HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Capnocytophaga gingivalis (GCA_947096245.1)

Select a Genome:
BAKTA Annotations for GCA_947096245.1
Genome Selected: Capnocytophaga gingivalis
ContigsBases CDSrRNA tmRNAtRNA
196 2041923 1834 1 0 23
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3724 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 3724 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAMUQP010000007.1 GCA947096245_00243 gene open 12616-13056
502 CAMUQP010000007.1 GCA947096245_00244 gene open 13071-13490
503 CAMUQP010000007.1 GCA947096245_00245 gene open 13813-14205 merR
504 CAMUQP010000007.1 GCA947096245_00246 gene open 14234-15874 merA
505 CAMUQP010000007.1 GCA947096245_00247 gene open 16098-16967
506 CAMUQP010000007.1 GCA947096245_00248 gene open 16975-18462
507 CAMUQP010000007.1 GCA947096245_00249 gene open 18613-19128
508 CAMUQP010000007.1 GCA947096245_00250 gene open 19242-20897 recN
509 CAMUQP010000007.1 GCA947096245_00251 gene open 20997-22862 abc-f
510 CAMUQP010000007.1 GCA947096245_00252 gene open 22872-23297 slyB
511 CAMUQP010000007.1 GCA947096245_00253 gene open 23569-25155
512 CAMUQP010000007.1 GCA947096245_00254 gene open 25343-27148 typA
513 CAMUQP010000007.1 GCA947096245_00255 gene open 27228-29024
514 CAMUQP010000007.1 GCA947096245_00256 gene open 29039-29794
515 CAMUQP010000007.1 GCA947096245_00257 gene open 29864-31726 mnmG
516 CAMUQP010000007.1 GCA947096245_00258 gene open 31894-32550
517 CAMUQP010000008.1 GCA947096245_00259 CDS open 633-1967 _na     444_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
518 CAMUQP010000008.1 GCA947096245_00260 CDS open 2058-3047 _na     329_aa aspartate-semialdehyde dehydrogenase
519 CAMUQP010000008.1 GCA947096245_00261 CDS open 3157-4170 _na     337_aa Phosphatidic acid phosphatase
520 CAMUQP010000008.1 GCA947096245_00262 CDS open 4270-4986 _na     238_aa Putative cyclase
521 CAMUQP010000008.1 GCA947096245_00263 CDS open 5122-6738 _na     538_aa Leucine rich repeat-containing protein
522 CAMUQP010000008.1 GCA947096245_00264 CDS open 6823-7842 _na     339_aa pta phosphate acetyltransferase
523 CAMUQP010000008.1 GCA947096245_00265 CDS open 7988-9652 _na     554_aa Sulfatase-modifying factor enzyme domain-containing protein
524 CAMUQP010000008.1 GCA947096245_00266 CDS open 9927-10448 _na     173_aa DUF4136 domain-containing protein
525 CAMUQP010000008.1 GCA947096245_00267 CDS open 10618-12042 _na     474_aa Peptidase M16
526 CAMUQP010000008.1 GCA947096245_00268 CDS open 12055-13488 _na     477_aa Insulinase family protein
527 CAMUQP010000008.1 GCA947096245_00269 CDS open 13525-14892 _na     455_aa ompA Cell envelope biogenesis protein OmpA
528 CAMUQP010000008.1 GCA947096245_00270 CDS open 15313-16443 _na     376_aa SAM-dependent methyltransferase
529 CAMUQP010000008.1 GCA947096245_00271 CDS open 16458-17423 _na     321_aa Hydroxyacid dehydrogenase
530 CAMUQP010000008.1 GCA947096245_00272 CDS open 17374-17607 _na     77_aa yidD membrane protein insertion efficiency factor YidD
531 CAMUQP010000008.1 GCA947096245_00273 CDS open 17607-18374 _na     255_aa hypothetical protein
532 CAMUQP010000008.1 GCA947096245_00274 CDS open 18628-18894 _na     88_aa Riboflavin synthase subunit beta
533 CAMUQP010000008.1 GCA947096245_00275 CDS open 18944-20767 _na     607_aa mutL DNA mismatch repair endonuclease MutL
534 CAMUQP010000008.1 GCA947096245_00276 CDS open 20864-21865 _na     333_aa murB UDP-N-acetylmuramate dehydrogenase
535 CAMUQP010000008.1 GCA947096245_00277 CDS open 21907-22896 _na     329_aa Pseudouridine synthase
536 CAMUQP010000008.1 GCA947096245_00278 CDS open 22901-23281 _na     126_aa 6-phosphogluconate dehydrogenase
537 CAMUQP010000008.1 GCA947096245_00279 CDS open 23289-24029 _na     246_aa rlmB 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB
538 CAMUQP010000008.1 GCA947096245_00280 CDS open 24230-25048 _na     272_aa ZIP family zinc (Zn2+)-iron (Fe2+) permease
539 CAMUQP010000008.1 GCA947096245_00281 CDS open 25116-26465 _na     449_aa purB adenylosuccinate lyase
540 CAMUQP010000008.1 GCA947096245_00282 CDS open 26472-27587 _na     371_aa dprA DNA-processing protein DprA
541 CAMUQP010000008.1 GCA947096245_00283 CDS open 27772-28554 _na     260_aa DUF2695 domain-containing protein
542 CAMUQP010000008.1 GCA947096245_00284 CDS open 28575-29399 _na     274_aa thymidylate synthase
543 CAMUQP010000008.1 GCA947096245_00285 CDS open 29507-30643 _na     378_aa cysteine-S-conjugate beta-lyase
544 CAMUQP010000008.1 GCA947096245_00259 gene open 633-1967 rimO
545 CAMUQP010000008.1 GCA947096245_00260 gene open 2058-3047
546 CAMUQP010000008.1 GCA947096245_00261 gene open 3157-4170
547 CAMUQP010000008.1 GCA947096245_00262 gene open 4270-4986
548 CAMUQP010000008.1 GCA947096245_00263 gene open 5122-6738
549 CAMUQP010000008.1 GCA947096245_00264 gene open 6823-7842 pta
550 CAMUQP010000008.1 GCA947096245_00265 gene open 7988-9652
551 CAMUQP010000008.1 GCA947096245_00266 gene open 9927-10448
552 CAMUQP010000008.1 GCA947096245_00267 gene open 10618-12042
553 CAMUQP010000008.1 GCA947096245_00268 gene open 12055-13488
554 CAMUQP010000008.1 GCA947096245_00269 gene open 13525-14892 ompA
555 CAMUQP010000008.1 GCA947096245_00270 gene open 15313-16443
556 CAMUQP010000008.1 GCA947096245_00271 gene open 16458-17423
557 CAMUQP010000008.1 GCA947096245_00272 gene open 17374-17607 yidD
558 CAMUQP010000008.1 GCA947096245_00273 gene open 17607-18374
559 CAMUQP010000008.1 GCA947096245_00274 gene open 18628-18894
560 CAMUQP010000008.1 GCA947096245_00275 gene open 18944-20767 mutL
561 CAMUQP010000008.1 GCA947096245_00276 gene open 20864-21865 murB
562 CAMUQP010000008.1 GCA947096245_00277 gene open 21907-22896
563 CAMUQP010000008.1 GCA947096245_00278 gene open 22901-23281
564 CAMUQP010000008.1 GCA947096245_00279 gene open 23289-24029 rlmB
565 CAMUQP010000008.1 GCA947096245_00280 gene open 24230-25048
566 CAMUQP010000008.1 GCA947096245_00281 gene open 25116-26465 purB
567 CAMUQP010000008.1 GCA947096245_00282 gene open 26472-27587 dprA
568 CAMUQP010000008.1 GCA947096245_00283 gene open 27772-28554
569 CAMUQP010000008.1 GCA947096245_00284 gene open 28575-29399
570 CAMUQP010000008.1 GCA947096245_00285 gene open 29507-30643
571 CAMUQP010000009.1 GCA947096245_00286 CDS open 988-3471 _na     827_aa lon endopeptidase La
572 CAMUQP010000009.1 GCA947096245_00287 CDS open 3586-3882 _na     98_aa erpK ErpK protein
573 CAMUQP010000009.1 GCA947096245_00288 CDS open 3957-5291 _na     444_aa ffh signal recognition particle protein
574 CAMUQP010000009.1 GCA947096245_00289 CDS open 5333-5785 _na     150_aa DUF2750 domain-containing protein
575 CAMUQP010000009.1 GCA947096245_00290 CDS open 6002-6469 _na     155_aa DUF3887 domain-containing protein
576 CAMUQP010000009.1 GCA947096245_00291 CDS open 6494-7969 _na     491_aa rpoN RNA polymerase factor sigma-54
577 CAMUQP010000009.1 GCA947096245_00292 CDS open 7972-9717 _na     581_aa ABC transporter
578 CAMUQP010000009.1 GCA947096245_00293 CDS open 9792-10337 _na     181_aa Lipoprotein
579 CAMUQP010000009.1 GCA947096245_00294 CDS open 10380-10841 _na     153_aa Cytochrome d ubiquinol oxidase subunit II
580 CAMUQP010000009.1 GCA947096245_00295 CDS open 10907-13018 _na     703_aa Alpha-glucosidase
581 CAMUQP010000009.1 GCA947096245_00296 CDS open 13090-14067 _na     325_aa dusB tRNA dihydrouridine synthase DusB
582 CAMUQP010000009.1 GCA947096245_00297 CDS open 14074-14901 _na     275_aa Haloacid dehalogenase
583 CAMUQP010000009.1 GCA947096245_00298 CDS open 14924-16333 _na     469_aa Alkaline phosphatase family protein
584 CAMUQP010000009.1 GCA947096245_00299 CDS open 16375-17808 _na     477_aa histidine kinase
585 CAMUQP010000009.1 GCA947096245_00300 CDS open 18078-19199 _na     373_aa GTP cyclohydrolase
586 CAMUQP010000009.1 GCA947096245_00301 CDS open 19189-19782 _na     197_aa Lipoprotein
587 CAMUQP010000009.1 GCA947096245_00302 CDS open 19790-21310 _na     506_aa AAA+ ATPase domain-containing protein
588 CAMUQP010000009.1 GCA947096245_00303 CDS open 21526-22566 _na     346_aa thiL thiamine-phosphate kinase
589 CAMUQP010000009.1 GCA947096245_00304 CDS open 22556-24322 _na     588_aa Adhesin
590 CAMUQP010000009.1 GCA947096245_00305 CDS open 24438-25202 _na     254_aa Alpha/beta hydrolase
591 CAMUQP010000009.1 GCA947096245_00306 CDS open 25204-25806 _na     200_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
592 CAMUQP010000009.1 GCA947096245_00307 CDS open 25814-27118 _na     434_aa Phenylacetate--CoA ligase
593 CAMUQP010000009.1 GCA947096245_00308 CDS open 27274-28752 _na     492_aa guaB IMP dehydrogenase
594 CAMUQP010000009.1 GCA947096245_00309 CDS open 28973-29554 _na     193_aa DUF4240 domain-containing protein
595 CAMUQP010000009.1 GCA947096245_00310 CDS open 29566-29916 _na     116_aa hypothetical protein
596 CAMUQP010000009.1 GCA947096245_00286 gene open 988-3471 lon
597 CAMUQP010000009.1 GCA947096245_00287 gene open 3586-3882 erpK
598 CAMUQP010000009.1 GCA947096245_00288 gene open 3957-5291 ffh
599 CAMUQP010000009.1 GCA947096245_00289 gene open 5333-5785
600 CAMUQP010000009.1 GCA947096245_00290 gene open 6002-6469
601 CAMUQP010000009.1 GCA947096245_00291 gene open 6494-7969 rpoN
602 CAMUQP010000009.1 GCA947096245_00292 gene open 7972-9717
603 CAMUQP010000009.1 GCA947096245_00293 gene open 9792-10337
604 CAMUQP010000009.1 GCA947096245_00294 gene open 10380-10841
605 CAMUQP010000009.1 GCA947096245_00295 gene open 10907-13018
606 CAMUQP010000009.1 GCA947096245_00296 gene open 13090-14067 dusB
607 CAMUQP010000009.1 GCA947096245_00297 gene open 14074-14901
608 CAMUQP010000009.1 GCA947096245_00298 gene open 14924-16333
609 CAMUQP010000009.1 GCA947096245_00299 gene open 16375-17808
610 CAMUQP010000009.1 GCA947096245_00300 gene open 18078-19199
611 CAMUQP010000009.1 GCA947096245_00301 gene open 19189-19782
612 CAMUQP010000009.1 GCA947096245_00302 gene open 19790-21310
613 CAMUQP010000009.1 GCA947096245_00303 gene open 21526-22566 thiL
614 CAMUQP010000009.1 GCA947096245_00304 gene open 22556-24322
615 CAMUQP010000009.1 GCA947096245_00305 gene open 24438-25202
616 CAMUQP010000009.1 GCA947096245_00306 gene open 25204-25806 yihA
617 CAMUQP010000009.1 GCA947096245_00307 gene open 25814-27118
618 CAMUQP010000009.1 GCA947096245_00308 gene open 27274-28752 guaB
619 CAMUQP010000009.1 GCA947096245_00309 gene open 28973-29554
620 CAMUQP010000009.1 GCA947096245_00310 gene open 29566-29916
621 CAMUQP010000010.1 GCA947096245_00311 CDS open 88-2034 _na     648_aa Dipeptidyl carboxypeptidase II
622 CAMUQP010000010.1 GCA947096245_00312 CDS open 2152-3747 _na     531_aa peptide chain release factor 3
623 CAMUQP010000010.1 GCA947096245_00313 CDS open 3788-4489 _na     233_aa DUF4197 domain-containing protein
624 CAMUQP010000010.1 GCA947096245_00314 CDS open 4571-6235 _na     554_aa menD 2-succinyl-5-enolpyruvyl-6-hydroxy-3-cyclohexene-1-carboxylic-acid synthase
625 CAMUQP010000010.1 GCA947096245_00315 CDS open 6232-6702 _na     156_aa Appr-1-p processing protein
626 CAMUQP010000010.1 GCA947096245_00316 CDS open 6846-7610 _na     254_aa MBL fold metallo-hydrolase
627 CAMUQP010000010.1 GCA947096245_00317 CDS open 7743-8174 _na     143_aa rpiB ribose 5-phosphate isomerase B
628 CAMUQP010000010.1 GCA947096245_00318 CDS open 8190-9209 _na     339_aa pheS phenylalanine--tRNA ligase subunit alpha
629 CAMUQP010000010.1 GCA947096245_00319 CDS open 9240-10013 _na     257_aa DUF1275 domain-containing protein
630 CAMUQP010000010.1 GCA947096245_00320 CDS open 10112-10843 _na     243_aa grpE Protein GrpE
631 CAMUQP010000010.1 GCA947096245_00321 CDS open 10866-11984 _na     372_aa dnaJ Chaperone protein DnaJ
632 CAMUQP010000010.1 GCA947096245_00322 CDS open 12042-13946 _na     634_aa S9 family peptidase
633 CAMUQP010000010.1 GCA947096245_00323 CDS open 14022-14438 _na     138_aa CBS domain protein
634 CAMUQP010000010.1 GCA947096245_00324 CDS open 14585-15250 _na     221_aa protein-L-isoaspartate(D-aspartate) O-methyltransferase
635 CAMUQP010000010.1 GCA947096245_00325 CDS open 15271-16227 _na     318_aa Carboxypeptidase-like regulatory domain-containing protein
636 CAMUQP010000010.1 GCA947096245_00326 CDS open 16370-19060 _na     896_aa AsmA-like C-terminal domain-containing protein
637 CAMUQP010000010.1 GCA947096245_00327 CDS open 19121-19900 _na     259_aa hypothetical protein
638 CAMUQP010000010.1 GCA947096245_00328 CDS open 20037-21014 _na     325_aa dTDP-Rha--alpha-D-GlcNAc-pyrophosphate polyprenol alpha-3-L-rhamnosyltransferase
639 CAMUQP010000010.1 GCA947096245_00329 CDS open 21017-22087 _na     356_aa aroB 3-dehydroquinate synthase
640 CAMUQP010000010.1 GCA947096245_00330 CDS open 22098-22607 _na     169_aa GNAT family N-acetyltransferase
641 CAMUQP010000010.1 GCA947096245_00331 CDS open 22743-23774 _na     343_aa Pseudouridine synthase
642 CAMUQP010000010.1 GCA947096245_00332 CDS open 23860-24492 _na     210_aa DUF4468 domain-containing protein
643 CAMUQP010000010.1 GCA947096245_00333 CDS open 24537-24800 _na     87_aa hypothetical protein
644 CAMUQP010000010.1 GCA947096245_00334 CDS open 24828-25526 _na     232_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
645 CAMUQP010000010.1 GCA947096245_00335 CDS open 25604-26446 _na     280_aa Glycosyl transferase family 2
646 CAMUQP010000010.1 GCA947096245_00336 CDS open 26471-27067 _na     198_aa pncA bifunctional nicotinamidase/pyrazinamidase
647 CAMUQP010000010.1 GCA947096245_00337 CDS open 27278-27568 _na     96_aa Sigma 54 modulation protein/S30EA ribosomal protein
648 CAMUQP010000010.1 GCA947096245_00338 CDS open 27586-28476 _na     296_aa xerC Tyrosine recombinase XerC
649 CAMUQP010000010.1 GCA947096245_00339 CDS open 28485-28946 _na     153_aa Copper resistance protein D domain-containing protein
650 CAMUQP010000010.1 GCA947096245_00340 CDS open 29131-29283 _na     50_aa hypothetical protein
651 CAMUQP010000010.1 GCA947096245_00311 gene open 88-2034
652 CAMUQP010000010.1 GCA947096245_00312 gene open 2152-3747
653 CAMUQP010000010.1 GCA947096245_00313 gene open 3788-4489
654 CAMUQP010000010.1 GCA947096245_00314 gene open 4571-6235 menD
655 CAMUQP010000010.1 GCA947096245_00315 gene open 6232-6702
656 CAMUQP010000010.1 GCA947096245_00316 gene open 6846-7610
657 CAMUQP010000010.1 GCA947096245_00317 gene open 7743-8174 rpiB
658 CAMUQP010000010.1 GCA947096245_00318 gene open 8190-9209 pheS
659 CAMUQP010000010.1 GCA947096245_00319 gene open 9240-10013
660 CAMUQP010000010.1 GCA947096245_00320 gene open 10112-10843 grpE
661 CAMUQP010000010.1 GCA947096245_00321 gene open 10866-11984 dnaJ
662 CAMUQP010000010.1 GCA947096245_00322 gene open 12042-13946
663 CAMUQP010000010.1 GCA947096245_00323 gene open 14022-14438
664 CAMUQP010000010.1 GCA947096245_00324 gene open 14585-15250
665 CAMUQP010000010.1 GCA947096245_00325 gene open 15271-16227
666 CAMUQP010000010.1 GCA947096245_00326 gene open 16370-19060
667 CAMUQP010000010.1 GCA947096245_00327 gene open 19121-19900
668 CAMUQP010000010.1 GCA947096245_00328 gene open 20037-21014
669 CAMUQP010000010.1 GCA947096245_00329 gene open 21017-22087 aroB
670 CAMUQP010000010.1 GCA947096245_00330 gene open 22098-22607
671 CAMUQP010000010.1 GCA947096245_00331 gene open 22743-23774
672 CAMUQP010000010.1 GCA947096245_00332 gene open 23860-24492
673 CAMUQP010000010.1 GCA947096245_00333 gene open 24537-24800
674 CAMUQP010000010.1 GCA947096245_00334 gene open 24828-25526 dapB
675 CAMUQP010000010.1 GCA947096245_00335 gene open 25604-26446
676 CAMUQP010000010.1 GCA947096245_00336 gene open 26471-27067 pncA
677 CAMUQP010000010.1 GCA947096245_00337 gene open 27278-27568
678 CAMUQP010000010.1 GCA947096245_00338 gene open 27586-28476 xerC
679 CAMUQP010000010.1 GCA947096245_00339 gene open 28485-28946
680 CAMUQP010000010.1 GCA947096245_00340 gene open 29131-29283
681 CAMUQP010000011.1 GCA947096245_00341 CDS open 228-458 _na     76_aa Lipoprotein
682 CAMUQP010000011.1 GCA947096245_00342 CDS open 448-909 _na     153_aa DUF805 domain-containing protein
683 CAMUQP010000011.1 GCA947096245_00343 CDS open 914-2197 _na     427_aa Glycosyl transferase family 1
684 CAMUQP010000011.1 GCA947096245_00344 CDS open 2216-3133 _na     305_aa UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase
685 CAMUQP010000011.1 GCA947096245_00345 CDS open 3188-4075 _na     295_aa ftsQ Cell division protein FtsQ
686 CAMUQP010000011.1 GCA947096245_00346 CDS open 4165-5574 _na     469_aa ftsA cell division protein FtsA
687 CAMUQP010000011.1 GCA947096245_00347 CDS open 5675-6511 _na     278_aa Mechanosensitive ion channel protein
688 CAMUQP010000011.1 GCA947096245_00348 CDS open 6525-7547 _na     340_aa galE UDP-glucose 4-epimerase GalE
689 CAMUQP010000011.1 GCA947096245_00349 CDS open 7557-8204 _na     215_aa Rhodanese
690 CAMUQP010000011.1 GCA947096245_00350 CDS open 8265-9098 _na     277_aa Alpha/beta hydrolase
691 CAMUQP010000011.1 GCA947096245_00351 CDS open 9111-9626 _na     171_aa Tetratricopeptide repeat protein
692 CAMUQP010000011.1 GCA947096245_00353 CDS open 9865-11139 _na     424_aa Serine hydroxymethyltransferase
693 CAMUQP010000011.1 GCA947096245_00354 CDS open 11212-11772 _na     186_aa L-threonylcarbamoyladenylate synthase
694 CAMUQP010000011.1 GCA947096245_00355 CDS open 11923-13551 _na     542_aa Peptidase S8
695 CAMUQP010000011.1 GCA947096245_00356 CDS open 13604-14101 _na     165_aa Bacterial Pleckstrin-like y domain-containing protein
696 CAMUQP010000011.1 GCA947096245_00357 CDS open 14120-16315 _na     731_aa Putative GTP diphosphokinase
697 CAMUQP010000011.1 GCA947096245_00358 CDS open 16519-18051 _na     510_aa purH bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase
698 CAMUQP010000011.1 GCA947096245_00359 CDS open 18187-19218 _na     343_aa quinone-dependent dihydroorotate dehydrogenase
699 CAMUQP010000011.1 GCA947096245_00360 CDS open 19338-20042 _na     234_aa ZIP family metal transporter
700 CAMUQP010000011.1 GCA947096245_00361 CDS open 20118-21065 _na     315_aa Peptidyl-prolyl cis-trans isomerase
701 CAMUQP010000011.1 GCA947096245_00362 CDS open 21087-22016 _na     309_aa putative membrane transporter protein
702 CAMUQP010000011.1 GCA947096245_00363 CDS open 22156-22917 _na     253_aa exodeoxyribonuclease III
703 CAMUQP010000011.1 GCA947096245_00364 CDS open 22921-23961 _na     346_aa rfaF ADP-heptose--LPS heptosyltransferase RfaF
704 CAMUQP010000011.1 GCA947096245_00365 CDS open 24023-24439 _na     138_aa ybeY rRNA maturation RNase YbeY
705 CAMUQP010000011.1 GCA947096245_00366 CDS open 24500-25066 _na     188_aa efp elongation factor P
706 CAMUQP010000011.1 GCA947096245_00367 CDS open 25085-26485 _na     466_aa fumC class II fumarate hydratase
707 CAMUQP010000011.1 GCA947096245_00368 CDS open 26698-27066 _na     122_aa hypothetical protein
708 CAMUQP010000011.1 GCA947096245_00341 gene open 228-458
709 CAMUQP010000011.1 GCA947096245_00342 gene open 448-909
710 CAMUQP010000011.1 GCA947096245_00343 gene open 914-2197
711 CAMUQP010000011.1 GCA947096245_00344 gene open 2216-3133
712 CAMUQP010000011.1 GCA947096245_00345 gene open 3188-4075 ftsQ
713 CAMUQP010000011.1 GCA947096245_00346 gene open 4165-5574 ftsA
714 CAMUQP010000011.1 GCA947096245_00347 gene open 5675-6511
715 CAMUQP010000011.1 GCA947096245_00348 gene open 6525-7547 galE
716 CAMUQP010000011.1 GCA947096245_00349 gene open 7557-8204
717 CAMUQP010000011.1 GCA947096245_00350 gene open 8265-9098
718 CAMUQP010000011.1 GCA947096245_00351 gene open 9111-9626
719 CAMUQP010000011.1 GCA947096245_00353 gene open 9865-11139
720 CAMUQP010000011.1 GCA947096245_00354 gene open 11212-11772
721 CAMUQP010000011.1 GCA947096245_00355 gene open 11923-13551
722 CAMUQP010000011.1 GCA947096245_00356 gene open 13604-14101
723 CAMUQP010000011.1 GCA947096245_00357 gene open 14120-16315
724 CAMUQP010000011.1 GCA947096245_00358 gene open 16519-18051 purH
725 CAMUQP010000011.1 GCA947096245_00359 gene open 18187-19218
726 CAMUQP010000011.1 GCA947096245_00360 gene open 19338-20042
727 CAMUQP010000011.1 GCA947096245_00361 gene open 20118-21065
728 CAMUQP010000011.1 GCA947096245_00362 gene open 21087-22016
729 CAMUQP010000011.1 GCA947096245_00363 gene open 22156-22917
730 CAMUQP010000011.1 GCA947096245_00364 gene open 22921-23961 rfaF
731 CAMUQP010000011.1 GCA947096245_00365 gene open 24023-24439 ybeY
732 CAMUQP010000011.1 GCA947096245_00366 gene open 24500-25066 efp
733 CAMUQP010000011.1 GCA947096245_00367 gene open 25085-26485 fumC
734 CAMUQP010000011.1 GCA947096245_00368 gene open 26698-27066
735 CAMUQP010000011.1 GCA947096245_00352 gene open 9650-9722 trnP
736 CAMUQP010000011.1 GCA947096245_00352 tRNA open 9650-9722 trnP tRNA-Pro(ggg)
737 CAMUQP010000012.1 repeat_region open 746-1027 CRISPR array with 4 repeats of length 47%2C consensus sequence AGTTGTTTGAGGTCACAAAATTACGAATTTGAAAGCAACTCACAACG and spacer length 28
738 CAMUQP010000012.1 GCA947096245_00369 CDS open 19-456 _na     145_aa hypothetical protein
739 CAMUQP010000012.1 GCA947096245_00370 CDS open 1186-2193 _na     335_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
740 CAMUQP010000012.1 GCA947096245_00371 CDS open 2258-3451 _na     397_aa sucC ADP-forming succinate--CoA ligase subunit beta
741 CAMUQP010000012.1 GCA947096245_00372 CDS open 3549-3926 _na     125_aa Ribonuclease P protein component
742 CAMUQP010000012.1 GCA947096245_00373 CDS open 4058-4783 _na     241_aa DNA-binding response regulator
743 CAMUQP010000012.1 GCA947096245_00374 CDS open 4839-6434 _na     531_aa histidine kinase
744 CAMUQP010000012.1 GCA947096245_00375 CDS open 6497-7105 _na     202_aa coaE dephospho-CoA kinase
745 CAMUQP010000012.1 GCA947096245_00376 CDS open 7102-8031 _na     309_aa YbbR-like protein
746 CAMUQP010000012.1 GCA947096245_00377 CDS open 8151-8570 _na     139_aa Dephospho-CoA kinase
747 CAMUQP010000012.1 GCA947096245_00378 CDS open 8584-9180 _na     198_aa def peptide deformylase
748 CAMUQP010000012.1 GCA947096245_00379 CDS open 9244-9696 _na     150_aa Hemerythrin
749 CAMUQP010000012.1 GCA947096245_00380 CDS open 9768-10139 _na     123_aa DUF1573 domain-containing protein
750 CAMUQP010000012.1 GCA947096245_00381 CDS open 10298-12937 _na     879_aa valine--tRNA ligase
751 CAMUQP010000012.1 GCA947096245_00382 CDS open 13085-15646 _na     853_aa clpC Clp protease ClpC
752 CAMUQP010000012.1 GCA947096245_00383 CDS open 15719-18028 _na     769_aa AAA+ ATPase domain-containing protein
753 CAMUQP010000012.1 GCA947096245_00384 CDS open 18170-18934 _na     254_aa hypothetical protein
754 CAMUQP010000012.1 GCA947096245_00385 CDS open 18942-19367 _na     141_aa Integron-associated effector binding protein domain-containing protein
755 CAMUQP010000012.1 GCA947096245_00386 CDS open 19507-20823 _na     438_aa mtaB tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))-methylthiotransferase MtaB
756 CAMUQP010000012.1 GCA947096245_00387 CDS open 20838-22934 _na     698_aa recG ATP-dependent DNA helicase RecG
757 CAMUQP010000012.1 GCA947096245_00388 CDS open 23081-24031 _na     316_aa acetyl-CoA carboxylase carboxyltransferase subunit alpha
758 CAMUQP010000012.1 GCA947096245_00389 CDS open 24178-24411 _na     77_aa gldL Gliding motility protein GldL
759 CAMUQP010000012.1 GCA947096245_00390 CDS open 24430-24837 _na     135_aa hypothetical protein
760 CAMUQP010000012.1 GCA947096245_00391 CDS open 24846-25838 _na     330_aa araC AraC family transcriptional regulator
761 CAMUQP010000012.1 GCA947096245_00369 gene open 19-456
762 CAMUQP010000012.1 GCA947096245_00370 gene open 1186-2193
763 CAMUQP010000012.1 GCA947096245_00371 gene open 2258-3451 sucC
764 CAMUQP010000012.1 GCA947096245_00372 gene open 3549-3926
765 CAMUQP010000012.1 GCA947096245_00373 gene open 4058-4783
766 CAMUQP010000012.1 GCA947096245_00374 gene open 4839-6434
767 CAMUQP010000012.1 GCA947096245_00375 gene open 6497-7105 coaE
768 CAMUQP010000012.1 GCA947096245_00376 gene open 7102-8031
769 CAMUQP010000012.1 GCA947096245_00377 gene open 8151-8570
770 CAMUQP010000012.1 GCA947096245_00378 gene open 8584-9180 def
771 CAMUQP010000012.1 GCA947096245_00379 gene open 9244-9696
772 CAMUQP010000012.1 GCA947096245_00380 gene open 9768-10139
773 CAMUQP010000012.1 GCA947096245_00381 gene open 10298-12937
774 CAMUQP010000012.1 GCA947096245_00382 gene open 13085-15646 clpC
775 CAMUQP010000012.1 GCA947096245_00383 gene open 15719-18028
776 CAMUQP010000012.1 GCA947096245_00384 gene open 18170-18934
777 CAMUQP010000012.1 GCA947096245_00385 gene open 18942-19367
778 CAMUQP010000012.1 GCA947096245_00386 gene open 19507-20823 mtaB
779 CAMUQP010000012.1 GCA947096245_00387 gene open 20838-22934 recG
780 CAMUQP010000012.1 GCA947096245_00388 gene open 23081-24031
781 CAMUQP010000012.1 GCA947096245_00389 gene open 24178-24411 gldL
782 CAMUQP010000012.1 GCA947096245_00390 gene open 24430-24837
783 CAMUQP010000012.1 GCA947096245_00391 gene open 24846-25838 araC
784 CAMUQP010000013.1 GCA947096245_00392 CDS open 105-662 _na     185_aa hypothetical protein
785 CAMUQP010000013.1 GCA947096245_00393 CDS open 665-1201 _na     178_aa DUF3341 domain-containing protein
786 CAMUQP010000013.1 GCA947096245_00394 CDS open 1198-1779 _na     193_aa Cytochrome C
787 CAMUQP010000013.1 GCA947096245_00395 CDS open 1802-3040 _na     412_aa Quinol:cytochrome C oxidoreductase
788 CAMUQP010000013.1 GCA947096245_00396 CDS open 3235-4182 _na     315_aa Sugar-binding protein
789 CAMUQP010000013.1 GCA947096245_00397 CDS open 4193-4729 _na     178_aa 3-oxoacyl-ACP synthase
790 CAMUQP010000013.1 GCA947096245_00398 CDS open 4853-5704 _na     283_aa atpG ATP synthase F1 subunit gamma
791 CAMUQP010000013.1 GCA947096245_00399 CDS open 5862-7256 _na     464_aa Transporter
792 CAMUQP010000013.1 GCA947096245_00400 CDS open 7494-8012 _na     172_aa Mechanosensitive ion channel family protein
793 CAMUQP010000013.1 GCA947096245_00401 CDS open 8033-8932 _na     299_aa Scaffold protein Nfu/NifU N-terminal domain-containing protein
794 CAMUQP010000013.1 GCA947096245_00402 CDS open 8935-9450 _na     171_aa TPM domain-containing protein
795 CAMUQP010000013.1 GCA947096245_00403 CDS open 9593-10819 _na     408_aa RNA methyltransferase
796 CAMUQP010000013.1 GCA947096245_00404 CDS open 11043-11882 _na     279_aa Histone deacetylase
797 CAMUQP010000013.1 GCA947096245_00405 CDS open 12021-12941 _na     306_aa Luciferase-type oxidoreductase%2C BA3436 family
798 CAMUQP010000013.1 GCA947096245_00406 CDS open 12945-13367 _na     140_aa aroQ type II 3-dehydroquinate dehydratase
799 CAMUQP010000013.1 GCA947096245_00407 CDS open 13536-14375 _na     279_aa Nucleotidyltransferase
800 CAMUQP010000013.1 GCA947096245_00408 CDS open 14608-15372 _na     254_aa Sugar-binding protein
801 CAMUQP010000013.1 GCA947096245_00409 CDS open 15481-16557 _na     358_aa murG undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase
802 CAMUQP010000013.1 GCA947096245_00411 CDS open 16734-16985 _na     83_aa hypothetical protein
803 CAMUQP010000013.1 GCA947096245_00412 CDS open 17001-18248 _na     415_aa Outer membrane protein transport protein%2C Ompp1/FadL/TodX family
804 CAMUQP010000013.1 GCA947096245_00413 CDS open 18326-19642 _na     438_aa M48 family metallopeptidase
805 CAMUQP010000013.1 GCA947096245_00414 CDS open 19639-20199 _na     186_aa lptC LPS export ABC transporter periplasmic protein LptC
806 CAMUQP010000013.1 GCA947096245_00415 CDS open 20387-21631 _na     414_aa Hemolysin
807 CAMUQP010000013.1 GCA947096245_00416 CDS open 21726-23168 _na     480_aa Divergent AAA domain protein
808 CAMUQP010000013.1 GCA947096245_00417 CDS open 23782-24801 _na     339_aa PQQ-like domain protein
809 CAMUQP010000013.1 GCA947096245_00418 CDS open 25141-25308 _na     55_aa hypothetical protein
810 CAMUQP010000013.1 GCA947096245_00419 CDS open 25468-26109 _na     213_aa Immunity protein 43 domain-containing protein
811 CAMUQP010000013.1 GCA947096245_00420 CDS open 26406-26684 _na     92_aa 3D domain protein
812 CAMUQP010000013.1 GCA947096245_00392 gene open 105-662
813 CAMUQP010000013.1 GCA947096245_00393 gene open 665-1201
814 CAMUQP010000013.1 GCA947096245_00394 gene open 1198-1779
815 CAMUQP010000013.1 GCA947096245_00395 gene open 1802-3040
816 CAMUQP010000013.1 GCA947096245_00396 gene open 3235-4182
817 CAMUQP010000013.1 GCA947096245_00397 gene open 4193-4729
818 CAMUQP010000013.1 GCA947096245_00398 gene open 4853-5704 atpG
819 CAMUQP010000013.1 GCA947096245_00399 gene open 5862-7256
820 CAMUQP010000013.1 GCA947096245_00400 gene open 7494-8012
821 CAMUQP010000013.1 GCA947096245_00401 gene open 8033-8932
822 CAMUQP010000013.1 GCA947096245_00402 gene open 8935-9450
823 CAMUQP010000013.1 GCA947096245_00403 gene open 9593-10819
824 CAMUQP010000013.1 GCA947096245_00404 gene open 11043-11882
825 CAMUQP010000013.1 GCA947096245_00405 gene open 12021-12941
826 CAMUQP010000013.1 GCA947096245_00406 gene open 12945-13367 aroQ
827 CAMUQP010000013.1 GCA947096245_00407 gene open 13536-14375
828 CAMUQP010000013.1 GCA947096245_00408 gene open 14608-15372
829 CAMUQP010000013.1 GCA947096245_00409 gene open 15481-16557 murG
830 CAMUQP010000013.1 GCA947096245_00411 gene open 16734-16985
831 CAMUQP010000013.1 GCA947096245_00412 gene open 17001-18248
832 CAMUQP010000013.1 GCA947096245_00413 gene open 18326-19642
833 CAMUQP010000013.1 GCA947096245_00414 gene open 19639-20199 lptC
834 CAMUQP010000013.1 GCA947096245_00415 gene open 20387-21631
835 CAMUQP010000013.1 GCA947096245_00416 gene open 21726-23168
836 CAMUQP010000013.1 GCA947096245_00417 gene open 23782-24801
837 CAMUQP010000013.1 GCA947096245_00418 gene open 25141-25308
838 CAMUQP010000013.1 GCA947096245_00419 gene open 25468-26109
839 CAMUQP010000013.1 GCA947096245_00420 gene open 26406-26684
840 CAMUQP010000013.1 GCA947096245_00410 gene open 16650-16725 trnF
841 CAMUQP010000013.1 GCA947096245_00410 tRNA open 16650-16725 trnF tRNA-Phe(gaa)
842 CAMUQP010000014.1 regulatory_region open 17643-17670 L19-Flavobacteria ribosomal protein leader
843 CAMUQP010000014.1 GCA947096245_00421 CDS open 53-1660 _na     535_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
844 CAMUQP010000014.1 GCA947096245_00422 CDS open 1682-4762 _na     1026_aa SusC/RagA family TonB-linked outer membrane protein
845 CAMUQP010000014.1 GCA947096245_00423 CDS open 5018-6640 _na     540_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
846 CAMUQP010000014.1 GCA947096245_00424 CDS open 6659-9736 _na     1025_aa SusC/RagA family TonB-linked outer membrane protein
847 CAMUQP010000014.1 GCA947096245_00425 CDS open 9823-10032 _na     69_aa hypothetical protein
848 CAMUQP010000014.1 GCA947096245_00426 CDS open 10019-11674 _na     551_aa SusD/RagB family nutrient-binding outer membrane lipoprotein
849 CAMUQP010000014.1 GCA947096245_00427 CDS open 11700-14807 _na     1035_aa SusC/RagA family TonB-linked outer membrane protein
850 CAMUQP010000014.1 GCA947096245_00428 CDS open 15229-15684 _na     151_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
851 CAMUQP010000014.1 GCA947096245_00429 CDS open 15774-17549 _na     591_aa nrdD anaerobic ribonucleoside-triphosphate reductase
852 CAMUQP010000014.1 GCA947096245_00430 CDS open 17704-18054 _na     116_aa rplS 50S ribosomal protein L19
853 CAMUQP010000014.1 GCA947096245_00431 CDS open 18144-19196 _na     350_aa Beta-ketoacyl synthase
854 CAMUQP010000014.1 GCA947096245_00432 CDS open 19276-19881 _na     201_aa Superoxide dismutase
855 CAMUQP010000014.1 GCA947096245_00433 CDS open 19970-20728 _na     252_aa tonB TonB C-terminal domain-containing protein
856 CAMUQP010000014.1 GCA947096245_00434 CDS open 20871-21494 _na     207_aa SCO family protein
857 CAMUQP010000014.1 GCA947096245_00435 CDS open 21505-22281 _na     258_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
858 CAMUQP010000014.1 GCA947096245_00436 CDS open 22288-23022 _na     244_aa fabG 3-oxoacyl-ACP reductase FabG
859 CAMUQP010000014.1 GCA947096245_00437 CDS open 23240-25651 _na     803_aa 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring)
860 CAMUQP010000014.1 GCA947096245_00438 CDS open 25797-26351 _na     184_aa frr ribosome recycling factor
861 CAMUQP010000014.1 GCA947096245_00421 gene open 53-1660
862 CAMUQP010000014.1 GCA947096245_00422 gene open 1682-4762
863 CAMUQP010000014.1 GCA947096245_00423 gene open 5018-6640
864 CAMUQP010000014.1 GCA947096245_00424 gene open 6659-9736
865 CAMUQP010000014.1 GCA947096245_00425 gene open 9823-10032
866 CAMUQP010000014.1 GCA947096245_00426 gene open 10019-11674
867 CAMUQP010000014.1 GCA947096245_00427 gene open 11700-14807
868 CAMUQP010000014.1 GCA947096245_00428 gene open 15229-15684 nrdG
869 CAMUQP010000014.1 GCA947096245_00429 gene open 15774-17549 nrdD
870 CAMUQP010000014.1 GCA947096245_00430 gene open 17704-18054 rplS
871 CAMUQP010000014.1 GCA947096245_00431 gene open 18144-19196
872 CAMUQP010000014.1 GCA947096245_00432 gene open 19276-19881
873 CAMUQP010000014.1 GCA947096245_00433 gene open 19970-20728 tonB
874 CAMUQP010000014.1 GCA947096245_00434 gene open 20871-21494
875 CAMUQP010000014.1 GCA947096245_00435 gene open 21505-22281 rsmA
876 CAMUQP010000014.1 GCA947096245_00436 gene open 22288-23022 fabG
877 CAMUQP010000014.1 GCA947096245_00437 gene open 23240-25651
878 CAMUQP010000014.1 GCA947096245_00438 gene open 25797-26351 frr
879 CAMUQP010000015.1 GCA947096245_00439 CDS open 149-592 _na     147_aa djlA Co-chaperone DjlA N-terminal domain-containing protein
880 CAMUQP010000015.1 GCA947096245_00440 CDS open 619-3459 _na     946_aa Serine/threonine protein kinase
881 CAMUQP010000015.1 GCA947096245_00441 CDS open 3462-4547 _na     361_aa 3-deoxy-7-phosphoheptulonate synthase
882 CAMUQP010000015.1 GCA947096245_00442 CDS open 5012-5140 _na     42_aa hypothetical protein
883 CAMUQP010000015.1 GCA947096245_00443 CDS open 5688-7445 _na     585_aa recG ATP-dependent DNA helicase RecG
884 CAMUQP010000015.1 GCA947096245_00444 CDS open 7727-7930 _na     67_aa heavy-metal-associated domain-containing protein
885 CAMUQP010000015.1 GCA947096245_00445 CDS open 7935-10319 _na     794_aa Copper-translocating P-type ATPase
886 CAMUQP010000015.1 GCA947096245_00446 CDS open 10320-10709 _na     129_aa hypothetical protein
887 CAMUQP010000015.1 GCA947096245_00447 CDS open 10696-10872 _na     58_aa hypothetical protein
888 CAMUQP010000015.1 GCA947096245_00448 CDS open 11222-12988 _na     588_aa Heat-shock protein Hsp70
889 CAMUQP010000015.1 GCA947096245_00449 CDS open 13008-13379 _na     123_aa Four helix bundle protein
890 CAMUQP010000015.1 GCA947096245_00451 CDS open 13949-14197 _na     82_aa Acyl carrier protein
891 CAMUQP010000015.1 GCA947096245_00452 CDS open 14187-15098 _na     303_aa Lipid A biosynthesis acyltransferase
892 CAMUQP010000015.1 GCA947096245_00453 CDS open 15092-15316 _na     74_aa Uroporphyrinogen decarboxylase
893 CAMUQP010000015.1 GCA947096245_00454 CDS open 15316-16422 _na     368_aa ahpC Antioxidant AhpC
894 CAMUQP010000015.1 GCA947096245_00455 CDS open 16668-16934 _na     88_aa acpP acyl carrier protein
895 CAMUQP010000015.1 GCA947096245_00456 CDS open 17027-18277 _na     416_aa fabF beta-ketoacyl-ACP synthase II
896 CAMUQP010000015.1 GCA947096245_00457 CDS open 18278-19039 _na     253_aa Ribonuclease 3
897 CAMUQP010000015.1 GCA947096245_00458 CDS open 19042-19332 _na     96_aa clpS Clp protease ClpS
898 CAMUQP010000015.1 GCA947096245_00459 CDS open 19405-19878 _na     157_aa hypothetical protein
899 CAMUQP010000015.1 GCA947096245_00460 CDS open 20025-20627 _na     200_aa HTH cro/C1-type domain-containing protein
900 CAMUQP010000015.1 GCA947096245_00461 CDS open 20829-21077 _na     82_aa hypothetical protein
901 CAMUQP010000015.1 GCA947096245_00462 CDS open 21100-21492 _na     130_aa hypothetical protein
902 CAMUQP010000015.1 GCA947096245_00463 CDS open 21578-22495 _na     305_aa ompA OmpA family protein
903 CAMUQP010000015.1 GCA947096245_00464 CDS open 22512-22916 _na     134_aa djlA Co-chaperone DjlA N-terminal domain-containing protein
904 CAMUQP010000015.1 GCA947096245_00465 CDS open 22948-23238 _na     96_aa hypothetical protein
905 CAMUQP010000015.1 GCA947096245_00466 CDS open 23287-23484 _na     65_aa DUF4236 domain-containing protein
906 CAMUQP010000015.1 GCA947096245_00467 CDS open 23511-23663 _na     50_aa hypothetical protein
907 CAMUQP010000015.1 GCA947096245_00468 CDS open 23669-23917 _na     82_aa hypothetical protein
908 CAMUQP010000015.1 GCA947096245_00469 CDS open 23914-24327 _na     137_aa DUF6884 domain-containing protein
909 CAMUQP010000015.1 GCA947096245_00470 CDS open 24358-25002 _na     214_aa GIY-YIG domain-containing protein
910 CAMUQP010000015.1 GCA947096245_00471 CDS open 25043-25345 _na     100_aa hypothetical protein
911 CAMUQP010000015.1 GCA947096245_00439 gene open 149-592 djlA
912 CAMUQP010000015.1 GCA947096245_00440 gene open 619-3459
913 CAMUQP010000015.1 GCA947096245_00441 gene open 3462-4547
914 CAMUQP010000015.1 GCA947096245_00442 gene open 5012-5140
915 CAMUQP010000015.1 GCA947096245_00443 gene open 5688-7445 recG
916 CAMUQP010000015.1 GCA947096245_00444 gene open 7727-7930
917 CAMUQP010000015.1 GCA947096245_00445 gene open 7935-10319
918 CAMUQP010000015.1 GCA947096245_00446 gene open 10320-10709
919 CAMUQP010000015.1 GCA947096245_00447 gene open 10696-10872
920 CAMUQP010000015.1 GCA947096245_00448 gene open 11222-12988
921 CAMUQP010000015.1 GCA947096245_00449 gene open 13008-13379
922 CAMUQP010000015.1 GCA947096245_00451 gene open 13949-14197
923 CAMUQP010000015.1 GCA947096245_00452 gene open 14187-15098
924 CAMUQP010000015.1 GCA947096245_00453 gene open 15092-15316
925 CAMUQP010000015.1 GCA947096245_00454 gene open 15316-16422 ahpC
926 CAMUQP010000015.1 GCA947096245_00455 gene open 16668-16934 acpP
927 CAMUQP010000015.1 GCA947096245_00456 gene open 17027-18277 fabF
928 CAMUQP010000015.1 GCA947096245_00457 gene open 18278-19039
929 CAMUQP010000015.1 GCA947096245_00458 gene open 19042-19332 clpS
930 CAMUQP010000015.1 GCA947096245_00459 gene open 19405-19878
931 CAMUQP010000015.1 GCA947096245_00460 gene open 20025-20627
932 CAMUQP010000015.1 GCA947096245_00461 gene open 20829-21077
933 CAMUQP010000015.1 GCA947096245_00462 gene open 21100-21492
934 CAMUQP010000015.1 GCA947096245_00463 gene open 21578-22495 ompA
935 CAMUQP010000015.1 GCA947096245_00464 gene open 22512-22916 djlA
936 CAMUQP010000015.1 GCA947096245_00465 gene open 22948-23238
937 CAMUQP010000015.1 GCA947096245_00466 gene open 23287-23484
938 CAMUQP010000015.1 GCA947096245_00467 gene open 23511-23663
939 CAMUQP010000015.1 GCA947096245_00468 gene open 23669-23917
940 CAMUQP010000015.1 GCA947096245_00469 gene open 23914-24327
941 CAMUQP010000015.1 GCA947096245_00470 gene open 24358-25002
942 CAMUQP010000015.1 GCA947096245_00471 gene open 25043-25345
943 CAMUQP010000015.1 GCA947096245_00450 gene open 13612-13685 trnD
944 CAMUQP010000015.1 GCA947096245_00450 tRNA open 13612-13685 trnD tRNA-Asp(gtc)
945 CAMUQP010000016.1 GCA947096245_00472 CDS open 213-1304 _na     363_aa ychF redox-regulated ATPase YchF
946 CAMUQP010000016.1 GCA947096245_00473 CDS open 1414-2403 _na     329_aa ABC transporter substrate-binding protein
947 CAMUQP010000016.1 GCA947096245_00474 CDS open 2491-3792 _na     433_aa Fe-S oxidoreductase
948 CAMUQP010000016.1 GCA947096245_00475 CDS open 3948-5510 _na     520_aa hypothetical protein
949 CAMUQP010000016.1 GCA947096245_00476 CDS open 5804-6409 _na     201_aa TetR/AcrR family transcriptional regulator
950 CAMUQP010000016.1 GCA947096245_00477 CDS open 6431-7795 _na     454_aa Transporter
951 CAMUQP010000016.1 GCA947096245_00478 CDS open 7955-8773 _na     272_aa Bacterial surface protein 26-residue repeat
952 CAMUQP010000016.1 GCA947096245_00479 CDS open 8946-9806 _na     286_aa phosphatase PAP2 family protein
953 CAMUQP010000016.1 GCA947096245_00480 CDS open 10019-13828 _na     1269_aa rpoB DNA-directed RNA polymerase subunit beta
954 CAMUQP010000016.1 GCA947096245_00481 CDS open 14701-15183 _na     160_aa helix-turn-helix domain-containing protein
955 CAMUQP010000016.1 GCA947096245_00482 CDS open 15256-15594 _na     112_aa hypothetical protein
956 CAMUQP010000016.1 GCA947096245_00483 CDS open 15439-16197 _na     252_aa hypothetical protein
957 CAMUQP010000016.1 GCA947096245_00484 CDS open 16142-17074 _na     310_aa DUF6291 domain-containing protein
958 CAMUQP010000016.1 GCA947096245_00485 CDS open 17889-18341 _na     150_aa Carboxypeptidase regulator
959 CAMUQP010000016.1 GCA947096245_00486 CDS open 18347-18535 _na     62_aa hypothetical protein
960 CAMUQP010000016.1 GCA947096245_00487 CDS open 19071-19382 _na     103_aa hypothetical protein
961 CAMUQP010000016.1 GCA947096245_00488 CDS open 19602-20231 _na     209_aa Gam-like protein
962 CAMUQP010000016.1 GCA947096245_00489 CDS open 20253-20816 _na     187_aa Head decoration protein
963 CAMUQP010000016.1 GCA947096245_00490 CDS open 20884-21981 _na     365_aa Phage capsid protein
964 CAMUQP010000016.1 GCA947096245_00491 CDS open 21981-22301 _na     106_aa DUF6706 domain-containing protein
965 CAMUQP010000016.1 GCA947096245_00492 CDS open 22558-22902 _na     114_aa hypothetical protein
966 CAMUQP010000016.1 GCA947096245_00493 CDS open 23009-23443 _na     144_aa hypothetical protein
967 CAMUQP010000016.1 GCA947096245_00494 CDS open 23415-23924 _na     169_aa Peptidoglycan hydrolase
968 CAMUQP010000016.1 GCA947096245_00472 gene open 213-1304 ychF
969 CAMUQP010000016.1 GCA947096245_00473 gene open 1414-2403
970 CAMUQP010000016.1 GCA947096245_00474 gene open 2491-3792
971 CAMUQP010000016.1 GCA947096245_00475 gene open 3948-5510
972 CAMUQP010000016.1 GCA947096245_00476 gene open 5804-6409
973 CAMUQP010000016.1 GCA947096245_00477 gene open 6431-7795
974 CAMUQP010000016.1 GCA947096245_00478 gene open 7955-8773
975 CAMUQP010000016.1 GCA947096245_00479 gene open 8946-9806
976 CAMUQP010000016.1 GCA947096245_00480 gene open 10019-13828 rpoB
977 CAMUQP010000016.1 GCA947096245_00481 gene open 14701-15183
978 CAMUQP010000016.1 GCA947096245_00482 gene open 15256-15594
979 CAMUQP010000016.1 GCA947096245_00483 gene open 15439-16197
980 CAMUQP010000016.1 GCA947096245_00484 gene open 16142-17074
981 CAMUQP010000016.1 GCA947096245_00485 gene open 17889-18341
982 CAMUQP010000016.1 GCA947096245_00486 gene open 18347-18535
983 CAMUQP010000016.1 GCA947096245_00487 gene open 19071-19382
984 CAMUQP010000016.1 GCA947096245_00488 gene open 19602-20231
985 CAMUQP010000016.1 GCA947096245_00489 gene open 20253-20816
986 CAMUQP010000016.1 GCA947096245_00490 gene open 20884-21981
987 CAMUQP010000016.1 GCA947096245_00491 gene open 21981-22301
988 CAMUQP010000016.1 GCA947096245_00492 gene open 22558-22902
989 CAMUQP010000016.1 GCA947096245_00493 gene open 23009-23443
990 CAMUQP010000016.1 GCA947096245_00494 gene open 23415-23924
991 CAMUQP010000017.1 GCA947096245_00495 CDS open 327-776 _na     149_aa Lipoprotein
992 CAMUQP010000017.1 GCA947096245_00496 CDS open 888-2579 _na     563_aa dld D-lactate dehydrogenase
993 CAMUQP010000017.1 GCA947096245_00497 CDS open 2633-4597 _na     654_aa Cytochrome C biogenesis protein transmembrane domain-containing protein
994 CAMUQP010000017.1 GCA947096245_00498 CDS open 4617-5309 _na     230_aa porT PorT protein
995 CAMUQP010000017.1 GCA947096245_00499 CDS open 5316-6053 _na     245_aa ubiE bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE
996 CAMUQP010000017.1 GCA947096245_00500 CDS open 6231-7574 _na     447_aa DUF5723 domain-containing protein
997 CAMUQP010000017.1 GCA947096245_00501 CDS open 7756-8346 _na     196_aa nitroreductase family protein
998 CAMUQP010000017.1 GCA947096245_00502 CDS open 8534-8992 _na     152_aa hypothetical protein
999 CAMUQP010000017.1 GCA947096245_00503 CDS open 9051-9422 _na     123_aa Immunity protein 30 domain-containing protein
1000 CAMUQP010000017.1 GCA947096245_00504 CDS open 9614-11506 _na     630_aa abc-f ribosomal protection-like ABC-F family protein