HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptostreptococcus anaerobius (GCA_947086575.1)

Select a Genome:
BAKTA Annotations for GCA_947086575.1
Genome Selected: Peptostreptococcus anaerobius
ContigsBases CDSrRNA tmRNAtRNA
84 1788916 1626 1 1 26
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3342 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:5]    |    Number of Records Found: 3342 [7 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
2001 CAMTZK010000020.1 GCA947086575_01004 CDS open 30099-30605 _na     168_aa Rubrerythrin
2002 CAMTZK010000020.1 GCA947086575_00980 gene open 1040-1324 arsR
2003 CAMTZK010000020.1 GCA947086575_00981 gene open 1580-5362
2004 CAMTZK010000020.1 GCA947086575_00982 gene open 5346-6614
2005 CAMTZK010000020.1 GCA947086575_00983 gene open 6683-8212 purH
2006 CAMTZK010000020.1 GCA947086575_00984 gene open 8228-8821 purN
2007 CAMTZK010000020.1 GCA947086575_00985 gene open 8848-9924
2008 CAMTZK010000020.1 GCA947086575_00986 gene open 10036-10512
2009 CAMTZK010000020.1 GCA947086575_00987 gene open 10953-11723 yaaA
2010 CAMTZK010000020.1 GCA947086575_00988 gene open 11948-13096 nagA
2011 CAMTZK010000020.1 GCA947086575_00989 gene open 13174-13998
2012 CAMTZK010000020.1 GCA947086575_00990 gene open 14009-14920
2013 CAMTZK010000020.1 GCA947086575_00991 gene open 15037-15486 tabA
2014 CAMTZK010000020.1 GCA947086575_00992 gene open 15500-17011
2015 CAMTZK010000020.1 GCA947086575_00993 gene open 17025-17945
2016 CAMTZK010000020.1 GCA947086575_00994 gene open 18053-18751
2017 CAMTZK010000020.1 GCA947086575_00995 gene open 19126-19857 nagB
2018 CAMTZK010000020.1 GCA947086575_00996 gene open 19964-20140
2019 CAMTZK010000020.1 GCA947086575_00997 gene open 20163-21263
2020 CAMTZK010000020.1 GCA947086575_00998 gene open 21347-22537
2021 CAMTZK010000020.1 GCA947086575_00999 gene open 22654-24036
2022 CAMTZK010000020.1 GCA947086575_01000 gene open 24326-25801 adhE
2023 CAMTZK010000020.1 GCA947086575_01001 gene open 26104-26739 opuBB
2024 CAMTZK010000020.1 GCA947086575_01002 gene open 26766-28490
2025 CAMTZK010000020.1 GCA947086575_01003 gene open 28499-29686
2026 CAMTZK010000020.1 GCA947086575_01004 gene open 30099-30605
2027 CAMTZK010000021.1 GCA947086575_01024 gene open 21339-21530 6S
2028 CAMTZK010000021.1 GCA947086575_01024 ncRNA open 21339-21530 6S / SsrS RNA
2029 CAMTZK010000021.1 GCA947086575_01005 CDS open 187-1386 _na     399_aa Phosphoglycerate kinase
2030 CAMTZK010000021.1 GCA947086575_01006 CDS open 1543-2283 _na     246_aa tpiA triose-phosphate isomerase
2031 CAMTZK010000021.1 GCA947086575_01007 CDS open 2357-3883 _na     508_aa gpmI 2%2C3-bisphosphoglycerate-independent phosphoglycerate mutase
2032 CAMTZK010000021.1 GCA947086575_01008 CDS open 4141-5427 _na     428_aa eno phosphopyruvate hydratase
2033 CAMTZK010000021.1 GCA947086575_01009 CDS open 5688-5921 _na     77_aa secG preprotein translocase subunit SecG
2034 CAMTZK010000021.1 GCA947086575_01010 CDS open 5980-8151 _na     723_aa rnr ribonuclease R
2035 CAMTZK010000021.1 GCA947086575_01011 CDS open 8164-8619 _na     151_aa smpB SsrA-binding protein SmpB
2036 CAMTZK010000021.1 GCA947086575_01012 CDS open 8812-9846 _na     344_aa DNA-binding helix-turn-helix protein
2037 CAMTZK010000021.1 GCA947086575_01013 CDS open 9885-11279 _na     464_aa aminopeptidase
2038 CAMTZK010000021.1 GCA947086575_01014 CDS open 11462-12148 _na     228_aa 4Fe-4S ferredoxin-type domain-containing protein
2039 CAMTZK010000021.1 GCA947086575_01015 CDS open 12167-13351 _na     394_aa TVP38/TMEM64 family membrane protein
2040 CAMTZK010000021.1 GCA947086575_01016 CDS open 13386-14072 _na     228_aa TVP38/TMEM64 family membrane protein
2041 CAMTZK010000021.1 GCA947086575_01017 CDS open 14122-15105 _na     327_aa Anaerobic glycerol-3-phosphate dehydrogenase subunit C
2042 CAMTZK010000021.1 GCA947086575_01018 CDS open 15186-16514 _na     442_aa CBS domain protein
2043 CAMTZK010000021.1 GCA947086575_01019 CDS open 16668-17516 _na     282_aa NAD kinase
2044 CAMTZK010000021.1 GCA947086575_01020 CDS open 17644-18567 _na     307_aa Pseudouridine synthase
2045 CAMTZK010000021.1 GCA947086575_01021 CDS open 18639-19649 _na     336_aa 37-kD nucleoid-associated bacterial protein
2046 CAMTZK010000021.1 GCA947086575_01022 CDS open 19739-19966 _na     75_aa acpP acyl carrier protein
2047 CAMTZK010000021.1 GCA947086575_01023 CDS open 20233-21258 _na     341_aa Sugar-binding domain protein
2048 CAMTZK010000021.1 GCA947086575_01025 CDS open 21593-22984 _na     463_aa gntR Transcriptional regulator%2C GntR family
2049 CAMTZK010000021.1 GCA947086575_01026 CDS open 23094-23294 _na     66_aa UPF0291 protein HMPREF0631_1738
2050 CAMTZK010000021.1 GCA947086575_01027 CDS open 23335-24249 _na     304_aa lysR selenium metabolism-associated LysR family transcriptional regulator
2051 CAMTZK010000021.1 GCA947086575_01028 CDS open 24829-25623 _na     264_aa deoR Transcriptional regulator%2C DeoR family
2052 CAMTZK010000021.1 GCA947086575_01029 CDS open 25851-26516 _na     221_aa deoC deoxyribose-phosphate aldolase
2053 CAMTZK010000021.1 GCA947086575_01030 CDS open 26500-27690 _na     396_aa phosphopentomutase
2054 CAMTZK010000021.1 GCA947086575_01031 CDS open 27718-28920 _na     400_aa nupC Nucleoside transporter%2C NupC family
2055 CAMTZK010000021.1 GCA947086575_01032 CDS open 29027-30328 _na     433_aa pyrimidine-nucleoside phosphorylase
2056 CAMTZK010000021.1 GCA947086575_01005 gene open 187-1386
2057 CAMTZK010000021.1 GCA947086575_01006 gene open 1543-2283 tpiA
2058 CAMTZK010000021.1 GCA947086575_01007 gene open 2357-3883 gpmI
2059 CAMTZK010000021.1 GCA947086575_01008 gene open 4141-5427 eno
2060 CAMTZK010000021.1 GCA947086575_01009 gene open 5688-5921 secG
2061 CAMTZK010000021.1 GCA947086575_01010 gene open 5980-8151 rnr
2062 CAMTZK010000021.1 GCA947086575_01011 gene open 8164-8619 smpB
2063 CAMTZK010000021.1 GCA947086575_01012 gene open 8812-9846
2064 CAMTZK010000021.1 GCA947086575_01013 gene open 9885-11279
2065 CAMTZK010000021.1 GCA947086575_01014 gene open 11462-12148
2066 CAMTZK010000021.1 GCA947086575_01015 gene open 12167-13351
2067 CAMTZK010000021.1 GCA947086575_01016 gene open 13386-14072
2068 CAMTZK010000021.1 GCA947086575_01017 gene open 14122-15105
2069 CAMTZK010000021.1 GCA947086575_01018 gene open 15186-16514
2070 CAMTZK010000021.1 GCA947086575_01019 gene open 16668-17516
2071 CAMTZK010000021.1 GCA947086575_01020 gene open 17644-18567
2072 CAMTZK010000021.1 GCA947086575_01021 gene open 18639-19649
2073 CAMTZK010000021.1 GCA947086575_01022 gene open 19739-19966 acpP
2074 CAMTZK010000021.1 GCA947086575_01023 gene open 20233-21258
2075 CAMTZK010000021.1 GCA947086575_01025 gene open 21593-22984 gntR
2076 CAMTZK010000021.1 GCA947086575_01026 gene open 23094-23294
2077 CAMTZK010000021.1 GCA947086575_01027 gene open 23335-24249 lysR
2078 CAMTZK010000021.1 GCA947086575_01028 gene open 24829-25623 deoR
2079 CAMTZK010000021.1 GCA947086575_01029 gene open 25851-26516 deoC
2080 CAMTZK010000021.1 GCA947086575_01030 gene open 26500-27690
2081 CAMTZK010000021.1 GCA947086575_01031 gene open 27718-28920 nupC
2082 CAMTZK010000021.1 GCA947086575_01032 gene open 29027-30328
2083 CAMTZK010000022.1 regulatory_region open 6522-6790 T-box leader
2084 CAMTZK010000022.1 GCA947086575_01033 CDS open 1655-2230 _na     191_aa zapA Cell division protein ZapA
2085 CAMTZK010000022.1 GCA947086575_01034 CDS open 3039-5432 _na     797_aa pheT phenylalanine--tRNA ligase subunit beta
2086 CAMTZK010000022.1 GCA947086575_01035 CDS open 5445-6524 _na     359_aa pheS phenylalanine--tRNA ligase subunit alpha
2087 CAMTZK010000022.1 GCA947086575_01036 CDS open 6948-7730 _na     260_aa trmH TrmH family tRNA/rRNA methyltransferase
2088 CAMTZK010000022.1 GCA947086575_01037 CDS open 7742-8395 _na     217_aa trkA TrkA N-terminal domain protein
2089 CAMTZK010000022.1 GCA947086575_01038 CDS open 8493-9860 _na     455_aa trkH Potassium uptake protein%2C TrkH family
2090 CAMTZK010000022.1 GCA947086575_01039 CDS open 10076-12139 _na     687_aa Arylsulfatase
2091 CAMTZK010000022.1 GCA947086575_01040 CDS open 12142-13101 _na     319_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
2092 CAMTZK010000022.1 GCA947086575_01041 CDS open 13386-13706 _na     106_aa yajC preprotein translocase subunit YajC
2093 CAMTZK010000022.1 GCA947086575_01042 CDS open 13762-14880 _na     372_aa tgt tRNA guanosine(34) transglycosylase Tgt
2094 CAMTZK010000022.1 GCA947086575_01043 CDS open 14977-15999 _na     340_aa queA tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA
2095 CAMTZK010000022.1 GCA947086575_01044 CDS open 16018-17034 _na     338_aa ruvB Holliday junction branch migration DNA helicase RuvB
2096 CAMTZK010000022.1 GCA947086575_01045 CDS open 17048-17671 _na     207_aa ruvA Holliday junction branch migration protein RuvA
2097 CAMTZK010000022.1 GCA947086575_01046 CDS open 17807-18301 _na     164_aa ruvC crossover junction endodeoxyribonuclease RuvC
2098 CAMTZK010000022.1 GCA947086575_01047 CDS open 18693-19277 _na     194_aa DNA-binding helix-turn-helix protein
2099 CAMTZK010000022.1 GCA947086575_01048 CDS open 19437-20258 _na     273_aa 3D domain protein
2100 CAMTZK010000022.1 GCA947086575_01049 CDS open 20520-21224 _na     234_aa Tat pathway signal sequence domain protein
2101 CAMTZK010000022.1 GCA947086575_01050 CDS open 21241-21558 _na     105_aa Lipoprotein
2102 CAMTZK010000022.1 GCA947086575_01051 CDS open 21612-22271 _na     219_aa tetR Transcriptional regulator%2C TetR family
2103 CAMTZK010000022.1 GCA947086575_01052 CDS open 22454-22810 _na     118_aa rplT 50S ribosomal protein L20
2104 CAMTZK010000022.1 GCA947086575_01053 CDS open 22835-23032 _na     65_aa rpmI 50S ribosomal protein L35
2105 CAMTZK010000022.1 GCA947086575_01054 CDS open 23059-23460 _na     133_aa infC translation initiation factor IF-3
2106 CAMTZK010000022.1 GCA947086575_01055 CDS open 23987-24853 _na     288_aa methionyl aminopeptidase
2107 CAMTZK010000022.1 GCA947086575_01056 CDS open 25087-25704 _na     205_aa Riboflavin transporter
2108 CAMTZK010000022.1 GCA947086575_01058 CDS open 26107-26619 _na     170_aa Ferritin
2109 CAMTZK010000022.1 GCA947086575_01033 gene open 1655-2230 zapA
2110 CAMTZK010000022.1 GCA947086575_01034 gene open 3039-5432 pheT
2111 CAMTZK010000022.1 GCA947086575_01035 gene open 5445-6524 pheS
2112 CAMTZK010000022.1 GCA947086575_01036 gene open 6948-7730 trmH
2113 CAMTZK010000022.1 GCA947086575_01037 gene open 7742-8395 trkA
2114 CAMTZK010000022.1 GCA947086575_01038 gene open 8493-9860 trkH
2115 CAMTZK010000022.1 GCA947086575_01039 gene open 10076-12139
2116 CAMTZK010000022.1 GCA947086575_01040 gene open 12142-13101 lytC
2117 CAMTZK010000022.1 GCA947086575_01041 gene open 13386-13706 yajC
2118 CAMTZK010000022.1 GCA947086575_01042 gene open 13762-14880 tgt
2119 CAMTZK010000022.1 GCA947086575_01043 gene open 14977-15999 queA
2120 CAMTZK010000022.1 GCA947086575_01044 gene open 16018-17034 ruvB
2121 CAMTZK010000022.1 GCA947086575_01045 gene open 17048-17671 ruvA
2122 CAMTZK010000022.1 GCA947086575_01046 gene open 17807-18301 ruvC
2123 CAMTZK010000022.1 GCA947086575_01047 gene open 18693-19277
2124 CAMTZK010000022.1 GCA947086575_01048 gene open 19437-20258
2125 CAMTZK010000022.1 GCA947086575_01049 gene open 20520-21224
2126 CAMTZK010000022.1 GCA947086575_01050 gene open 21241-21558
2127 CAMTZK010000022.1 GCA947086575_01051 gene open 21612-22271 tetR
2128 CAMTZK010000022.1 GCA947086575_01052 gene open 22454-22810 rplT
2129 CAMTZK010000022.1 GCA947086575_01053 gene open 22835-23032 rpmI
2130 CAMTZK010000022.1 GCA947086575_01054 gene open 23059-23460 infC
2131 CAMTZK010000022.1 GCA947086575_01055 gene open 23987-24853
2132 CAMTZK010000022.1 GCA947086575_01056 gene open 25087-25704
2133 CAMTZK010000022.1 GCA947086575_01058 gene open 26107-26619
2134 CAMTZK010000022.1 GCA947086575_01057 gene open 25762-25845 trnL
2135 CAMTZK010000022.1 GCA947086575_01057 tRNA open 25762-25845 trnL tRNA-Leu(caa)
2136 CAMTZK010000023.1 repeat_region open 22292-23854 CRISPR array with 26 repeats of length 28%2C consensus sequence GTACTACCCACACACGTGGGGGTGATCC and spacer length 33
2137 CAMTZK010000023.1 GCA947086575_01059 CDS open 520-753 _na     77_aa hypothetical protein
2138 CAMTZK010000023.1 GCA947086575_01060 CDS open 1400-2308 _na     302_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
2139 CAMTZK010000023.1 GCA947086575_01061 CDS open 2482-3024 _na     180_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
2140 CAMTZK010000023.1 GCA947086575_01062 CDS open 3026-4375 _na     449_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
2141 CAMTZK010000023.1 GCA947086575_01063 CDS open 4378-5238 _na     286_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
2142 CAMTZK010000023.1 GCA947086575_01064 CDS open 5299-6042 _na     247_aa acetyl-CoA carboxytransferase
2143 CAMTZK010000023.1 GCA947086575_01065 CDS open 6057-6746 _na     229_aa marR Transcriptional regulator%2C MarR family
2144 CAMTZK010000023.1 GCA947086575_01066 CDS open 6736-7746 _na     336_aa 3-oxoacyl-[acyl-carrier-protein] synthase 3
2145 CAMTZK010000023.1 GCA947086575_01067 CDS open 7907-8137 _na     76_aa Acyl carrier protein
2146 CAMTZK010000023.1 GCA947086575_01068 CDS open 8137-9090 _na     317_aa Nitronate monooxygenase
2147 CAMTZK010000023.1 GCA947086575_01069 CDS open 9083-10015 _na     310_aa Malonyl CoA-acyl carrier protein transacylase
2148 CAMTZK010000023.1 GCA947086575_01070 CDS open 10031-10777 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
2149 CAMTZK010000023.1 GCA947086575_01071 CDS open 10800-12035 _na     411_aa fabF beta-ketoacyl-ACP synthase II
2150 CAMTZK010000023.1 GCA947086575_01072 CDS open 12050-12496 _na     148_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
2151 CAMTZK010000023.1 GCA947086575_01073 CDS open 12844-15621 _na     925_aa Helicase Cas3
2152 CAMTZK010000023.1 GCA947086575_01074 CDS open 15625-17370 _na     581_aa casA type I-E CRISPR-associated protein Cse1/CasA
2153 CAMTZK010000023.1 GCA947086575_01075 CDS open 17357-17938 _na     193_aa casB type I-E CRISPR-associated protein Cse2/CasB
2154 CAMTZK010000023.1 GCA947086575_01076 CDS open 17979-19055 _na     358_aa cas7e type I-E CRISPR-associated protein Cas7/Cse4/CasC
2155 CAMTZK010000023.1 GCA947086575_01077 CDS open 19073-19792 _na     239_aa cas5e type I-E CRISPR-associated protein Cas5/CasD
2156 CAMTZK010000023.1 GCA947086575_01078 CDS open 19804-20439 _na     211_aa cas6e type I-E CRISPR-associated protein Cas6/Cse3/CasE
2157 CAMTZK010000023.1 GCA947086575_01079 CDS open 20444-21385 _na     313_aa cas1e type I-E CRISPR-associated endonuclease Cas1e
2158 CAMTZK010000023.1 GCA947086575_01080 CDS open 21387-22268 _na     293_aa cas2e type I-E CRISPR-associated endoribonuclease Cas2e
2159 CAMTZK010000023.1 GCA947086575_01081 CDS open 24076-24381 _na     101_aa hypothetical protein
2160 CAMTZK010000023.1 GCA947086575_01082 CDS open 24496-24765 _na     89_aa hypothetical protein
2161 CAMTZK010000023.1 GCA947086575_01083 CDS open 25282-26592 _na     436_aa IS30 family transposase
2162 CAMTZK010000023.1 GCA947086575_01059 gene open 520-753
2163 CAMTZK010000023.1 GCA947086575_01060 gene open 1400-2308 prmC
2164 CAMTZK010000023.1 GCA947086575_01061 gene open 2482-3024 accB
2165 CAMTZK010000023.1 GCA947086575_01062 gene open 3026-4375 accC
2166 CAMTZK010000023.1 GCA947086575_01063 gene open 4378-5238 accD
2167 CAMTZK010000023.1 GCA947086575_01064 gene open 5299-6042
2168 CAMTZK010000023.1 GCA947086575_01065 gene open 6057-6746 marR
2169 CAMTZK010000023.1 GCA947086575_01066 gene open 6736-7746
2170 CAMTZK010000023.1 GCA947086575_01067 gene open 7907-8137
2171 CAMTZK010000023.1 GCA947086575_01068 gene open 8137-9090
2172 CAMTZK010000023.1 GCA947086575_01069 gene open 9083-10015
2173 CAMTZK010000023.1 GCA947086575_01070 gene open 10031-10777 fabG
2174 CAMTZK010000023.1 GCA947086575_01071 gene open 10800-12035 fabF
2175 CAMTZK010000023.1 GCA947086575_01072 gene open 12050-12496 fabZ
2176 CAMTZK010000023.1 GCA947086575_01073 gene open 12844-15621
2177 CAMTZK010000023.1 GCA947086575_01074 gene open 15625-17370 casA
2178 CAMTZK010000023.1 GCA947086575_01075 gene open 17357-17938 casB
2179 CAMTZK010000023.1 GCA947086575_01076 gene open 17979-19055 cas7e
2180 CAMTZK010000023.1 GCA947086575_01077 gene open 19073-19792 cas5e
2181 CAMTZK010000023.1 GCA947086575_01078 gene open 19804-20439 cas6e
2182 CAMTZK010000023.1 GCA947086575_01079 gene open 20444-21385 cas1e
2183 CAMTZK010000023.1 GCA947086575_01080 gene open 21387-22268 cas2e
2184 CAMTZK010000023.1 GCA947086575_01081 gene open 24076-24381
2185 CAMTZK010000023.1 GCA947086575_01082 gene open 24496-24765
2186 CAMTZK010000023.1 GCA947086575_01083 gene open 25282-26592
2187 CAMTZK010000024.1 regulatory_region open 20966-21173 T-box leader
2188 CAMTZK010000024.1 GCA947086575_01084 CDS open 3-953 _na     316_aa galT galactose-1-phosphate uridylyltransferase
2189 CAMTZK010000024.1 GCA947086575_01085 CDS open 1208-3109 _na     633_aa Glutamine synthetase
2190 CAMTZK010000024.1 GCA947086575_01086 CDS open 3513-3959 _na     148_aa HTH domain protein
2191 CAMTZK010000024.1 GCA947086575_01087 CDS open 4036-5259 _na     407_aa tyrS tyrosine--tRNA ligase
2192 CAMTZK010000024.1 GCA947086575_01088 CDS open 5658-6014 _na     118_aa rplS 50S ribosomal protein L19
2193 CAMTZK010000024.1 GCA947086575_01089 CDS open 6126-7013 _na     295_aa ylqF ribosome biogenesis GTPase YlqF
2194 CAMTZK010000024.1 GCA947086575_01090 CDS open 7164-8327 _na     387_aa alr alanine racemase
2195 CAMTZK010000024.1 GCA947086575_01091 CDS open 8478-9278 _na     266_aa ribonuclease HII
2196 CAMTZK010000024.1 GCA947086575_01092 CDS open 9451-10455 _na     334_aa L-lactate oxidase
2197 CAMTZK010000024.1 GCA947086575_01093 CDS open 10480-10851 _na     123_aa Aldoketomutase
2198 CAMTZK010000024.1 GCA947086575_01094 CDS open 11047-11397 _na     116_aa yraN YraN family protein
2199 CAMTZK010000024.1 GCA947086575_01095 CDS open 11553-13148 _na     531_aa comM Competence protein ComM
2200 CAMTZK010000024.1 GCA947086575_01096 CDS open 13281-14552 _na     423_aa dprA DNA-processing protein DprA
2201 CAMTZK010000024.1 GCA947086575_01097 CDS open 14606-16660 _na     684_aa topA type I DNA topoisomerase
2202 CAMTZK010000024.1 GCA947086575_01098 CDS open 16896-17672 _na     258_aa codY GTP-sensing pleiotropic transcriptional regulator CodY
2203 CAMTZK010000024.1 GCA947086575_01099 CDS open 17784-19055 _na     423_aa ATPase%2C AAA family
2204 CAMTZK010000024.1 GCA947086575_01100 CDS open 19148-19606 _na     152_aa Transcriptional regulator%2C Rrf2 family
2205 CAMTZK010000024.1 GCA947086575_01101 CDS open 19804-20856 _na     350_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
2206 CAMTZK010000024.1 GCA947086575_01102 CDS open 21296-23932 _na     878_aa alaS alanine--tRNA ligase
2207 CAMTZK010000024.1 GCA947086575_01103 CDS open 24026-24607 _na     193_aa PAP2 family protein
2208 CAMTZK010000024.1 GCA947086575_01084 gene open 3-953 galT
2209 CAMTZK010000024.1 GCA947086575_01085 gene open 1208-3109
2210 CAMTZK010000024.1 GCA947086575_01086 gene open 3513-3959
2211 CAMTZK010000024.1 GCA947086575_01087 gene open 4036-5259 tyrS
2212 CAMTZK010000024.1 GCA947086575_01088 gene open 5658-6014 rplS
2213 CAMTZK010000024.1 GCA947086575_01089 gene open 6126-7013 ylqF
2214 CAMTZK010000024.1 GCA947086575_01090 gene open 7164-8327 alr
2215 CAMTZK010000024.1 GCA947086575_01091 gene open 8478-9278
2216 CAMTZK010000024.1 GCA947086575_01092 gene open 9451-10455
2217 CAMTZK010000024.1 GCA947086575_01093 gene open 10480-10851
2218 CAMTZK010000024.1 GCA947086575_01094 gene open 11047-11397 yraN
2219 CAMTZK010000024.1 GCA947086575_01095 gene open 11553-13148 comM
2220 CAMTZK010000024.1 GCA947086575_01096 gene open 13281-14552 dprA
2221 CAMTZK010000024.1 GCA947086575_01097 gene open 14606-16660 topA
2222 CAMTZK010000024.1 GCA947086575_01098 gene open 16896-17672 codY
2223 CAMTZK010000024.1 GCA947086575_01099 gene open 17784-19055
2224 CAMTZK010000024.1 GCA947086575_01100 gene open 19148-19606
2225 CAMTZK010000024.1 GCA947086575_01101 gene open 19804-20856 mnmA
2226 CAMTZK010000024.1 GCA947086575_01102 gene open 21296-23932 alaS
2227 CAMTZK010000024.1 GCA947086575_01103 gene open 24026-24607
2228 CAMTZK010000025.1 GCA947086575_01112 CDS open 1104-2204 _na     366_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
2229 CAMTZK010000025.1 GCA947086575_01113 CDS open 2453-3343 _na     296_aa Beta-glucoside kinase
2230 CAMTZK010000025.1 GCA947086575_01114 CDS open 3771-4760 _na     329_aa Maltose operon transcriptional repressor
2231 CAMTZK010000025.1 GCA947086575_01115 CDS open 4801-6087 _na     428_aa ABC transporter%2C solute-binding protein
2232 CAMTZK010000025.1 GCA947086575_01116 CDS open 6161-7033 _na     290_aa ABC transporter%2C permease protein
2233 CAMTZK010000025.1 GCA947086575_01117 CDS open 7033-7854 _na     273_aa ycjP Inner membrane ABC transporter permease protein ycjP
2234 CAMTZK010000025.1 GCA947086575_01118 CDS open 7885-10164 _na     759_aa Glycosyl hydrolase family 65 central catalytic domain protein
2235 CAMTZK010000025.1 GCA947086575_01119 CDS open 10184-11842 _na     552_aa Oligo-1%2C6-glucosidase 1
2236 CAMTZK010000025.1 GCA947086575_01120 CDS open 11852-12493 _na     213_aa pgmB beta-phosphoglucomutase
2237 CAMTZK010000025.1 GCA947086575_01121 CDS open 12509-13633 _na     374_aa ABC transporter%2C ATP-binding protein
2238 CAMTZK010000025.1 GCA947086575_01122 CDS open 13759-14622 _na     287_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
2239 CAMTZK010000025.1 GCA947086575_01123 CDS open 14813-16213 _na     466_aa gabR HTH-type transcriptional regulatory protein gabR
2240 CAMTZK010000025.1 GCA947086575_01124 CDS open 17114-17515 _na     133_aa hypothetical protein
2241 CAMTZK010000025.1 GCA947086575_01126 CDS open 17673-18749 _na     358_aa Aldose 1-epimerase
2242 CAMTZK010000025.1 GCA947086575_01127 CDS open 18913-20145 _na     410_aa pepT peptidase T
2243 CAMTZK010000025.1 GCA947086575_01128 CDS open 20348-21754 _na     468_aa gnd decarboxylating NADP(+)-dependent phosphogluconate dehydrogenase
2244 CAMTZK010000025.1 GCA947086575_01129 CDS open 21764-23206 _na     480_aa zwf glucose-6-phosphate dehydrogenase
2245 CAMTZK010000025.1 GCA947086575_01130 CDS open 23208-23831 _na     207_aa Kynurenine formamidase
2246 CAMTZK010000025.1 GCA947086575_01112 gene open 1104-2204 lytC
2247 CAMTZK010000025.1 GCA947086575_01113 gene open 2453-3343
2248 CAMTZK010000025.1 GCA947086575_01114 gene open 3771-4760
2249 CAMTZK010000025.1 GCA947086575_01115 gene open 4801-6087
2250 CAMTZK010000025.1 GCA947086575_01116 gene open 6161-7033
2251 CAMTZK010000025.1 GCA947086575_01117 gene open 7033-7854 ycjP
2252 CAMTZK010000025.1 GCA947086575_01118 gene open 7885-10164
2253 CAMTZK010000025.1 GCA947086575_01119 gene open 10184-11842
2254 CAMTZK010000025.1 GCA947086575_01120 gene open 11852-12493 pgmB
2255 CAMTZK010000025.1 GCA947086575_01121 gene open 12509-13633
2256 CAMTZK010000025.1 GCA947086575_01122 gene open 13759-14622 pdxS
2257 CAMTZK010000025.1 GCA947086575_01123 gene open 14813-16213 gabR
2258 CAMTZK010000025.1 GCA947086575_01124 gene open 17114-17515
2259 CAMTZK010000025.1 GCA947086575_01126 gene open 17673-18749
2260 CAMTZK010000025.1 GCA947086575_01127 gene open 18913-20145 pepT
2261 CAMTZK010000025.1 GCA947086575_01128 gene open 20348-21754 gnd
2262 CAMTZK010000025.1 GCA947086575_01129 gene open 21764-23206 zwf
2263 CAMTZK010000025.1 GCA947086575_01130 gene open 23208-23831
2264 CAMTZK010000025.1 GCA947086575_01104 gene open 62-135 trnR
2265 CAMTZK010000025.1 GCA947086575_01105 gene open 147-222 trnQ
2266 CAMTZK010000025.1 GCA947086575_01106 gene open 263-351 trnS
2267 CAMTZK010000025.1 GCA947086575_01107 gene open 358-433 trnF
2268 CAMTZK010000025.1 GCA947086575_01108 gene open 441-514 trnM
2269 CAMTZK010000025.1 GCA947086575_01109 gene open 535-607 trnK
2270 CAMTZK010000025.1 GCA947086575_01110 gene open 624-694 trnC
2271 CAMTZK010000025.1 GCA947086575_01111 gene open 705-778 trnR
2272 CAMTZK010000025.1 GCA947086575_01125 gene open 17547-17620 trnR
2273 CAMTZK010000025.1 GCA947086575_01104 tRNA open 62-135 trnR tRNA-Arg(tct)
2274 CAMTZK010000025.1 GCA947086575_01105 tRNA open 147-222 trnQ tRNA-Gln(ttg)
2275 CAMTZK010000025.1 GCA947086575_01106 tRNA open 263-351 trnS tRNA-Ser(tga)
2276 CAMTZK010000025.1 GCA947086575_01107 tRNA open 358-433 trnF tRNA-Phe(gaa)
2277 CAMTZK010000025.1 GCA947086575_01108 tRNA open 441-514 trnM tRNA-Met(cat)
2278 CAMTZK010000025.1 GCA947086575_01109 tRNA open 535-607 trnK tRNA-Lys(ctt)
2279 CAMTZK010000025.1 GCA947086575_01110 tRNA open 624-694 trnC tRNA-Cys(gca)
2280 CAMTZK010000025.1 GCA947086575_01111 tRNA open 705-778 trnR tRNA-Arg(acg)
2281 CAMTZK010000025.1 GCA947086575_01125 tRNA open 17547-17620 trnR tRNA-Arg(tcg)
2282 CAMTZK010000026.1 GCA947086575_01131 CDS open 318-536 _na     72_aa feoA FeoA domain protein
2283 CAMTZK010000026.1 GCA947086575_01132 CDS open 719-952 _na     77_aa feoA FeoA domain protein
2284 CAMTZK010000026.1 GCA947086575_01133 CDS open 1201-3360 _na     719_aa feoB ferrous iron transport protein B
2285 CAMTZK010000026.1 GCA947086575_01134 CDS open 3536-3679 _na     47_aa FeoB-associated Cys-rich membrane protein
2286 CAMTZK010000026.1 GCA947086575_01135 CDS open 3873-4796 _na     307_aa pyrB aspartate carbamoyltransferase
2287 CAMTZK010000026.1 GCA947086575_01136 CDS open 4796-5485 _na     229_aa dihydroorotate dehydrogenase electron transfer subunit
2288 CAMTZK010000026.1 GCA947086575_01137 CDS open 5485-6387 _na     300_aa dihydroorotate dehydrogenase
2289 CAMTZK010000026.1 GCA947086575_01138 CDS open 6511-7092 _na     193_aa Orotate phosphoribosyltransferase
2290 CAMTZK010000026.1 GCA947086575_01139 CDS open 7276-7887 _na     203_aa amaP alkaline shock response membrane anchor protein AmaP
2291 CAMTZK010000026.1 GCA947086575_01140 CDS open 7900-8433 _na     177_aa DUF2273 domain-containing protein
2292 CAMTZK010000026.1 GCA947086575_01141 CDS open 8523-8915 _na     130_aa Alkaline shock protein 23 domain protein
2293 CAMTZK010000026.1 GCA947086575_01142 CDS open 8988-9878 _na     296_aa DNA-(apurinic or apyrimidinic site) lyase
2294 CAMTZK010000026.1 GCA947086575_01143 CDS open 9887-11368 _na     493_aa cls cardiolipin synthase
2295 CAMTZK010000026.1 GCA947086575_01144 CDS open 11447-11731 _na     94_aa Co-chaperonin GroES
2296 CAMTZK010000026.1 GCA947086575_01145 CDS open 11751-13373 _na     540_aa groL chaperonin GroEL
2297 CAMTZK010000026.1 GCA947086575_01146 CDS open 13618-14646 _na     342_aa Sulfate exporter family transporter
2298 CAMTZK010000026.1 GCA947086575_01147 CDS open 14821-15054 _na     77_aa F0F1-ATPase subunit (ATPase_gene1)
2299 CAMTZK010000026.1 GCA947086575_01148 CDS open 15047-15436 _na     129_aa ATP synthase subunit I
2300 CAMTZK010000026.1 GCA947086575_01149 CDS open 15453-16157 _na     234_aa ATP synthase subunit a
2301 CAMTZK010000026.1 GCA947086575_01150 CDS open 16275-16538 _na     87_aa atpE ATP synthase F0 subunit C
2302 CAMTZK010000026.1 GCA947086575_01151 CDS open 16581-17081 _na     166_aa atpF F0F1 ATP synthase subunit B
2303 CAMTZK010000026.1 GCA947086575_01152 CDS open 17081-17623 _na     180_aa F0F1 ATP synthase subunit delta
2304 CAMTZK010000026.1 GCA947086575_01153 CDS open 17640-19136 _na     498_aa atpA F0F1 ATP synthase subunit alpha
2305 CAMTZK010000026.1 GCA947086575_01154 CDS open 19165-20163 _na     332_aa atpG ATP synthase F1 subunit gamma
2306 CAMTZK010000026.1 GCA947086575_01155 CDS open 20174-21571 _na     465_aa atpD F0F1 ATP synthase subunit beta
2307 CAMTZK010000026.1 GCA947086575_01156 CDS open 21571-21828 _na     85_aa ATP synthase%2C delta/epsilon subunit%2C beta-sandwich domain protein
2308 CAMTZK010000026.1 GCA947086575_01157 CDS open 21847-22425 _na     192_aa DUF4829 domain-containing protein
2309 CAMTZK010000026.1 GCA947086575_01158 CDS open 22636-23460 _na     274_aa zinc ribbon domain-containing protein
2310 CAMTZK010000026.1 GCA947086575_01131 gene open 318-536 feoA
2311 CAMTZK010000026.1 GCA947086575_01132 gene open 719-952 feoA
2312 CAMTZK010000026.1 GCA947086575_01133 gene open 1201-3360 feoB
2313 CAMTZK010000026.1 GCA947086575_01134 gene open 3536-3679
2314 CAMTZK010000026.1 GCA947086575_01135 gene open 3873-4796 pyrB
2315 CAMTZK010000026.1 GCA947086575_01136 gene open 4796-5485
2316 CAMTZK010000026.1 GCA947086575_01137 gene open 5485-6387
2317 CAMTZK010000026.1 GCA947086575_01138 gene open 6511-7092
2318 CAMTZK010000026.1 GCA947086575_01139 gene open 7276-7887 amaP
2319 CAMTZK010000026.1 GCA947086575_01140 gene open 7900-8433
2320 CAMTZK010000026.1 GCA947086575_01141 gene open 8523-8915
2321 CAMTZK010000026.1 GCA947086575_01142 gene open 8988-9878
2322 CAMTZK010000026.1 GCA947086575_01143 gene open 9887-11368 cls
2323 CAMTZK010000026.1 GCA947086575_01144 gene open 11447-11731
2324 CAMTZK010000026.1 GCA947086575_01145 gene open 11751-13373 groL
2325 CAMTZK010000026.1 GCA947086575_01146 gene open 13618-14646
2326 CAMTZK010000026.1 GCA947086575_01147 gene open 14821-15054
2327 CAMTZK010000026.1 GCA947086575_01148 gene open 15047-15436
2328 CAMTZK010000026.1 GCA947086575_01149 gene open 15453-16157
2329 CAMTZK010000026.1 GCA947086575_01150 gene open 16275-16538 atpE
2330 CAMTZK010000026.1 GCA947086575_01151 gene open 16581-17081 atpF
2331 CAMTZK010000026.1 GCA947086575_01152 gene open 17081-17623
2332 CAMTZK010000026.1 GCA947086575_01153 gene open 17640-19136 atpA
2333 CAMTZK010000026.1 GCA947086575_01154 gene open 19165-20163 atpG
2334 CAMTZK010000026.1 GCA947086575_01155 gene open 20174-21571 atpD
2335 CAMTZK010000026.1 GCA947086575_01156 gene open 21571-21828
2336 CAMTZK010000026.1 GCA947086575_01157 gene open 21847-22425
2337 CAMTZK010000026.1 GCA947086575_01158 gene open 22636-23460
2338 CAMTZK010000027.1 GCA947086575_01159 CDS open 95-3628 _na     1177_aa nifJ pyruvate:ferredoxin (flavodoxin) oxidoreductase
2339 CAMTZK010000027.1 GCA947086575_01160 CDS open 4142-5908 _na     588_aa rsbU Phosphoserine phosphatase rsbU
2340 CAMTZK010000027.1 GCA947086575_01161 CDS open 6193-6654 _na     153_aa hypothetical protein
2341 CAMTZK010000027.1 GCA947086575_01162 CDS open 6772-8016 _na     414_aa Flavoprotein family protein
2342 CAMTZK010000027.1 GCA947086575_01163 CDS open 8026-8811 _na     261_aa Cof-like hydrolase
2343 CAMTZK010000027.1 GCA947086575_01164 CDS open 8813-9337 _na     174_aa hpt hypoxanthine phosphoribosyltransferase
2344 CAMTZK010000027.1 GCA947086575_01165 CDS open 9357-10361 _na     334_aa asnA aspartate--ammonia ligase
2345 CAMTZK010000027.1 GCA947086575_01166 CDS open 10479-11645 _na     388_aa Lipoprotein
2346 CAMTZK010000027.1 GCA947086575_01167 CDS open 11662-12771 _na     369_aa Lipoprotein
2347 CAMTZK010000027.1 GCA947086575_01168 CDS open 12782-13801 _na     339_aa galE UDP-glucose 4-epimerase GalE
2348 CAMTZK010000027.1 GCA947086575_01169 CDS open 13812-13988 _na     58_aa hypothetical protein
2349 CAMTZK010000027.1 GCA947086575_01170 CDS open 13988-15970 _na     660_aa hypothetical protein
2350 CAMTZK010000027.1 GCA947086575_01171 CDS open 15983-18940 _na     985_aa Sporulation and cell division repeat protein
2351 CAMTZK010000027.1 GCA947086575_01172 CDS open 19154-19639 _na     161_aa GAF domain-containing protein
2352 CAMTZK010000027.1 GCA947086575_01173 CDS open 19762-20598 _na     278_aa Thermonuclease
2353 CAMTZK010000027.1 GCA947086575_01174 CDS open 20653-21480 _na     275_aa hypothetical protein
2354 CAMTZK010000027.1 GCA947086575_01159 gene open 95-3628 nifJ
2355 CAMTZK010000027.1 GCA947086575_01160 gene open 4142-5908 rsbU
2356 CAMTZK010000027.1 GCA947086575_01161 gene open 6193-6654
2357 CAMTZK010000027.1 GCA947086575_01162 gene open 6772-8016
2358 CAMTZK010000027.1 GCA947086575_01163 gene open 8026-8811
2359 CAMTZK010000027.1 GCA947086575_01164 gene open 8813-9337 hpt
2360 CAMTZK010000027.1 GCA947086575_01165 gene open 9357-10361 asnA
2361 CAMTZK010000027.1 GCA947086575_01166 gene open 10479-11645
2362 CAMTZK010000027.1 GCA947086575_01167 gene open 11662-12771
2363 CAMTZK010000027.1 GCA947086575_01168 gene open 12782-13801 galE
2364 CAMTZK010000027.1 GCA947086575_01169 gene open 13812-13988
2365 CAMTZK010000027.1 GCA947086575_01170 gene open 13988-15970
2366 CAMTZK010000027.1 GCA947086575_01171 gene open 15983-18940
2367 CAMTZK010000027.1 GCA947086575_01172 gene open 19154-19639
2368 CAMTZK010000027.1 GCA947086575_01173 gene open 19762-20598
2369 CAMTZK010000027.1 GCA947086575_01174 gene open 20653-21480
2370 CAMTZK010000028.1 GCA947086575_01175 CDS open 19-279 _na     86_aa hypothetical protein
2371 CAMTZK010000028.1 GCA947086575_01176 CDS open 459-1250 _na     263_aa sufC Fe-S cluster assembly ATPase SufC
2372 CAMTZK010000028.1 GCA947086575_01177 CDS open 1240-2652 _na     470_aa sufB Fe-S cluster assembly protein SufB
2373 CAMTZK010000028.1 GCA947086575_01178 CDS open 2664-3494 _na     276_aa sufD FeS cluster assembly protein sufD
2374 CAMTZK010000028.1 GCA947086575_01179 CDS open 3606-4841 _na     411_aa Cysteine desulfurase
2375 CAMTZK010000028.1 GCA947086575_01180 CDS open 4831-5277 _na     148_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
2376 CAMTZK010000028.1 GCA947086575_01181 CDS open 5477-6103 _na     208_aa hypothetical protein
2377 CAMTZK010000028.1 GCA947086575_01182 CDS open 6115-6663 _na     182_aa Chromate transport protein
2378 CAMTZK010000028.1 GCA947086575_01183 CDS open 6664-7221 _na     185_aa Chromate transport protein
2379 CAMTZK010000028.1 GCA947086575_01184 CDS open 7286-7843 _na     185_aa hypothetical protein
2380 CAMTZK010000028.1 GCA947086575_01185 CDS open 7854-8264 _na     136_aa Tetratricopeptide repeat protein
2381 CAMTZK010000028.1 GCA947086575_01186 CDS open 8322-9053 _na     243_aa phosphoserine phosphatase
2382 CAMTZK010000028.1 GCA947086575_01187 CDS open 9205-10353 _na     382_aa hypothetical protein
2383 CAMTZK010000028.1 GCA947086575_01188 CDS open 10477-11133 _na     218_aa YheO-like protein
2384 CAMTZK010000028.1 GCA947086575_01189 CDS open 11386-11676 _na     96_aa Gram-positive signal peptide protein%2C YSIRK family
2385 CAMTZK010000028.1 GCA947086575_01190 CDS open 11676-12740 _na     354_aa Lipoprotein
2386 CAMTZK010000028.1 GCA947086575_01191 CDS open 12835-13122 _na     95_aa YcxB-like protein domain-containing protein
2387 CAMTZK010000028.1 GCA947086575_01192 CDS open 13208-14134 _na     308_aa Hydroxyacylglutathione hydrolase
2388 CAMTZK010000028.1 GCA947086575_01193 CDS open 14157-14963 _na     268_aa yjbM GTP pyrophosphokinase yjbM
2389 CAMTZK010000028.1 GCA947086575_01194 CDS open 14965-15660 _na     231_aa Ser/Thr phosphatase family protein
2390 CAMTZK010000028.1 GCA947086575_01195 CDS open 15657-16220 _na     187_aa Nucleotidase
2391 CAMTZK010000028.1 GCA947086575_01196 CDS open 16313-17236 _na     307_aa fba class II fructose-1%2C6-bisphosphate aldolase
2392 CAMTZK010000028.1 GCA947086575_01197 CDS open 17452-18648 _na     398_aa Monogalactosyldiacylglycerol synthase%2C C-terminal domain protein
2393 CAMTZK010000028.1 GCA947086575_01198 CDS open 18775-19464 _na     229_aa Bifunctional xylanase/deacetylase
2394 CAMTZK010000028.1 GCA947086575_01199 CDS open 19476-20510 _na     344_aa Phosphatidylglycerol lysyltransferase
2395 CAMTZK010000028.1 GCA947086575_01175 gene open 19-279
2396 CAMTZK010000028.1 GCA947086575_01176 gene open 459-1250 sufC
2397 CAMTZK010000028.1 GCA947086575_01177 gene open 1240-2652 sufB
2398 CAMTZK010000028.1 GCA947086575_01178 gene open 2664-3494 sufD
2399 CAMTZK010000028.1 GCA947086575_01179 gene open 3606-4841
2400 CAMTZK010000028.1 GCA947086575_01180 gene open 4831-5277 sufU
2401 CAMTZK010000028.1 GCA947086575_01181 gene open 5477-6103
2402 CAMTZK010000028.1 GCA947086575_01182 gene open 6115-6663
2403 CAMTZK010000028.1 GCA947086575_01183 gene open 6664-7221
2404 CAMTZK010000028.1 GCA947086575_01184 gene open 7286-7843
2405 CAMTZK010000028.1 GCA947086575_01185 gene open 7854-8264
2406 CAMTZK010000028.1 GCA947086575_01186 gene open 8322-9053
2407 CAMTZK010000028.1 GCA947086575_01187 gene open 9205-10353
2408 CAMTZK010000028.1 GCA947086575_01188 gene open 10477-11133
2409 CAMTZK010000028.1 GCA947086575_01189 gene open 11386-11676
2410 CAMTZK010000028.1 GCA947086575_01190 gene open 11676-12740
2411 CAMTZK010000028.1 GCA947086575_01191 gene open 12835-13122
2412 CAMTZK010000028.1 GCA947086575_01192 gene open 13208-14134
2413 CAMTZK010000028.1 GCA947086575_01193 gene open 14157-14963 yjbM
2414 CAMTZK010000028.1 GCA947086575_01194 gene open 14965-15660
2415 CAMTZK010000028.1 GCA947086575_01195 gene open 15657-16220
2416 CAMTZK010000028.1 GCA947086575_01196 gene open 16313-17236 fba
2417 CAMTZK010000028.1 GCA947086575_01197 gene open 17452-18648
2418 CAMTZK010000028.1 GCA947086575_01198 gene open 18775-19464
2419 CAMTZK010000028.1 GCA947086575_01199 gene open 19476-20510
2420 CAMTZK010000029.1 GCA947086575_01200 CDS open 232-2877 _na     881_aa ppdK pyruvate%2C phosphate dikinase
2421 CAMTZK010000029.1 GCA947086575_01201 CDS open 2895-3734 _na     279_aa Putative pyruvate%2C phosphate dikinase regulatory protein
2422 CAMTZK010000029.1 GCA947086575_01202 CDS open 3748-4380 _na     210_aa Control catabolite protein of gluconeogenesis
2423 CAMTZK010000029.1 GCA947086575_01203 CDS open 4669-6732 _na     687_aa Glycine--tRNA ligase beta subunit
2424 CAMTZK010000029.1 GCA947086575_01204 CDS open 6725-7609 _na     294_aa glyQ glycine--tRNA ligase subunit alpha
2425 CAMTZK010000029.1 GCA947086575_01205 CDS open 7713-8318 _na     201_aa DUF4342 domain-containing protein
2426 CAMTZK010000029.1 GCA947086575_01206 CDS open 8330-9076 _na     248_aa recO DNA repair protein RecO
2427 CAMTZK010000029.1 GCA947086575_01207 CDS open 9178-10557 _na     459_aa mgtE magnesium transporter
2428 CAMTZK010000029.1 GCA947086575_01208 CDS open 10586-11485 _na     299_aa era GTPase Era
2429 CAMTZK010000029.1 GCA947086575_01209 CDS open 11600-12349 _na     249_aa PAP2 family protein
2430 CAMTZK010000029.1 GCA947086575_01210 CDS open 12339-12815 _na     158_aa ybeY rRNA maturation RNase YbeY
2431 CAMTZK010000029.1 GCA947086575_01211 CDS open 12822-13832 _na     336_aa PhoH-like protein
2432 CAMTZK010000029.1 GCA947086575_01212 CDS open 13982-14533 _na     183_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
2433 CAMTZK010000029.1 GCA947086575_01213 CDS open 14657-15802 _na     381_aa C4-dicarboxylate transporter/malic acid transport protein
2434 CAMTZK010000029.1 GCA947086575_01214 CDS open 15956-17320 _na     454_aa Arylsulfotransferase N-terminal domain-containing protein
2435 CAMTZK010000029.1 GCA947086575_01215 CDS open 17313-18200 _na     295_aa ABC-2 family transporter protein
2436 CAMTZK010000029.1 GCA947086575_01216 CDS open 18213-19016 _na     267_aa ABC transporter permease
2437 CAMTZK010000029.1 GCA947086575_01217 CDS open 19009-19728 _na     239_aa lptB Lipopolysaccharide export system ATP-binding protein LptB
2438 CAMTZK010000029.1 GCA947086575_01218 CDS open 19766-20194 _na     142_aa gntR Transcriptional regulator%2C GntR family
2439 CAMTZK010000029.1 GCA947086575_01200 gene open 232-2877 ppdK
2440 CAMTZK010000029.1 GCA947086575_01201 gene open 2895-3734
2441 CAMTZK010000029.1 GCA947086575_01202 gene open 3748-4380
2442 CAMTZK010000029.1 GCA947086575_01203 gene open 4669-6732
2443 CAMTZK010000029.1 GCA947086575_01204 gene open 6725-7609 glyQ
2444 CAMTZK010000029.1 GCA947086575_01205 gene open 7713-8318
2445 CAMTZK010000029.1 GCA947086575_01206 gene open 8330-9076 recO
2446 CAMTZK010000029.1 GCA947086575_01207 gene open 9178-10557 mgtE
2447 CAMTZK010000029.1 GCA947086575_01208 gene open 10586-11485 era
2448 CAMTZK010000029.1 GCA947086575_01209 gene open 11600-12349
2449 CAMTZK010000029.1 GCA947086575_01210 gene open 12339-12815 ybeY
2450 CAMTZK010000029.1 GCA947086575_01211 gene open 12822-13832
2451 CAMTZK010000029.1 GCA947086575_01212 gene open 13982-14533 hpf
2452 CAMTZK010000029.1 GCA947086575_01213 gene open 14657-15802
2453 CAMTZK010000029.1 GCA947086575_01214 gene open 15956-17320
2454 CAMTZK010000029.1 GCA947086575_01215 gene open 17313-18200
2455 CAMTZK010000029.1 GCA947086575_01216 gene open 18213-19016
2456 CAMTZK010000029.1 GCA947086575_01217 gene open 19009-19728 lptB
2457 CAMTZK010000029.1 GCA947086575_01218 gene open 19766-20194 gntR
2458 CAMTZK010000030.1 GCA947086575_01219 CDS open 286-5880 _na     1864_aa cell wall-binding repeat-containing protein
2459 CAMTZK010000030.1 GCA947086575_01220 CDS open 6169-8244 _na     691_aa Iron transport-associated domain protein
2460 CAMTZK010000030.1 GCA947086575_01221 CDS open 8231-9325 _na     364_aa Cell surface protein Shp haem-binding domain-containing protein
2461 CAMTZK010000030.1 GCA947086575_01222 CDS open 9318-10238 _na     306_aa isdE heme ABC transporter substrate-binding protein IsdE
2462 CAMTZK010000030.1 GCA947086575_01223 CDS open 10238-11302 _na     354_aa isdF putative heme-iron transport system permease protein IsdF
2463 CAMTZK010000030.1 GCA947086575_01224 CDS open 11292-12056 _na     254_aa ABC transporter%2C ATP-binding protein
2464 CAMTZK010000030.1 GCA947086575_01225 CDS open 12184-13659 _na     491_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
2465 CAMTZK010000030.1 GCA947086575_01226 CDS open 13980-19967 _na     1995_aa Leucine Rich Repeat protein
2466 CAMTZK010000030.1 GCA947086575_01227 CDS open 20093-20254 _na     53_aa Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein
2467 CAMTZK010000030.1 GCA947086575_01219 gene open 286-5880
2468 CAMTZK010000030.1 GCA947086575_01220 gene open 6169-8244
2469 CAMTZK010000030.1 GCA947086575_01221 gene open 8231-9325
2470 CAMTZK010000030.1 GCA947086575_01222 gene open 9318-10238 isdE
2471 CAMTZK010000030.1 GCA947086575_01223 gene open 10238-11302 isdF
2472 CAMTZK010000030.1 GCA947086575_01224 gene open 11292-12056
2473 CAMTZK010000030.1 GCA947086575_01225 gene open 12184-13659 lytC
2474 CAMTZK010000030.1 GCA947086575_01226 gene open 13980-19967
2475 CAMTZK010000030.1 GCA947086575_01227 gene open 20093-20254
2476 CAMTZK010000031.1 regulatory_region open 5930-6053 Ribosomal protein L10 leader
2477 CAMTZK010000031.1 GCA947086575_01228 CDS open 114-1787 _na     557_aa AlgX/AlgJ SGNH hydrolase-like domain-containing protein
2478 CAMTZK010000031.1 GCA947086575_01229 CDS open 1805-3163 _na     452_aa dltB D-alanyl-lipoteichoic acid biosynthesis protein DltB
2479 CAMTZK010000031.1 GCA947086575_01230 CDS open 3225-3860 _na     211_aa DUF4358 domain-containing protein
2480 CAMTZK010000031.1 GCA947086575_01231 CDS open 3872-4606 _na     244_aa SGNH hydrolase-type esterase domain-containing protein
2481 CAMTZK010000031.1 GCA947086575_01232 CDS open 4896-5261 _na     121_aa rplL 50S ribosomal protein L7/L12
2482 CAMTZK010000031.1 GCA947086575_01233 CDS open 5370-5888 _na     172_aa rplJ 50S ribosomal protein L10
2483 CAMTZK010000031.1 GCA947086575_01234 CDS open 6103-6801 _na     232_aa rplA 50S ribosomal protein L1
2484 CAMTZK010000031.1 GCA947086575_01235 CDS open 6930-7355 _na     141_aa rplK 50S ribosomal protein L11
2485 CAMTZK010000031.1 GCA947086575_01236 CDS open 7370-7921 _na     183_aa nusG transcription termination/antitermination protein NusG
2486 CAMTZK010000031.1 GCA947086575_01237 CDS open 7940-8146 _na     68_aa secE preprotein translocase subunit SecE
2487 CAMTZK010000031.1 GCA947086575_01238 CDS open 8167-8316 _na     49_aa rpmG 50S ribosomal protein L33
2488 CAMTZK010000031.1 GCA947086575_01239 CDS open 8489-10279 _na     596_aa Creatinase
2489 CAMTZK010000031.1 GCA947086575_01240 CDS open 10293-11255 _na     320_aa pip prolyl aminopeptidase
2490 CAMTZK010000031.1 GCA947086575_01241 CDS open 11597-12676 _na     359_aa Creatinase
2491 CAMTZK010000031.1 GCA947086575_01242 CDS open 12822-14222 _na     466_aa Di-/tripeptide transporter
2492 CAMTZK010000031.1 GCA947086575_01243 CDS open 14367-14681 _na     104_aa hypothetical protein
2493 CAMTZK010000031.1 GCA947086575_01244 CDS open 14920-15909 _na     329_aa Oxidoreductase%2C FAD/FMN-binding protein
2494 CAMTZK010000031.1 GCA947086575_01245 CDS open 15958-16608 _na     216_aa Hemolysin
2495 CAMTZK010000031.1 GCA947086575_01246 CDS open 17031-17879 _na     282_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
2496 CAMTZK010000031.1 GCA947086575_01247 CDS open 17848-19158 _na     436_aa L-aspartate oxidase
2497 CAMTZK010000031.1 GCA947086575_01248 CDS open 19160-20095 _na     311_aa nadA quinolinate synthase NadA
2498 CAMTZK010000031.1 GCA947086575_01228 gene open 114-1787
2499 CAMTZK010000031.1 GCA947086575_01229 gene open 1805-3163 dltB
2500 CAMTZK010000031.1 GCA947086575_01230 gene open 3225-3860