HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella intermedia (GCA_947097145.1)

Select a Genome:
BAKTA Annotations for GCA_947097145.1
Genome Selected: Prevotella intermedia
ContigsBases CDSrRNA tmRNAtRNA
163 2344677 1865 0 0 33
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3812 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:7]    |    Number of Records Found: 3812 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
3001 CAMUQX010000070.1 GCA947097145_01506 gene open 4307-6460
3002 CAMUQX010000070.1 GCA947097145_01507 gene open 6513-7973
3003 CAMUQX010000070.1 GCA947097145_01508 gene open 8025-9296 mraY
3004 CAMUQX010000070.1 GCA947097145_01509 gene open 9186-9716
3005 CAMUQX010000071.1 GCA947097145_01511 CDS open 210-2726 _na     838_aa TonB-dependent receptor
3006 CAMUQX010000071.1 GCA947097145_01512 CDS open 2896-3477 _na     193_aa DUF417 domain-containing protein
3007 CAMUQX010000071.1 GCA947097145_01513 CDS open 3945-8396 _na     1483_aa Fibronectin type-III domain-containing protein
3008 CAMUQX010000071.1 GCA947097145_01514 CDS open 8422-8700 _na     92_aa hypothetical protein
3009 CAMUQX010000071.1 GCA947097145_01515 CDS open 8736-9506 _na     256_aa OmpR/PhoB-type domain-containing protein
3010 CAMUQX010000071.1 GCA947097145_01511 gene open 210-2726
3011 CAMUQX010000071.1 GCA947097145_01512 gene open 2896-3477
3012 CAMUQX010000071.1 GCA947097145_01513 gene open 3945-8396
3013 CAMUQX010000071.1 GCA947097145_01514 gene open 8422-8700
3014 CAMUQX010000071.1 GCA947097145_01515 gene open 8736-9506
3015 CAMUQX010000071.1 GCA947097145_01510 gene open 2-73 trnR
3016 CAMUQX010000071.1 GCA947097145_01510 tRNA open 2-73 trnR tRNA-Arg(cct)
3017 CAMUQX010000072.1 GCA947097145_01516 CDS open 222-2192 _na     656_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
3018 CAMUQX010000072.1 GCA947097145_01517 CDS open 2288-3154 _na     288_aa HTH araC/xylS-type domain-containing protein
3019 CAMUQX010000072.1 GCA947097145_01518 CDS open 3095-3262 _na     55_aa hypothetical protein
3020 CAMUQX010000072.1 GCA947097145_01519 CDS open 3512-6328 _na     938_aa Peptidase M16
3021 CAMUQX010000072.1 GCA947097145_01520 CDS open 6982-9171 _na     729_aa Glutamine synthetase type III N terminal
3022 CAMUQX010000072.1 GCA947097145_01516 gene open 222-2192 gyrB
3023 CAMUQX010000072.1 GCA947097145_01517 gene open 2288-3154
3024 CAMUQX010000072.1 GCA947097145_01518 gene open 3095-3262
3025 CAMUQX010000072.1 GCA947097145_01519 gene open 3512-6328
3026 CAMUQX010000072.1 GCA947097145_01520 gene open 6982-9171
3027 CAMUQX010000073.1 GCA947097145_01521 CDS open 73-228 _na     51_aa hypothetical protein
3028 CAMUQX010000073.1 GCA947097145_01522 CDS open 370-1314 _na     314_aa phage/plasmid replication protein
3029 CAMUQX010000073.1 GCA947097145_01523 CDS open 1367-1891 _na     174_aa Solute-binding protein family 3/N-terminal domain-containing protein
3030 CAMUQX010000073.1 GCA947097145_01524 CDS open 1888-2178 _na     96_aa helix-turn-helix domain-containing protein
3031 CAMUQX010000073.1 GCA947097145_01525 CDS open 2410-3066 _na     218_aa hypothetical protein
3032 CAMUQX010000073.1 GCA947097145_01526 CDS open 3068-4297 _na     409_aa site-specific integrase
3033 CAMUQX010000073.1 GCA947097145_01527 CDS open 4659-5180 _na     173_aa Putative DNA mismatch endonuclease Vsr
3034 CAMUQX010000073.1 GCA947097145_01528 CDS open 5740-6504 _na     254_aa UDP-2%2C3-diacylglucosamine diphosphatase
3035 CAMUQX010000073.1 GCA947097145_01529 CDS open 6560-6880 _na     106_aa FeS assembly SUF system protein
3036 CAMUQX010000073.1 GCA947097145_01530 CDS open 6987-9074 _na     695_aa TonB-dependent receptor
3037 CAMUQX010000073.1 GCA947097145_01521 gene open 73-228
3038 CAMUQX010000073.1 GCA947097145_01522 gene open 370-1314
3039 CAMUQX010000073.1 GCA947097145_01523 gene open 1367-1891
3040 CAMUQX010000073.1 GCA947097145_01524 gene open 1888-2178
3041 CAMUQX010000073.1 GCA947097145_01525 gene open 2410-3066
3042 CAMUQX010000073.1 GCA947097145_01526 gene open 3068-4297
3043 CAMUQX010000073.1 GCA947097145_01527 gene open 4659-5180
3044 CAMUQX010000073.1 GCA947097145_01528 gene open 5740-6504
3045 CAMUQX010000073.1 GCA947097145_01529 gene open 6560-6880
3046 CAMUQX010000073.1 GCA947097145_01530 gene open 6987-9074
3047 CAMUQX010000074.1 GCA947097145_01531 CDS open 245-2164 _na     639_aa Internalin-related protein
3048 CAMUQX010000074.1 GCA947097145_01533 CDS open 3609-4547 _na     312_aa Lipocalin-like domain-containing protein
3049 CAMUQX010000074.1 GCA947097145_01534 CDS open 4791-7154 _na     787_aa Peptidase
3050 CAMUQX010000074.1 GCA947097145_01531 gene open 245-2164
3051 CAMUQX010000074.1 GCA947097145_01533 gene open 3609-4547
3052 CAMUQX010000074.1 GCA947097145_01534 gene open 4791-7154
3053 CAMUQX010000074.1 GCA947097145_01532 gene open 2635-2708 trnN
3054 CAMUQX010000074.1 GCA947097145_01532 tRNA open 2635-2708 trnN tRNA-Asn(gtt)
3055 CAMUQX010000075.1 GCA947097145_01542 gene open 7096-7284 Bacteroidales-1
3056 CAMUQX010000075.1 GCA947097145_01542 ncRNA open 7096-7284 Bacteroidales-1 6S-Bacteroidales RNA suggested
3057 CAMUQX010000075.1 GCA947097145_01535 CDS open 8-565 _na     185_aa 30S ribosomal protein S16
3058 CAMUQX010000075.1 GCA947097145_01536 CDS open 632-955 _na     107_aa hypothetical protein
3059 CAMUQX010000075.1 GCA947097145_01537 CDS open 1150-2235 _na     361_aa gcvT glycine cleavage system aminomethyltransferase GcvT
3060 CAMUQX010000075.1 GCA947097145_01538 CDS open 2322-2702 _na     126_aa gcvH glycine cleavage system protein GcvH
3061 CAMUQX010000075.1 GCA947097145_01539 CDS open 2818-4128 _na     436_aa gcvPA aminomethyl-transferring glycine dehydrogenase subunit GcvPA
3062 CAMUQX010000075.1 GCA947097145_01540 CDS open 4178-5656 _na     492_aa gcvPB aminomethyl-transferring glycine dehydrogenase subunit GcvPB
3063 CAMUQX010000075.1 GCA947097145_01541 CDS open 5677-7035 _na     452_aa lpdA dihydrolipoyl dehydrogenase
3064 CAMUQX010000075.1 GCA947097145_01543 CDS open 7399-8004 _na     201_aa riboflavin synthase
3065 CAMUQX010000075.1 GCA947097145_01544 CDS open 8127-8615 _na     162_aa tonB TonB C-terminal domain-containing protein
3066 CAMUQX010000075.1 GCA947097145_01535 gene open 8-565
3067 CAMUQX010000075.1 GCA947097145_01536 gene open 632-955
3068 CAMUQX010000075.1 GCA947097145_01537 gene open 1150-2235 gcvT
3069 CAMUQX010000075.1 GCA947097145_01538 gene open 2322-2702 gcvH
3070 CAMUQX010000075.1 GCA947097145_01539 gene open 2818-4128 gcvPA
3071 CAMUQX010000075.1 GCA947097145_01540 gene open 4178-5656 gcvPB
3072 CAMUQX010000075.1 GCA947097145_01541 gene open 5677-7035 lpdA
3073 CAMUQX010000075.1 GCA947097145_01543 gene open 7399-8004
3074 CAMUQX010000075.1 GCA947097145_01544 gene open 8127-8615 tonB
3075 CAMUQX010000076.1 GCA947097145_01545 CDS open 485-1801 _na     438_aa DEAD/DEAH box helicase
3076 CAMUQX010000076.1 GCA947097145_01546 CDS open 1788-2957 _na     389_aa TPR domain protein
3077 CAMUQX010000076.1 GCA947097145_01547 CDS open 2996-4108 _na     370_aa Tetratricopeptide repeat protein
3078 CAMUQX010000076.1 GCA947097145_01548 CDS open 4265-5518 _na     417_aa TPR domain protein
3079 CAMUQX010000076.1 GCA947097145_01549 CDS open 5613-8234 _na     873_aa gyrA DNA gyrase subunit A
3080 CAMUQX010000076.1 GCA947097145_01545 gene open 485-1801
3081 CAMUQX010000076.1 GCA947097145_01546 gene open 1788-2957
3082 CAMUQX010000076.1 GCA947097145_01547 gene open 2996-4108
3083 CAMUQX010000076.1 GCA947097145_01548 gene open 4265-5518
3084 CAMUQX010000076.1 GCA947097145_01549 gene open 5613-8234 gyrA
3085 CAMUQX010000077.1 GCA947097145_01550 CDS open 275-430 _na     51_aa hypothetical protein
3086 CAMUQX010000077.1 GCA947097145_01551 CDS open 653-1201 _na     182_aa cinA C-terminal domain of CinA type S
3087 CAMUQX010000077.1 GCA947097145_01552 CDS open 1214-2248 _na     344_aa tsaD tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD
3088 CAMUQX010000077.1 GCA947097145_01553 CDS open 2341-3204 _na     287_aa map type I methionyl aminopeptidase
3089 CAMUQX010000077.1 GCA947097145_01554 CDS open 4278-5717 _na     479_aa Leucine-rich repeat domain-containing protein
3090 CAMUQX010000077.1 GCA947097145_01555 CDS open 6112-6234 _na     40_aa hypothetical protein
3091 CAMUQX010000077.1 GCA947097145_01556 CDS open 6721-8295 _na     524_aa Hemerythrin-like domain-containing protein
3092 CAMUQX010000077.1 GCA947097145_01550 gene open 275-430
3093 CAMUQX010000077.1 GCA947097145_01551 gene open 653-1201 cinA
3094 CAMUQX010000077.1 GCA947097145_01552 gene open 1214-2248 tsaD
3095 CAMUQX010000077.1 GCA947097145_01553 gene open 2341-3204 map
3096 CAMUQX010000077.1 GCA947097145_01554 gene open 4278-5717
3097 CAMUQX010000077.1 GCA947097145_01555 gene open 6112-6234
3098 CAMUQX010000077.1 GCA947097145_01556 gene open 6721-8295
3099 CAMUQX010000078.1 GCA947097145_01557 CDS open 268-519 _na     83_aa type B 50S ribosomal protein L31
3100 CAMUQX010000078.1 GCA947097145_01558 CDS open 644-1582 _na     312_aa Endonuclease
3101 CAMUQX010000078.1 GCA947097145_01559 CDS open 1450-1881 _na     143_aa hypothetical protein
3102 CAMUQX010000078.1 GCA947097145_01560 CDS open 1942-2763 _na     273_aa Lipoprotein
3103 CAMUQX010000078.1 GCA947097145_01561 CDS open 3108-5072 _na     654_aa Hemin-binding protein
3104 CAMUQX010000078.1 GCA947097145_01562 CDS open 5099-5254 _na     51_aa hypothetical protein
3105 CAMUQX010000078.1 GCA947097145_01563 CDS open 5402-7360 _na     652_aa Hemin-binding protein
3106 CAMUQX010000078.1 GCA947097145_01564 CDS open 7607-8161 _na     184_aa Glutathione peroxidase
3107 CAMUQX010000078.1 GCA947097145_01557 gene open 268-519
3108 CAMUQX010000078.1 GCA947097145_01558 gene open 644-1582
3109 CAMUQX010000078.1 GCA947097145_01559 gene open 1450-1881
3110 CAMUQX010000078.1 GCA947097145_01560 gene open 1942-2763
3111 CAMUQX010000078.1 GCA947097145_01561 gene open 3108-5072
3112 CAMUQX010000078.1 GCA947097145_01562 gene open 5099-5254
3113 CAMUQX010000078.1 GCA947097145_01563 gene open 5402-7360
3114 CAMUQX010000078.1 GCA947097145_01564 gene open 7607-8161
3115 CAMUQX010000079.1 GCA947097145_01565 CDS open 33-308 _na     91_aa hypothetical protein
3116 CAMUQX010000079.1 GCA947097145_01567 CDS open 1030-2283 _na     417_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
3117 CAMUQX010000079.1 GCA947097145_01568 CDS open 2302-2700 _na     132_aa Phospholipase
3118 CAMUQX010000079.1 GCA947097145_01569 CDS open 2772-6323 _na     1183_aa Tetratricopeptide repeat protein
3119 CAMUQX010000079.1 GCA947097145_01570 CDS open 6396-7991 _na     531_aa Response regulatory domain-containing protein
3120 CAMUQX010000079.1 GCA947097145_01565 gene open 33-308
3121 CAMUQX010000079.1 GCA947097145_01567 gene open 1030-2283 aroA
3122 CAMUQX010000079.1 GCA947097145_01568 gene open 2302-2700
3123 CAMUQX010000079.1 GCA947097145_01569 gene open 2772-6323
3124 CAMUQX010000079.1 GCA947097145_01570 gene open 6396-7991
3125 CAMUQX010000079.1 GCA947097145_01566 gene open 797-871 trnP
3126 CAMUQX010000079.1 GCA947097145_01566 tRNA open 797-871 trnP tRNA-Pro(ggg)
3127 CAMUQX010000080.1 GCA947097145_01571 CDS open 379-2160 _na     593_aa abc-f ribosomal protection-like ABC-F family protein
3128 CAMUQX010000080.1 GCA947097145_01572 CDS open 2164-2778 _na     204_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
3129 CAMUQX010000080.1 GCA947097145_01573 CDS open 2789-4180 _na     463_aa glmM phosphoglucosamine mutase
3130 CAMUQX010000080.1 GCA947097145_01574 CDS open 4246-4884 _na     212_aa DUF4827 domain-containing protein
3131 CAMUQX010000080.1 GCA947097145_01575 CDS open 5101-7488 _na     795_aa Ferric aerobactin receptor
3132 CAMUQX010000080.1 GCA947097145_01576 CDS open 7597-7761 _na     54_aa rubredoxin
3133 CAMUQX010000080.1 GCA947097145_01577 CDS open 7800-7991 _na     63_aa hypothetical protein
3134 CAMUQX010000080.1 GCA947097145_01571 gene open 379-2160 abc-f
3135 CAMUQX010000080.1 GCA947097145_01572 gene open 2164-2778 yihA
3136 CAMUQX010000080.1 GCA947097145_01573 gene open 2789-4180 glmM
3137 CAMUQX010000080.1 GCA947097145_01574 gene open 4246-4884
3138 CAMUQX010000080.1 GCA947097145_01575 gene open 5101-7488
3139 CAMUQX010000080.1 GCA947097145_01576 gene open 7597-7761
3140 CAMUQX010000080.1 GCA947097145_01577 gene open 7800-7991
3141 CAMUQX010000081.1 GCA947097145_01579 CDS open 177-332 _na     51_aa hypothetical protein
3142 CAMUQX010000081.1 GCA947097145_01580 CDS open 843-1478 _na     211_aa ABC transporter permease
3143 CAMUQX010000081.1 GCA947097145_01581 CDS open 1468-2193 _na     241_aa Response regulatory domain-containing protein
3144 CAMUQX010000081.1 GCA947097145_01582 CDS open 2200-5820 _na     1206_aa histidine kinase
3145 CAMUQX010000081.1 GCA947097145_01583 CDS open 5926-6990 _na     354_aa Transcriptional regulator
3146 CAMUQX010000081.1 GCA947097145_01584 CDS open 7028-7840 _na     270_aa hypothetical protein
3147 CAMUQX010000081.1 GCA947097145_01579 gene open 177-332
3148 CAMUQX010000081.1 GCA947097145_01580 gene open 843-1478
3149 CAMUQX010000081.1 GCA947097145_01581 gene open 1468-2193
3150 CAMUQX010000081.1 GCA947097145_01582 gene open 2200-5820
3151 CAMUQX010000081.1 GCA947097145_01583 gene open 5926-6990
3152 CAMUQX010000081.1 GCA947097145_01584 gene open 7028-7840
3153 CAMUQX010000081.1 GCA947097145_01578 gene open 87-160 trnP
3154 CAMUQX010000081.1 GCA947097145_01578 tRNA open 87-160 trnP tRNA-Pro(tgg)
3155 CAMUQX010000082.1 GCA947097145_01585 CDS open 2001-2285 _na     94_aa hypothetical protein
3156 CAMUQX010000082.1 GCA947097145_01586 CDS open 2310-2927 _na     205_aa ruvA Holliday junction branch migration complex subunit RuvA
3157 CAMUQX010000082.1 GCA947097145_01587 CDS open 3048-3650 _na     200_aa Viral histone-like protein
3158 CAMUQX010000082.1 GCA947097145_01588 CDS open 3959-4489 _na     176_aa Putative methyltransferase
3159 CAMUQX010000082.1 GCA947097145_01589 CDS open 4512-5324 _na     270_aa DUF3822 domain-containing protein
3160 CAMUQX010000082.1 GCA947097145_01590 CDS open 5491-6912 _na     473_aa ATP-dependent endonuclease
3161 CAMUQX010000082.1 GCA947097145_01591 CDS open 6912-7577 _na     221_aa SprT-like domain-containing protein
3162 CAMUQX010000082.1 GCA947097145_01585 gene open 2001-2285
3163 CAMUQX010000082.1 GCA947097145_01586 gene open 2310-2927 ruvA
3164 CAMUQX010000082.1 GCA947097145_01587 gene open 3048-3650
3165 CAMUQX010000082.1 GCA947097145_01588 gene open 3959-4489
3166 CAMUQX010000082.1 GCA947097145_01589 gene open 4512-5324
3167 CAMUQX010000082.1 GCA947097145_01590 gene open 5491-6912
3168 CAMUQX010000082.1 GCA947097145_01591 gene open 6912-7577
3169 CAMUQX010000083.1 GCA947097145_01592 CDS open 79-3558 _na     1159_aa mfd transcription-repair coupling factor
3170 CAMUQX010000083.1 GCA947097145_01593 CDS open 3997-4776 _na     259_aa TPM domain-containing protein
3171 CAMUQX010000083.1 GCA947097145_01594 CDS open 4818-5402 _na     194_aa lemA LemA family protein
3172 CAMUQX010000083.1 GCA947097145_01595 CDS open 5800-7254 _na     484_aa PDZ domain-containing protein
3173 CAMUQX010000083.1 GCA947097145_01592 gene open 79-3558 mfd
3174 CAMUQX010000083.1 GCA947097145_01593 gene open 3997-4776
3175 CAMUQX010000083.1 GCA947097145_01594 gene open 4818-5402 lemA
3176 CAMUQX010000083.1 GCA947097145_01595 gene open 5800-7254
3177 CAMUQX010000084.1 GCA947097145_01596 CDS open 86-1699 _na     537_aa pckA phosphoenolpyruvate carboxykinase (ATP)
3178 CAMUQX010000084.1 GCA947097145_01597 CDS open 1982-2641 _na     219_aa upp uracil phosphoribosyltransferase
3179 CAMUQX010000084.1 GCA947097145_01598 CDS open 3244-3396 _na     50_aa hypothetical protein
3180 CAMUQX010000084.1 GCA947097145_01599 CDS open 3415-4272 _na     285_aa OmpA-like domain-containing protein
3181 CAMUQX010000084.1 GCA947097145_01600 CDS open 4304-4408 _na     34_aa hypothetical protein
3182 CAMUQX010000084.1 GCA947097145_01601 CDS open 4458-4862 _na     134_aa tonB Energy transducer TonB
3183 CAMUQX010000084.1 GCA947097145_01602 CDS open 4963-5427 _na     154_aa Serum opacity factor
3184 CAMUQX010000084.1 GCA947097145_01603 CDS open 5466-6248 _na     260_aa Glycosyl transferase%2C group 2 family protein
3185 CAMUQX010000084.1 GCA947097145_01604 CDS open 6249-7520 _na     423_aa Glycosyltransferase family 1
3186 CAMUQX010000084.1 GCA947097145_01596 gene open 86-1699 pckA
3187 CAMUQX010000084.1 GCA947097145_01597 gene open 1982-2641 upp
3188 CAMUQX010000084.1 GCA947097145_01598 gene open 3244-3396
3189 CAMUQX010000084.1 GCA947097145_01599 gene open 3415-4272
3190 CAMUQX010000084.1 GCA947097145_01600 gene open 4304-4408
3191 CAMUQX010000084.1 GCA947097145_01601 gene open 4458-4862 tonB
3192 CAMUQX010000084.1 GCA947097145_01602 gene open 4963-5427
3193 CAMUQX010000084.1 GCA947097145_01603 gene open 5466-6248
3194 CAMUQX010000084.1 GCA947097145_01604 gene open 6249-7520
3195 CAMUQX010000085.1 repeat_region open 1141-1584 CRISPR array with 7 repeats of length 36%2C consensus sequence GTTGTTTTTACCTTGCAAACAGCAGGCAGATGCAAC and spacer length 30
3196 CAMUQX010000085.1 GCA947097145_01605 CDS open 434-895 _na     153_aa hypothetical protein
3197 CAMUQX010000085.1 GCA947097145_01606 CDS open 1598-2203 _na     201_aa csx28 CRISPR-associated protein Csx28
3198 CAMUQX010000085.1 GCA947097145_01607 CDS open 2208-5588 _na     1126_aa cas13b type VI-B CRISPR-associated RNA-guided ribonuclease Cas13b
3199 CAMUQX010000085.1 GCA947097145_01608 CDS open 5867-6760 _na     297_aa DUF481 domain-containing protein
3200 CAMUQX010000085.1 GCA947097145_01609 CDS open 6937-7353 _na     138_aa hypothetical protein
3201 CAMUQX010000085.1 GCA947097145_01610 CDS open 7502-7645 _na     47_aa hypothetical protein
3202 CAMUQX010000085.1 GCA947097145_01605 gene open 434-895
3203 CAMUQX010000085.1 GCA947097145_01606 gene open 1598-2203 csx28
3204 CAMUQX010000085.1 GCA947097145_01607 gene open 2208-5588 cas13b
3205 CAMUQX010000085.1 GCA947097145_01608 gene open 5867-6760
3206 CAMUQX010000085.1 GCA947097145_01609 gene open 6937-7353
3207 CAMUQX010000085.1 GCA947097145_01610 gene open 7502-7645
3208 CAMUQX010000086.1 GCA947097145_01611 CDS open 467-1768 _na     433_aa UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D-alanine ligase
3209 CAMUQX010000086.1 GCA947097145_01612 CDS open 1844-3628 _na     594_aa TPR domain protein with HTH18 domain
3210 CAMUQX010000086.1 GCA947097145_01613 CDS open 3638-4762 _na     374_aa HTH araC/xylS-type domain-containing protein
3211 CAMUQX010000086.1 GCA947097145_01611 gene open 467-1768
3212 CAMUQX010000086.1 GCA947097145_01612 gene open 1844-3628
3213 CAMUQX010000086.1 GCA947097145_01613 gene open 3638-4762
3214 CAMUQX010000087.1 regulatory_region open 831-1013 Cobalamin riboswitch aptamer
3215 CAMUQX010000087.1 GCA947097145_01614 CDS open 407-556 _na     49_aa hypothetical protein
3216 CAMUQX010000087.1 GCA947097145_01615 CDS open 1493-1603 _na     36_aa hypothetical protein
3217 CAMUQX010000087.1 GCA947097145_01616 CDS open 1875-3503 _na     542_aa C4-dicarboxylate ABC transporter
3218 CAMUQX010000087.1 GCA947097145_01617 CDS open 4055-4657 _na     200_aa Outer membrane protein beta-barrel domain-containing protein
3219 CAMUQX010000087.1 GCA947097145_01618 CDS open 4730-4846 _na     38_aa hypothetical protein
3220 CAMUQX010000087.1 GCA947097145_01619 CDS open 4877-6319 _na     480_aa Peptidase M20 dimerisation domain-containing protein
3221 CAMUQX010000087.1 GCA947097145_01620 CDS open 6405-6599 _na     64_aa hypothetical protein
3222 CAMUQX010000087.1 GCA947097145_01621 CDS open 6633-7229 _na     198_aa ompH OmpH family outer membrane protein
3223 CAMUQX010000087.1 GCA947097145_01614 gene open 407-556
3224 CAMUQX010000087.1 GCA947097145_01615 gene open 1493-1603
3225 CAMUQX010000087.1 GCA947097145_01616 gene open 1875-3503
3226 CAMUQX010000087.1 GCA947097145_01617 gene open 4055-4657
3227 CAMUQX010000087.1 GCA947097145_01618 gene open 4730-4846
3228 CAMUQX010000087.1 GCA947097145_01619 gene open 4877-6319
3229 CAMUQX010000087.1 GCA947097145_01620 gene open 6405-6599
3230 CAMUQX010000087.1 GCA947097145_01621 gene open 6633-7229 ompH
3231 CAMUQX010000088.1 GCA947097145_01622 CDS open 314-1495 _na     393_aa phosphoribosylaminoimidazolecarboxamide formyltransferase
3232 CAMUQX010000088.1 GCA947097145_01623 CDS open 1533-1718 _na     61_aa 30S ribosomal protein THX
3233 CAMUQX010000088.1 GCA947097145_01624 CDS open 1875-2330 _na     151_aa nlpE Copper resistance protein NlpE
3234 CAMUQX010000088.1 GCA947097145_01625 CDS open 2494-3540 _na     348_aa aroB 3-dehydroquinate synthase
3235 CAMUQX010000088.1 GCA947097145_01626 CDS open 3598-4614 _na     338_aa AMP-dependent synthetase/ligase domain-containing protein
3236 CAMUQX010000088.1 GCA947097145_01627 CDS open 4686-5723 _na     345_aa Mandelate racemase/muconate lactonizing enzyme C-terminal domain-containing protein
3237 CAMUQX010000088.1 GCA947097145_01628 CDS open 5730-6557 _na     275_aa menB 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
3238 CAMUQX010000088.1 GCA947097145_01629 CDS open 6575-7711 _na     378_aa hypothetical protein
3239 CAMUQX010000088.1 GCA947097145_01622 gene open 314-1495
3240 CAMUQX010000088.1 GCA947097145_01623 gene open 1533-1718
3241 CAMUQX010000088.1 GCA947097145_01624 gene open 1875-2330 nlpE
3242 CAMUQX010000088.1 GCA947097145_01625 gene open 2494-3540 aroB
3243 CAMUQX010000088.1 GCA947097145_01626 gene open 3598-4614
3244 CAMUQX010000088.1 GCA947097145_01627 gene open 4686-5723
3245 CAMUQX010000088.1 GCA947097145_01628 gene open 5730-6557 menB
3246 CAMUQX010000088.1 GCA947097145_01629 gene open 6575-7711
3247 CAMUQX010000089.1 GCA947097145_01630 CDS open 344-487 _na     47_aa hypothetical protein
3248 CAMUQX010000089.1 GCA947097145_01631 CDS open 2265-2477 _na     70_aa hypothetical protein
3249 CAMUQX010000089.1 GCA947097145_01632 CDS open 2718-2969 _na     83_aa hypothetical protein
3250 CAMUQX010000089.1 GCA947097145_01633 CDS open 3131-3547 _na     138_aa hypothetical protein
3251 CAMUQX010000089.1 GCA947097145_01634 CDS open 3669-4043 _na     124_aa Bona fide RidA/YjgF/TdcF/RutC subgroup
3252 CAMUQX010000089.1 GCA947097145_01635 CDS open 4113-4454 _na     113_aa Secreted protein
3253 CAMUQX010000089.1 GCA947097145_01636 CDS open 4441-4887 _na     148_aa hypothetical protein
3254 CAMUQX010000089.1 GCA947097145_01637 CDS open 5375-6553 _na     392_aa HTH araC/xylS-type domain-containing protein
3255 CAMUQX010000089.1 GCA947097145_01630 gene open 344-487
3256 CAMUQX010000089.1 GCA947097145_01631 gene open 2265-2477
3257 CAMUQX010000089.1 GCA947097145_01632 gene open 2718-2969
3258 CAMUQX010000089.1 GCA947097145_01633 gene open 3131-3547
3259 CAMUQX010000089.1 GCA947097145_01634 gene open 3669-4043
3260 CAMUQX010000089.1 GCA947097145_01635 gene open 4113-4454
3261 CAMUQX010000089.1 GCA947097145_01636 gene open 4441-4887
3262 CAMUQX010000089.1 GCA947097145_01637 gene open 5375-6553
3263 CAMUQX010000090.1 GCA947097145_01638 CDS open 445-906 _na     153_aa bcp thioredoxin-dependent thiol peroxidase
3264 CAMUQX010000090.1 GCA947097145_01639 CDS open 1258-2574 _na     438_aa Anaerobic C4-dicarboxylate uptake (Dcu) family transporter
3265 CAMUQX010000090.1 GCA947097145_01640 CDS open 2634-3689 _na     351_aa ansB L-asparaginase 2
3266 CAMUQX010000090.1 GCA947097145_01641 CDS open 3798-4994 _na     398_aa Porin
3267 CAMUQX010000090.1 GCA947097145_01642 CDS open 5157-5324 _na     55_aa Histidine kinase
3268 CAMUQX010000090.1 GCA947097145_01643 CDS open 5694-7376 _na     560_aa TonB-dependent receptor
3269 CAMUQX010000090.1 GCA947097145_01638 gene open 445-906 bcp
3270 CAMUQX010000090.1 GCA947097145_01639 gene open 1258-2574
3271 CAMUQX010000090.1 GCA947097145_01640 gene open 2634-3689 ansB
3272 CAMUQX010000090.1 GCA947097145_01641 gene open 3798-4994
3273 CAMUQX010000090.1 GCA947097145_01642 gene open 5157-5324
3274 CAMUQX010000090.1 GCA947097145_01643 gene open 5694-7376
3275 CAMUQX010000091.1 regulatory_region open 3658-3733 L13-Bacteroidia ribosomal protein leader
3276 CAMUQX010000091.1 GCA947097145_01644 CDS open 579-1577 _na     332_aa tsf translation elongation factor Ts
3277 CAMUQX010000091.1 GCA947097145_01645 CDS open 1691-2533 _na     280_aa rpsB 30S ribosomal protein S2
3278 CAMUQX010000091.1 GCA947097145_01646 CDS open 2740-3126 _na     128_aa rpsI 30S ribosomal protein S9
3279 CAMUQX010000091.1 GCA947097145_01647 CDS open 3141-3605 _na     154_aa rplM 50S ribosomal protein L13
3280 CAMUQX010000091.1 GCA947097145_01648 CDS open 3872-6505 _na     877_aa DUF3943 domain-containing protein
3281 CAMUQX010000091.1 GCA947097145_01644 gene open 579-1577 tsf
3282 CAMUQX010000091.1 GCA947097145_01645 gene open 1691-2533 rpsB
3283 CAMUQX010000091.1 GCA947097145_01646 gene open 2740-3126 rpsI
3284 CAMUQX010000091.1 GCA947097145_01647 gene open 3141-3605 rplM
3285 CAMUQX010000091.1 GCA947097145_01648 gene open 3872-6505
3286 CAMUQX010000092.1 GCA947097145_01649 CDS open 415-1002 _na     195_aa hypothetical protein
3287 CAMUQX010000092.1 GCA947097145_01650 CDS open 1839-3488 _na     549_aa Alkaline protease
3288 CAMUQX010000092.1 GCA947097145_01651 CDS open 3927-5477 _na     516_aa Fimbrillin family protein
3289 CAMUQX010000092.1 GCA947097145_01652 CDS open 5557-5730 _na     57_aa hypothetical protein
3290 CAMUQX010000092.1 GCA947097145_01653 CDS open 5976-6800 _na     274_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
3291 CAMUQX010000092.1 GCA947097145_01649 gene open 415-1002
3292 CAMUQX010000092.1 GCA947097145_01650 gene open 1839-3488
3293 CAMUQX010000092.1 GCA947097145_01651 gene open 3927-5477
3294 CAMUQX010000092.1 GCA947097145_01652 gene open 5557-5730
3295 CAMUQX010000092.1 GCA947097145_01653 gene open 5976-6800 trmB
3296 CAMUQX010000093.1 GCA947097145_01654 CDS open 605-3040 _na     811_aa Bacterial surface antigen (D15) domain-containing protein
3297 CAMUQX010000093.1 GCA947097145_01655 CDS open 3024-7184 _na     1386_aa Phage tail protein
3298 CAMUQX010000093.1 GCA947097145_01654 gene open 605-3040
3299 CAMUQX010000093.1 GCA947097145_01655 gene open 3024-7184
3300 CAMUQX010000094.1 GCA947097145_01656 CDS open 212-1906 _na     564_aa putative transporter
3301 CAMUQX010000094.1 GCA947097145_01657 CDS open 2285-2830 _na     181_aa Zinc ribbon domain-containing protein
3302 CAMUQX010000094.1 GCA947097145_01658 CDS open 2882-3709 _na     275_aa J domain-containing protein
3303 CAMUQX010000094.1 GCA947097145_01659 CDS open 3906-4739 _na     277_aa Antioxidant AhpC/TSA family
3304 CAMUQX010000094.1 GCA947097145_01660 CDS open 4931-5623 _na     230_aa yhhQ queuosine precursor transporter
3305 CAMUQX010000094.1 GCA947097145_01661 CDS open 5670-6125 _na     151_aa queF preQ(1) synthase
3306 CAMUQX010000094.1 GCA947097145_01662 CDS open 6323-6733 _na     136_aa SHSP domain-containing protein
3307 CAMUQX010000094.1 GCA947097145_01656 gene open 212-1906
3308 CAMUQX010000094.1 GCA947097145_01657 gene open 2285-2830
3309 CAMUQX010000094.1 GCA947097145_01658 gene open 2882-3709
3310 CAMUQX010000094.1 GCA947097145_01659 gene open 3906-4739
3311 CAMUQX010000094.1 GCA947097145_01660 gene open 4931-5623 yhhQ
3312 CAMUQX010000094.1 GCA947097145_01661 gene open 5670-6125 queF
3313 CAMUQX010000094.1 GCA947097145_01662 gene open 6323-6733
3314 CAMUQX010000095.1 GCA947097145_01663 CDS open 64-564 _na     166_aa Four helix bundle protein
3315 CAMUQX010000095.1 GCA947097145_01664 CDS open 649-1809 _na     386_aa bifunctional methionine sulfoxide reductase B/A protein
3316 CAMUQX010000095.1 GCA947097145_01665 CDS open 2037-2522 _na     161_aa Ferritin
3317 CAMUQX010000095.1 GCA947097145_01666 CDS open 3092-4195 _na     367_aa Iron-sulfur cluster carrier protein
3318 CAMUQX010000095.1 GCA947097145_01667 CDS open 4343-4828 _na     161_aa hypothetical protein
3319 CAMUQX010000095.1 GCA947097145_01668 CDS open 4809-5033 _na     74_aa DNA-binding protein
3320 CAMUQX010000095.1 GCA947097145_01669 CDS open 5206-6171 _na     321_aa Band 7 protein
3321 CAMUQX010000095.1 GCA947097145_01670 CDS open 6461-6976 _na     171_aa hutD HutD family protein
3322 CAMUQX010000095.1 GCA947097145_01663 gene open 64-564
3323 CAMUQX010000095.1 GCA947097145_01664 gene open 649-1809
3324 CAMUQX010000095.1 GCA947097145_01665 gene open 2037-2522
3325 CAMUQX010000095.1 GCA947097145_01666 gene open 3092-4195
3326 CAMUQX010000095.1 GCA947097145_01667 gene open 4343-4828
3327 CAMUQX010000095.1 GCA947097145_01668 gene open 4809-5033
3328 CAMUQX010000095.1 GCA947097145_01669 gene open 5206-6171
3329 CAMUQX010000095.1 GCA947097145_01670 gene open 6461-6976 hutD
3330 CAMUQX010000096.1 GCA947097145_01671 CDS open 862-1038 _na     58_aa Benenodin family lasso peptide
3331 CAMUQX010000096.1 GCA947097145_01672 CDS open 1637-2494 _na     285_aa gntR GntR family transcriptional regulator
3332 CAMUQX010000096.1 GCA947097145_01673 CDS open 2518-3195 _na     225_aa lolD Lipoprotein-releasing system ATP-binding protein LolD
3333 CAMUQX010000096.1 GCA947097145_01674 CDS open 3200-5320 _na     706_aa Cation:proton antiporter
3334 CAMUQX010000096.1 GCA947097145_01675 CDS open 5496-6509 _na     337_aa aspartate-semialdehyde dehydrogenase
3335 CAMUQX010000096.1 GCA947097145_01671 gene open 862-1038
3336 CAMUQX010000096.1 GCA947097145_01672 gene open 1637-2494 gntR
3337 CAMUQX010000096.1 GCA947097145_01673 gene open 2518-3195 lolD
3338 CAMUQX010000096.1 GCA947097145_01674 gene open 3200-5320
3339 CAMUQX010000096.1 GCA947097145_01675 gene open 5496-6509
3340 CAMUQX010000097.1 GCA947097145_01676 CDS open 15-1028 _na     337_aa PKD domain-containing protein
3341 CAMUQX010000097.1 GCA947097145_01677 CDS open 1043-2158 _na     371_aa 40-residue YVTN family beta-propeller
3342 CAMUQX010000097.1 GCA947097145_01678 CDS open 2177-4210 _na     677_aa TonB-dependent siderophore receptor
3343 CAMUQX010000097.1 GCA947097145_01679 CDS open 4334-4906 _na     190_aa N-acetyltransferase domain-containing protein
3344 CAMUQX010000097.1 GCA947097145_01680 CDS open 4915-6399 _na     494_aa Phosphomannomutase/phosphoglucomutase
3345 CAMUQX010000097.1 GCA947097145_01676 gene open 15-1028
3346 CAMUQX010000097.1 GCA947097145_01677 gene open 1043-2158
3347 CAMUQX010000097.1 GCA947097145_01678 gene open 2177-4210
3348 CAMUQX010000097.1 GCA947097145_01679 gene open 4334-4906
3349 CAMUQX010000097.1 GCA947097145_01680 gene open 4915-6399
3350 CAMUQX010000098.1 GCA947097145_01681 CDS open 28-1365 _na     445_aa hypothetical protein
3351 CAMUQX010000098.1 GCA947097145_01682 CDS open 1837-2541 _na     234_aa hypothetical protein
3352 CAMUQX010000098.1 GCA947097145_01683 CDS open 2761-3921 _na     386_aa ompA Major outer membrane protein OmpA
3353 CAMUQX010000098.1 GCA947097145_01684 CDS open 4296-4616 _na     106_aa transposase
3354 CAMUQX010000098.1 GCA947097145_01685 CDS open 4570-5451 _na     293_aa IS256 family transposase
3355 CAMUQX010000098.1 GCA947097145_01686 CDS open 5962-6204 _na     80_aa hypothetical protein
3356 CAMUQX010000098.1 GCA947097145_01681 gene open 28-1365
3357 CAMUQX010000098.1 GCA947097145_01682 gene open 1837-2541
3358 CAMUQX010000098.1 GCA947097145_01683 gene open 2761-3921 ompA
3359 CAMUQX010000098.1 GCA947097145_01684 gene open 4296-4616
3360 CAMUQX010000098.1 GCA947097145_01685 gene open 4570-5451
3361 CAMUQX010000098.1 GCA947097145_01686 gene open 5962-6204
3362 CAMUQX010000099.1 GCA947097145_01687 CDS open 452-1537 _na     361_aa Endonuclease
3363 CAMUQX010000099.1 GCA947097145_01688 CDS open 1551-1751 _na     66_aa Bacteriocin
3364 CAMUQX010000099.1 GCA947097145_01689 CDS open 1769-3505 _na     578_aa Lipocalin-like domain-containing protein
3365 CAMUQX010000099.1 GCA947097145_01690 CDS open 4432-4917 _na     161_aa Sigma-70 region 2
3366 CAMUQX010000099.1 GCA947097145_01691 CDS open 4908-5375 _na     155_aa Anti-sigma factor
3367 CAMUQX010000099.1 GCA947097145_01692 CDS open 5365-5802 _na     145_aa DUF4252 domain-containing protein
3368 CAMUQX010000099.1 GCA947097145_01693 CDS open 5850-6686 _na     278_aa Outer membrane protein beta-barrel domain-containing protein
3369 CAMUQX010000099.1 GCA947097145_01687 gene open 452-1537
3370 CAMUQX010000099.1 GCA947097145_01688 gene open 1551-1751
3371 CAMUQX010000099.1 GCA947097145_01689 gene open 1769-3505
3372 CAMUQX010000099.1 GCA947097145_01690 gene open 4432-4917
3373 CAMUQX010000099.1 GCA947097145_01691 gene open 4908-5375
3374 CAMUQX010000099.1 GCA947097145_01692 gene open 5365-5802
3375 CAMUQX010000099.1 GCA947097145_01693 gene open 5850-6686
3376 CAMUQX010000100.1 GCA947097145_01694 CDS open 193-318 _na     41_aa hypothetical protein
3377 CAMUQX010000100.1 GCA947097145_01695 CDS open 379-867 _na     162_aa Thioredoxin domain-containing protein
3378 CAMUQX010000100.1 GCA947097145_01696 CDS open 877-2550 _na     557_aa TonB-dependent receptor-like beta-barrel domain-containing protein
3379 CAMUQX010000100.1 GCA947097145_01697 CDS open 2563-3330 _na     255_aa Outer membrane protein Omp28
3380 CAMUQX010000100.1 GCA947097145_01698 CDS open 3368-4024 _na     218_aa Lipocalin-like domain-containing protein
3381 CAMUQX010000100.1 GCA947097145_01699 CDS open 4176-4700 _na     174_aa mutT DNA mismatch repair protein MutT
3382 CAMUQX010000100.1 GCA947097145_01700 CDS open 4912-5736 _na     274_aa Putative xylanase
3383 CAMUQX010000100.1 GCA947097145_01701 CDS open 5864-6448 _na     194_aa Outer membrane protein beta-barrel domain-containing protein
3384 CAMUQX010000100.1 GCA947097145_01694 gene open 193-318
3385 CAMUQX010000100.1 GCA947097145_01695 gene open 379-867
3386 CAMUQX010000100.1 GCA947097145_01696 gene open 877-2550
3387 CAMUQX010000100.1 GCA947097145_01697 gene open 2563-3330
3388 CAMUQX010000100.1 GCA947097145_01698 gene open 3368-4024
3389 CAMUQX010000100.1 GCA947097145_01699 gene open 4176-4700 mutT
3390 CAMUQX010000100.1 GCA947097145_01700 gene open 4912-5736
3391 CAMUQX010000100.1 GCA947097145_01701 gene open 5864-6448
3392 CAMUQX010000101.1 GCA947097145_01702 CDS open 311-1096 _na     261_aa Zinc ribbon domain-containing protein
3393 CAMUQX010000101.1 GCA947097145_01703 CDS open 1101-1382 _na     93_aa Zinc ribbon domain-containing protein
3394 CAMUQX010000101.1 GCA947097145_01704 CDS open 1399-2838 _na     479_aa pyk pyruvate kinase
3395 CAMUQX010000101.1 GCA947097145_01705 CDS open 2976-3413 _na     145_aa Ribose 5-phosphate isomerase B
3396 CAMUQX010000101.1 GCA947097145_01706 CDS open 3471-5486 _na     671_aa Transketolase
3397 CAMUQX010000101.1 GCA947097145_01707 CDS open 5690-6457 _na     255_aa Acyl-ACP thioesterase
3398 CAMUQX010000101.1 GCA947097145_01702 gene open 311-1096
3399 CAMUQX010000101.1 GCA947097145_01703 gene open 1101-1382
3400 CAMUQX010000101.1 GCA947097145_01704 gene open 1399-2838 pyk
3401 CAMUQX010000101.1 GCA947097145_01705 gene open 2976-3413
3402 CAMUQX010000101.1 GCA947097145_01706 gene open 3471-5486
3403 CAMUQX010000101.1 GCA947097145_01707 gene open 5690-6457
3404 CAMUQX010000102.1 GCA947097145_01708 CDS open 329-1591 _na     420_aa Major facilitator superfamily (MFS) profile domain-containing protein
3405 CAMUQX010000102.1 GCA947097145_01709 CDS open 1591-2151 _na     186_aa BFN domain-containing protein
3406 CAMUQX010000102.1 GCA947097145_01710 CDS open 2162-2884 _na     240_aa 16S rRNA (uracil(1498)-N(3))-methyltransferase
3407 CAMUQX010000102.1 GCA947097145_01711 CDS open 3489-3791 _na     100_aa hypothetical protein
3408 CAMUQX010000102.1 GCA947097145_01708 gene open 329-1591
3409 CAMUQX010000102.1 GCA947097145_01709 gene open 1591-2151
3410 CAMUQX010000102.1 GCA947097145_01710 gene open 2162-2884
3411 CAMUQX010000102.1 GCA947097145_01711 gene open 3489-3791
3412 CAMUQX010000103.1 GCA947097145_01712 CDS open 42-689 _na     215_aa Succinate dehydrogenase cytochrome B subunit%2C b558 family
3413 CAMUQX010000103.1 GCA947097145_01713 CDS open 722-2704 _na     660_aa sdhA Succinate dehydrogenase or fumarate reductase%2C flavoprotein subunit
3414 CAMUQX010000103.1 GCA947097145_01714 CDS open 2750-3505 _na     251_aa Succinate dehydrogenase/fumarate reductase iron-sulfur subunit
3415 CAMUQX010000103.1 GCA947097145_01715 CDS open 3705-4985 _na     426_aa Clostripain family protein
3416 CAMUQX010000103.1 GCA947097145_01716 CDS open 5056-5526 _na     156_aa coaD pantetheine-phosphate adenylyltransferase
3417 CAMUQX010000103.1 GCA947097145_01717 CDS open 5539-5949 _na     136_aa ybeY rRNA maturation RNase YbeY
3418 CAMUQX010000103.1 GCA947097145_01712 gene open 42-689
3419 CAMUQX010000103.1 GCA947097145_01713 gene open 722-2704 sdhA
3420 CAMUQX010000103.1 GCA947097145_01714 gene open 2750-3505
3421 CAMUQX010000103.1 GCA947097145_01715 gene open 3705-4985
3422 CAMUQX010000103.1 GCA947097145_01716 gene open 5056-5526 coaD
3423 CAMUQX010000103.1 GCA947097145_01717 gene open 5539-5949 ybeY
3424 CAMUQX010000104.1 GCA947097145_01718 CDS open 512-1948 _na     478_aa lysM LysM domain-containing protein
3425 CAMUQX010000104.1 GCA947097145_01719 CDS open 2001-2696 _na     231_aa Gliding motility protein
3426 CAMUQX010000104.1 GCA947097145_01720 CDS open 2730-5570 _na     946_aa uvrA excinuclease ABC subunit UvrA
3427 CAMUQX010000104.1 GCA947097145_01718 gene open 512-1948 lysM
3428 CAMUQX010000104.1 GCA947097145_01719 gene open 2001-2696
3429 CAMUQX010000104.1 GCA947097145_01720 gene open 2730-5570 uvrA
3430 CAMUQX010000105.1 GCA947097145_01721 CDS open 1623-2657 _na     344_aa Endolytic murein transglycosylase
3431 CAMUQX010000105.1 GCA947097145_01722 CDS open 3184-4413 _na     409_aa Mobile element protein
3432 CAMUQX010000105.1 GCA947097145_01723 CDS open 4479-4802 _na     107_aa Integrase family protein
3433 CAMUQX010000105.1 GCA947097145_01724 CDS open 4799-5731 _na     310_aa Tyr recombinase domain-containing protein
3434 CAMUQX010000105.1 GCA947097145_01721 gene open 1623-2657
3435 CAMUQX010000105.1 GCA947097145_01722 gene open 3184-4413
3436 CAMUQX010000105.1 GCA947097145_01723 gene open 4479-4802
3437 CAMUQX010000105.1 GCA947097145_01724 gene open 4799-5731
3438 CAMUQX010000106.1 GCA947097145_01725 CDS open 142-1290 _na     382_aa rfbB dTDP-glucose 4%2C6-dehydratase
3439 CAMUQX010000106.1 GCA947097145_01726 CDS open 1316-1822 _na     168_aa Phosphoesterase
3440 CAMUQX010000106.1 GCA947097145_01727 CDS open 1830-2456 _na     208_aa Cytidylate kinase
3441 CAMUQX010000106.1 GCA947097145_01728 CDS open 2488-3837 _na     449_aa mepA Multidrug export protein MepA
3442 CAMUQX010000106.1 GCA947097145_01729 CDS open 3993-4595 _na     200_aa Outer membrane protein beta-barrel domain-containing protein
3443 CAMUQX010000106.1 GCA947097145_01730 CDS open 5032-5490 _na     152_aa Beta-lactamase-inhibitor-like PepSY-like domain-containing protein
3444 CAMUQX010000106.1 GCA947097145_01725 gene open 142-1290 rfbB
3445 CAMUQX010000106.1 GCA947097145_01726 gene open 1316-1822
3446 CAMUQX010000106.1 GCA947097145_01727 gene open 1830-2456
3447 CAMUQX010000106.1 GCA947097145_01728 gene open 2488-3837 mepA
3448 CAMUQX010000106.1 GCA947097145_01729 gene open 3993-4595
3449 CAMUQX010000106.1 GCA947097145_01730 gene open 5032-5490
3450 CAMUQX010000107.1 GCA947097145_01731 CDS open 1971-3410 _na     479_aa Alpha/beta hydrolase
3451 CAMUQX010000107.1 GCA947097145_01732 CDS open 3734-5635 _na     633_aa dnaK molecular chaperone DnaK
3452 CAMUQX010000107.1 GCA947097145_01731 gene open 1971-3410
3453 CAMUQX010000107.1 GCA947097145_01732 gene open 3734-5635 dnaK
3454 CAMUQX010000108.1 GCA947097145_01733 CDS open 309-5729 _na     1806_aa sprA Cell surface protein SprA
3455 CAMUQX010000108.1 GCA947097145_01733 gene open 309-5729 sprA
3456 CAMUQX010000109.1 GCA947097145_01734 CDS open 432-1151 _na     239_aa BAX inhibitor (BI)-1/YccA family protein
3457 CAMUQX010000109.1 GCA947097145_01735 CDS open 1095-1214 _na     39_aa hypothetical protein
3458 CAMUQX010000109.1 GCA947097145_01736 CDS open 1312-1923 _na     203_aa DUF4840 domain-containing protein
3459 CAMUQX010000109.1 GCA947097145_01737 CDS open 2507-4444 _na     645_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
3460 CAMUQX010000109.1 GCA947097145_01738 CDS open 4959-5351 _na     130_aa hypothetical protein
3461 CAMUQX010000109.1 GCA947097145_01734 gene open 432-1151
3462 CAMUQX010000109.1 GCA947097145_01735 gene open 1095-1214
3463 CAMUQX010000109.1 GCA947097145_01736 gene open 1312-1923
3464 CAMUQX010000109.1 GCA947097145_01737 gene open 2507-4444 dxs
3465 CAMUQX010000109.1 GCA947097145_01738 gene open 4959-5351
3466 CAMUQX010000110.1 GCA947097145_01739 CDS open 1550-1648 _na     32_aa hypothetical protein
3467 CAMUQX010000110.1 GCA947097145_01740 CDS open 1832-4078 _na     748_aa pflB formate C-acetyltransferase
3468 CAMUQX010000110.1 GCA947097145_01741 CDS open 4106-4279 _na     57_aa hypothetical protein
3469 CAMUQX010000110.1 GCA947097145_01742 CDS open 4314-5105 _na     263_aa pflA pyruvate formate-lyase-activating protein
3470 CAMUQX010000110.1 GCA947097145_01739 gene open 1550-1648
3471 CAMUQX010000110.1 GCA947097145_01740 gene open 1832-4078 pflB
3472 CAMUQX010000110.1 GCA947097145_01741 gene open 4106-4279
3473 CAMUQX010000110.1 GCA947097145_01742 gene open 4314-5105 pflA
3474 CAMUQX010000111.1 GCA947097145_01743 CDS open 5-1297 _na     430_aa IgA peptidase M64
3475 CAMUQX010000111.1 GCA947097145_01744 CDS open 1432-2415 _na     327_aa Gfo/Idh/MocA family oxidoreductase
3476 CAMUQX010000111.1 GCA947097145_01745 CDS open 2420-3610 _na     396_aa DUF4421 domain-containing protein
3477 CAMUQX010000111.1 GCA947097145_01746 CDS open 3607-4554 _na     315_aa Xylanase
3478 CAMUQX010000111.1 GCA947097145_01747 CDS open 4665-5024 _na     119_aa rplU 50S ribosomal protein L21
3479 CAMUQX010000111.1 GCA947097145_01748 CDS open 5042-5332 _na     96_aa rpmA 50S ribosomal protein L27
3480 CAMUQX010000111.1 GCA947097145_01743 gene open 5-1297
3481 CAMUQX010000111.1 GCA947097145_01744 gene open 1432-2415
3482 CAMUQX010000111.1 GCA947097145_01745 gene open 2420-3610
3483 CAMUQX010000111.1 GCA947097145_01746 gene open 3607-4554
3484 CAMUQX010000111.1 GCA947097145_01747 gene open 4665-5024 rplU
3485 CAMUQX010000111.1 GCA947097145_01748 gene open 5042-5332 rpmA
3486 CAMUQX010000112.1 GCA947097145_01749 CDS open 377-733 _na     118_aa DUF2023 domain-containing protein
3487 CAMUQX010000112.1 GCA947097145_01750 CDS open 770-1258 _na     162_aa fldA flavodoxin FldA
3488 CAMUQX010000112.1 GCA947097145_01751 CDS open 1597-2472 _na     291_aa nadC carboxylating nicotinate-nucleotide diphosphorylase
3489 CAMUQX010000112.1 GCA947097145_01752 CDS open 2515-3507 _na     330_aa nadA quinolinate synthase NadA
3490 CAMUQX010000112.1 GCA947097145_01753 CDS open 3539-5137 _na     532_aa nadB L-aspartate oxidase
3491 CAMUQX010000112.1 GCA947097145_01749 gene open 377-733
3492 CAMUQX010000112.1 GCA947097145_01750 gene open 770-1258 fldA
3493 CAMUQX010000112.1 GCA947097145_01751 gene open 1597-2472 nadC
3494 CAMUQX010000112.1 GCA947097145_01752 gene open 2515-3507 nadA
3495 CAMUQX010000112.1 GCA947097145_01753 gene open 3539-5137 nadB
3496 CAMUQX010000113.1 GCA947097145_01754 CDS open 132-836 _na     234_aa rteC RteC protein
3497 CAMUQX010000113.1 GCA947097145_01755 CDS open 849-1946 _na     365_aa Lipoprotein
3498 CAMUQX010000113.1 GCA947097145_01756 CDS open 2169-2360 _na     63_aa hypothetical protein
3499 CAMUQX010000113.1 GCA947097145_01757 CDS open 2382-4841 _na     819_aa TonB-dependent receptor plug domain-containing protein
3500 CAMUQX010000113.1 GCA947097145_01754 gene open 132-836 rteC