2973 ispE
3983 CAMSPR010000111.1 GCA947062025_01988 gene open 3678-3941 rpmB
3984 CAMSPR010000111.1 GCA947062025_01989 gene open 3946-4134 rpmG
3985 CAMSPR010000111.1 GCA947062025_01990 gene open 4171-4329
3986 CAMSPR010000112.1 GCA947062025_01991 CDS open 326-475 _na     49_aa hypothetical protein
3987 CAMSPR010000112.1 GCA947062025_01992 CDS open 1330-2826 _na     498_aa KAP NTPase domain-containing protein
3988 CAMSPR010000112.1 GCA947062025_01993 CDS open 3216-4556 _na     446_aa Abortive infection protein
3989 CAMSPR010000112.1 GCA947062025_01991 gene open 326-475
3990 CAMSPR010000112.1 GCA947062025_01992 gene open 1330-2826
3991 CAMSPR010000112.1 GCA947062025_01993 gene open 3216-4556
3992 CAMSPR010000113.1 GCA947062025_01994 CDS open 64-279 _na     71_aa hypothetical protein
3993 CAMSPR010000113.1 GCA947062025_01995 CDS open 352-1146 _na     264_aa GLPGLI family protein
3994 CAMSPR010000113.1 GCA947062025_01996 CDS open 1154-3796 _na     880_aa Outer membrane protein beta-barrel domain-containing protein
3995 CAMSPR010000113.1 GCA947062025_01997 CDS open 3796-4011 _na     71_aa cysteine peptidase family C39 domain-containing protein
3996 CAMSPR010000113.1 GCA947062025_01998 CDS open 4198-4641 _na     147_aa hypothetical protein
3997 CAMSPR010000113.1 GCA947062025_01994 gene open 64-279
3998 CAMSPR010000113.1 GCA947062025_01995 gene open 352-1146
3999 CAMSPR010000113.1 GCA947062025_01996 gene open 1154-3796
4000 CAMSPR010000113.1 GCA947062025_01997 gene open 3796-4011