BAKTAGenome Explorer: Megasphaera lornae (GCA_947087535.1)
Select a Genome:
|
BAKTA Annotations for GCA_947087535.1
|
Search & Sort all 3137 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1001 | CAMUDA010000003.1 | GCA947087535_00522 | CDS | open | 53615-54187 | _na 190_aa | grpE | nucleotide exchange factor GrpE |
| 1002 | CAMUDA010000003.1 | GCA947087535_00523 | CDS | open | 54202-55275 | _na 357_aa | hrcA | heat-inducible transcriptional repressor HrcA |
| 1003 | CAMUDA010000003.1 | GCA947087535_00524 | CDS | open | 55454-56737 | _na 427_aa | M18 family aminopeptidase | |
| 1004 | CAMUDA010000003.1 | GCA947087535_00525 | CDS | open | 56933-57286 | _na 117_aa | DNA-binding helix-turn-helix protein | |
| 1005 | CAMUDA010000003.1 | GCA947087535_00526 | CDS | open | 57313-57981 | _na 222_aa | yigZ | YigZ family protein |
| 1006 | CAMUDA010000003.1 | GCA947087535_00527 | CDS | open | 58023-59270 | _na 415_aa | Methionine ABC transporter ATP-binding protein | |
| 1007 | CAMUDA010000003.1 | GCA947087535_00528 | CDS | open | 59251-59904 | _na 217_aa | ABC transporter%2C permease protein | |
| 1008 | CAMUDA010000003.1 | GCA947087535_00530 | CDS | open | 60254-60877 | _na 207_aa | Thiamine transporter protein | |
| 1009 | CAMUDA010000003.1 | GCA947087535_00531 | CDS | open | 60905-61072 | _na 55_aa | hypothetical protein | |
| 1010 | CAMUDA010000003.1 | GCA947087535_00532 | CDS | open | 61169-62620 | _na 483_aa | nicotinate phosphoribosyltransferase | |
| 1011 | CAMUDA010000003.1 | GCA947087535_00533 | CDS | open | 62815-63696 | _na 293_aa | Membrane protein | |
| 1012 | CAMUDA010000003.1 | GCA947087535_00534 | CDS | open | 63829-65079 | _na 416_aa | Malic enzyme%2C NAD binding domain protein | |
| 1013 | CAMUDA010000003.1 | GCA947087535_00535 | CDS | open | 65171-66037 | _na 288_aa | hypothetical protein | |
| 1014 | CAMUDA010000003.1 | GCA947087535_00536 | CDS | open | 66194-67180 | _na 328_aa | Sulfate exporter family transporter | |
| 1015 | CAMUDA010000003.1 | GCA947087535_00537 | CDS | open | 67350-68273 | _na 307_aa | lysR | LysR substrate binding domain protein |
| 1016 | CAMUDA010000003.1 | GCA947087535_00538 | CDS | open | 68331-69320 | _na 329_aa | Site-specific recombinase%2C phage integrase family | |
| 1017 | CAMUDA010000003.1 | GCA947087535_00539 | CDS | open | 69491-70039 | _na 182_aa | DUF805 domain-containing protein | |
| 1018 | CAMUDA010000003.1 | GCA947087535_00540 | CDS | open | 70115-70255 | _na 46_aa | hypothetical protein | |
| 1019 | CAMUDA010000003.1 | GCA947087535_00541 | CDS | open | 70265-71203 | _na 312_aa | Transketolase%2C pyridine binding domain protein | |
| 1020 | CAMUDA010000003.1 | GCA947087535_00542 | CDS | open | 71203-72024 | _na 273_aa | Transketolase%2C thiamine diphosphate binding domain protein | |
| 1021 | CAMUDA010000003.1 | GCA947087535_00543 | CDS | open | 72258-73142 | _na 294_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 1022 | CAMUDA010000003.1 | GCA947087535_00544 | CDS | open | 73139-73687 | _na 182_aa | rnmV | ribonuclease M5 |
| 1023 | CAMUDA010000003.1 | GCA947087535_00545 | CDS | open | 73680-74936 | _na 418_aa | Aluminum resistance protein | |
| 1024 | CAMUDA010000003.1 | GCA947087535_00546 | CDS | open | 74941-75885 | _na 314_aa | miaA | tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA |
| 1025 | CAMUDA010000003.1 | GCA947087535_00547 | CDS | open | 75878-76663 | _na 261_aa | SAM-dependent methyltransferase | |
| 1026 | CAMUDA010000003.1 | GCA947087535_00548 | CDS | open | 76660-78558 | _na 632_aa | mutL | DNA mismatch repair endonuclease MutL |
| 1027 | CAMUDA010000003.1 | GCA947087535_00549 | CDS | open | 78555-81155 | _na 866_aa | mutS | DNA mismatch repair protein MutS |
| 1028 | CAMUDA010000003.1 | GCA947087535_00550 | CDS | open | 81166-82494 | _na 442_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 1029 | CAMUDA010000003.1 | GCA947087535_00551 | CDS | open | 82593-83144 | _na 183_aa | Phosphoribosyl transferase domain protein | |
| 1030 | CAMUDA010000003.1 | GCA947087535_00552 | CDS | open | 83197-83907 | _na 236_aa | tatC | twin-arginine translocase subunit TatC |
| 1031 | CAMUDA010000003.1 | GCA947087535_00553 | CDS | open | 83891-84118 | _na 75_aa | tatA | Sec-independent protein translocase protein TatA |
| 1032 | CAMUDA010000003.1 | GCA947087535_00555 | CDS | open | 84520-85209 | _na 229_aa | TVP38/TMEM64 family membrane protein | |
| 1033 | CAMUDA010000003.1 | GCA947087535_00556 | CDS | open | 85331-86350 | _na 339_aa | C4-dicarboxylate transporter/malic acid transport protein | |
| 1034 | CAMUDA010000003.1 | GCA947087535_00557 | CDS | open | 86405-87193 | _na 262_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 1035 | CAMUDA010000003.1 | GCA947087535_00558 | CDS | open | 87190-87990 | _na 266_aa | ecfT | Energy-coupling factor transporter transmembrane protein EcfT |
| 1036 | CAMUDA010000003.1 | GCA947087535_00559 | CDS | open | 87980-88849 | _na 289_aa | energy-coupling factor transporter ATPase | |
| 1037 | CAMUDA010000003.1 | GCA947087535_00560 | CDS | open | 88840-89673 | _na 277_aa | energy-coupling factor transporter ATPase | |
| 1038 | CAMUDA010000003.1 | GCA947087535_00561 | CDS | open | 89767-90315 | _na 182_aa | DUF805 domain-containing protein | |
| 1039 | CAMUDA010000003.1 | GCA947087535_00562 | CDS | open | 90502-91008 | _na 168_aa | nrdG | anaerobic ribonucleoside-triphosphate reductase activating protein |
| 1040 | CAMUDA010000003.1 | GCA947087535_00563 | CDS | open | 91020-93170 | _na 716_aa | nrdD | anaerobic ribonucleoside-triphosphate reductase |
| 1041 | CAMUDA010000003.1 | GCA947087535_00564 | CDS | open | 93406-94116 | _na 236_aa | thiF | ThiF family protein |
| 1042 | CAMUDA010000003.1 | GCA947087535_00565 | CDS | open | 94113-94481 | _na 122_aa | Aldoketomutase | |
| 1043 | CAMUDA010000003.1 | GCA947087535_00566 | CDS | open | 94516-97560 | _na 1014_aa | Nuclease SbcCD subunit C | |
| 1044 | CAMUDA010000003.1 | GCA947087535_00567 | CDS | open | 97557-98705 | _na 382_aa | Nuclease SbcCD subunit D | |
| 1045 | CAMUDA010000003.1 | GCA947087535_00568 | CDS | open | 98770-99180 | _na 136_aa | Transcriptional regulator%2C Fur family | |
| 1046 | CAMUDA010000003.1 | GCA947087535_00571 | CDS | open | 99698-100411 | _na 237_aa | yjbE | Integral membrane protein%2C YjbE family |
| 1047 | CAMUDA010000003.1 | GCA947087535_00572 | CDS | open | 100579-101997 | _na 472_aa | glcD | Glycolate oxidase%2C subunit GlcD |
| 1048 | CAMUDA010000003.1 | GCA947087535_00573 | CDS | open | 102425-103225 | _na 266_aa | proC | pyrroline-5-carboxylate reductase |
| 1049 | CAMUDA010000003.1 | GCA947087535_00574 | CDS | open | 103296-104552 | _na 418_aa | Aminotransferase%2C class I/II | |
| 1050 | CAMUDA010000003.1 | GCA947087535_00575 | CDS | open | 104650-104751 | _na 33_aa | hypothetical protein | |
| 1051 | CAMUDA010000003.1 | GCA947087535_00576 | CDS | open | 104920-105879 | _na 319_aa | NLPA lipoprotein | |
| 1052 | CAMUDA010000003.1 | GCA947087535_00577 | CDS | open | 105854-106570 | _na 238_aa | ABC transporter%2C ATP-binding protein | |
| 1053 | CAMUDA010000003.1 | GCA947087535_00578 | CDS | open | 106515-107312 | _na 265_aa | ABC transporter%2C permease protein | |
| 1054 | CAMUDA010000003.1 | GCA947087535_00579 | CDS | open | 107469-107654 | _na 61_aa | abrB | Toxin-antitoxin system%2C antitoxin component%2C AbrB domain protein |
| 1055 | CAMUDA010000003.1 | GCA947087535_00580 | CDS | open | 107778-108941 | _na 387_aa | Transporter%2C major facilitator family protein | |
| 1056 | CAMUDA010000003.1 | GCA947087535_00581 | CDS | open | 109127-110317 | _na 396_aa | pyridoxal phosphate-dependent aminotransferase | |
| 1057 | CAMUDA010000003.1 | GCA947087535_00582 | CDS | open | 110373-110789 | _na 138_aa | Positive regulator of sigma(E)%2C RseC/MucC | |
| 1058 | CAMUDA010000003.1 | GCA947087535_00583 | CDS | open | 111005-113092 | _na 695_aa | Cd(2+)-exporting ATPase | |
| 1059 | CAMUDA010000003.1 | GCA947087535_00584 | CDS | open | 113095-113748 | _na 217_aa | HMA2 domain-containing protein | |
| 1060 | CAMUDA010000003.1 | GCA947087535_00585 | CDS | open | 113751-114053 | _na 100_aa | HMA domain-containing protein | |
| 1061 | CAMUDA010000003.1 | GCA947087535_00586 | CDS | open | 114135-114353 | _na 72_aa | 50S ribosomal protein L9 domain protein | |
| 1062 | CAMUDA010000003.1 | GCA947087535_00587 | CDS | open | 114775-116466 | _na 563_aa | LPO_1073/Vpar_1526 family protein | |
| 1063 | CAMUDA010000003.1 | GCA947087535_00588 | CDS | open | 116688-117713 | _na 341_aa | SLH domain-containing protein | |
| 1064 | CAMUDA010000003.1 | GCA947087535_00589 | CDS | open | 117710-118861 | _na 383_aa | SLH domain-containing protein | |
| 1065 | CAMUDA010000003.1 | GCA947087535_00590 | CDS | open | 118957-119940 | _na 327_aa | L-asparaginase%2C type II | |
| 1066 | CAMUDA010000003.1 | GCA947087535_00591 | CDS | open | 120124-120861 | _na 245_aa | Serine aminopeptidase S33 domain-containing protein | |
| 1067 | CAMUDA010000003.1 | GCA947087535_00592 | CDS | open | 120888-121319 | _na 143_aa | hypothetical protein | |
| 1068 | CAMUDA010000003.1 | GCA947087535_00593 | CDS | open | 121328-122362 | _na 344_aa | floA | flotillin-like protein FloA |
| 1069 | CAMUDA010000003.1 | GCA947087535_00594 | CDS | open | 122382-123680 | _na 432_aa | Nodulation efficiency protein D | |
| 1070 | CAMUDA010000003.1 | GCA947087535_00595 | CDS | open | 123696-124109 | _na 137_aa | hypothetical protein | |
| 1071 | CAMUDA010000003.1 | GCA947087535_00596 | CDS | open | 124193-124783 | _na 196_aa | yfbR | 5'-deoxynucleotidase |
| 1072 | CAMUDA010000003.1 | GCA947087535_00597 | CDS | open | 124793-125782 | _na 329_aa | trpS | tryptophan--tRNA ligase |
| 1073 | CAMUDA010000003.1 | GCA947087535_00598 | CDS | open | 126242-127504 | _na 420_aa | RNA helicase | |
| 1074 | CAMUDA010000003.1 | GCA947087535_00599 | CDS | open | 127515-128201 | _na 228_aa | Lipoprotein | |
| 1075 | CAMUDA010000003.1 | GCA947087535_00600 | CDS | open | 128313-128900 | _na 195_aa | rpsD | 30S ribosomal protein S4 |
| 1076 | CAMUDA010000003.1 | GCA947087535_00601 | CDS | open | 129402-131006 | _na 534_aa | L-lactate permease | |
| 1077 | CAMUDA010000003.1 | GCA947087535_00602 | CDS | open | 131728-132378 | _na 216_aa | Riboflavin transporter | |
| 1078 | CAMUDA010000003.1 | GCA947087535_00603 | CDS | open | 132577-135375 | _na 932_aa | ileS | isoleucine--tRNA ligase |
| 1079 | CAMUDA010000003.1 | GCA947087535_00604 | CDS | open | 135684-137087 | _na 467_aa | Amino acid carrier protein | |
| 1080 | CAMUDA010000003.1 | GCA947087535_00605 | CDS | open | 137522-138250 | _na 242_aa | NAD-dependent protein deacylase | |
| 1081 | CAMUDA010000003.1 | GCA947087535_00606 | CDS | open | 138387-140759 | _na 790_aa | mutS2 | endonuclease MutS2 |
| 1082 | CAMUDA010000003.1 | GCA947087535_00607 | CDS | open | 140772-143177 | _na 801_aa | Peptidase%2C U32 family | |
| 1083 | CAMUDA010000003.1 | GCA947087535_00608 | CDS | open | 143336-143803 | _na 155_aa | ATPase | |
| 1084 | CAMUDA010000003.1 | GCA947087535_00609 | CDS | open | 143815-144360 | _na 181_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 1085 | CAMUDA010000003.1 | GCA947087535_00610 | CDS | open | 144308-144880 | _na 190_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 1086 | CAMUDA010000003.1 | GCA947087535_00611 | CDS | open | 144945-145562 | _na 205_aa | plsY | glycerol-3-phosphate 1-O-acyltransferase PlsY |
| 1087 | CAMUDA010000003.1 | GCA947087535_00612 | CDS | open | 145559-146890 | _na 443_aa | der | ribosome biogenesis GTPase Der |
| 1088 | CAMUDA010000003.1 | GCA947087535_00613 | CDS | open | 147011-148918 | _na 635_aa | bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1 | |
| 1089 | CAMUDA010000003.1 | GCA947087535_00614 | CDS | open | 148915-149529 | _na 204_aa | Acyltransferase | |
| 1090 | CAMUDA010000003.1 | GCA947087535_00615 | CDS | open | 149526-150197 | _na 223_aa | cmk | (d)CMP kinase |
| 1091 | CAMUDA010000003.1 | GCA947087535_00616 | CDS | open | 150194-151435 | _na 413_aa | Flavoprotein family protein | |
| 1092 | CAMUDA010000003.1 | GCA947087535_00617 | CDS | open | 151451-152167 | _na 238_aa | Pseudouridine synthase | |
| 1093 | CAMUDA010000003.1 | GCA947087535_00618 | CDS | open | 152139-152777 | _na 212_aa | scpB | SMC-Scp complex subunit ScpB |
| 1094 | CAMUDA010000003.1 | GCA947087535_00619 | CDS | open | 152728-153522 | _na 264_aa | Segregation and condensation protein A | |
| 1095 | CAMUDA010000003.1 | GCA947087535_00625 | CDS | open | 154206-155741 | _na 511_aa | rny | ribonuclease Y |
| 1096 | CAMUDA010000003.1 | GCA947087535_00626 | CDS | open | 155964-156383 | _na 139_aa | recX | Regulatory protein RecX |
| 1097 | CAMUDA010000003.1 | GCA947087535_00627 | CDS | open | 156380-157426 | _na 348_aa | recA | recombinase RecA |
| 1098 | CAMUDA010000003.1 | GCA947087535_00628 | CDS | open | 157439-158692 | _na 417_aa | competence/damage-inducible protein A | |
| 1099 | CAMUDA010000003.1 | GCA947087535_00629 | CDS | open | 158709-160040 | _na 443_aa | rimO | 30S ribosomal protein S12 methylthiotransferase RimO |
| 1100 | CAMUDA010000003.1 | GCA947087535_00630 | CDS | open | 160041-161087 | _na 348_aa | ABC transporter%2C solute-binding protein | |
| 1101 | CAMUDA010000003.1 | GCA947087535_00631 | CDS | open | 161144-161521 | _na 125_aa | HTH cro/C1-type domain-containing protein | |
| 1102 | CAMUDA010000003.1 | GCA947087535_00632 | CDS | open | 161600-164062 | _na 820_aa | FtsK/SpoIIIE family protein | |
| 1103 | CAMUDA010000003.1 | GCA947087535_00633 | CDS | open | 164080-165399 | _na 439_aa | rarA | Recombination factor protein RarA |
| 1104 | CAMUDA010000003.1 | GCA947087535_00635 | CDS | open | 165804-167804 | _na 666_aa | tkt | transketolase |
| 1105 | CAMUDA010000003.1 | GCA947087535_00636 | CDS | open | 167923-168825 | _na 300_aa | Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase | |
| 1106 | CAMUDA010000003.1 | GCA947087535_00637 | CDS | open | 168837-169856 | _na 339_aa | lpxD | UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase |
| 1107 | CAMUDA010000003.1 | GCA947087535_00638 | CDS | open | 169869-170288 | _na 139_aa | Outer membrane protein | |
| 1108 | CAMUDA010000003.1 | GCA947087535_00639 | CDS | open | 170304-171188 | _na 294_aa | Outer membrane protein | |
| 1109 | CAMUDA010000003.1 | GCA947087535_00640 | CDS | open | 171234-171719 | _na 161_aa | Outer membrane protein | |
| 1110 | CAMUDA010000003.1 | GCA947087535_00641 | CDS | open | 171735-173009 | _na 424_aa | POTRA domain-containing protein | |
| 1111 | CAMUDA010000003.1 | GCA947087535_00642 | CDS | open | 173016-175073 | _na 685_aa | bamA | outer membrane protein assembly factor BamA |
| 1112 | CAMUDA010000003.1 | GCA947087535_00643 | CDS | open | 175086-175643 | _na 185_aa | hypothetical protein | |
| 1113 | CAMUDA010000003.1 | GCA947087535_00644 | CDS | open | 175775-176413 | _na 212_aa | Sigma-70 region 2 | |
| 1114 | CAMUDA010000003.1 | GCA947087535_00645 | CDS | open | 176429-180724 | _na 1431_aa | tamB | translocation/assembly module TamB domain-containing protein |
| 1115 | CAMUDA010000003.1 | GCA947087535_00646 | CDS | open | 180853-182328 | _na 491_aa | Outer membrane efflux protein | |
| 1116 | CAMUDA010000003.1 | GCA947087535_00647 | CDS | open | 182362-183597 | _na 411_aa | Virulence factor Mce family protein | |
| 1117 | CAMUDA010000003.1 | GCA947087535_00648 | CDS | open | 183581-184345 | _na 254_aa | ABC transporter%2C ATP-binding protein | |
| 1118 | CAMUDA010000003.1 | GCA947087535_00649 | CDS | open | 184354-185115 | _na 253_aa | Toluene tolerance protein Ttg2B | |
| 1119 | CAMUDA010000003.1 | GCA947087535_00650 | CDS | open | 185280-187235 | _na 651_aa | Peptidase S55 domain-containing protein | |
| 1120 | CAMUDA010000003.1 | GCA947087535_00651 | CDS | open | 187248-187541 | _na 97_aa | Lipoyl-binding domain-containing protein | |
| 1121 | CAMUDA010000003.1 | GCA947087535_00652 | CDS | open | 187553-188638 | _na 361_aa | mreB | Cell shape-determining protein MreB |
| 1122 | CAMUDA010000003.1 | GCA947087535_00653 | CDS | open | 188607-189878 | _na 423_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 1123 | CAMUDA010000003.1 | GCA947087535_00654 | CDS | open | 190124-190705 | _na 193_aa | Phosphoglycerate mutase family protein | |
| 1124 | CAMUDA010000003.1 | GCA947087535_00655 | CDS | open | 190778-194311 | _na 1177_aa | nifJ | pyruvate:ferredoxin (flavodoxin) oxidoreductase |
| 1125 | CAMUDA010000003.1 | GCA947087535_00656 | CDS | open | 194523-195689 | _na 388_aa | Cyclopropane-fatty-acyl-phospholipid synthase | |
| 1126 | CAMUDA010000003.1 | GCA947087535_00657 | CDS | open | 195716-196543 | _na 275_aa | folD | Bifunctional protein FolD |
| 1127 | CAMUDA010000003.1 | GCA947087535_00658 | CDS | open | 196556-198559 | _na 667_aa | Penicillin-binding protein%2C transpeptidase domain protein | |
| 1128 | CAMUDA010000003.1 | GCA947087535_00659 | CDS | open | 198570-199910 | _na 446_aa | tRNA nucleotidyltransferase/poly(A) polymerase family protein | |
| 1129 | CAMUDA010000003.1 | GCA947087535_00660 | CDS | open | 200104-200631 | _na 175_aa | Cob(I)yrinic acid a%2Cc-diamide adenosyltransferase | |
| 1130 | CAMUDA010000003.1 | GCA947087535_00661 | CDS | open | 200642-201853 | _na 403_aa | Cation diffusion facilitator family transporter | |
| 1131 | CAMUDA010000003.1 | GCA947087535_00663 | CDS | open | 202092-202235 | _na 47_aa | DUF971 domain-containing protein | |
| 1132 | CAMUDA010000003.1 | GCA947087535_00664 | CDS | open | 202560-202781 | _na 73_aa | hypothetical protein | |
| 1133 | CAMUDA010000003.1 | GCA947087535_00665 | CDS | open | 203016-203810 | _na 264_aa | Phage head morphogenesis domain-containing protein | |
| 1134 | CAMUDA010000003.1 | GCA947087535_00669 | CDS | open | 204848-205537 | _na 229_aa | Response regulator receiver domain protein | |
| 1135 | CAMUDA010000003.1 | GCA947087535_00470 | gene | open | 275-1591 | |||
| 1136 | CAMUDA010000003.1 | GCA947087535_00471 | gene | open | 1685-2200 | |||
| 1137 | CAMUDA010000003.1 | GCA947087535_00472 | gene | open | 2322-3575 | |||
| 1138 | CAMUDA010000003.1 | GCA947087535_00473 | gene | open | 3721-4578 | lysR | ||
| 1139 | CAMUDA010000003.1 | GCA947087535_00474 | gene | open | 4930-5187 | copZ | ||
| 1140 | CAMUDA010000003.1 | GCA947087535_00475 | gene | open | 5292-6179 | dapA | ||
| 1141 | CAMUDA010000003.1 | GCA947087535_00476 | gene | open | 6200-7234 | |||
| 1142 | CAMUDA010000003.1 | GCA947087535_00477 | gene | open | 7256-8053 | dapB | ||
| 1143 | CAMUDA010000003.1 | GCA947087535_00478 | gene | open | 8120-9826 | recN | ||
| 1144 | CAMUDA010000003.1 | GCA947087535_00479 | gene | open | 9834-10289 | argR | ||
| 1145 | CAMUDA010000003.1 | GCA947087535_00480 | gene | open | 10329-10901 | |||
| 1146 | CAMUDA010000003.1 | GCA947087535_00481 | gene | open | 10903-11775 | |||
| 1147 | CAMUDA010000003.1 | GCA947087535_00482 | gene | open | 11787-12584 | |||
| 1148 | CAMUDA010000003.1 | GCA947087535_00483 | gene | open | 12601-13488 | |||
| 1149 | CAMUDA010000003.1 | GCA947087535_00484 | gene | open | 13475-13723 | xseB | ||
| 1150 | CAMUDA010000003.1 | GCA947087535_00485 | gene | open | 13710-14915 | xseA | ||
| 1151 | CAMUDA010000003.1 | GCA947087535_00486 | gene | open | 14917-15864 | |||
| 1152 | CAMUDA010000003.1 | GCA947087535_00487 | gene | open | 15861-16286 | nusB | ||
| 1153 | CAMUDA010000003.1 | GCA947087535_00488 | gene | open | 16296-16601 | |||
| 1154 | CAMUDA010000003.1 | GCA947087535_00489 | gene | open | 16585-16974 | |||
| 1155 | CAMUDA010000003.1 | GCA947087535_00490 | gene | open | 17050-17607 | efp | ||
| 1156 | CAMUDA010000003.1 | GCA947087535_00491 | gene | open | 17622-18683 | |||
| 1157 | CAMUDA010000003.1 | GCA947087535_00492 | gene | open | 18745-19461 | |||
| 1158 | CAMUDA010000003.1 | GCA947087535_00493 | gene | open | 19471-20124 | cobC | ||
| 1159 | CAMUDA010000003.1 | GCA947087535_00494 | gene | open | 20273-20761 | |||
| 1160 | CAMUDA010000003.1 | GCA947087535_00495 | gene | open | 20996-21961 | |||
| 1161 | CAMUDA010000003.1 | GCA947087535_00496 | gene | open | 21869-22114 | |||
| 1162 | CAMUDA010000003.1 | GCA947087535_00497 | gene | open | 22053-27014 | |||
| 1163 | CAMUDA010000003.1 | GCA947087535_00498 | gene | open | 27229-27927 | |||
| 1164 | CAMUDA010000003.1 | GCA947087535_00499 | gene | open | 28158-31376 | |||
| 1165 | CAMUDA010000003.1 | GCA947087535_00500 | gene | open | 31806-32420 | |||
| 1166 | CAMUDA010000003.1 | GCA947087535_00501 | gene | open | 32496-32846 | rplT | ||
| 1167 | CAMUDA010000003.1 | GCA947087535_00502 | gene | open | 32887-33084 | rpmI | ||
| 1168 | CAMUDA010000003.1 | GCA947087535_00503 | gene | open | 33103-33567 | infC | ||
| 1169 | CAMUDA010000003.1 | GCA947087535_00504 | gene | open | 33833-33988 | |||
| 1170 | CAMUDA010000003.1 | GCA947087535_00505 | gene | open | 34257-35438 | |||
| 1171 | CAMUDA010000003.1 | GCA947087535_00506 | gene | open | 35628-36953 | potE | ||
| 1172 | CAMUDA010000003.1 | GCA947087535_00507 | gene | open | 37281-39218 | |||
| 1173 | CAMUDA010000003.1 | GCA947087535_00508 | gene | open | 39302-39733 | |||
| 1174 | CAMUDA010000003.1 | GCA947087535_00509 | gene | open | 40219-41505 | |||
| 1175 | CAMUDA010000003.1 | GCA947087535_00510 | gene | open | 41525-42451 | metA | ||
| 1176 | CAMUDA010000003.1 | GCA947087535_00511 | gene | open | 42501-43898 | glcD | ||
| 1177 | CAMUDA010000003.1 | GCA947087535_00512 | gene | open | 43950-44117 | |||
| 1178 | CAMUDA010000003.1 | GCA947087535_00513 | gene | open | 44129-44857 | |||
| 1179 | CAMUDA010000003.1 | GCA947087535_00514 | gene | open | 44850-45725 | ispE | ||
| 1180 | CAMUDA010000003.1 | GCA947087535_00515 | gene | open | 45903-46838 | |||
| 1181 | CAMUDA010000003.1 | GCA947087535_00516 | gene | open | 47180-47524 | |||
| 1182 | CAMUDA010000003.1 | GCA947087535_00517 | gene | open | 47521-48843 | mtaB | ||
| 1183 | CAMUDA010000003.1 | GCA947087535_00518 | gene | open | 48847-49572 | |||
| 1184 | CAMUDA010000003.1 | GCA947087535_00519 | gene | open | 49573-50454 | prmA | ||
| 1185 | CAMUDA010000003.1 | GCA947087535_00520 | gene | open | 50472-51704 | dnaJ | ||
| 1186 | CAMUDA010000003.1 | GCA947087535_00521 | gene | open | 51731-53584 | dnaK | ||
| 1187 | CAMUDA010000003.1 | GCA947087535_00522 | gene | open | 53615-54187 | grpE | ||
| 1188 | CAMUDA010000003.1 | GCA947087535_00523 | gene | open | 54202-55275 | hrcA | ||
| 1189 | CAMUDA010000003.1 | GCA947087535_00524 | gene | open | 55454-56737 | |||
| 1190 | CAMUDA010000003.1 | GCA947087535_00525 | gene | open | 56933-57286 | |||
| 1191 | CAMUDA010000003.1 | GCA947087535_00526 | gene | open | 57313-57981 | yigZ | ||
| 1192 | CAMUDA010000003.1 | GCA947087535_00527 | gene | open | 58023-59270 | |||
| 1193 | CAMUDA010000003.1 | GCA947087535_00528 | gene | open | 59251-59904 | |||
| 1194 | CAMUDA010000003.1 | GCA947087535_00530 | gene | open | 60254-60877 | |||
| 1195 | CAMUDA010000003.1 | GCA947087535_00531 | gene | open | 60905-61072 | |||
| 1196 | CAMUDA010000003.1 | GCA947087535_00532 | gene | open | 61169-62620 | |||
| 1197 | CAMUDA010000003.1 | GCA947087535_00533 | gene | open | 62815-63696 | |||
| 1198 | CAMUDA010000003.1 | GCA947087535_00534 | gene | open | 63829-65079 | |||
| 1199 | CAMUDA010000003.1 | GCA947087535_00535 | gene | open | 65171-66037 | |||
| 1200 | CAMUDA010000003.1 | GCA947087535_00536 | gene | open | 66194-67180 | |||
| 1201 | CAMUDA010000003.1 | GCA947087535_00537 | gene | open | 67350-68273 | lysR | ||
| 1202 | CAMUDA010000003.1 | GCA947087535_00538 | gene | open | 68331-69320 | |||
| 1203 | CAMUDA010000003.1 | GCA947087535_00539 | gene | open | 69491-70039 | |||
| 1204 | CAMUDA010000003.1 | GCA947087535_00540 | gene | open | 70115-70255 | |||
| 1205 | CAMUDA010000003.1 | GCA947087535_00541 | gene | open | 70265-71203 | |||
| 1206 | CAMUDA010000003.1 | GCA947087535_00542 | gene | open | 71203-72024 | |||
| 1207 | CAMUDA010000003.1 | GCA947087535_00543 | gene | open | 72258-73142 | rsmA | ||
| 1208 | CAMUDA010000003.1 | GCA947087535_00544 | gene | open | 73139-73687 | rnmV | ||
| 1209 | CAMUDA010000003.1 | GCA947087535_00545 | gene | open | 73680-74936 | |||
| 1210 | CAMUDA010000003.1 | GCA947087535_00546 | gene | open | 74941-75885 | miaA | ||
| 1211 | CAMUDA010000003.1 | GCA947087535_00547 | gene | open | 75878-76663 | |||
| 1212 | CAMUDA010000003.1 | GCA947087535_00548 | gene | open | 76660-78558 | mutL | ||
| 1213 | CAMUDA010000003.1 | GCA947087535_00549 | gene | open | 78555-81155 | mutS | ||
| 1214 | CAMUDA010000003.1 | GCA947087535_00550 | gene | open | 81166-82494 | miaB | ||
| 1215 | CAMUDA010000003.1 | GCA947087535_00551 | gene | open | 82593-83144 | |||
| 1216 | CAMUDA010000003.1 | GCA947087535_00552 | gene | open | 83197-83907 | tatC | ||
| 1217 | CAMUDA010000003.1 | GCA947087535_00553 | gene | open | 83891-84118 | tatA | ||
| 1218 | CAMUDA010000003.1 | GCA947087535_00555 | gene | open | 84520-85209 | |||
| 1219 | CAMUDA010000003.1 | GCA947087535_00556 | gene | open | 85331-86350 | |||
| 1220 | CAMUDA010000003.1 | GCA947087535_00557 | gene | open | 86405-87193 | truA | ||
| 1221 | CAMUDA010000003.1 | GCA947087535_00558 | gene | open | 87190-87990 | ecfT | ||
| 1222 | CAMUDA010000003.1 | GCA947087535_00559 | gene | open | 87980-88849 | |||
| 1223 | CAMUDA010000003.1 | GCA947087535_00560 | gene | open | 88840-89673 | |||
| 1224 | CAMUDA010000003.1 | GCA947087535_00561 | gene | open | 89767-90315 | |||
| 1225 | CAMUDA010000003.1 | GCA947087535_00562 | gene | open | 90502-91008 | nrdG | ||
| 1226 | CAMUDA010000003.1 | GCA947087535_00563 | gene | open | 91020-93170 | nrdD | ||
| 1227 | CAMUDA010000003.1 | GCA947087535_00564 | gene | open | 93406-94116 | thiF | ||
| 1228 | CAMUDA010000003.1 | GCA947087535_00565 | gene | open | 94113-94481 | |||
| 1229 | CAMUDA010000003.1 | GCA947087535_00566 | gene | open | 94516-97560 | |||
| 1230 | CAMUDA010000003.1 | GCA947087535_00567 | gene | open | 97557-98705 | |||
| 1231 | CAMUDA010000003.1 | GCA947087535_00568 | gene | open | 98770-99180 | |||
| 1232 | CAMUDA010000003.1 | GCA947087535_00571 | gene | open | 99698-100411 | yjbE | ||
| 1233 | CAMUDA010000003.1 | GCA947087535_00572 | gene | open | 100579-101997 | glcD | ||
| 1234 | CAMUDA010000003.1 | GCA947087535_00573 | gene | open | 102425-103225 | proC | ||
| 1235 | CAMUDA010000003.1 | GCA947087535_00574 | gene | open | 103296-104552 | |||
| 1236 | CAMUDA010000003.1 | GCA947087535_00575 | gene | open | 104650-104751 | |||
| 1237 | CAMUDA010000003.1 | GCA947087535_00576 | gene | open | 104920-105879 | |||
| 1238 | CAMUDA010000003.1 | GCA947087535_00577 | gene | open | 105854-106570 | |||
| 1239 | CAMUDA010000003.1 | GCA947087535_00578 | gene | open | 106515-107312 | |||
| 1240 | CAMUDA010000003.1 | GCA947087535_00579 | gene | open | 107469-107654 | abrB | ||
| 1241 | CAMUDA010000003.1 | GCA947087535_00580 | gene | open | 107778-108941 | |||
| 1242 | CAMUDA010000003.1 | GCA947087535_00581 | gene | open | 109127-110317 | |||
| 1243 | CAMUDA010000003.1 | GCA947087535_00582 | gene | open | 110373-110789 | |||
| 1244 | CAMUDA010000003.1 | GCA947087535_00583 | gene | open | 111005-113092 | |||
| 1245 | CAMUDA010000003.1 | GCA947087535_00584 | gene | open | 113095-113748 | |||
| 1246 | CAMUDA010000003.1 | GCA947087535_00585 | gene | open | 113751-114053 | |||
| 1247 | CAMUDA010000003.1 | GCA947087535_00586 | gene | open | 114135-114353 | |||
| 1248 | CAMUDA010000003.1 | GCA947087535_00587 | gene | open | 114775-116466 | |||
| 1249 | CAMUDA010000003.1 | GCA947087535_00588 | gene | open | 116688-117713 | |||
| 1250 | CAMUDA010000003.1 | GCA947087535_00589 | gene | open | 117710-118861 | |||
| 1251 | CAMUDA010000003.1 | GCA947087535_00590 | gene | open | 118957-119940 | |||
| 1252 | CAMUDA010000003.1 | GCA947087535_00591 | gene | open | 120124-120861 | |||
| 1253 | CAMUDA010000003.1 | GCA947087535_00592 | gene | open | 120888-121319 | |||
| 1254 | CAMUDA010000003.1 | GCA947087535_00593 | gene | open | 121328-122362 | floA | ||
| 1255 | CAMUDA010000003.1 | GCA947087535_00594 | gene | open | 122382-123680 | |||
| 1256 | CAMUDA010000003.1 | GCA947087535_00595 | gene | open | 123696-124109 | |||
| 1257 | CAMUDA010000003.1 | GCA947087535_00596 | gene | open | 124193-124783 | yfbR | ||
| 1258 | CAMUDA010000003.1 | GCA947087535_00597 | gene | open | 124793-125782 | trpS | ||
| 1259 | CAMUDA010000003.1 | GCA947087535_00598 | gene | open | 126242-127504 | |||
| 1260 | CAMUDA010000003.1 | GCA947087535_00599 | gene | open | 127515-128201 | |||
| 1261 | CAMUDA010000003.1 | GCA947087535_00600 | gene | open | 128313-128900 | rpsD | ||
| 1262 | CAMUDA010000003.1 | GCA947087535_00601 | gene | open | 129402-131006 | |||
| 1263 | CAMUDA010000003.1 | GCA947087535_00602 | gene | open | 131728-132378 | |||
| 1264 | CAMUDA010000003.1 | GCA947087535_00603 | gene | open | 132577-135375 | ileS | ||
| 1265 | CAMUDA010000003.1 | GCA947087535_00604 | gene | open | 135684-137087 | |||
| 1266 | CAMUDA010000003.1 | GCA947087535_00605 | gene | open | 137522-138250 | |||
| 1267 | CAMUDA010000003.1 | GCA947087535_00606 | gene | open | 138387-140759 | mutS2 | ||
| 1268 | CAMUDA010000003.1 | GCA947087535_00607 | gene | open | 140772-143177 | |||
| 1269 | CAMUDA010000003.1 | GCA947087535_00608 | gene | open | 143336-143803 | |||
| 1270 | CAMUDA010000003.1 | GCA947087535_00609 | gene | open | 143815-144360 | coaD | ||
| 1271 | CAMUDA010000003.1 | GCA947087535_00610 | gene | open | 144308-144880 | rsmD | ||
| 1272 | CAMUDA010000003.1 | GCA947087535_00611 | gene | open | 144945-145562 | plsY | ||
| 1273 | CAMUDA010000003.1 | GCA947087535_00612 | gene | open | 145559-146890 | der | ||
| 1274 | CAMUDA010000003.1 | GCA947087535_00613 | gene | open | 147011-148918 | |||
| 1275 | CAMUDA010000003.1 | GCA947087535_00614 | gene | open | 148915-149529 | |||
| 1276 | CAMUDA010000003.1 | GCA947087535_00615 | gene | open | 149526-150197 | cmk | ||
| 1277 | CAMUDA010000003.1 | GCA947087535_00616 | gene | open | 150194-151435 | |||
| 1278 | CAMUDA010000003.1 | GCA947087535_00617 | gene | open | 151451-152167 | |||
| 1279 | CAMUDA010000003.1 | GCA947087535_00618 | gene | open | 152139-152777 | scpB | ||
| 1280 | CAMUDA010000003.1 | GCA947087535_00619 | gene | open | 152728-153522 | |||
| 1281 | CAMUDA010000003.1 | GCA947087535_00625 | gene | open | 154206-155741 | rny | ||
| 1282 | CAMUDA010000003.1 | GCA947087535_00626 | gene | open | 155964-156383 | recX | ||
| 1283 | CAMUDA010000003.1 | GCA947087535_00627 | gene | open | 156380-157426 | recA | ||
| 1284 | CAMUDA010000003.1 | GCA947087535_00628 | gene | open | 157439-158692 | |||
| 1285 | CAMUDA010000003.1 | GCA947087535_00629 | gene | open | 158709-160040 | rimO | ||
| 1286 | CAMUDA010000003.1 | GCA947087535_00630 | gene | open | 160041-161087 | |||
| 1287 | CAMUDA010000003.1 | GCA947087535_00631 | gene | open | 161144-161521 | |||
| 1288 | CAMUDA010000003.1 | GCA947087535_00632 | gene | open | 161600-164062 | |||
| 1289 | CAMUDA010000003.1 | GCA947087535_00633 | gene | open | 164080-165399 | rarA | ||
| 1290 | CAMUDA010000003.1 | GCA947087535_00635 | gene | open | 165804-167804 | tkt | ||
| 1291 | CAMUDA010000003.1 | GCA947087535_00636 | gene | open | 167923-168825 | |||
| 1292 | CAMUDA010000003.1 | GCA947087535_00637 | gene | open | 168837-169856 | lpxD | ||
| 1293 | CAMUDA010000003.1 | GCA947087535_00638 | gene | open | 169869-170288 | |||
| 1294 | CAMUDA010000003.1 | GCA947087535_00639 | gene | open | 170304-171188 | |||
| 1295 | CAMUDA010000003.1 | GCA947087535_00640 | gene | open | 171234-171719 | |||
| 1296 | CAMUDA010000003.1 | GCA947087535_00641 | gene | open | 171735-173009 | |||
| 1297 | CAMUDA010000003.1 | GCA947087535_00642 | gene | open | 173016-175073 | bamA | ||
| 1298 | CAMUDA010000003.1 | GCA947087535_00643 | gene | open | 175086-175643 | |||
| 1299 | CAMUDA010000003.1 | GCA947087535_00644 | gene | open | 175775-176413 | |||
| 1300 | CAMUDA010000003.1 | GCA947087535_00645 | gene | open | 176429-180724 | tamB | ||
| 1301 | CAMUDA010000003.1 | GCA947087535_00646 | gene | open | 180853-182328 | |||
| 1302 | CAMUDA010000003.1 | GCA947087535_00647 | gene | open | 182362-183597 | |||
| 1303 | CAMUDA010000003.1 | GCA947087535_00648 | gene | open | 183581-184345 | |||
| 1304 | CAMUDA010000003.1 | GCA947087535_00649 | gene | open | 184354-185115 | |||
| 1305 | CAMUDA010000003.1 | GCA947087535_00650 | gene | open | 185280-187235 | |||
| 1306 | CAMUDA010000003.1 | GCA947087535_00651 | gene | open | 187248-187541 | |||
| 1307 | CAMUDA010000003.1 | GCA947087535_00652 | gene | open | 187553-188638 | mreB | ||
| 1308 | CAMUDA010000003.1 | GCA947087535_00653 | gene | open | 188607-189878 | murA | ||
| 1309 | CAMUDA010000003.1 | GCA947087535_00654 | gene | open | 190124-190705 | |||
| 1310 | CAMUDA010000003.1 | GCA947087535_00655 | gene | open | 190778-194311 | nifJ | ||
| 1311 | CAMUDA010000003.1 | GCA947087535_00656 | gene | open | 194523-195689 | |||
| 1312 | CAMUDA010000003.1 | GCA947087535_00657 | gene | open | 195716-196543 | folD | ||
| 1313 | CAMUDA010000003.1 | GCA947087535_00658 | gene | open | 196556-198559 | |||
| 1314 | CAMUDA010000003.1 | GCA947087535_00659 | gene | open | 198570-199910 | |||
| 1315 | CAMUDA010000003.1 | GCA947087535_00660 | gene | open | 200104-200631 | |||
| 1316 | CAMUDA010000003.1 | GCA947087535_00661 | gene | open | 200642-201853 | |||
| 1317 | CAMUDA010000003.1 | GCA947087535_00663 | gene | open | 202092-202235 | |||
| 1318 | CAMUDA010000003.1 | GCA947087535_00664 | gene | open | 202560-202781 | |||
| 1319 | CAMUDA010000003.1 | GCA947087535_00665 | gene | open | 203016-203810 | |||
| 1320 | CAMUDA010000003.1 | GCA947087535_00669 | gene | open | 204848-205537 | |||
| 1321 | CAMUDA010000003.1 | GCA947087535_00529 | gene | open | 60019-60107 | trnS | ||
| 1322 | CAMUDA010000003.1 | GCA947087535_00554 | gene | open | 84183-84267 | trnL | ||
| 1323 | CAMUDA010000003.1 | GCA947087535_00569 | gene | open | 99445-99536 | trnS | ||
| 1324 | CAMUDA010000003.1 | GCA947087535_00570 | gene | open | 99577-99653 | trnP | ||
| 1325 | CAMUDA010000003.1 | GCA947087535_00620 | gene | open | 153586-153674 | trnL | ||
| 1326 | CAMUDA010000003.1 | GCA947087535_00621 | gene | open | 153691-153764 | trnC | ||
| 1327 | CAMUDA010000003.1 | GCA947087535_00622 | gene | open | 153768-153842 | trnG | ||
| 1328 | CAMUDA010000003.1 | GCA947087535_00623 | gene | open | 153851-153926 | trnF | ||
| 1329 | CAMUDA010000003.1 | GCA947087535_00624 | gene | open | 153932-154008 | trnD | ||
| 1330 | CAMUDA010000003.1 | GCA947087535_00662 | gene | open | 201937-202013 | trnI | ||
| 1331 | CAMUDA010000003.1 | GCA947087535_00666 | gene | open | 204025-204100 | trnV | ||
| 1332 | CAMUDA010000003.1 | GCA947087535_00667 | gene | open | 204106-204181 | trnE | ||
| 1333 | CAMUDA010000003.1 | GCA947087535_00668 | gene | open | 204183-204258 | trnN | ||
| 1334 | CAMUDA010000003.1 | GCA947087535_00529 | tRNA | open | 60019-60107 | trnS | tRNA-Ser(cga) | |
| 1335 | CAMUDA010000003.1 | GCA947087535_00554 | tRNA | open | 84183-84267 | trnL | tRNA-Leu(caa) | |
| 1336 | CAMUDA010000003.1 | GCA947087535_00569 | tRNA | open | 99445-99536 | trnS | tRNA-Ser(gga) | |
| 1337 | CAMUDA010000003.1 | GCA947087535_00570 | tRNA | open | 99577-99653 | trnP | tRNA-Pro(cgg) | |
| 1338 | CAMUDA010000003.1 | GCA947087535_00620 | tRNA | open | 153586-153674 | trnL | tRNA-Leu(taa) | |
| 1339 | CAMUDA010000003.1 | GCA947087535_00621 | tRNA | open | 153691-153764 | trnC | tRNA-Cys(gca) | |
| 1340 | CAMUDA010000003.1 | GCA947087535_00622 | tRNA | open | 153768-153842 | trnG | tRNA-Gly(gcc) | |
| 1341 | CAMUDA010000003.1 | GCA947087535_00623 | tRNA | open | 153851-153926 | trnF | tRNA-Phe(gaa) | |
| 1342 | CAMUDA010000003.1 | GCA947087535_00624 | tRNA | open | 153932-154008 | trnD | tRNA-Asp(gtc) | |
| 1343 | CAMUDA010000003.1 | GCA947087535_00662 | tRNA | open | 201937-202013 | trnI | tRNA-Ile(gat) | |
| 1344 | CAMUDA010000003.1 | GCA947087535_00666 | tRNA | open | 204025-204100 | trnV | tRNA-Val(tac) | |
| 1345 | CAMUDA010000003.1 | GCA947087535_00667 | tRNA | open | 204106-204181 | trnE | tRNA-Glu(ttc) | |
| 1346 | CAMUDA010000003.1 | GCA947087535_00668 | tRNA | open | 204183-204258 | trnN | tRNA-Asn(gtt) | |
| 1347 | CAMUDA010000004.1 | GCA947087535_00707 | gene | open | 46562-46598 | abiF | ||
| 1348 | CAMUDA010000004.1 | GCA947087535_00708 | gene | open | 46778-46908 | SpR18_sRNA | ||
| 1349 | CAMUDA010000004.1 | GCA947087535_00715 | gene | open | 58423-58553 | SpR18_sRNA | ||
| 1350 | CAMUDA010000004.1 | GCA947087535_00717 | gene | open | 60036-60166 | SpR18_sRNA | ||
| 1351 | CAMUDA010000004.1 | GCA947087535_00707 | ncRNA | open | 46562-46598 | abiF | abiF RNA | |
| 1352 | CAMUDA010000004.1 | GCA947087535_00708 | ncRNA | open | 46778-46908 | Streptococcus sRNA SpR18 | ||
| 1353 | CAMUDA010000004.1 | GCA947087535_00715 | ncRNA | open | 58423-58553 | Streptococcus sRNA SpR18 | ||
| 1354 | CAMUDA010000004.1 | GCA947087535_00717 | ncRNA | open | 60036-60166 | Streptococcus sRNA SpR18 | ||
| 1355 | CAMUDA010000004.1 | regulatory_region | open | 69665-69869 | T-box leader | |||
| 1356 | CAMUDA010000004.1 | regulatory_region | open | 75081-75321 | T-box leader | |||
| 1357 | CAMUDA010000004.1 | regulatory_region | open | 167266-167354 | Glycine riboswitch aptamer | |||
| 1358 | CAMUDA010000004.1 | regulatory_region | open | 187063-187314 | T-box leader | |||
| 1359 | CAMUDA010000004.1 | regulatory_region | open | 187479-187574 | SAM riboswitch aptamer (S box leader) | |||
| 1360 | CAMUDA010000004.1 | repeat_region | open | 33539-34837 | CRISPR array with 20 repeats of length 36%2C consensus sequence GTTTTAGACATTTATAGAATTACATTACTCTCAAAC and spacer length 30 | |||
| 1361 | CAMUDA010000004.1 | GCA947087535_00670 | CDS | open | 465-2372 | _na 635_aa | thrS | threonine--tRNA ligase |
| 1362 | CAMUDA010000004.1 | GCA947087535_00671 | CDS | open | 2699-3520 | _na 273_aa | Putative pyruvate%2C phosphate dikinase regulatory protein | |
| 1363 | CAMUDA010000004.1 | GCA947087535_00672 | CDS | open | 3522-4166 | _na 214_aa | HTH domain protein | |
| 1364 | CAMUDA010000004.1 | GCA947087535_00673 | CDS | open | 4259-6628 | _na 789_aa | ppsA | phosphoenolpyruvate synthase |
| 1365 | CAMUDA010000004.1 | GCA947087535_00674 | CDS | open | 6918-9020 | _na 700_aa | peptidoglycan glycosyltransferase | |
| 1366 | CAMUDA010000004.1 | GCA947087535_00675 | CDS | open | 9078-10262 | _na 394_aa | cytX | Hydroxymethylpyrimidine transporter CytX |
| 1367 | CAMUDA010000004.1 | GCA947087535_00676 | CDS | open | 10473-11573 | _na 366_aa | Efflux transporter%2C RND family%2C MFP subunit | |
| 1368 | CAMUDA010000004.1 | GCA947087535_00677 | CDS | open | 11583-12290 | _na 235_aa | ABC transporter%2C ATP-binding protein | |
| 1369 | CAMUDA010000004.1 | GCA947087535_00678 | CDS | open | 12280-13497 | _na 405_aa | Efflux ABC transporter%2C permease protein | |
| 1370 | CAMUDA010000004.1 | GCA947087535_00679 | CDS | open | 13644-14885 | _na 413_aa | LL-diaminopimelate aminotransferase | |
| 1371 | CAMUDA010000004.1 | GCA947087535_00680 | CDS | open | 14899-16005 | _na 368_aa | ychF | redox-regulated ATPase YchF |
| 1372 | CAMUDA010000004.1 | GCA947087535_00681 | CDS | open | 16300-16518 | _na 72_aa | helix-turn-helix transcriptional regulator | |
| 1373 | CAMUDA010000004.1 | GCA947087535_00682 | CDS | open | 16511-18331 | _na 606_aa | class I SAM-dependent DNA methyltransferase | |
| 1374 | CAMUDA010000004.1 | GCA947087535_00683 | CDS | open | 18328-19533 | _na 401_aa | restriction endonuclease subunit S | |
| 1375 | CAMUDA010000004.1 | GCA947087535_00684 | CDS | open | 19549-22701 | _na 1050_aa | type I restriction endonuclease subunit R | |
| 1376 | CAMUDA010000004.1 | GCA947087535_00685 | CDS | open | 23089-23358 | _na 89_aa | type II toxin-antitoxin system RelB/DinJ family antitoxin | |
| 1377 | CAMUDA010000004.1 | GCA947087535_00686 | CDS | open | 23351-23626 | _na 91_aa | yafQ | mRNA interferase YafQ |
| 1378 | CAMUDA010000004.1 | GCA947087535_00687 | CDS | open | 23824-24489 | _na 221_aa | hypothetical protein | |
| 1379 | CAMUDA010000004.1 | GCA947087535_00688 | CDS | open | 24687-25310 | _na 207_aa | Formiminotransferase-cyclodeaminase | |
| 1380 | CAMUDA010000004.1 | GCA947087535_00689 | CDS | open | 25310-26986 | _na 558_aa | formate--tetrahydrofolate ligase | |
| 1381 | CAMUDA010000004.1 | GCA947087535_00690 | CDS | open | 27254-29155 | _na 633_aa | Glutamate--ammonia ligase%2C catalytic domain protein | |
| 1382 | CAMUDA010000004.1 | GCA947087535_00691 | CDS | open | 29304-29750 | _na 148_aa | YqeY-like protein | |
| 1383 | CAMUDA010000004.1 | GCA947087535_00692 | CDS | open | 29776-29955 | _na 59_aa | rpsU | 30S ribosomal protein S21 |
| 1384 | CAMUDA010000004.1 | GCA947087535_00693 | CDS | open | 30118-31926 | _na 602_aa | DUF4127 domain-containing protein | |
| 1385 | CAMUDA010000004.1 | GCA947087535_00694 | CDS | open | 31974-32648 | _na 224_aa | Glycine transporter domain-containing protein | |
| 1386 | CAMUDA010000004.1 | GCA947087535_00695 | CDS | open | 32767-33240 | _na 157_aa | tadA | tRNA adenosine(34) deaminase TadA |
| 1387 | CAMUDA010000004.1 | GCA947087535_00696 | CDS | open | 34901-35575 | _na 224_aa | csn2 | type II-A CRISPR-associated protein Csn2 |
| 1388 | CAMUDA010000004.1 | GCA947087535_00697 | CDS | open | 35572-35877 | _na 101_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1389 | CAMUDA010000004.1 | GCA947087535_00698 | CDS | open | 35882-36757 | _na 291_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 1390 | CAMUDA010000004.1 | GCA947087535_00699 | CDS | open | 36770-40810 | _na 1346_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 1391 | CAMUDA010000004.1 | GCA947087535_00701 | CDS | open | 42214-43095 | _na 293_aa | Abortive infection bacteriophage resistance protein | |
| 1392 | CAMUDA010000004.1 | GCA947087535_00702 | CDS | open | 43369-44370 | _na 333_aa | Cytosine-specific methyltransferase | |
| 1393 | CAMUDA010000004.1 | GCA947087535_00703 | CDS | open | 44471-44578 | _na 35_aa | hypothetical protein | |
| 1394 | CAMUDA010000004.1 | GCA947087535_00704 | CDS | open | 44923-45153 | _na 76_aa | hypothetical protein | |
| 1395 | CAMUDA010000004.1 | GCA947087535_00705 | CDS | open | 45459-46439 | _na 326_aa | Abi family protein | |
| 1396 | CAMUDA010000004.1 | GCA947087535_00706 | CDS | open | 46510-46971 | _na 153_aa | hypothetical protein | |
| 1397 | CAMUDA010000004.1 | GCA947087535_00709 | CDS | open | 46953-50015 | _na 1020_aa | type III restriction-modification system endonuclease | |
| 1398 | CAMUDA010000004.1 | GCA947087535_00710 | CDS | open | 50029-51912 | _na 627_aa | site-specific DNA-methyltransferase | |
| 1399 | CAMUDA010000004.1 | GCA947087535_00711 | CDS | open | 51923-53887 | _na 654_aa | site-specific DNA-methyltransferase | |
| 1400 | CAMUDA010000004.1 | GCA947087535_00712 | CDS | open | 53889-54542 | _na 217_aa | DUF4391 domain-containing protein | |
| 1401 | CAMUDA010000004.1 | GCA947087535_00713 | CDS | open | 54557-57793 | _na 1078_aa | Helicase | |
| 1402 | CAMUDA010000004.1 | GCA947087535_00714 | CDS | open | 57828-58037 | _na 69_aa | VanUG2 | |
| 1403 | CAMUDA010000004.1 | GCA947087535_00716 | CDS | open | 58736-59575 | _na 279_aa | KilA-N domain-containing protein | |
| 1404 | CAMUDA010000004.1 | GCA947087535_00718 | CDS | open | 60194-61729 | _na 511_aa | guaA | glutamine-hydrolyzing GMP synthase |
| 1405 | CAMUDA010000004.1 | GCA947087535_00719 | CDS | open | 61940-62335 | _na 131_aa | rpsI | 30S ribosomal protein S9 |
| 1406 | CAMUDA010000004.1 | GCA947087535_00720 | CDS | open | 62354-62794 | _na 146_aa | rplM | 50S ribosomal protein L13 |
| 1407 | CAMUDA010000004.1 | GCA947087535_00721 | CDS | open | 62934-63689 | _na 251_aa | rex | redox-sensing transcriptional repressor Rex |
| 1408 | CAMUDA010000004.1 | GCA947087535_00722 | CDS | open | 63679-64944 | _na 421_aa | O-antigen polymerase | |
| 1409 | CAMUDA010000004.1 | GCA947087535_00723 | CDS | open | 65085-65498 | _na 137_aa | Toxin-antitoxin system%2C antitoxin component%2C Xre domain protein | |
| 1410 | CAMUDA010000004.1 | GCA947087535_00724 | CDS | open | 65644-66948 | _na 434_aa | tetrahydrofolate synthase | |
| 1411 | CAMUDA010000004.1 | GCA947087535_00725 | CDS | open | 66961-69621 | _na 886_aa | valine--tRNA ligase | |
| 1412 | CAMUDA010000004.1 | GCA947087535_00726 | CDS | open | 70014-71666 | _na 550_aa | ilvD | dihydroxy-acid dehydratase |
| 1413 | CAMUDA010000004.1 | GCA947087535_00727 | CDS | open | 71687-72187 | _na 166_aa | ilvN | acetolactate synthase small subunit |
| 1414 | CAMUDA010000004.1 | GCA947087535_00728 | CDS | open | 72184-73884 | _na 566_aa | ilvB | biosynthetic-type acetolactate synthase large subunit |
| 1415 | CAMUDA010000004.1 | GCA947087535_00729 | CDS | open | 73973-74983 | _na 336_aa | ilvC | ketol-acid reductoisomerase |
| 1416 | CAMUDA010000004.1 | GCA947087535_00730 | CDS | open | 75491-76828 | _na 445_aa | nox | H2O-forming NADH oxidase |
| 1417 | CAMUDA010000004.1 | GCA947087535_00731 | CDS | open | 77207-78886 | _na 559_aa | hutW | heme anaerobic degradation radical SAM methyltransferase ChuW/HutW |
| 1418 | CAMUDA010000004.1 | GCA947087535_00732 | CDS | open | 78899-79417 | _na 172_aa | Flavodoxin family protein | |
| 1419 | CAMUDA010000004.1 | GCA947087535_00733 | CDS | open | 79562-80353 | _na 263_aa | tonB | TonB family domain protein |
| 1420 | CAMUDA010000004.1 | GCA947087535_00734 | CDS | open | 80361-80765 | _na 134_aa | Transport energizing protein%2C ExbD/TolR family | |
| 1421 | CAMUDA010000004.1 | GCA947087535_00735 | CDS | open | 80777-81388 | _na 203_aa | Transporter%2C MotA/TolQ/ExbB proton channel family protein | |
| 1422 | CAMUDA010000004.1 | GCA947087535_00736 | CDS | open | 81626-82096 | _na 156_aa | hypothetical protein | |
| 1423 | CAMUDA010000004.1 | GCA947087535_00737 | CDS | open | 82038-82682 | _na 214_aa | pilN | Fimbrial assembly protein PilN |
| 1424 | CAMUDA010000004.1 | GCA947087535_00738 | CDS | open | 82634-83398 | _na 254_aa | hypothetical protein | |
| 1425 | CAMUDA010000004.1 | GCA947087535_00739 | CDS | open | 83417-83860 | _na 147_aa | Prepilin-type cleavage/methylation protein | |
| 1426 | CAMUDA010000004.1 | GCA947087535_00740 | CDS | open | 83882-84436 | _na 184_aa | Prepilin-type cleavage/methylation protein | |
| 1427 | CAMUDA010000004.1 | GCA947087535_00741 | CDS | open | 84381-84737 | _na 118_aa | Prepilin-type cleavage/methylation protein | |
| 1428 | CAMUDA010000004.1 | GCA947087535_00742 | CDS | open | 84730-85197 | _na 155_aa | Prepilin-type cleavage/methylation protein | |
| 1429 | CAMUDA010000004.1 | GCA947087535_00743 | CDS | open | 85155-85598 | _na 147_aa | Prepilin type IV endopeptidase peptidase domain-containing protein | |
| 1430 | CAMUDA010000004.1 | GCA947087535_00744 | CDS | open | 85621-86016 | _na 131_aa | General secretion pathway protein G | |
| 1431 | CAMUDA010000004.1 | GCA947087535_00745 | CDS | open | 86045-87244 | _na 399_aa | Bacterial type II secretion system protein F domain protein | |
| 1432 | CAMUDA010000004.1 | GCA947087535_00746 | CDS | open | 87241-88185 | _na 314_aa | Twitching motility protein | |
| 1433 | CAMUDA010000004.1 | GCA947087535_00747 | CDS | open | 88148-89344 | _na 398_aa | Type II/IV secretion system protein | |
| 1434 | CAMUDA010000004.1 | GCA947087535_00748 | CDS | open | 89516-92125 | _na 869_aa | DNA 3'-5' helicase | |
| 1435 | CAMUDA010000004.1 | GCA947087535_00750 | CDS | open | 92410-93534 | _na 374_aa | Alcohol dehydrogenase%2C iron-dependent | |
| 1436 | CAMUDA010000004.1 | GCA947087535_00751 | CDS | open | 93550-94971 | _na 473_aa | Aldehyde dehydrogenase (NAD) family protein | |
| 1437 | CAMUDA010000004.1 | GCA947087535_00752 | CDS | open | 94952-95794 | _na 280_aa | eutJ | ethanolamine utilization protein EutJ |
| 1438 | CAMUDA010000004.1 | GCA947087535_00753 | CDS | open | 95851-96111 | _na 86_aa | Ethanolamine utilization protein EutN/carboxysome structural protein Ccml | |
| 1439 | CAMUDA010000004.1 | GCA947087535_00754 | CDS | open | 96151-96651 | _na 166_aa | BMC domain protein | |
| 1440 | CAMUDA010000004.1 | GCA947087535_00755 | CDS | open | 96657-97373 | _na 238_aa | Flavoprotein domain-containing protein | |
| 1441 | CAMUDA010000004.1 | GCA947087535_00756 | CDS | open | 97388-97666 | _na 92_aa | pduA | Propanediol utilization microcompartment protein PduA |
| 1442 | CAMUDA010000004.1 | GCA947087535_00757 | CDS | open | 97694-98506 | _na 270_aa | pduB | propanediol utilization microcompartment protein PduB |
| 1443 | CAMUDA010000004.1 | GCA947087535_00758 | CDS | open | 98517-99458 | _na 313_aa | Glycyl-radical enzyme activating protein family protein | |
| 1444 | CAMUDA010000004.1 | GCA947087535_00759 | CDS | open | 99497-102088 | _na 863_aa | Formate C-acetyltransferase | |
| 1445 | CAMUDA010000004.1 | GCA947087535_00760 | CDS | open | 102365-103276 | _na 303_aa | araC | Transcriptional regulator%2C AraC family |
| 1446 | CAMUDA010000004.1 | GCA947087535_00761 | CDS | open | 103719-105371 | _na 550_aa | Thioredoxin-disulfide reductase | |
| 1447 | CAMUDA010000004.1 | GCA947087535_00762 | CDS | open | 105383-105946 | _na 187_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 1448 | CAMUDA010000004.1 | GCA947087535_00763 | CDS | open | 106162-106632 | _na 156_aa | CBS domain protein | |
| 1449 | CAMUDA010000004.1 | GCA947087535_00764 | CDS | open | 106738-107217 | _na 159_aa | rlmH | 23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH |
| 1450 | CAMUDA010000004.1 | GCA947087535_00765 | CDS | open | 107214-108323 | _na 369_aa | Trypsin | |
| 1451 | CAMUDA010000004.1 | GCA947087535_00766 | CDS | open | 108343-109284 | _na 313_aa | Metallo-beta-lactamase domain protein | |
| 1452 | CAMUDA010000004.1 | GCA947087535_00767 | CDS | open | 109274-109930 | _na 218_aa | deoC | deoxyribose-phosphate aldolase |
| 1453 | CAMUDA010000004.1 | GCA947087535_00768 | CDS | open | 110022-110777 | _na 251_aa | deoC | deoxyribose-phosphate aldolase |
| 1454 | CAMUDA010000004.1 | GCA947087535_00769 | CDS | open | 110956-111879 | _na 307_aa | thrB | homoserine kinase |
| 1455 | CAMUDA010000004.1 | GCA947087535_00770 | CDS | open | 111883-113169 | _na 428_aa | Homoserine dehydrogenase | |
| 1456 | CAMUDA010000004.1 | GCA947087535_00771 | CDS | open | 113189-113638 | _na 149_aa | ACT domain-containing protein | |
| 1457 | CAMUDA010000004.1 | GCA947087535_00772 | CDS | open | 113635-114564 | _na 309_aa | NAD dependent epimerase/dehydratase family protein | |
| 1458 | CAMUDA010000004.1 | GCA947087535_00773 | CDS | open | 114577-115425 | _na 282_aa | hpnK | Hopanoid biosynthesis associated protein HpnK |
| 1459 | CAMUDA010000004.1 | GCA947087535_00774 | CDS | open | 115433-116359 | _na 308_aa | Ribonuclease | |
| 1460 | CAMUDA010000004.1 | GCA947087535_00775 | CDS | open | 116368-117180 | _na 270_aa | trmH | RNA methyltransferase%2C TrmH family |
| 1461 | CAMUDA010000004.1 | GCA947087535_00776 | CDS | open | 117319-118698 | _na 459_aa | Pyruvate carboxylase subunit B | |
| 1462 | CAMUDA010000004.1 | GCA947087535_00777 | CDS | open | 119045-120451 | _na 468_aa | Radical SAM domain protein | |
| 1463 | CAMUDA010000004.1 | GCA947087535_00778 | CDS | open | 120605-121360 | _na 251_aa | LytTr DNA-binding domain protein | |
| 1464 | CAMUDA010000004.1 | GCA947087535_00779 | CDS | open | 121353-122429 | _na 358_aa | Radical SAM protein%2C TIGR01212 family | |
| 1465 | CAMUDA010000004.1 | GCA947087535_00780 | CDS | open | 122471-123226 | _na 251_aa | rnc | ribonuclease III |
| 1466 | CAMUDA010000004.1 | GCA947087535_00781 | CDS | open | 123189-124445 | _na 418_aa | fabF | beta-ketoacyl-ACP synthase II |
| 1467 | CAMUDA010000004.1 | GCA947087535_00782 | CDS | open | 124472-125434 | _na 320_aa | 2-nitropropane dioxygenase | |
| 1468 | CAMUDA010000004.1 | GCA947087535_00783 | CDS | open | 125502-125747 | _na 81_aa | acpP | acyl carrier protein |
| 1469 | CAMUDA010000004.1 | GCA947087535_00784 | CDS | open | 125792-126535 | _na 247_aa | fabG | 3-oxoacyl-[acyl-carrier-protein] reductase |
| 1470 | CAMUDA010000004.1 | GCA947087535_00785 | CDS | open | 126537-127478 | _na 313_aa | fabD | ACP S-malonyltransferase |
| 1471 | CAMUDA010000004.1 | GCA947087535_00786 | CDS | open | 127496-128509 | _na 337_aa | Beta-ketoacyl-[acyl-carrier-protein] synthase III | |
| 1472 | CAMUDA010000004.1 | GCA947087535_00787 | CDS | open | 128481-129509 | _na 342_aa | plsX | phosphate acyltransferase PlsX |
| 1473 | CAMUDA010000004.1 | GCA947087535_00788 | CDS | open | 129525-130067 | _na 180_aa | fapR | transcription factor FapR |
| 1474 | CAMUDA010000004.1 | GCA947087535_00789 | CDS | open | 130215-130451 | _na 78_aa | Transcriptional coactivator p15 (PC4) C-terminal domain-containing protein | |
| 1475 | CAMUDA010000004.1 | GCA947087535_00790 | CDS | open | 130568-131428 | _na 286_aa | DUF2179 domain-containing protein | |
| 1476 | CAMUDA010000004.1 | GCA947087535_00791 | CDS | open | 131425-131841 | _na 138_aa | YqgF/RNase H-like domain-containing protein | |
| 1477 | CAMUDA010000004.1 | GCA947087535_00792 | CDS | open | 131851-133134 | _na 427_aa | DUF3084 domain-containing protein | |
| 1478 | CAMUDA010000004.1 | GCA947087535_00793 | CDS | open | 133227-134315 | _na 362_aa | Permease%2C YjgP/YjgQ family | |
| 1479 | CAMUDA010000004.1 | GCA947087535_00794 | CDS | open | 134332-135051 | _na 239_aa | lptB | LPS export ABC transporter ATP-binding protein |
| 1480 | CAMUDA010000004.1 | GCA947087535_00795 | CDS | open | 135069-135797 | _na 242_aa | OstA-like protein | |
| 1481 | CAMUDA010000004.1 | GCA947087535_00796 | CDS | open | 135800-136351 | _na 183_aa | lptC | LPS export ABC transporter periplasmic protein LptC |
| 1482 | CAMUDA010000004.1 | GCA947087535_00797 | CDS | open | 136332-137264 | _na 310_aa | Lipid A biosynthesis (KDO)2-(Lauroyl)-lipid IVA acyltransferase | |
| 1483 | CAMUDA010000004.1 | GCA947087535_00798 | CDS | open | 137283-137816 | _na 177_aa | yrbI | 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase%2C YrbI family |
| 1484 | CAMUDA010000004.1 | GCA947087535_00799 | CDS | open | 137816-138787 | _na 323_aa | Sugar isomerase%2C KpsF/GutQ family | |
| 1485 | CAMUDA010000004.1 | GCA947087535_00800 | CDS | open | 138805-139650 | _na 281_aa | kdsA | 3-deoxy-8-phosphooctulonate synthase |
| 1486 | CAMUDA010000004.1 | GCA947087535_00801 | CDS | open | 139654-140391 | _na 245_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 1487 | CAMUDA010000004.1 | GCA947087535_00802 | CDS | open | 140388-141524 | _na 378_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 1488 | CAMUDA010000004.1 | GCA947087535_00803 | CDS | open | 141505-142815 | _na 436_aa | 3-deoxy-D-manno-octulosonic acid transferase | |
| 1489 | CAMUDA010000004.1 | GCA947087535_00804 | CDS | open | 142828-144582 | _na 584_aa | msbA | Lipid A export permease/ATP-binding protein MsbA |
| 1490 | CAMUDA010000004.1 | GCA947087535_00805 | CDS | open | 144579-145721 | _na 380_aa | lpxB | lipid-A-disaccharide synthase |
| 1491 | CAMUDA010000004.1 | GCA947087535_00806 | CDS | open | 145730-146545 | _na 271_aa | minC | Septum site-determining protein MinC |
| 1492 | CAMUDA010000004.1 | GCA947087535_00807 | CDS | open | 146662-147471 | _na 269_aa | lpxA | acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase |
| 1493 | CAMUDA010000004.1 | GCA947087535_00808 | CDS | open | 147669-148112 | _na 147_aa | fabZ | 3-hydroxyacyl-ACP dehydratase FabZ |
| 1494 | CAMUDA010000004.1 | GCA947087535_00809 | CDS | open | 148127-148966 | _na 279_aa | lpxC | UDP-3-O-acyl-N-acetylglucosamine deacetylase |
| 1495 | CAMUDA010000004.1 | GCA947087535_00810 | CDS | open | 149134-150570 | _na 478_aa | argH | argininosuccinate lyase |
| 1496 | CAMUDA010000004.1 | GCA947087535_00811 | CDS | open | 150592-151821 | _na 409_aa | argininosuccinate synthase | |
| 1497 | CAMUDA010000004.1 | GCA947087535_00812 | CDS | open | 151998-152765 | _na 255_aa | Transglycosylase | |
| 1498 | CAMUDA010000004.1 | GCA947087535_00813 | CDS | open | 152938-153573 | _na 211_aa | LUD domain-containing protein | |
| 1499 | CAMUDA010000004.1 | GCA947087535_00814 | CDS | open | 153813-155330 | _na 505_aa | L-lactate permease | |
| 1500 | CAMUDA010000004.1 | GCA947087535_00815 | CDS | open | 155394-155954 | _na 186_aa | hypothetical protein |

