HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_947097145.1)

Select a Genome:
BAKTA Annotations for GCA_947097145.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
163 2344677 1865 0 0 33
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3812 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3812 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAMUQX010000009.1 GCA947097145_00489 gene open 6649-7422
1002 CAMUQX010000009.1 GCA947097145_00490 gene open 7446-8354
1003 CAMUQX010000009.1 GCA947097145_00491 gene open 8396-9145
1004 CAMUQX010000009.1 GCA947097145_00492 gene open 9274-10044 surE
1005 CAMUQX010000009.1 GCA947097145_00493 gene open 10096-11238 lpxB
1006 CAMUQX010000009.1 GCA947097145_00494 gene open 11748-12383
1007 CAMUQX010000009.1 GCA947097145_00495 gene open 12419-13816
1008 CAMUQX010000009.1 GCA947097145_00496 gene open 13952-14620
1009 CAMUQX010000009.1 GCA947097145_00497 gene open 14671-16221
1010 CAMUQX010000009.1 GCA947097145_00498 gene open 16900-19737
1011 CAMUQX010000009.1 GCA947097145_00499 gene open 19745-20563
1012 CAMUQX010000009.1 GCA947097145_00500 gene open 20563-21582
1013 CAMUQX010000009.1 GCA947097145_00501 gene open 22202-23869
1014 CAMUQX010000009.1 GCA947097145_00502 gene open 24134-25576 tig
1015 CAMUQX010000009.1 GCA947097145_00503 gene open 26411-27100 clpP
1016 CAMUQX010000009.1 GCA947097145_00504 gene open 27081-28313 clpX
1017 CAMUQX010000009.1 GCA947097145_00505 gene open 28408-30591 recQ
1018 CAMUQX010000009.1 GCA947097145_00506 gene open 31233-32258
1019 CAMUQX010000009.1 GCA947097145_00507 gene open 32266-32880
1020 CAMUQX010000009.1 GCA947097145_00508 gene open 33233-34717 guaB
1021 CAMUQX010000009.1 GCA947097145_00509 gene open 34829-36256
1022 CAMUQX010000009.1 GCA947097145_00510 gene open 36273-37706 surA
1023 CAMUQX010000009.1 GCA947097145_00511 gene open 37703-39646 lptC
1024 CAMUQX010000009.1 GCA947097145_00512 gene open 39662-39934
1025 CAMUQX010000009.1 GCA947097145_00513 gene open 39948-41783 mutL
1026 CAMUQX010000009.1 GCA947097145_00514 gene open 41777-41914
1027 CAMUQX010000009.1 GCA947097145_00515 gene open 42005-43060
1028 CAMUQX010000009.1 GCA947097145_00516 gene open 43064-46255
1029 CAMUQX010000010.1 GCA947097145_00538 gene open 22307-22689 RNaseP_bact_a
1030 CAMUQX010000010.1 GCA947097145_00538 ncRNA open 22307-22689 Bacterial RNase P class A
1031 CAMUQX010000010.1 GCA947097145_00517 CDS open 2-1060 _na     352_aa hypothetical protein
1032 CAMUQX010000010.1 GCA947097145_00518 CDS open 1300-1785 _na     161_aa Protein SDA1
1033 CAMUQX010000010.1 GCA947097145_00519 CDS open 1782-2330 _na     182_aa HD domain-containing protein
1034 CAMUQX010000010.1 GCA947097145_00520 CDS open 2390-5227 _na     945_aa Kinase
1035 CAMUQX010000010.1 GCA947097145_00521 CDS open 5791-6750 _na     319_aa Putative K+-dependent Na+/Ca+ exchanger
1036 CAMUQX010000010.1 GCA947097145_00522 CDS open 6798-9068 _na     756_aa RCK C-terminal domain-containing protein
1037 CAMUQX010000010.1 GCA947097145_00523 CDS open 9341-10564 _na     407_aa pepT peptidase T
1038 CAMUQX010000010.1 GCA947097145_00524 CDS open 10568-10750 _na     60_aa hypothetical protein
1039 CAMUQX010000010.1 GCA947097145_00525 CDS open 10792-11601 _na     269_aa Nif3-like dinuclear metal center hexameric protein
1040 CAMUQX010000010.1 GCA947097145_00526 CDS open 11656-12477 _na     273_aa C4-type zinc ribbon domain-containing protein
1041 CAMUQX010000010.1 GCA947097145_00527 CDS open 12946-13395 _na     149_aa Type I restriction enzyme R protein N-terminal domain-containing protein
1042 CAMUQX010000010.1 GCA947097145_00528 CDS open 13625-14650 _na     341_aa holA DNA polymerase III subunit delta
1043 CAMUQX010000010.1 GCA947097145_00529 CDS open 15543-15980 _na     145_aa Transcriptional regulator
1044 CAMUQX010000010.1 GCA947097145_00530 CDS open 16115-16252 _na     45_aa hypothetical protein
1045 CAMUQX010000010.1 GCA947097145_00531 CDS open 16357-17256 _na     299_aa Dihydroorotate dehydrogenase B (NAD(+))%2C electron transfer subunit
1046 CAMUQX010000010.1 GCA947097145_00532 CDS open 17328-18236 _na     302_aa dihydroorotate dehydrogenase
1047 CAMUQX010000010.1 GCA947097145_00533 CDS open 18516-19604 _na     362_aa aroC chorismate synthase
1048 CAMUQX010000010.1 GCA947097145_00534 CDS open 19726-20430 _na     234_aa hypothetical protein
1049 CAMUQX010000010.1 GCA947097145_00536 CDS open 21298-21705 _na     135_aa DUF1232 domain-containing protein
1050 CAMUQX010000010.1 GCA947097145_00537 CDS open 21758-22180 _na     140_aa Positive regulator of sigma(E)%2C RseC/MucC
1051 CAMUQX010000010.1 GCA947097145_00539 CDS open 23314-25632 _na     772_aa Carboxypeptidase
1052 CAMUQX010000010.1 GCA947097145_00540 CDS open 26214-26414 _na     66_aa hypothetical protein
1053 CAMUQX010000010.1 GCA947097145_00541 CDS open 26459-28066 _na     535_aa Fimbrillin family protein
1054 CAMUQX010000010.1 GCA947097145_00542 CDS open 28479-28802 _na     107_aa Fis family transcriptional regulator
1055 CAMUQX010000010.1 GCA947097145_00543 CDS open 28864-30042 _na     392_aa hemW radical SAM family heme chaperone HemW
1056 CAMUQX010000010.1 GCA947097145_00544 CDS open 30319-32481 _na     720_aa tetQ Tetracycline resistance protein TetQ
1057 CAMUQX010000010.1 GCA947097145_00545 CDS open 32958-33704 _na     248_aa Undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase
1058 CAMUQX010000010.1 GCA947097145_00546 CDS open 33788-35110 _na     440_aa Suppressor of fused-like domain-containing protein
1059 CAMUQX010000010.1 GCA947097145_00547 CDS open 35152-35490 _na     112_aa hypothetical protein
1060 CAMUQX010000010.1 GCA947097145_00548 CDS open 35553-36767 _na     404_aa Uracil permease
1061 CAMUQX010000010.1 GCA947097145_00549 CDS open 36879-37892 _na     337_aa Iron compound ABC transporter%2C permease
1062 CAMUQX010000010.1 GCA947097145_00550 CDS open 37916-39034 _na     372_aa Fe/B12 periplasmic-binding domain-containing protein
1063 CAMUQX010000010.1 GCA947097145_00551 CDS open 39166-40632 _na     488_aa Dihydroorotate dehydrogenase
1064 CAMUQX010000010.1 GCA947097145_00552 CDS open 40942-42243 _na     433_aa MFS transporter%2C AGZA family%2C xanthine/uracil permease
1065 CAMUQX010000010.1 GCA947097145_00553 CDS open 42270-43052 _na     260_aa nudC NAD(+) diphosphatase
1066 CAMUQX010000010.1 GCA947097145_00554 CDS open 43089-44846 _na     585_aa 2'%2C3'-cyclic-nucleotide 2'-phosphodiesterase
1067 CAMUQX010000010.1 GCA947097145_00555 CDS open 44901-46163 _na     420_aa Type 9 secretion system plug protein N-terminal domain-containing protein
1068 CAMUQX010000010.1 GCA947097145_00556 CDS open 46176-46604 _na     142_aa Knr4/Smi1-like domain-containing protein
1069 CAMUQX010000010.1 GCA947097145_00517 gene open 2-1060
1070 CAMUQX010000010.1 GCA947097145_00518 gene open 1300-1785
1071 CAMUQX010000010.1 GCA947097145_00519 gene open 1782-2330
1072 CAMUQX010000010.1 GCA947097145_00520 gene open 2390-5227
1073 CAMUQX010000010.1 GCA947097145_00521 gene open 5791-6750
1074 CAMUQX010000010.1 GCA947097145_00522 gene open 6798-9068
1075 CAMUQX010000010.1 GCA947097145_00523 gene open 9341-10564 pepT
1076 CAMUQX010000010.1 GCA947097145_00524 gene open 10568-10750
1077 CAMUQX010000010.1 GCA947097145_00525 gene open 10792-11601
1078 CAMUQX010000010.1 GCA947097145_00526 gene open 11656-12477
1079 CAMUQX010000010.1 GCA947097145_00527 gene open 12946-13395
1080 CAMUQX010000010.1 GCA947097145_00528 gene open 13625-14650 holA
1081 CAMUQX010000010.1 GCA947097145_00529 gene open 15543-15980
1082 CAMUQX010000010.1 GCA947097145_00530 gene open 16115-16252
1083 CAMUQX010000010.1 GCA947097145_00531 gene open 16357-17256
1084 CAMUQX010000010.1 GCA947097145_00532 gene open 17328-18236
1085 CAMUQX010000010.1 GCA947097145_00533 gene open 18516-19604 aroC
1086 CAMUQX010000010.1 GCA947097145_00534 gene open 19726-20430
1087 CAMUQX010000010.1 GCA947097145_00536 gene open 21298-21705
1088 CAMUQX010000010.1 GCA947097145_00537 gene open 21758-22180
1089 CAMUQX010000010.1 GCA947097145_00539 gene open 23314-25632
1090 CAMUQX010000010.1 GCA947097145_00540 gene open 26214-26414
1091 CAMUQX010000010.1 GCA947097145_00541 gene open 26459-28066
1092 CAMUQX010000010.1 GCA947097145_00542 gene open 28479-28802
1093 CAMUQX010000010.1 GCA947097145_00543 gene open 28864-30042 hemW
1094 CAMUQX010000010.1 GCA947097145_00544 gene open 30319-32481 tetQ
1095 CAMUQX010000010.1 GCA947097145_00545 gene open 32958-33704
1096 CAMUQX010000010.1 GCA947097145_00546 gene open 33788-35110
1097 CAMUQX010000010.1 GCA947097145_00547 gene open 35152-35490
1098 CAMUQX010000010.1 GCA947097145_00548 gene open 35553-36767
1099 CAMUQX010000010.1 GCA947097145_00549 gene open 36879-37892
1100 CAMUQX010000010.1 GCA947097145_00550 gene open 37916-39034
1101 CAMUQX010000010.1 GCA947097145_00551 gene open 39166-40632
1102 CAMUQX010000010.1 GCA947097145_00552 gene open 40942-42243
1103 CAMUQX010000010.1 GCA947097145_00553 gene open 42270-43052 nudC
1104 CAMUQX010000010.1 GCA947097145_00554 gene open 43089-44846
1105 CAMUQX010000010.1 GCA947097145_00555 gene open 44901-46163
1106 CAMUQX010000010.1 GCA947097145_00556 gene open 46176-46604
1107 CAMUQX010000010.1 GCA947097145_00535 gene open 20933-21003 trnC
1108 CAMUQX010000010.1 GCA947097145_00535 tRNA open 20933-21003 trnC tRNA-Cys(gca)
1109 CAMUQX010000011.1 GCA947097145_00557 CDS open 55-672 _na     205_aa HTH tetR-type domain-containing protein
1110 CAMUQX010000011.1 GCA947097145_00558 CDS open 714-1955 _na     413_aa Lipoprotein
1111 CAMUQX010000011.1 GCA947097145_00559 CDS open 1979-4381 _na     800_aa Colicin I receptor
1112 CAMUQX010000011.1 GCA947097145_00560 CDS open 5090-6850 _na     586_aa aspS aspartate--tRNA ligase
1113 CAMUQX010000011.1 GCA947097145_00561 CDS open 7023-7304 _na     93_aa Winged helix-turn-helix domain-containing protein
1114 CAMUQX010000011.1 GCA947097145_00562 CDS open 7361-7690 _na     109_aa DNA-binding protein
1115 CAMUQX010000011.1 GCA947097145_00563 CDS open 7784-8851 _na     355_aa Mannose-1-phosphate guanylyltransferase
1116 CAMUQX010000011.1 GCA947097145_00564 CDS open 8906-9973 _na     355_aa gmd GDP-mannose 4%2C6-dehydratase
1117 CAMUQX010000011.1 GCA947097145_00565 CDS open 10427-11449 _na     340_aa Phytase-like domain-containing protein
1118 CAMUQX010000011.1 GCA947097145_00566 CDS open 11469-12158 _na     229_aa RNA polymerase sigma-70 domain-containing protein
1119 CAMUQX010000011.1 GCA947097145_00567 CDS open 12188-13417 _na     409_aa Tetratricopeptide repeat protein
1120 CAMUQX010000011.1 GCA947097145_00568 CDS open 13424-15145 _na     573_aa glutamine--tRNA ligase/YqeY domain fusion protein
1121 CAMUQX010000011.1 GCA947097145_00569 CDS open 15952-17232 _na     426_aa DUF6383 domain-containing protein
1122 CAMUQX010000011.1 GCA947097145_00570 CDS open 17388-17615 _na     75_aa hypothetical protein
1123 CAMUQX010000011.1 GCA947097145_00571 CDS open 17711-18274 _na     187_aa Putative flavoredoxin
1124 CAMUQX010000011.1 GCA947097145_00572 CDS open 18347-18610 _na     87_aa GlsB/YeaQ/YmgE family stress response membrane protein
1125 CAMUQX010000011.1 GCA947097145_00573 CDS open 18612-18860 _na     82_aa hypothetical protein
1126 CAMUQX010000011.1 GCA947097145_00574 CDS open 18857-19612 _na     251_aa Hydrolase
1127 CAMUQX010000011.1 GCA947097145_00575 CDS open 19628-20656 _na     342_aa Winged helix DNA-binding domain-containing protein
1128 CAMUQX010000011.1 GCA947097145_00576 CDS open 20835-21155 _na     106_aa Cupin domain-containing protein
1129 CAMUQX010000011.1 GCA947097145_00577 CDS open 21502-21630 _na     42_aa hypothetical protein
1130 CAMUQX010000011.1 GCA947097145_00578 CDS open 21616-21984 _na     122_aa DUF488 domain-containing protein
1131 CAMUQX010000011.1 GCA947097145_00579 CDS open 21968-23419 _na     483_aa Peptidase
1132 CAMUQX010000011.1 GCA947097145_00580 CDS open 23665-24270 _na     201_aa nrfH cytochrome c nitrite reductase small subunit
1133 CAMUQX010000011.1 GCA947097145_00581 CDS open 24283-25779 _na     498_aa nrfA ammonia-forming cytochrome c nitrite reductase
1134 CAMUQX010000011.1 GCA947097145_00582 CDS open 25827-27134 _na     435_aa ResB-like domain-containing protein
1135 CAMUQX010000011.1 GCA947097145_00583 CDS open 27131-27928 _na     265_aa Cytochrome c assembly protein domain-containing protein
1136 CAMUQX010000011.1 GCA947097145_00584 CDS open 27837-28013 _na     58_aa hypothetical protein
1137 CAMUQX010000011.1 GCA947097145_00585 CDS open 28061-28504 _na     147_aa Histidinol phosphate phosphatase
1138 CAMUQX010000011.1 GCA947097145_00586 CDS open 28777-29445 _na     222_aa HTH crp-type domain-containing protein
1139 CAMUQX010000011.1 GCA947097145_00587 CDS open 29540-31183 _na     547_aa hcp hydroxylamine reductase
1140 CAMUQX010000011.1 GCA947097145_00588 CDS open 31421-31804 _na     127_aa Glyoxalase/bleomycin resistance/extradiol dioxygenase family protein
1141 CAMUQX010000011.1 GCA947097145_00589 CDS open 31970-32131 _na     53_aa mshK MSHA biogenesis protein MshK
1142 CAMUQX010000011.1 GCA947097145_00590 CDS open 32128-32241 _na     37_aa hypothetical protein
1143 CAMUQX010000011.1 GCA947097145_00591 CDS open 32411-34609 _na     732_aa T9SS type A sorting domain-containing protein
1144 CAMUQX010000011.1 GCA947097145_00592 CDS open 35360-35968 _na     202_aa UbiE/COQ5 methyltransferase
1145 CAMUQX010000011.1 GCA947097145_00593 CDS open 36443-37102 _na     219_aa Nitroreductase
1146 CAMUQX010000011.1 GCA947097145_00594 CDS open 37196-38599 _na     467_aa mnmE tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE
1147 CAMUQX010000011.1 GCA947097145_00595 CDS open 38744-39616 _na     290_aa Uridine phosphorylase
1148 CAMUQX010000011.1 GCA947097145_00596 CDS open 39863-42217 _na     784_aa bifunctional dihydroorotate dehydrogenase B NAD binding subunit/NADPH-dependent glutamate synthase
1149 CAMUQX010000011.1 GCA947097145_00597 CDS open 42381-43670 _na     429_aa serS serine--tRNA ligase
1150 CAMUQX010000011.1 GCA947097145_00557 gene open 55-672
1151 CAMUQX010000011.1 GCA947097145_00558 gene open 714-1955
1152 CAMUQX010000011.1 GCA947097145_00559 gene open 1979-4381
1153 CAMUQX010000011.1 GCA947097145_00560 gene open 5090-6850 aspS
1154 CAMUQX010000011.1 GCA947097145_00561 gene open 7023-7304
1155 CAMUQX010000011.1 GCA947097145_00562 gene open 7361-7690
1156 CAMUQX010000011.1 GCA947097145_00563 gene open 7784-8851
1157 CAMUQX010000011.1 GCA947097145_00564 gene open 8906-9973 gmd
1158 CAMUQX010000011.1 GCA947097145_00565 gene open 10427-11449
1159 CAMUQX010000011.1 GCA947097145_00566 gene open 11469-12158
1160 CAMUQX010000011.1 GCA947097145_00567 gene open 12188-13417
1161 CAMUQX010000011.1 GCA947097145_00568 gene open 13424-15145
1162 CAMUQX010000011.1 GCA947097145_00569 gene open 15952-17232
1163 CAMUQX010000011.1 GCA947097145_00570 gene open 17388-17615
1164 CAMUQX010000011.1 GCA947097145_00571 gene open 17711-18274
1165 CAMUQX010000011.1 GCA947097145_00572 gene open 18347-18610
1166 CAMUQX010000011.1 GCA947097145_00573 gene open 18612-18860
1167 CAMUQX010000011.1 GCA947097145_00574 gene open 18857-19612
1168 CAMUQX010000011.1 GCA947097145_00575 gene open 19628-20656
1169 CAMUQX010000011.1 GCA947097145_00576 gene open 20835-21155
1170 CAMUQX010000011.1 GCA947097145_00577 gene open 21502-21630
1171 CAMUQX010000011.1 GCA947097145_00578 gene open 21616-21984
1172 CAMUQX010000011.1 GCA947097145_00579 gene open 21968-23419
1173 CAMUQX010000011.1 GCA947097145_00580 gene open 23665-24270 nrfH
1174 CAMUQX010000011.1 GCA947097145_00581 gene open 24283-25779 nrfA
1175 CAMUQX010000011.1 GCA947097145_00582 gene open 25827-27134
1176 CAMUQX010000011.1 GCA947097145_00583 gene open 27131-27928
1177 CAMUQX010000011.1 GCA947097145_00584 gene open 27837-28013
1178 CAMUQX010000011.1 GCA947097145_00585 gene open 28061-28504
1179 CAMUQX010000011.1 GCA947097145_00586 gene open 28777-29445
1180 CAMUQX010000011.1 GCA947097145_00587 gene open 29540-31183 hcp
1181 CAMUQX010000011.1 GCA947097145_00588 gene open 31421-31804
1182 CAMUQX010000011.1 GCA947097145_00589 gene open 31970-32131 mshK
1183 CAMUQX010000011.1 GCA947097145_00590 gene open 32128-32241
1184 CAMUQX010000011.1 GCA947097145_00591 gene open 32411-34609
1185 CAMUQX010000011.1 GCA947097145_00592 gene open 35360-35968
1186 CAMUQX010000011.1 GCA947097145_00593 gene open 36443-37102
1187 CAMUQX010000011.1 GCA947097145_00594 gene open 37196-38599 mnmE
1188 CAMUQX010000011.1 GCA947097145_00595 gene open 38744-39616
1189 CAMUQX010000011.1 GCA947097145_00596 gene open 39863-42217
1190 CAMUQX010000011.1 GCA947097145_00597 gene open 42381-43670 serS
1191 CAMUQX010000012.1 GCA947097145_00598 CDS open 421-1887 _na     488_aa Alkaline phosphatase
1192 CAMUQX010000012.1 GCA947097145_00599 CDS open 1902-2516 _na     204_aa Deoxynucleoside kinase domain-containing protein
1193 CAMUQX010000012.1 GCA947097145_00600 CDS open 2556-3176 _na     206_aa Deoxynucleoside kinase domain-containing protein
1194 CAMUQX010000012.1 GCA947097145_00601 CDS open 3267-4208 _na     313_aa trxB thioredoxin-disulfide reductase
1195 CAMUQX010000012.1 GCA947097145_00602 CDS open 5348-6199 _na     283_aa ATPase
1196 CAMUQX010000012.1 GCA947097145_00603 CDS open 6390-7064 _na     224_aa cpoB Ancillary SecYEG translocon subunit/Cell division coordinator CpoB TPR domain-containing protein
1197 CAMUQX010000012.1 GCA947097145_00604 CDS open 7078-7554 _na     158_aa ribH 6%2C7-dimethyl-8-ribityllumazine synthase
1198 CAMUQX010000012.1 GCA947097145_00605 CDS open 7577-7957 _na     126_aa yjbR YjbR protein
1199 CAMUQX010000012.1 GCA947097145_00606 CDS open 8432-10255 _na     607_aa lipA lipoyl synthase
1200 CAMUQX010000012.1 GCA947097145_00607 CDS open 10611-11684 _na     357_aa FMN-binding domain-containing protein
1201 CAMUQX010000012.1 GCA947097145_00608 CDS open 12119-12937 _na     272_aa panB 3-methyl-2-oxobutanoate hydroxymethyltransferase
1202 CAMUQX010000012.1 GCA947097145_00609 CDS open 12959-13609 _na     216_aa Putative HAD hydrolase family IA
1203 CAMUQX010000012.1 GCA947097145_00610 CDS open 13646-14410 _na     254_aa DUF3298 domain-containing protein
1204 CAMUQX010000012.1 GCA947097145_00611 CDS open 14424-15050 _na     208_aa rsmG 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG
1205 CAMUQX010000012.1 GCA947097145_00612 CDS open 15105-15749 _na     214_aa Metallo-beta-lactamase domain-containing protein
1206 CAMUQX010000012.1 GCA947097145_00613 CDS open 15754-16335 _na     193_aa ruvC crossover junction endodeoxyribonuclease RuvC
1207 CAMUQX010000012.1 GCA947097145_00614 CDS open 16459-16980 _na     173_aa DUF3347 domain-containing protein
1208 CAMUQX010000012.1 GCA947097145_00615 CDS open 17884-19038 _na     384_aa DNA-binding protein
1209 CAMUQX010000012.1 GCA947097145_00616 CDS open 19038-19325 _na     95_aa Integration host factor subunit alpha
1210 CAMUQX010000012.1 GCA947097145_00617 CDS open 19384-20685 _na     433_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
1211 CAMUQX010000012.1 GCA947097145_00618 CDS open 20749-21705 _na     318_aa ftsY signal recognition particle-docking protein FtsY
1212 CAMUQX010000012.1 GCA947097145_00619 CDS open 21717-22016 _na     99_aa Transposase
1213 CAMUQX010000012.1 GCA947097145_00620 CDS open 22193-22945 _na     250_aa kdsB 3-deoxy-manno-octulosonate cytidylyltransferase
1214 CAMUQX010000012.1 GCA947097145_00621 CDS open 22993-23970 _na     325_aa BioF2-like acetyltransferase domain-containing protein
1215 CAMUQX010000012.1 GCA947097145_00622 CDS open 24107-24880 _na     257_aa DUF2520 domain-containing protein
1216 CAMUQX010000012.1 GCA947097145_00623 CDS open 24917-25435 _na     172_aa 3-deoxy-D-manno-octulosonate 8-phosphate phosphatase
1217 CAMUQX010000012.1 GCA947097145_00624 CDS open 25517-26974 _na     485_aa S41 family peptidase
1218 CAMUQX010000012.1 GCA947097145_00625 CDS open 26982-27557 _na     191_aa dTTP/UTP pyrophosphatase
1219 CAMUQX010000012.1 GCA947097145_00626 CDS open 27611-28120 _na     169_aa Gamma carbonic anhydrase family protein
1220 CAMUQX010000012.1 GCA947097145_00628 CDS open 28520-29560 _na     346_aa pheS phenylalanine--tRNA ligase subunit alpha
1221 CAMUQX010000012.1 GCA947097145_00629 CDS open 29724-30578 _na     284_aa DUF4348 domain-containing protein
1222 CAMUQX010000012.1 GCA947097145_00630 CDS open 30631-31635 _na     334_aa murB UDP-N-acetylmuramate dehydrogenase
1223 CAMUQX010000012.1 GCA947097145_00631 CDS open 31645-32406 _na     253_aa Metallo-beta-lactamase domain-containing protein
1224 CAMUQX010000012.1 GCA947097145_00632 CDS open 32697-33314 _na     205_aa HTH tetR-type domain-containing protein
1225 CAMUQX010000012.1 GCA947097145_00633 CDS open 33395-34141 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
1226 CAMUQX010000012.1 GCA947097145_00634 CDS open 34208-34876 _na     222_aa Pseudouridine synthase RsuA/RluA-like domain-containing protein
1227 CAMUQX010000012.1 GCA947097145_00635 CDS open 34884-35150 _na     88_aa Phosphoglycolate phosphatase
1228 CAMUQX010000012.1 GCA947097145_00636 CDS open 35267-36025 _na     252_aa ydfG NADP-dependent L-serine/L-allo-threonine dehydrogenase ydfG
1229 CAMUQX010000012.1 GCA947097145_00598 gene open 421-1887
1230 CAMUQX010000012.1 GCA947097145_00599 gene open 1902-2516
1231 CAMUQX010000012.1 GCA947097145_00600 gene open 2556-3176
1232 CAMUQX010000012.1 GCA947097145_00601 gene open 3267-4208 trxB
1233 CAMUQX010000012.1 GCA947097145_00602 gene open 5348-6199
1234 CAMUQX010000012.1 GCA947097145_00603 gene open 6390-7064 cpoB
1235 CAMUQX010000012.1 GCA947097145_00604 gene open 7078-7554 ribH
1236 CAMUQX010000012.1 GCA947097145_00605 gene open 7577-7957 yjbR
1237 CAMUQX010000012.1 GCA947097145_00606 gene open 8432-10255 lipA
1238 CAMUQX010000012.1 GCA947097145_00607 gene open 10611-11684
1239 CAMUQX010000012.1 GCA947097145_00608 gene open 12119-12937 panB
1240 CAMUQX010000012.1 GCA947097145_00609 gene open 12959-13609
1241 CAMUQX010000012.1 GCA947097145_00610 gene open 13646-14410
1242 CAMUQX010000012.1 GCA947097145_00611 gene open 14424-15050 rsmG
1243 CAMUQX010000012.1 GCA947097145_00612 gene open 15105-15749
1244 CAMUQX010000012.1 GCA947097145_00613 gene open 15754-16335 ruvC
1245 CAMUQX010000012.1 GCA947097145_00614 gene open 16459-16980
1246 CAMUQX010000012.1 GCA947097145_00615 gene open 17884-19038
1247 CAMUQX010000012.1 GCA947097145_00616 gene open 19038-19325
1248 CAMUQX010000012.1 GCA947097145_00617 gene open 19384-20685 rimO
1249 CAMUQX010000012.1 GCA947097145_00618 gene open 20749-21705 ftsY
1250 CAMUQX010000012.1 GCA947097145_00619 gene open 21717-22016
1251 CAMUQX010000012.1 GCA947097145_00620 gene open 22193-22945 kdsB
1252 CAMUQX010000012.1 GCA947097145_00621 gene open 22993-23970
1253 CAMUQX010000012.1 GCA947097145_00622 gene open 24107-24880
1254 CAMUQX010000012.1 GCA947097145_00623 gene open 24917-25435
1255 CAMUQX010000012.1 GCA947097145_00624 gene open 25517-26974
1256 CAMUQX010000012.1 GCA947097145_00625 gene open 26982-27557
1257 CAMUQX010000012.1 GCA947097145_00626 gene open 27611-28120
1258 CAMUQX010000012.1 GCA947097145_00628 gene open 28520-29560 pheS
1259 CAMUQX010000012.1 GCA947097145_00629 gene open 29724-30578
1260 CAMUQX010000012.1 GCA947097145_00630 gene open 30631-31635 murB
1261 CAMUQX010000012.1 GCA947097145_00631 gene open 31645-32406
1262 CAMUQX010000012.1 GCA947097145_00632 gene open 32697-33314
1263 CAMUQX010000012.1 GCA947097145_00633 gene open 33395-34141 fabG
1264 CAMUQX010000012.1 GCA947097145_00634 gene open 34208-34876
1265 CAMUQX010000012.1 GCA947097145_00635 gene open 34884-35150
1266 CAMUQX010000012.1 GCA947097145_00636 gene open 35267-36025 ydfG
1267 CAMUQX010000013.1 GCA947097145_00637 CDS open 182-1735 _na     517_aa Competence protein
1268 CAMUQX010000013.1 GCA947097145_00638 CDS open 1760-2533 _na     257_aa truA tRNA pseudouridine(38-40) synthase TruA
1269 CAMUQX010000013.1 GCA947097145_00639 CDS open 2870-3757 _na     295_aa fabD ACP S-malonyltransferase
1270 CAMUQX010000013.1 GCA947097145_00640 CDS open 3893-5635 _na     580_aa Alpha-amylase
1271 CAMUQX010000013.1 GCA947097145_00641 CDS open 5639-6112 _na     157_aa Threonyl/alanyl tRNA synthetase SAD domain-containing protein
1272 CAMUQX010000013.1 GCA947097145_00642 CDS open 6223-6468 _na     81_aa Transposase
1273 CAMUQX010000013.1 GCA947097145_00643 CDS open 6471-6608 _na     45_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1274 CAMUQX010000013.1 GCA947097145_00644 CDS open 6615-7952 _na     445_aa DNA-damage-inducible protein F
1275 CAMUQX010000013.1 GCA947097145_00645 CDS open 8789-9568 _na     259_aa ZIP zinc transporter
1276 CAMUQX010000013.1 GCA947097145_00646 CDS open 9584-10501 _na     305_aa ychK Protein YchK
1277 CAMUQX010000013.1 GCA947097145_00647 CDS open 10534-11172 _na     212_aa Cation transporter
1278 CAMUQX010000013.1 GCA947097145_00648 CDS open 11262-12056 _na     264_aa Hydrolase HAD superfamily
1279 CAMUQX010000013.1 GCA947097145_00649 CDS open 12561-15698 _na     1045_aa prtT putative thiol protease/trypsin like proteinase PrtT
1280 CAMUQX010000013.1 GCA947097145_00650 CDS open 16011-16841 _na     276_aa 4Fe-4S ferredoxin-type domain-containing protein
1281 CAMUQX010000013.1 GCA947097145_00651 CDS open 16921-18687 _na     588_aa Peptidase M6-like domain-containing protein
1282 CAMUQX010000013.1 GCA947097145_00652 CDS open 18772-20172 _na     466_aa Chitobiase
1283 CAMUQX010000013.1 GCA947097145_00653 CDS open 20724-22667 _na     647_aa 4-alpha-glucanotransferase
1284 CAMUQX010000013.1 GCA947097145_00654 CDS open 22697-23947 _na     416_aa Glycosyltransferase family 1 protein
1285 CAMUQX010000013.1 GCA947097145_00655 CDS open 24009-25406 _na     465_aa Alpha-amylase
1286 CAMUQX010000013.1 GCA947097145_00656 CDS open 25884-26822 _na     312_aa DAGKc domain-containing protein
1287 CAMUQX010000013.1 GCA947097145_00657 CDS open 26849-27769 _na     306_aa miaA tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA
1288 CAMUQX010000013.1 GCA947097145_00658 CDS open 27863-28882 _na     339_aa gap type I glyceraldehyde-3-phosphate dehydrogenase
1289 CAMUQX010000013.1 GCA947097145_00659 CDS open 29107-29487 _na     126_aa mscL large-conductance mechanosensitive channel protein MscL
1290 CAMUQX010000013.1 GCA947097145_00660 CDS open 29898-31439 _na     513_aa guaA glutamine-hydrolyzing GMP synthase
1291 CAMUQX010000013.1 GCA947097145_00661 CDS open 31486-32283 _na     265_aa nucleotidyltransferase family protein
1292 CAMUQX010000013.1 GCA947097145_00662 CDS open 32397-33950 _na     517_aa Phosphotransferase
1293 CAMUQX010000013.1 GCA947097145_00663 CDS open 33950-34168 _na     72_aa Transporter
1294 CAMUQX010000013.1 GCA947097145_00665 CDS open 34659-35903 _na     414_aa Sigma-54 factor interaction domain-containing protein
1295 CAMUQX010000013.1 GCA947097145_00637 gene open 182-1735
1296 CAMUQX010000013.1 GCA947097145_00638 gene open 1760-2533 truA
1297 CAMUQX010000013.1 GCA947097145_00639 gene open 2870-3757 fabD
1298 CAMUQX010000013.1 GCA947097145_00640 gene open 3893-5635
1299 CAMUQX010000013.1 GCA947097145_00641 gene open 5639-6112
1300 CAMUQX010000013.1 GCA947097145_00642 gene open 6223-6468
1301 CAMUQX010000013.1 GCA947097145_00643 gene open 6471-6608
1302 CAMUQX010000013.1 GCA947097145_00644 gene open 6615-7952
1303 CAMUQX010000013.1 GCA947097145_00645 gene open 8789-9568
1304 CAMUQX010000013.1 GCA947097145_00646 gene open 9584-10501 ychK
1305 CAMUQX010000013.1 GCA947097145_00647 gene open 10534-11172
1306 CAMUQX010000013.1 GCA947097145_00648 gene open 11262-12056
1307 CAMUQX010000013.1 GCA947097145_00649 gene open 12561-15698 prtT
1308 CAMUQX010000013.1 GCA947097145_00650 gene open 16011-16841
1309 CAMUQX010000013.1 GCA947097145_00651 gene open 16921-18687
1310 CAMUQX010000013.1 GCA947097145_00652 gene open 18772-20172
1311 CAMUQX010000013.1 GCA947097145_00653 gene open 20724-22667
1312 CAMUQX010000013.1 GCA947097145_00654 gene open 22697-23947
1313 CAMUQX010000013.1 GCA947097145_00655 gene open 24009-25406
1314 CAMUQX010000013.1 GCA947097145_00656 gene open 25884-26822
1315 CAMUQX010000013.1 GCA947097145_00657 gene open 26849-27769 miaA
1316 CAMUQX010000013.1 GCA947097145_00658 gene open 27863-28882 gap
1317 CAMUQX010000013.1 GCA947097145_00659 gene open 29107-29487 mscL
1318 CAMUQX010000013.1 GCA947097145_00660 gene open 29898-31439 guaA
1319 CAMUQX010000013.1 GCA947097145_00661 gene open 31486-32283
1320 CAMUQX010000013.1 GCA947097145_00662 gene open 32397-33950
1321 CAMUQX010000013.1 GCA947097145_00663 gene open 33950-34168
1322 CAMUQX010000013.1 GCA947097145_00665 gene open 34659-35903
1323 CAMUQX010000014.1 GCA947097145_00666 CDS open 314-922 _na     202_aa ribonuclease HII
1324 CAMUQX010000014.1 GCA947097145_00667 CDS open 941-1843 _na     300_aa WYL domain-containing protein
1325 CAMUQX010000014.1 GCA947097145_00668 CDS open 2255-5257 _na     1000_aa ragA RagA protein
1326 CAMUQX010000014.1 GCA947097145_00669 CDS open 5294-6847 _na     517_aa RagB/SusD domain-containing protein
1327 CAMUQX010000014.1 GCA947097145_00670 CDS open 7058-10765 _na     1235_aa T9SS C-terminal target domain-containing protein
1328 CAMUQX010000014.1 GCA947097145_00671 CDS open 11005-14079 _na     1024_aa Outer membrane protein beta-barrel domain-containing protein
1329 CAMUQX010000014.1 GCA947097145_00672 CDS open 15322-16920 _na     532_aa Lipocalin-like domain-containing protein
1330 CAMUQX010000014.1 GCA947097145_00673 CDS open 16920-19292 _na     790_aa Peptidase S8/S53 domain-containing protein
1331 CAMUQX010000014.1 GCA947097145_00674 CDS open 19297-23007 _na     1236_aa DUF6383 domain-containing protein
1332 CAMUQX010000014.1 GCA947097145_00675 CDS open 23260-23355 _na     31_aa hypothetical protein
1333 CAMUQX010000014.1 GCA947097145_00676 CDS open 23357-23764 _na     135_aa Lipocalin-like domain-containing protein
1334 CAMUQX010000014.1 GCA947097145_00677 CDS open 24141-25826 _na     561_aa Carboxy-terminal processing protease
1335 CAMUQX010000014.1 GCA947097145_00678 CDS open 25940-26452 _na     170_aa Carboxypeptidase regulatory-like domain-containing protein
1336 CAMUQX010000014.1 GCA947097145_00679 CDS open 26600-28249 _na     549_aa Glycogen synthase
1337 CAMUQX010000014.1 GCA947097145_00680 CDS open 28315-30873 _na     852_aa Maltodextrin phosphorylase
1338 CAMUQX010000014.1 GCA947097145_00681 CDS open 31486-32193 _na     235_aa Ankyrin repeat domain-containing protein
1339 CAMUQX010000014.1 GCA947097145_00682 CDS open 32362-33072 _na     236_aa Ankyrin repeat domain-containing protein
1340 CAMUQX010000014.1 GCA947097145_00683 CDS open 33133-34494 _na     453_aa DUF4280 domain-containing protein
1341 CAMUQX010000014.1 GCA947097145_00684 CDS open 34491-35216 _na     241_aa hypothetical protein
1342 CAMUQX010000014.1 GCA947097145_00666 gene open 314-922
1343 CAMUQX010000014.1 GCA947097145_00667 gene open 941-1843
1344 CAMUQX010000014.1 GCA947097145_00668 gene open 2255-5257 ragA
1345 CAMUQX010000014.1 GCA947097145_00669 gene open 5294-6847
1346 CAMUQX010000014.1 GCA947097145_00670 gene open 7058-10765
1347 CAMUQX010000014.1 GCA947097145_00671 gene open 11005-14079
1348 CAMUQX010000014.1 GCA947097145_00672 gene open 15322-16920
1349 CAMUQX010000014.1 GCA947097145_00673 gene open 16920-19292
1350 CAMUQX010000014.1 GCA947097145_00674 gene open 19297-23007
1351 CAMUQX010000014.1 GCA947097145_00675 gene open 23260-23355
1352 CAMUQX010000014.1 GCA947097145_00676 gene open 23357-23764
1353 CAMUQX010000014.1 GCA947097145_00677 gene open 24141-25826
1354 CAMUQX010000014.1 GCA947097145_00678 gene open 25940-26452
1355 CAMUQX010000014.1 GCA947097145_00679 gene open 26600-28249
1356 CAMUQX010000014.1 GCA947097145_00680 gene open 28315-30873
1357 CAMUQX010000014.1 GCA947097145_00681 gene open 31486-32193
1358 CAMUQX010000014.1 GCA947097145_00682 gene open 32362-33072
1359 CAMUQX010000014.1 GCA947097145_00683 gene open 33133-34494
1360 CAMUQX010000014.1 GCA947097145_00684 gene open 34491-35216
1361 CAMUQX010000015.1 GCA947097145_00685 CDS open 343-2841 _na     832_aa Transglutaminase-like domain-containing protein
1362 CAMUQX010000015.1 GCA947097145_00686 CDS open 2961-4319 _na     452_aa hypothetical protein
1363 CAMUQX010000015.1 GCA947097145_00687 CDS open 4453-4545 _na     30_aa hypothetical protein
1364 CAMUQX010000015.1 GCA947097145_00688 CDS open 4520-5389 _na     289_aa prmA 50S ribosomal protein L11 methyltransferase
1365 CAMUQX010000015.1 GCA947097145_00689 CDS open 5316-6182 _na     288_aa Glycosyl hydrolase family 25
1366 CAMUQX010000015.1 GCA947097145_00690 CDS open 6218-7876 _na     552_aa diphosphate--fructose-6-phosphate 1-phosphotransferase
1367 CAMUQX010000015.1 GCA947097145_00691 CDS open 8080-8352 _na     90_aa rteC RteC protein
1368 CAMUQX010000015.1 GCA947097145_00692 CDS open 8354-8914 _na     186_aa Phospholipid/glycerol acyltransferase domain-containing protein
1369 CAMUQX010000015.1 GCA947097145_00693 CDS open 8914-11508 _na     864_aa Fibronectin type-III domain-containing protein
1370 CAMUQX010000015.1 GCA947097145_00694 CDS open 11554-11898 _na     114_aa hypothetical protein
1371 CAMUQX010000015.1 GCA947097145_00695 CDS open 12038-14119 _na     693_aa ygiQ YgiQ family radical SAM protein
1372 CAMUQX010000015.1 GCA947097145_00696 CDS open 14182-14826 _na     214_aa Phosphoglycolate phosphatase
1373 CAMUQX010000015.1 GCA947097145_00697 CDS open 15272-16084 _na     270_aa RNA polymerase subunit sigma
1374 CAMUQX010000015.1 GCA947097145_00698 CDS open 16259-17533 _na     424_aa rarA Recombination factor protein RarA
1375 CAMUQX010000015.1 GCA947097145_00699 CDS open 17539-18495 _na     318_aa 2-hydroxyacid dehydrogenase HI_1556
1376 CAMUQX010000015.1 GCA947097145_00700 CDS open 18526-19161 _na     211_aa Glycine transporter domain-containing protein
1377 CAMUQX010000015.1 GCA947097145_00702 CDS open 20059-21435 _na     458_aa Aromatic amino acid beta-eliminating lyase/threonine aldolase domain-containing protein
1378 CAMUQX010000015.1 GCA947097145_00703 CDS open 21392-21544 _na     50_aa hypothetical protein
1379 CAMUQX010000015.1 GCA947097145_00704 CDS open 21724-23106 _na     460_aa nhaD sodium:proton antiporter NhaD
1380 CAMUQX010000015.1 GCA947097145_00705 CDS open 23183-23668 _na     161_aa 8-oxo-dGTP diphosphatase
1381 CAMUQX010000015.1 GCA947097145_00706 CDS open 23659-24324 _na     221_aa B3/B4 tRNA-binding domain-containing protein
1382 CAMUQX010000015.1 GCA947097145_00707 CDS open 24334-26307 _na     657_aa ligA NAD-dependent DNA ligase LigA
1383 CAMUQX010000015.1 GCA947097145_00708 CDS open 26887-27789 _na     300_aa GYF domain-containing protein
1384 CAMUQX010000015.1 GCA947097145_00709 CDS open 27913-29358 _na     481_aa ffh signal recognition particle protein
1385 CAMUQX010000015.1 GCA947097145_00710 CDS open 29399-30283 _na     294_aa folD bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD
1386 CAMUQX010000015.1 GCA947097145_00711 CDS open 30365-30547 _na     60_aa Tetratricopeptide repeat protein
1387 CAMUQX010000015.1 GCA947097145_00712 CDS open 30561-30794 _na     77_aa Ferredoxin%2C 4Fe-4S
1388 CAMUQX010000015.1 GCA947097145_00713 CDS open 30798-31883 _na     361_aa 3-methyl-2-oxobutanoate dehydrogenase (Ferredoxin)
1389 CAMUQX010000015.1 GCA947097145_00714 CDS open 31976-32674 _na     232_aa Thiamine pyrophosphate enzyme TPP-binding domain-containing protein
1390 CAMUQX010000015.1 GCA947097145_00715 CDS open 32697-33245 _na     182_aa Pyruvate/ketoisovalerate oxidoreductase catalytic domain-containing protein
1391 CAMUQX010000015.1 GCA947097145_00716 CDS open 33508-34608 _na     366_aa OmpA-like domain-containing protein
1392 CAMUQX010000015.1 GCA947097145_00685 gene open 343-2841
1393 CAMUQX010000015.1 GCA947097145_00686 gene open 2961-4319
1394 CAMUQX010000015.1 GCA947097145_00687 gene open 4453-4545
1395 CAMUQX010000015.1 GCA947097145_00688 gene open 4520-5389 prmA
1396 CAMUQX010000015.1 GCA947097145_00689 gene open 5316-6182
1397 CAMUQX010000015.1 GCA947097145_00690 gene open 6218-7876
1398 CAMUQX010000015.1 GCA947097145_00691 gene open 8080-8352 rteC
1399 CAMUQX010000015.1 GCA947097145_00692 gene open 8354-8914
1400 CAMUQX010000015.1 GCA947097145_00693 gene open 8914-11508
1401 CAMUQX010000015.1 GCA947097145_00694 gene open 11554-11898
1402 CAMUQX010000015.1 GCA947097145_00695 gene open 12038-14119 ygiQ
1403 CAMUQX010000015.1 GCA947097145_00696 gene open 14182-14826
1404 CAMUQX010000015.1 GCA947097145_00697 gene open 15272-16084
1405 CAMUQX010000015.1 GCA947097145_00698 gene open 16259-17533 rarA
1406 CAMUQX010000015.1 GCA947097145_00699 gene open 17539-18495
1407 CAMUQX010000015.1 GCA947097145_00700 gene open 18526-19161
1408 CAMUQX010000015.1 GCA947097145_00702 gene open 20059-21435
1409 CAMUQX010000015.1 GCA947097145_00703 gene open 21392-21544
1410 CAMUQX010000015.1 GCA947097145_00704 gene open 21724-23106 nhaD
1411 CAMUQX010000015.1 GCA947097145_00705 gene open 23183-23668
1412 CAMUQX010000015.1 GCA947097145_00706 gene open 23659-24324
1413 CAMUQX010000015.1 GCA947097145_00707 gene open 24334-26307 ligA
1414 CAMUQX010000015.1 GCA947097145_00708 gene open 26887-27789
1415 CAMUQX010000015.1 GCA947097145_00709 gene open 27913-29358 ffh
1416 CAMUQX010000015.1 GCA947097145_00710 gene open 29399-30283 folD
1417 CAMUQX010000015.1 GCA947097145_00711 gene open 30365-30547
1418 CAMUQX010000015.1 GCA947097145_00712 gene open 30561-30794
1419 CAMUQX010000015.1 GCA947097145_00713 gene open 30798-31883
1420 CAMUQX010000015.1 GCA947097145_00714 gene open 31976-32674
1421 CAMUQX010000015.1 GCA947097145_00715 gene open 32697-33245
1422 CAMUQX010000015.1 GCA947097145_00716 gene open 33508-34608
1423 CAMUQX010000015.1 GCA947097145_00701 gene open 19277-19350 trnR
1424 CAMUQX010000015.1 GCA947097145_00701 tRNA open 19277-19350 trnR tRNA-Arg(acg)
1425 CAMUQX010000016.1 repeat_region open 26639-28151 CRISPR array with 20 repeats of length 47%2C consensus sequence GTTGTGATTAGCTTTAAAATTAGTATCTTTGCATTGGCAAATACAAC and spacer length 29
1426 CAMUQX010000016.1 GCA947097145_00717 CDS open 325-441 _na     38_aa hypothetical protein
1427 CAMUQX010000016.1 GCA947097145_00718 CDS open 1030-3204 _na     724_aa AAA+ ATPase domain-containing protein
1428 CAMUQX010000016.1 GCA947097145_00719 CDS open 3724-3933 _na     69_aa mshK MSHA biogenesis protein MshK
1429 CAMUQX010000016.1 GCA947097145_00720 CDS open 4071-4646 _na     191_aa Chromate transporter
1430 CAMUQX010000016.1 GCA947097145_00721 CDS open 4649-5263 _na     204_aa Chromate transporter
1431 CAMUQX010000016.1 GCA947097145_00722 CDS open 5266-9018 _na     1250_aa purL phosphoribosylformylglycinamidine synthase
1432 CAMUQX010000016.1 GCA947097145_00723 CDS open 9267-9392 _na     41_aa hypothetical protein
1433 CAMUQX010000016.1 GCA947097145_00724 CDS open 9804-10190 _na     128_aa Metal-dependent hydrolase
1434 CAMUQX010000016.1 GCA947097145_00725 CDS open 10306-11184 _na     292_aa yicC YicC family protein
1435 CAMUQX010000016.1 GCA947097145_00726 CDS open 11196-11768 _na     190_aa gmk guanylate kinase
1436 CAMUQX010000016.1 GCA947097145_00727 CDS open 11776-12357 _na     193_aa nadD nicotinate (nicotinamide) nucleotide adenylyltransferase
1437 CAMUQX010000016.1 GCA947097145_00728 CDS open 12403-13863 _na     486_aa wzxC Lipopolysaccharide biosynthesis protein WzxC
1438 CAMUQX010000016.1 GCA947097145_00729 CDS open 13931-14890 _na     319_aa putative glycosyl transferase family 2
1439 CAMUQX010000016.1 GCA947097145_00730 CDS open 14904-16340 _na     478_aa gtrA GtrA family protein
1440 CAMUQX010000016.1 GCA947097145_00731 CDS open 16337-17686 _na     449_aa DUF6080 domain-containing protein
1441 CAMUQX010000016.1 GCA947097145_00732 CDS open 17772-18734 _na     320_aa putative HAD-superfamily hydrolase
1442 CAMUQX010000016.1 GCA947097145_00733 CDS open 18736-19614 _na     292_aa decaprenyl-phosphate phosphoribosyltransferase
1443 CAMUQX010000016.1 GCA947097145_00734 CDS open 19619-20641 _na     340_aa Acyltransferase 3 domain-containing protein
1444 CAMUQX010000016.1 GCA947097145_00735 CDS open 20643-21782 _na     379_aa Acyltransferase 3 domain-containing protein
1445 CAMUQX010000016.1 GCA947097145_00736 CDS open 21809-23656 _na     615_aa Sulfatase N-terminal domain-containing protein
1446 CAMUQX010000016.1 GCA947097145_00737 CDS open 23906-24124 _na     72_aa hypothetical protein
1447 CAMUQX010000016.1 GCA947097145_00738 CDS open 26045-26173 _na     42_aa hypothetical protein
1448 CAMUQX010000016.1 GCA947097145_00739 CDS open 28262-28558 _na     98_aa cas2 CRISPR-associated endonuclease Cas2
1449 CAMUQX010000016.1 GCA947097145_00740 CDS open 28610-29542 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
1450 CAMUQX010000016.1 GCA947097145_00741 CDS open 29555-33697 _na     1380_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1451 CAMUQX010000016.1 GCA947097145_00717 gene open 325-441
1452 CAMUQX010000016.1 GCA947097145_00718 gene open 1030-3204
1453 CAMUQX010000016.1 GCA947097145_00719 gene open 3724-3933 mshK
1454 CAMUQX010000016.1 GCA947097145_00720 gene open 4071-4646
1455 CAMUQX010000016.1 GCA947097145_00721 gene open 4649-5263
1456 CAMUQX010000016.1 GCA947097145_00722 gene open 5266-9018 purL
1457 CAMUQX010000016.1 GCA947097145_00723 gene open 9267-9392
1458 CAMUQX010000016.1 GCA947097145_00724 gene open 9804-10190
1459 CAMUQX010000016.1 GCA947097145_00725 gene open 10306-11184 yicC
1460 CAMUQX010000016.1 GCA947097145_00726 gene open 11196-11768 gmk
1461 CAMUQX010000016.1 GCA947097145_00727 gene open 11776-12357 nadD
1462 CAMUQX010000016.1 GCA947097145_00728 gene open 12403-13863 wzxC
1463 CAMUQX010000016.1 GCA947097145_00729 gene open 13931-14890
1464 CAMUQX010000016.1 GCA947097145_00730 gene open 14904-16340 gtrA
1465 CAMUQX010000016.1 GCA947097145_00731 gene open 16337-17686
1466 CAMUQX010000016.1 GCA947097145_00732 gene open 17772-18734
1467 CAMUQX010000016.1 GCA947097145_00733 gene open 18736-19614
1468 CAMUQX010000016.1 GCA947097145_00734 gene open 19619-20641
1469 CAMUQX010000016.1 GCA947097145_00735 gene open 20643-21782
1470 CAMUQX010000016.1 GCA947097145_00736 gene open 21809-23656
1471 CAMUQX010000016.1 GCA947097145_00737 gene open 23906-24124
1472 CAMUQX010000016.1 GCA947097145_00738 gene open 26045-26173
1473 CAMUQX010000016.1 GCA947097145_00739 gene open 28262-28558 cas2
1474 CAMUQX010000016.1 GCA947097145_00740 gene open 28610-29542 cas1
1475 CAMUQX010000016.1 GCA947097145_00741 gene open 29555-33697 cas9
1476 CAMUQX010000017.1 GCA947097145_00742 CDS open 227-574 _na     115_aa hypothetical protein
1477 CAMUQX010000017.1 GCA947097145_00743 CDS open 1000-2034 _na     344_aa Outer membrane protein SusF/SusE-like C-terminal domain-containing protein
1478 CAMUQX010000017.1 GCA947097145_00744 CDS open 2063-3247 _na     394_aa susE SusE outer membrane protein domain-containing protein
1479 CAMUQX010000017.1 GCA947097145_00745 CDS open 3305-4939 _na     544_aa RagB/SusD domain-containing protein
1480 CAMUQX010000017.1 GCA947097145_00746 CDS open 4963-8046 _na     1027_aa TonB-dependent receptor plug domain-containing protein
1481 CAMUQX010000017.1 GCA947097145_00747 CDS open 8321-9346 _na     341_aa lacI LacI family transcriptional regulator
1482 CAMUQX010000017.1 GCA947097145_00748 CDS open 9399-10736 _na     445_aa MFS transporter
1483 CAMUQX010000017.1 GCA947097145_00749 CDS open 11057-13081 _na     674_aa SIR2 family protein
1484 CAMUQX010000017.1 GCA947097145_00750 CDS open 13720-14880 _na     386_aa oprP Phosphate-specific outer membrane porin OprP
1485 CAMUQX010000017.1 GCA947097145_00751 CDS open 14982-15773 _na     263_aa pgpB Acid phosphatase
1486 CAMUQX010000017.1 GCA947097145_00752 CDS open 15924-19106 _na     1060_aa fliS Flagellar protein FliS
1487 CAMUQX010000017.1 GCA947097145_00753 CDS open 19377-19607 _na     76_aa Secreted protein
1488 CAMUQX010000017.1 GCA947097145_00754 CDS open 19818-20744 _na     308_aa Thioredoxin domain-containing protein
1489 CAMUQX010000017.1 GCA947097145_00755 CDS open 20756-22492 _na     578_aa putative ABC transporter ATP-binding protein
1490 CAMUQX010000017.1 GCA947097145_00756 CDS open 22542-23429 _na     295_aa NAD kinase
1491 CAMUQX010000017.1 GCA947097145_00757 CDS open 23666-24235 _na     189_aa DJ-1 family glyoxalase III
1492 CAMUQX010000017.1 GCA947097145_00758 CDS open 24261-24935 _na     224_aa 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase
1493 CAMUQX010000017.1 GCA947097145_00759 CDS open 24957-27053 _na     698_aa recG ATP-dependent DNA helicase RecG
1494 CAMUQX010000017.1 GCA947097145_00760 CDS open 27320-28321 _na     333_aa lysM LysM peptidoglycan-binding domain-containing protein
1495 CAMUQX010000017.1 GCA947097145_00761 CDS open 28744-29589 _na     281_aa GLPGLI family protein
1496 CAMUQX010000017.1 GCA947097145_00762 CDS open 29603-32212 _na     869_aa TonB-dependent receptor
1497 CAMUQX010000017.1 GCA947097145_00742 gene open 227-574
1498 CAMUQX010000017.1 GCA947097145_00743 gene open 1000-2034
1499 CAMUQX010000017.1 GCA947097145_00744 gene open 2063-3247 susE
1500 CAMUQX010000017.1 GCA947097145_00745 gene open 3305-4939