HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Aggregatibacter segnis (GCA_947097335.1)

Select a Genome:
BAKTA Annotations for GCA_947097335.1
Genome Selected: Aggregatibacter segnis
ContigsBases CDSrRNA tmRNAtRNA
140 1850914 1731 0 0 33
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3573 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3573 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAMURA010000008.1 GCA947097335_00476 gene open 1431-1529
1002 CAMURA010000008.1 GCA947097335_00477 gene open 1647-1865
1003 CAMURA010000008.1 GCA947097335_00478 gene open 2104-2367 rpsT
1004 CAMURA010000008.1 GCA947097335_00479 gene open 2636-4213 murJ
1005 CAMURA010000008.1 GCA947097335_00480 gene open 4295-5233 ribF
1006 CAMURA010000008.1 GCA947097335_00481 gene open 5273-8095 ileS
1007 CAMURA010000008.1 GCA947097335_00482 gene open 8164-9111
1008 CAMURA010000008.1 GCA947097335_00483 gene open 9130-9777 tenA
1009 CAMURA010000008.1 GCA947097335_00484 gene open 9786-10532
1010 CAMURA010000008.1 GCA947097335_00485 gene open 10529-11251
1011 CAMURA010000008.1 GCA947097335_00486 gene open 11343-11498
1012 CAMURA010000008.1 GCA947097335_00487 gene open 11588-12088 lspA
1013 CAMURA010000008.1 GCA947097335_00488 gene open 12085-13029 ispH
1014 CAMURA010000008.1 GCA947097335_00489 gene open 13087-13638
1015 CAMURA010000008.1 GCA947097335_00490 gene open 13686-14204 sprT
1016 CAMURA010000008.1 GCA947097335_00491 gene open 14431-15585 rlmN
1017 CAMURA010000008.1 GCA947097335_00492 gene open 15610-16161 pilW
1018 CAMURA010000008.1 GCA947097335_00493 gene open 16377-17408 rodZ
1019 CAMURA010000008.1 GCA947097335_00494 gene open 17419-18522 ispG
1020 CAMURA010000008.1 GCA947097335_00495 gene open 18548-19825 hisS
1021 CAMURA010000008.1 GCA947097335_00496 gene open 19835-20449
1022 CAMURA010000008.1 GCA947097335_00497 gene open 20506-20958
1023 CAMURA010000008.1 GCA947097335_00498 gene open 20965-21669 hda
1024 CAMURA010000008.1 GCA947097335_00499 gene open 21784-23028 uraA
1025 CAMURA010000008.1 GCA947097335_00500 gene open 23160-23786 upp
1026 CAMURA010000008.1 GCA947097335_00501 gene open 23913-25760 ppiD
1027 CAMURA010000008.1 GCA947097335_00502 gene open 25887-28301 lon
1028 CAMURA010000008.1 GCA947097335_00504 gene open 28744-30492 dauA
1029 CAMURA010000008.1 GCA947097335_00505 gene open 30525-31166
1030 CAMURA010000008.1 GCA947097335_00506 gene open 31239-32471 serA
1031 CAMURA010000008.1 GCA947097335_00507 gene open 32490-33146 rpiA
1032 CAMURA010000008.1 GCA947097335_00508 gene open 33243-34412 hemW
1033 CAMURA010000008.1 GCA947097335_00509 gene open 34412-34735 ybjQ
1034 CAMURA010000008.1 GCA947097335_00510 gene open 34778-35377 rdgB
1035 CAMURA010000008.1 GCA947097335_00511 gene open 35498-35827
1036 CAMURA010000008.1 GCA947097335_00512 gene open 36219-36545 glpE
1037 CAMURA010000008.1 GCA947097335_00513 gene open 36542-36856
1038 CAMURA010000008.1 GCA947097335_00514 gene open 36898-37773 glpG
1039 CAMURA010000008.1 GCA947097335_00515 gene open 37838-38593 glpR
1040 CAMURA010000008.1 GCA947097335_00516 gene open 38925-41699
1041 CAMURA010000008.1 GCA947097335_00517 gene open 42237-43034
1042 CAMURA010000008.1 GCA947097335_00518 gene open 42992-43432
1043 CAMURA010000008.1 GCA947097335_00520 gene open 43834-45675 rpoD
1044 CAMURA010000008.1 GCA947097335_00503 gene open 28498-28587 trnS
1045 CAMURA010000008.1 GCA947097335_00519 gene open 43631-43707 trnI
1046 CAMURA010000008.1 GCA947097335_00503 tRNA open 28498-28587 trnS tRNA-Ser(gga)
1047 CAMURA010000008.1 GCA947097335_00519 tRNA open 43631-43707 trnI tRNA-Ile2(cat)
1048 CAMURA010000009.1 regulatory_region open 2067-2208 radC RNA
1049 CAMURA010000009.1 regulatory_region open 28413-28554 radC RNA
1050 CAMURA010000009.1 GCA947097335_00521 CDS open 448-1281 _na     277_aa hypothetical protein
1051 CAMURA010000009.1 GCA947097335_00522 CDS open 1354-1575 _na     73_aa hypothetical protein
1052 CAMURA010000009.1 GCA947097335_00523 CDS open 1652-1981 _na     109_aa hypothetical protein
1053 CAMURA010000009.1 GCA947097335_00524 CDS open 2394-2621 _na     75_aa hypothetical protein
1054 CAMURA010000009.1 GCA947097335_00525 CDS open 2745-2999 _na     84_aa hypothetical protein
1055 CAMURA010000009.1 GCA947097335_00526 CDS open 3044-3673 _na     209_aa recombinase family protein
1056 CAMURA010000009.1 GCA947097335_00527 CDS open 3666-4631 _na     321_aa DUF6685 domain-containing protein
1057 CAMURA010000009.1 GCA947097335_00528 CDS open 4686-5048 _na     120_aa DUF4431 domain-containing protein
1058 CAMURA010000009.1 GCA947097335_00529 CDS open 5057-7030 _na     657_aa integrating conjugative element protein
1059 CAMURA010000009.1 GCA947097335_00530 CDS open 7036-7983 _na     315_aa TIGR03756 family integrating conjugative element protein
1060 CAMURA010000009.1 GCA947097335_00531 CDS open 7980-8417 _na     145_aa TIGR03757 family integrating conjugative element protein
1061 CAMURA010000009.1 GCA947097335_00532 CDS open 8574-8828 _na     84_aa transcriptional regulator
1062 CAMURA010000009.1 GCA947097335_00533 CDS open 8830-9171 _na     113_aa mazF MazF family transcriptional regulator
1063 CAMURA010000009.1 GCA947097335_00534 CDS open 9219-9554 _na     111_aa hypothetical protein
1064 CAMURA010000009.1 GCA947097335_00535 CDS open 9607-11103 _na     498_aa traG conjugal transfer protein TraG N-terminal domain-containing protein
1065 CAMURA010000009.1 GCA947097335_00536 CDS open 11110-11439 _na     109_aa hypothetical protein
1066 CAMURA010000009.1 GCA947097335_00537 CDS open 11445-11894 _na     149_aa hypothetical protein
1067 CAMURA010000009.1 GCA947097335_00538 CDS open 11891-14719 _na     942_aa conjugative transfer ATPase
1068 CAMURA010000009.1 GCA947097335_00539 CDS open 14732-15133 _na     133_aa TIGR03751 family conjugal transfer lipoprotein
1069 CAMURA010000009.1 GCA947097335_00540 CDS open 15151-16653 _na     500_aa TIGR03752 family integrating conjugative element protein
1070 CAMURA010000009.1 GCA947097335_00541 CDS open 16650-17558 _na     302_aa TIGR03749 family integrating conjugative element protein
1071 CAMURA010000009.1 GCA947097335_00542 CDS open 17560-18201 _na     213_aa PFL_4703 family integrating conjugative element protein
1072 CAMURA010000009.1 GCA947097335_00543 CDS open 18201-18590 _na     129_aa TIGR03750 family conjugal transfer protein
1073 CAMURA010000009.1 GCA947097335_00544 CDS open 18609-18974 _na     121_aa TIGR03745 family integrating conjugative element membrane protein
1074 CAMURA010000009.1 GCA947097335_00545 CDS open 18993-19235 _na     80_aa TIGR03758 family integrating conjugative element protein
1075 CAMURA010000009.1 GCA947097335_00546 CDS open 19235-19561 _na     108_aa RAQPRD family integrative conjugative element protein
1076 CAMURA010000009.1 GCA947097335_00547 CDS open 19714-20409 _na     231_aa TIGR03747 family integrating conjugative element membrane protein
1077 CAMURA010000009.1 GCA947097335_00548 CDS open 20409-20735 _na     108_aa hypothetical protein
1078 CAMURA010000009.1 GCA947097335_00549 CDS open 20763-22988 _na     741_aa traD type IV conjugative transfer system coupling protein TraD
1079 CAMURA010000009.1 GCA947097335_00550 CDS open 22985-23488 _na     167_aa integrating conjugative element protein
1080 CAMURA010000009.1 GCA947097335_00551 CDS open 23505-24230 _na     241_aa Lytic murein transglycosylase
1081 CAMURA010000009.1 GCA947097335_00552 CDS open 24209-24955 _na     248_aa TIGR03759 family integrating conjugative element protein
1082 CAMURA010000009.1 GCA947097335_00553 CDS open 24970-25644 _na     224_aa pilL PilL N-terminal domain-containing protein
1083 CAMURA010000009.1 GCA947097335_00554 CDS open 25799-26383 _na     194_aa hypothetical protein
1084 CAMURA010000009.1 GCA947097335_00555 CDS open 26641-27282 _na     213_aa DUF3560 domain-containing protein
1085 CAMURA010000009.1 GCA947097335_00556 CDS open 27389-27835 _na     148_aa STY4534 family ICE replication protein
1086 CAMURA010000009.1 GCA947097335_00557 CDS open 27932-28090 _na     52_aa hypothetical protein
1087 CAMURA010000009.1 GCA947097335_00558 CDS open 28111-28332 _na     73_aa hypothetical protein
1088 CAMURA010000009.1 GCA947097335_00559 CDS open 29245-31305 _na     686_aa DNA topoisomerase III
1089 CAMURA010000009.1 GCA947097335_00560 CDS open 31318-31566 _na     82_aa hypothetical protein
1090 CAMURA010000009.1 GCA947097335_00561 CDS open 31824-32300 _na     158_aa hypothetical protein
1091 CAMURA010000009.1 GCA947097335_00562 CDS open 32343-32726 _na     127_aa single-stranded DNA-binding protein
1092 CAMURA010000009.1 GCA947097335_00563 CDS open 32915-33412 _na     165_aa DUF3158 domain-containing protein
1093 CAMURA010000009.1 GCA947097335_00564 CDS open 33432-34199 _na     255_aa PFL_4669 family integrating conjugative element protein
1094 CAMURA010000009.1 GCA947097335_00565 CDS open 34445-35731 _na     428_aa STY4528 family pathogenicity island replication protein
1095 CAMURA010000009.1 GCA947097335_00566 CDS open 35832-36380 _na     182_aa DUF2857 domain-containing protein
1096 CAMURA010000009.1 GCA947097335_00567 CDS open 36398-38110 _na     570_aa parB ParB family protein
1097 CAMURA010000009.1 GCA947097335_00568 CDS open 38124-39491 _na     455_aa dnaB replicative DNA helicase
1098 CAMURA010000009.1 GCA947097335_00569 CDS open 39504-40337 _na     277_aa parA ParA family protein
1099 CAMURA010000009.1 GCA947097335_00572 CDS open 40755-41312 _na     185_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1100 CAMURA010000009.1 GCA947097335_00573 CDS open 41498-42691 _na     397_aa metC cystathionine beta-lyase
1101 CAMURA010000009.1 GCA947097335_00574 CDS open 42892-43953 _na     353_aa ompC OmpC protein
1102 CAMURA010000009.1 GCA947097335_00521 gene open 448-1281
1103 CAMURA010000009.1 GCA947097335_00522 gene open 1354-1575
1104 CAMURA010000009.1 GCA947097335_00523 gene open 1652-1981
1105 CAMURA010000009.1 GCA947097335_00524 gene open 2394-2621
1106 CAMURA010000009.1 GCA947097335_00525 gene open 2745-2999
1107 CAMURA010000009.1 GCA947097335_00526 gene open 3044-3673
1108 CAMURA010000009.1 GCA947097335_00527 gene open 3666-4631
1109 CAMURA010000009.1 GCA947097335_00528 gene open 4686-5048
1110 CAMURA010000009.1 GCA947097335_00529 gene open 5057-7030
1111 CAMURA010000009.1 GCA947097335_00530 gene open 7036-7983
1112 CAMURA010000009.1 GCA947097335_00531 gene open 7980-8417
1113 CAMURA010000009.1 GCA947097335_00532 gene open 8574-8828
1114 CAMURA010000009.1 GCA947097335_00533 gene open 8830-9171 mazF
1115 CAMURA010000009.1 GCA947097335_00534 gene open 9219-9554
1116 CAMURA010000009.1 GCA947097335_00535 gene open 9607-11103 traG
1117 CAMURA010000009.1 GCA947097335_00536 gene open 11110-11439
1118 CAMURA010000009.1 GCA947097335_00537 gene open 11445-11894
1119 CAMURA010000009.1 GCA947097335_00538 gene open 11891-14719
1120 CAMURA010000009.1 GCA947097335_00539 gene open 14732-15133
1121 CAMURA010000009.1 GCA947097335_00540 gene open 15151-16653
1122 CAMURA010000009.1 GCA947097335_00541 gene open 16650-17558
1123 CAMURA010000009.1 GCA947097335_00542 gene open 17560-18201
1124 CAMURA010000009.1 GCA947097335_00543 gene open 18201-18590
1125 CAMURA010000009.1 GCA947097335_00544 gene open 18609-18974
1126 CAMURA010000009.1 GCA947097335_00545 gene open 18993-19235
1127 CAMURA010000009.1 GCA947097335_00546 gene open 19235-19561
1128 CAMURA010000009.1 GCA947097335_00547 gene open 19714-20409
1129 CAMURA010000009.1 GCA947097335_00548 gene open 20409-20735
1130 CAMURA010000009.1 GCA947097335_00549 gene open 20763-22988 traD
1131 CAMURA010000009.1 GCA947097335_00550 gene open 22985-23488
1132 CAMURA010000009.1 GCA947097335_00551 gene open 23505-24230
1133 CAMURA010000009.1 GCA947097335_00552 gene open 24209-24955
1134 CAMURA010000009.1 GCA947097335_00553 gene open 24970-25644 pilL
1135 CAMURA010000009.1 GCA947097335_00554 gene open 25799-26383
1136 CAMURA010000009.1 GCA947097335_00555 gene open 26641-27282
1137 CAMURA010000009.1 GCA947097335_00556 gene open 27389-27835
1138 CAMURA010000009.1 GCA947097335_00557 gene open 27932-28090
1139 CAMURA010000009.1 GCA947097335_00558 gene open 28111-28332
1140 CAMURA010000009.1 GCA947097335_00559 gene open 29245-31305
1141 CAMURA010000009.1 GCA947097335_00560 gene open 31318-31566
1142 CAMURA010000009.1 GCA947097335_00561 gene open 31824-32300
1143 CAMURA010000009.1 GCA947097335_00562 gene open 32343-32726
1144 CAMURA010000009.1 GCA947097335_00563 gene open 32915-33412
1145 CAMURA010000009.1 GCA947097335_00564 gene open 33432-34199
1146 CAMURA010000009.1 GCA947097335_00565 gene open 34445-35731
1147 CAMURA010000009.1 GCA947097335_00566 gene open 35832-36380
1148 CAMURA010000009.1 GCA947097335_00567 gene open 36398-38110 parB
1149 CAMURA010000009.1 GCA947097335_00568 gene open 38124-39491 dnaB
1150 CAMURA010000009.1 GCA947097335_00569 gene open 39504-40337 parA
1151 CAMURA010000009.1 GCA947097335_00572 gene open 40755-41312 pgsA
1152 CAMURA010000009.1 GCA947097335_00573 gene open 41498-42691 metC
1153 CAMURA010000009.1 GCA947097335_00574 gene open 42892-43953 ompC
1154 CAMURA010000009.1 GCA947097335_00570 gene open 40437-40523 trnL
1155 CAMURA010000009.1 GCA947097335_00571 gene open 40525-40600 trnG
1156 CAMURA010000009.1 GCA947097335_00570 tRNA open 40437-40523 trnL tRNA-Leu(taa)
1157 CAMURA010000009.1 GCA947097335_00571 tRNA open 40525-40600 trnG tRNA-Gly(gcc)
1158 CAMURA010000010.1 regulatory_region open 41516-41628 Alpha operon ribosome binding site
1159 CAMURA010000010.1 GCA947097335_00575 CDS open 122-1078 _na     318_aa hypothetical protein
1160 CAMURA010000010.1 GCA947097335_00576 CDS open 1112-2950 _na     612_aa ilvD dihydroxy-acid dehydratase
1161 CAMURA010000010.1 GCA947097335_00577 CDS open 3125-4705 _na     526_aa ilvA threonine ammonia-lyase%2C biosynthetic
1162 CAMURA010000010.1 GCA947097335_00578 CDS open 4863-5783 _na     306_aa Dialkylrecorsinol condensing enzyme
1163 CAMURA010000010.1 GCA947097335_00579 CDS open 5786-6946 _na     386_aa 3-oxoacyl-(Acyl-carrier-protein) synthase III
1164 CAMURA010000010.1 GCA947097335_00580 CDS open 6936-7325 _na     129_aa XRE family transcriptional regulator
1165 CAMURA010000010.1 GCA947097335_00581 CDS open 7415-8347 _na     310_aa Peptidase
1166 CAMURA010000010.1 GCA947097335_00582 CDS open 8344-9066 _na     240_aa sagG ABC transporter%2C ATP-binding protein SagG
1167 CAMURA010000010.1 GCA947097335_00583 CDS open 9060-10301 _na     413_aa ABC-2 type transporter
1168 CAMURA010000010.1 GCA947097335_00584 CDS open 10301-10591 _na     96_aa Carrier domain-containing protein
1169 CAMURA010000010.1 GCA947097335_00585 CDS open 10591-11577 _na     328_aa Beta-ketoacyl synthase
1170 CAMURA010000010.1 GCA947097335_00586 CDS open 11574-12161 _na     195_aa Beta-ketoacyl synthase N-terminal domain-containing protein
1171 CAMURA010000010.1 GCA947097335_00587 CDS open 12189-13433 _na     414_aa fabB beta-ketoacyl-ACP synthase
1172 CAMURA010000010.1 GCA947097335_00588 CDS open 13473-14201 _na     242_aa fabG 3-oxoacyl-ACP reductase FabG
1173 CAMURA010000010.1 GCA947097335_00589 CDS open 14251-14694 _na     147_aa Thioester dehydrase
1174 CAMURA010000010.1 GCA947097335_00590 CDS open 14687-15910 _na     407_aa 3-oxoacyl-(Acyl-carrier-protein) synthase II
1175 CAMURA010000010.1 GCA947097335_00591 CDS open 15918-16394 _na     158_aa Lipoprotein
1176 CAMURA010000010.1 GCA947097335_00592 CDS open 16401-18674 _na     757_aa SSD domain-containing protein
1177 CAMURA010000010.1 GCA947097335_00593 CDS open 18681-19265 _na     194_aa lolA Outer membrane lipoprotein carrier protein LolA
1178 CAMURA010000010.1 GCA947097335_00594 CDS open 19265-19717 _na     150_aa 4-hydroxybenzoyl-CoA thioesterase domain protein
1179 CAMURA010000010.1 GCA947097335_00595 CDS open 19719-20639 _na     306_aa Acyltransferase
1180 CAMURA010000010.1 GCA947097335_00596 CDS open 20636-21358 _na     240_aa Group 2 glycosyl transferase
1181 CAMURA010000010.1 GCA947097335_00597 CDS open 21355-22665 _na     436_aa AMP-binding enzyme family protein
1182 CAMURA010000010.1 GCA947097335_00598 CDS open 22658-23203 _na     181_aa DNA gyrase subunit B
1183 CAMURA010000010.1 GCA947097335_00599 CDS open 23252-24916 _na     554_aa AMP-binding enzyme family protein
1184 CAMURA010000010.1 GCA947097335_00600 CDS open 24916-25167 _na     83_aa acpP acyl carrier protein
1185 CAMURA010000010.1 GCA947097335_00601 CDS open 25169-25432 _na     87_aa Acyl carrier protein
1186 CAMURA010000010.1 GCA947097335_00602 CDS open 25410-26198 _na     262_aa Acyltransferase
1187 CAMURA010000010.1 GCA947097335_00603 CDS open 26183-26926 _na     247_aa Beta-ketoacyl synthase-like N-terminal domain-containing protein
1188 CAMURA010000010.1 GCA947097335_00604 CDS open 26933-27349 _na     138_aa Lipoprotein
1189 CAMURA010000010.1 GCA947097335_00605 CDS open 27540-27965 _na     141_aa Excinuclease ABC subunit A
1190 CAMURA010000010.1 GCA947097335_00606 CDS open 28053-28766 _na     237_aa yigB 5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB
1191 CAMURA010000010.1 GCA947097335_00607 CDS open 28777-29667 _na     296_aa xerC tyrosine recombinase XerC
1192 CAMURA010000010.1 GCA947097335_00608 CDS open 29683-30507 _na     274_aa dapF diaminopimelate epimerase
1193 CAMURA010000010.1 GCA947097335_00609 CDS open 30654-32498 _na     614_aa mdlB Multidrug ABC superfamily ATP binding cassette transporter%2C ABC protein
1194 CAMURA010000010.1 GCA947097335_00610 CDS open 32588-33505 _na     305_aa araC AraC family transcriptional regulator
1195 CAMURA010000010.1 GCA947097335_00611 CDS open 33619-33960 _na     113_aa 4-carboxymuconolactone decarboxylase
1196 CAMURA010000010.1 GCA947097335_00612 CDS open 34048-35091 _na     347_aa Heptosyltransferase II (RfaF)
1197 CAMURA010000010.1 GCA947097335_00613 CDS open 35179-35904 _na     241_aa 3-deoxy-D-manno-octulosonic acid kinase
1198 CAMURA010000010.1 GCA947097335_00614 CDS open 35964-36449 _na     161_aa coaD pantetheine-phosphate adenylyltransferase
1199 CAMURA010000010.1 GCA947097335_00615 CDS open 36450-37733 _na     427_aa waaA lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase
1200 CAMURA010000010.1 GCA947097335_00616 CDS open 37831-38592 _na     253_aa wcaA Group 2 glycosyl transferase
1201 CAMURA010000010.1 GCA947097335_00617 CDS open 38688-39077 _na     129_aa rplQ 50S ribosomal protein L17
1202 CAMURA010000010.1 GCA947097335_00618 CDS open 39119-40108 _na     329_aa rpoA DNA-directed RNA polymerase subunit alpha
1203 CAMURA010000010.1 GCA947097335_00619 CDS open 40137-40757 _na     206_aa rpsD 30S ribosomal protein S4
1204 CAMURA010000010.1 GCA947097335_00620 CDS open 40787-41176 _na     129_aa rpsK 30S ribosomal protein S11
1205 CAMURA010000010.1 GCA947097335_00621 CDS open 41192-41548 _na     118_aa rpsM 30S ribosomal protein S13
1206 CAMURA010000010.1 GCA947097335_00622 CDS open 41686-41799 _na     37_aa rpmJ 50S ribosomal protein L36
1207 CAMURA010000010.1 GCA947097335_00623 CDS open 41824-43149 _na     441_aa secY preprotein translocase subunit SecY
1208 CAMURA010000010.1 GCA947097335_00624 CDS open 43153-43425 _na     90_aa 50S ribosomal protein L15
1209 CAMURA010000010.1 GCA947097335_00575 gene open 122-1078
1210 CAMURA010000010.1 GCA947097335_00576 gene open 1112-2950 ilvD
1211 CAMURA010000010.1 GCA947097335_00577 gene open 3125-4705 ilvA
1212 CAMURA010000010.1 GCA947097335_00578 gene open 4863-5783
1213 CAMURA010000010.1 GCA947097335_00579 gene open 5786-6946
1214 CAMURA010000010.1 GCA947097335_00580 gene open 6936-7325
1215 CAMURA010000010.1 GCA947097335_00581 gene open 7415-8347
1216 CAMURA010000010.1 GCA947097335_00582 gene open 8344-9066 sagG
1217 CAMURA010000010.1 GCA947097335_00583 gene open 9060-10301
1218 CAMURA010000010.1 GCA947097335_00584 gene open 10301-10591
1219 CAMURA010000010.1 GCA947097335_00585 gene open 10591-11577
1220 CAMURA010000010.1 GCA947097335_00586 gene open 11574-12161
1221 CAMURA010000010.1 GCA947097335_00587 gene open 12189-13433 fabB
1222 CAMURA010000010.1 GCA947097335_00588 gene open 13473-14201 fabG
1223 CAMURA010000010.1 GCA947097335_00589 gene open 14251-14694
1224 CAMURA010000010.1 GCA947097335_00590 gene open 14687-15910
1225 CAMURA010000010.1 GCA947097335_00591 gene open 15918-16394
1226 CAMURA010000010.1 GCA947097335_00592 gene open 16401-18674
1227 CAMURA010000010.1 GCA947097335_00593 gene open 18681-19265 lolA
1228 CAMURA010000010.1 GCA947097335_00594 gene open 19265-19717
1229 CAMURA010000010.1 GCA947097335_00595 gene open 19719-20639
1230 CAMURA010000010.1 GCA947097335_00596 gene open 20636-21358
1231 CAMURA010000010.1 GCA947097335_00597 gene open 21355-22665
1232 CAMURA010000010.1 GCA947097335_00598 gene open 22658-23203
1233 CAMURA010000010.1 GCA947097335_00599 gene open 23252-24916
1234 CAMURA010000010.1 GCA947097335_00600 gene open 24916-25167 acpP
1235 CAMURA010000010.1 GCA947097335_00601 gene open 25169-25432
1236 CAMURA010000010.1 GCA947097335_00602 gene open 25410-26198
1237 CAMURA010000010.1 GCA947097335_00603 gene open 26183-26926
1238 CAMURA010000010.1 GCA947097335_00604 gene open 26933-27349
1239 CAMURA010000010.1 GCA947097335_00605 gene open 27540-27965
1240 CAMURA010000010.1 GCA947097335_00606 gene open 28053-28766 yigB
1241 CAMURA010000010.1 GCA947097335_00607 gene open 28777-29667 xerC
1242 CAMURA010000010.1 GCA947097335_00608 gene open 29683-30507 dapF
1243 CAMURA010000010.1 GCA947097335_00609 gene open 30654-32498 mdlB
1244 CAMURA010000010.1 GCA947097335_00610 gene open 32588-33505 araC
1245 CAMURA010000010.1 GCA947097335_00611 gene open 33619-33960
1246 CAMURA010000010.1 GCA947097335_00612 gene open 34048-35091
1247 CAMURA010000010.1 GCA947097335_00613 gene open 35179-35904
1248 CAMURA010000010.1 GCA947097335_00614 gene open 35964-36449 coaD
1249 CAMURA010000010.1 GCA947097335_00615 gene open 36450-37733 waaA
1250 CAMURA010000010.1 GCA947097335_00616 gene open 37831-38592 wcaA
1251 CAMURA010000010.1 GCA947097335_00617 gene open 38688-39077 rplQ
1252 CAMURA010000010.1 GCA947097335_00618 gene open 39119-40108 rpoA
1253 CAMURA010000010.1 GCA947097335_00619 gene open 40137-40757 rpsD
1254 CAMURA010000010.1 GCA947097335_00620 gene open 40787-41176 rpsK
1255 CAMURA010000010.1 GCA947097335_00621 gene open 41192-41548 rpsM
1256 CAMURA010000010.1 GCA947097335_00622 gene open 41686-41799 rpmJ
1257 CAMURA010000010.1 GCA947097335_00623 gene open 41824-43149 secY
1258 CAMURA010000010.1 GCA947097335_00624 gene open 43153-43425
1259 CAMURA010000011.1 regulatory_region open 21729-21831 TPP riboswitch aptamer (THI element)
1260 CAMURA010000011.1 repeat_region open 235-5582 CRISPR array with 89 repeats of length 28%2C consensus sequence CTTCACTGCCGAATAGGCAGCTTAGAAA and spacer length 32
1261 CAMURA010000011.1 GCA947097335_00625 CDS open 5896-7236 _na     446_aa csy1 type I-F CRISPR-associated protein Csy1
1262 CAMURA010000011.1 GCA947097335_00626 CDS open 7246-8205 _na     319_aa csy2 type I-F CRISPR-associated protein Csy2
1263 CAMURA010000011.1 GCA947097335_00627 CDS open 8205-9203 _na     332_aa csy3 type I-F CRISPR-associated protein Csy3
1264 CAMURA010000011.1 GCA947097335_00628 CDS open 9206-9766 _na     186_aa cas6f type I-F CRISPR-associated endoribonuclease Cas6/Csy4
1265 CAMURA010000011.1 GCA947097335_00629 CDS open 9814-13107 _na     1097_aa cas3f type I-F CRISPR-associated helicase Cas3f
1266 CAMURA010000011.1 GCA947097335_00630 CDS open 13104-14069 _na     321_aa cas1f type I-F CRISPR-associated endonuclease Cas1f
1267 CAMURA010000011.1 GCA947097335_00631 CDS open 14442-15197 _na     251_aa Nif3-like dinuclear metal center hexameric protein
1268 CAMURA010000011.1 GCA947097335_00632 CDS open 15288-16076 _na     262_aa fabI Enoyl-[acyl-carrier-protein] reductase [NADH] FabI
1269 CAMURA010000011.1 GCA947097335_00633 CDS open 16200-18179 _na     659_aa rnb exoribonuclease II
1270 CAMURA010000011.1 GCA947097335_00634 CDS open 18301-18783 _na     160_aa DNA starvation/stationary phase protection protein Dps
1271 CAMURA010000011.1 GCA947097335_00635 CDS open 18974-20134 _na     386_aa Multidrug resistance protein A
1272 CAMURA010000011.1 GCA947097335_00636 CDS open 20147-21661 _na     504_aa araJ MFS transporter
1273 CAMURA010000011.1 GCA947097335_00637 CDS open 21914-22969 _na     351_aa ABC transporter substrate-binding protein
1274 CAMURA010000011.1 GCA947097335_00638 CDS open 23124-23402 _na     92_aa hipB Antitoxin HipB
1275 CAMURA010000011.1 GCA947097335_00639 CDS open 23402-24673 _na     423_aa hipA Serine/threonine-protein kinase HipA
1276 CAMURA010000011.1 GCA947097335_00640 CDS open 24756-27620 _na     954_aa valS valine--tRNA ligase
1277 CAMURA010000011.1 GCA947097335_00641 CDS open 27644-28945 _na     433_aa transglycosylase domain-containing protein
1278 CAMURA010000011.1 GCA947097335_00642 CDS open 29034-29345 _na     103_aa yqfB N(4)-acetylcytidine aminohydrolase
1279 CAMURA010000011.1 GCA947097335_00643 CDS open 29419-29865 _na     148_aa holC DNA-directed DNA polymerase III chi subunit
1280 CAMURA010000011.1 GCA947097335_00644 CDS open 30087-31481 _na     464_aa fumC class II fumarate hydratase
1281 CAMURA010000011.1 GCA947097335_00645 CDS open 31580-32185 _na     201_aa Chalcone isomerase domain-containing protein
1282 CAMURA010000011.1 GCA947097335_00646 CDS open 32239-32778 _na     179_aa ycfP alpha/beta hydrolase YcfP
1283 CAMURA010000011.1 GCA947097335_00647 CDS open 32775-33680 _na     301_aa putative alpha-L-glutamate ligase
1284 CAMURA010000011.1 GCA947097335_00648 CDS open 33699-34235 _na     178_aa NADPH-flavin oxidoreductase
1285 CAMURA010000011.1 GCA947097335_00649 CDS open 34243-34434 _na     63_aa hypothetical protein
1286 CAMURA010000011.1 GCA947097335_00650 CDS open 34571-34834 _na     87_aa grxA GrxA family glutaredoxin
1287 CAMURA010000011.1 GCA947097335_00651 CDS open 35247-36461 _na     404_aa sdaC Aromatic amino acid permease
1288 CAMURA010000011.1 GCA947097335_00652 CDS open 36596-37057 _na     153_aa Ascorbate-specific PTS system EIIA component
1289 CAMURA010000011.1 GCA947097335_00653 CDS open 37201-37536 _na     111_aa DUF496 domain-containing protein
1290 CAMURA010000011.1 GCA947097335_00654 CDS open 37734-38816 _na     360_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
1291 CAMURA010000011.1 GCA947097335_00655 CDS open 38896-39993 _na     365_aa hisC histidinol-phosphate transaminase
1292 CAMURA010000011.1 GCA947097335_00656 CDS open 40004-41314 _na     436_aa aroA 3-phosphoshikimate 1-carboxyvinyltransferase
1293 CAMURA010000011.1 GCA947097335_00657 CDS open 41408-41875 _na     155_aa rnhA ribonuclease HI
1294 CAMURA010000011.1 GCA947097335_00658 CDS open 41943-42704 _na     253_aa dnaQ DNA polymerase III subunit epsilon
1295 CAMURA010000011.1 GCA947097335_00625 gene open 5896-7236 csy1
1296 CAMURA010000011.1 GCA947097335_00626 gene open 7246-8205 csy2
1297 CAMURA010000011.1 GCA947097335_00627 gene open 8205-9203 csy3
1298 CAMURA010000011.1 GCA947097335_00628 gene open 9206-9766 cas6f
1299 CAMURA010000011.1 GCA947097335_00629 gene open 9814-13107 cas3f
1300 CAMURA010000011.1 GCA947097335_00630 gene open 13104-14069 cas1f
1301 CAMURA010000011.1 GCA947097335_00631 gene open 14442-15197
1302 CAMURA010000011.1 GCA947097335_00632 gene open 15288-16076 fabI
1303 CAMURA010000011.1 GCA947097335_00633 gene open 16200-18179 rnb
1304 CAMURA010000011.1 GCA947097335_00634 gene open 18301-18783
1305 CAMURA010000011.1 GCA947097335_00635 gene open 18974-20134
1306 CAMURA010000011.1 GCA947097335_00636 gene open 20147-21661 araJ
1307 CAMURA010000011.1 GCA947097335_00637 gene open 21914-22969
1308 CAMURA010000011.1 GCA947097335_00638 gene open 23124-23402 hipB
1309 CAMURA010000011.1 GCA947097335_00639 gene open 23402-24673 hipA
1310 CAMURA010000011.1 GCA947097335_00640 gene open 24756-27620 valS
1311 CAMURA010000011.1 GCA947097335_00641 gene open 27644-28945
1312 CAMURA010000011.1 GCA947097335_00642 gene open 29034-29345 yqfB
1313 CAMURA010000011.1 GCA947097335_00643 gene open 29419-29865 holC
1314 CAMURA010000011.1 GCA947097335_00644 gene open 30087-31481 fumC
1315 CAMURA010000011.1 GCA947097335_00645 gene open 31580-32185
1316 CAMURA010000011.1 GCA947097335_00646 gene open 32239-32778 ycfP
1317 CAMURA010000011.1 GCA947097335_00647 gene open 32775-33680
1318 CAMURA010000011.1 GCA947097335_00648 gene open 33699-34235
1319 CAMURA010000011.1 GCA947097335_00649 gene open 34243-34434
1320 CAMURA010000011.1 GCA947097335_00650 gene open 34571-34834 grxA
1321 CAMURA010000011.1 GCA947097335_00651 gene open 35247-36461 sdaC
1322 CAMURA010000011.1 GCA947097335_00652 gene open 36596-37057
1323 CAMURA010000011.1 GCA947097335_00653 gene open 37201-37536
1324 CAMURA010000011.1 GCA947097335_00654 gene open 37734-38816 serC
1325 CAMURA010000011.1 GCA947097335_00655 gene open 38896-39993 hisC
1326 CAMURA010000011.1 GCA947097335_00656 gene open 40004-41314 aroA
1327 CAMURA010000011.1 GCA947097335_00657 gene open 41408-41875 rnhA
1328 CAMURA010000011.1 GCA947097335_00658 gene open 41943-42704 dnaQ
1329 CAMURA010000012.1 GCA947097335_00659 CDS open 48-443 _na     131_aa hypothetical protein
1330 CAMURA010000012.1 GCA947097335_00660 CDS open 488-1735 _na     415_aa clpX ATP-dependent protease ATP-binding subunit ClpX
1331 CAMURA010000012.1 GCA947097335_00661 CDS open 1745-2326 _na     193_aa clpP ATP-dependent Clp endopeptidase proteolytic subunit ClpP
1332 CAMURA010000012.1 GCA947097335_00662 CDS open 2405-2524 _na     39_aa hypothetical protein
1333 CAMURA010000012.1 GCA947097335_00663 CDS open 2553-4160 _na     535_aa Sulfatase N-terminal domain-containing protein
1334 CAMURA010000012.1 GCA947097335_00664 CDS open 4399-6675 _na     758_aa gshB bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB
1335 CAMURA010000012.1 GCA947097335_00665 CDS open 7118-8773 _na     551_aa pilus assembly protein TadG-related protein
1336 CAMURA010000012.1 GCA947097335_00666 CDS open 8804-9382 _na     192_aa tadF Pilus assembly protein TadF
1337 CAMURA010000012.1 GCA947097335_00667 CDS open 9481-10068 _na     195_aa tadE Protein TadE
1338 CAMURA010000012.1 GCA947097335_00668 CDS open 10083-10844 _na     253_aa lapB lipopolysaccharide assembly protein LapB
1339 CAMURA010000012.1 GCA947097335_00669 CDS open 10834-11700 _na     288_aa tadB Flp pilus assembly protein TadB
1340 CAMURA010000012.1 GCA947097335_00670 CDS open 11697-12584 _na     295_aa tadB Flp pilus assembly protein TadB
1341 CAMURA010000012.1 GCA947097335_00671 CDS open 12581-13861 _na     426_aa tadA TadA
1342 CAMURA010000012.1 GCA947097335_00672 CDS open 13875-14996 _na     373_aa cpaE Flp pilus assembly protein%2C ATPase CpaE
1343 CAMURA010000012.1 GCA947097335_00673 CDS open 15012-15515 _na     167_aa rcpB RcpB protein
1344 CAMURA010000012.1 GCA947097335_00674 CDS open 15512-16894 _na     460_aa pulD Pullulanase secretion envelope pulD
1345 CAMURA010000012.1 GCA947097335_00675 CDS open 16896-17723 _na     275_aa flp operon protein C
1346 CAMURA010000012.1 GCA947097335_00676 CDS open 17768-18196 _na     142_aa prepilin peptidase
1347 CAMURA010000012.1 GCA947097335_00677 CDS open 18209-18436 _na     75_aa Flp family type IVb pilin
1348 CAMURA010000012.1 GCA947097335_00678 CDS open 18498-18728 _na     76_aa Flp family type IVb pilin
1349 CAMURA010000012.1 GCA947097335_00679 CDS open 19286-20395 _na     369_aa PhoH-like protein
1350 CAMURA010000012.1 GCA947097335_00680 CDS open 20388-20852 _na     154_aa ybeY rRNA maturation RNase YbeY
1351 CAMURA010000012.1 GCA947097335_00681 CDS open 20849-22786 _na     645_aa tmcA tRNA(Met) cytidine acetyltransferase TmcA
1352 CAMURA010000012.1 GCA947097335_00682 CDS open 22837-23013 _na     58_aa DUF5363 domain-containing protein
1353 CAMURA010000012.1 GCA947097335_00683 CDS open 23138-26590 _na     1150_aa mfd transcription-repair coupling factor
1354 CAMURA010000012.1 GCA947097335_00685 CDS open 26914-29772 _na     952_aa rne ribonuclease E
1355 CAMURA010000012.1 GCA947097335_00686 CDS open 29753-29905 _na     50_aa hypothetical protein
1356 CAMURA010000012.1 GCA947097335_00687 CDS open 30194-31198 _na     334_aa rluC 23S rRNA pseudouridine(955/2504/2580) synthase RluC
1357 CAMURA010000012.1 GCA947097335_00688 CDS open 31307-31630 _na     107_aa trxA thioredoxin
1358 CAMURA010000012.1 GCA947097335_00689 CDS open 31727-32722 _na     331_aa ldhA D-lactate dehydrogenase
1359 CAMURA010000012.1 GCA947097335_00690 CDS open 32746-33855 _na     369_aa metC methionine biosynthesis PLP-dependent protein
1360 CAMURA010000012.1 GCA947097335_00694 CDS open 34534-35886 _na     450_aa lysC lysine-sensitive aspartokinase 3
1361 CAMURA010000012.1 GCA947097335_00695 CDS open 36006-37268 _na     420_aa glutamate-5-semialdehyde dehydrogenase
1362 CAMURA010000012.1 GCA947097335_00696 CDS open 37277-37948 _na     223_aa yadS Glycine transporter domain-containing protein
1363 CAMURA010000012.1 GCA947097335_00697 CDS open 38160-38966 _na     268_aa Gamma-glutamyl phosphate reductase
1364 CAMURA010000012.1 GCA947097335_00698 CDS open 39064-39879 _na     271_aa fbp class 1 fructose-bisphosphatase
1365 CAMURA010000012.1 GCA947097335_00659 gene open 48-443
1366 CAMURA010000012.1 GCA947097335_00660 gene open 488-1735 clpX
1367 CAMURA010000012.1 GCA947097335_00661 gene open 1745-2326 clpP
1368 CAMURA010000012.1 GCA947097335_00662 gene open 2405-2524
1369 CAMURA010000012.1 GCA947097335_00663 gene open 2553-4160
1370 CAMURA010000012.1 GCA947097335_00664 gene open 4399-6675 gshB
1371 CAMURA010000012.1 GCA947097335_00665 gene open 7118-8773
1372 CAMURA010000012.1 GCA947097335_00666 gene open 8804-9382 tadF
1373 CAMURA010000012.1 GCA947097335_00667 gene open 9481-10068 tadE
1374 CAMURA010000012.1 GCA947097335_00668 gene open 10083-10844 lapB
1375 CAMURA010000012.1 GCA947097335_00669 gene open 10834-11700 tadB
1376 CAMURA010000012.1 GCA947097335_00670 gene open 11697-12584 tadB
1377 CAMURA010000012.1 GCA947097335_00671 gene open 12581-13861 tadA
1378 CAMURA010000012.1 GCA947097335_00672 gene open 13875-14996 cpaE
1379 CAMURA010000012.1 GCA947097335_00673 gene open 15012-15515 rcpB
1380 CAMURA010000012.1 GCA947097335_00674 gene open 15512-16894 pulD
1381 CAMURA010000012.1 GCA947097335_00675 gene open 16896-17723
1382 CAMURA010000012.1 GCA947097335_00676 gene open 17768-18196
1383 CAMURA010000012.1 GCA947097335_00677 gene open 18209-18436
1384 CAMURA010000012.1 GCA947097335_00678 gene open 18498-18728
1385 CAMURA010000012.1 GCA947097335_00679 gene open 19286-20395
1386 CAMURA010000012.1 GCA947097335_00680 gene open 20388-20852 ybeY
1387 CAMURA010000012.1 GCA947097335_00681 gene open 20849-22786 tmcA
1388 CAMURA010000012.1 GCA947097335_00682 gene open 22837-23013
1389 CAMURA010000012.1 GCA947097335_00683 gene open 23138-26590 mfd
1390 CAMURA010000012.1 GCA947097335_00685 gene open 26914-29772 rne
1391 CAMURA010000012.1 GCA947097335_00686 gene open 29753-29905
1392 CAMURA010000012.1 GCA947097335_00687 gene open 30194-31198 rluC
1393 CAMURA010000012.1 GCA947097335_00688 gene open 31307-31630 trxA
1394 CAMURA010000012.1 GCA947097335_00689 gene open 31727-32722 ldhA
1395 CAMURA010000012.1 GCA947097335_00690 gene open 32746-33855 metC
1396 CAMURA010000012.1 GCA947097335_00694 gene open 34534-35886 lysC
1397 CAMURA010000012.1 GCA947097335_00695 gene open 36006-37268
1398 CAMURA010000012.1 GCA947097335_00696 gene open 37277-37948 yadS
1399 CAMURA010000012.1 GCA947097335_00697 gene open 38160-38966
1400 CAMURA010000012.1 GCA947097335_00698 gene open 39064-39879 fbp
1401 CAMURA010000012.1 GCA947097335_00684 gene open 26732-26821 trnS
1402 CAMURA010000012.1 GCA947097335_00691 gene open 34097-34172 trnG
1403 CAMURA010000012.1 GCA947097335_00692 gene open 34180-34253 trnC
1404 CAMURA010000012.1 GCA947097335_00693 gene open 34285-34371 trnL
1405 CAMURA010000012.1 GCA947097335_00684 tRNA open 26732-26821 trnS tRNA-Ser(tga)
1406 CAMURA010000012.1 GCA947097335_00691 tRNA open 34097-34172 trnG tRNA-Gly(gcc)
1407 CAMURA010000012.1 GCA947097335_00692 tRNA open 34180-34253 trnC tRNA-Cys(gca)
1408 CAMURA010000012.1 GCA947097335_00693 tRNA open 34285-34371 trnL tRNA-Leu(taa)
1409 CAMURA010000013.1 regulatory_region open 317-450 CpoB/ybgF ICR thermometer
1410 CAMURA010000013.1 regulatory_region open 23719-23847 Histidine operon leader
1411 CAMURA010000013.1 GCA947097335_00700 CDS open 351-803 _na     150_aa pal peptidoglycan-associated lipoprotein Pal
1412 CAMURA010000013.1 GCA947097335_00701 CDS open 818-2098 _na     426_aa tolB Tol-Pal system beta propeller repeat protein TolB
1413 CAMURA010000013.1 GCA947097335_00702 CDS open 2132-3247 _na     371_aa tolA cell envelope integrity protein TolA
1414 CAMURA010000013.1 GCA947097335_00703 CDS open 3265-3687 _na     140_aa tolR colicin uptake protein TolR
1415 CAMURA010000013.1 GCA947097335_00704 CDS open 3773-4462 _na     229_aa tolQ protein TolQ
1416 CAMURA010000013.1 GCA947097335_00705 CDS open 4492-4896 _na     134_aa ybgC tol-pal system-associated acyl-CoA thioesterase
1417 CAMURA010000013.1 GCA947097335_00706 CDS open 5011-5298 _na     95_aa ybgE cyd operon protein YbgE
1418 CAMURA010000013.1 GCA947097335_00707 CDS open 5303-5401 _na     32_aa hypothetical protein
1419 CAMURA010000013.1 GCA947097335_00708 CDS open 5412-6551 _na     379_aa cydB cytochrome d ubiquinol oxidase subunit II
1420 CAMURA010000013.1 GCA947097335_00709 CDS open 6566-8131 _na     521_aa Cytochrome D ubiquinol oxidase subunit I
1421 CAMURA010000013.1 GCA947097335_00710 CDS open 8576-8899 _na     107_aa ruvB ATP-dependent DNA helicase RuvB
1422 CAMURA010000013.1 GCA947097335_00711 CDS open 8951-9964 _na     337_aa ruvB Holliday junction branch migration DNA helicase RuvB
1423 CAMURA010000013.1 GCA947097335_00712 CDS open 9980-10594 _na     204_aa ruvA Holliday junction branch migration protein RuvA
1424 CAMURA010000013.1 GCA947097335_00713 CDS open 10658-11230 _na     190_aa ruvC crossover junction endodeoxyribonuclease RuvC
1425 CAMURA010000013.1 GCA947097335_00714 CDS open 11288-11719 _na     143_aa Excinuclease ABC subunit A
1426 CAMURA010000013.1 GCA947097335_00715 CDS open 11729-12469 _na     246_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
1427 CAMURA010000013.1 GCA947097335_00716 CDS open 12482-12862 _na     126_aa Dihydroneopterin triphosphate diphosphatase
1428 CAMURA010000013.1 GCA947097335_00717 CDS open 13040-14308 _na     422_aa mntH Nramp family divalent metal transporter
1429 CAMURA010000013.1 GCA947097335_00718 CDS open 14581-16347 _na     588_aa aspS aspartate--tRNA ligase
1430 CAMURA010000013.1 GCA947097335_00719 CDS open 16514-17236 _na     240_aa cmoA carboxy-S-adenosyl-L-methionine synthase CmoA
1431 CAMURA010000013.1 GCA947097335_00720 CDS open 17332-19896 _na     854_aa Brp/Blh family beta-carotene 15%2C15'-monooxygenase
1432 CAMURA010000013.1 GCA947097335_00721 CDS open 20197-22296 _na     699_aa Ferric enterobactin receptor
1433 CAMURA010000013.1 GCA947097335_00722 CDS open 22444-22851 _na     135_aa gloA lactoylglutathione lyase
1434 CAMURA010000013.1 GCA947097335_00723 CDS open 22939-23592 _na     217_aa rnt ribonuclease T
1435 CAMURA010000013.1 GCA947097335_00724 CDS open 23950-25299 _na     449_aa gntP GntP family gluconate:H+ symporter
1436 CAMURA010000013.1 GCA947097335_00725 CDS open 25356-25928 _na     190_aa Primosomal replication protein N
1437 CAMURA010000013.1 GCA947097335_00726 CDS open 25984-27408 _na     474_aa miaB tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB
1438 CAMURA010000013.1 GCA947097335_00727 CDS open 27695-28423 _na     242_aa queH Epoxyqueuosine reductase QueH
1439 CAMURA010000013.1 GCA947097335_00728 CDS open 28425-29414 _na     329_aa ispB octaprenyl diphosphate synthase
1440 CAMURA010000013.1 GCA947097335_00729 CDS open 29655-29966 _na     103_aa rplU 50S ribosomal protein L21
1441 CAMURA010000013.1 GCA947097335_00730 CDS open 29987-30244 _na     85_aa rpmA 50S ribosomal protein L27
1442 CAMURA010000013.1 GCA947097335_00731 CDS open 30275-31228 _na     317_aa L-rhamnose-H(+) symporter
1443 CAMURA010000013.1 GCA947097335_00732 CDS open 31256-32431 _na     391_aa cgtA Obg family GTPase CgtA
1444 CAMURA010000013.1 GCA947097335_00733 CDS open 32505-32987 _na     160_aa smpB SsrA-binding protein SmpB
1445 CAMURA010000013.1 GCA947097335_00734 CDS open 33227-33931 _na     234_aa arcA two-component system response regulator ArcA
1446 CAMURA010000013.1 GCA947097335_00735 CDS open 34175-34315 _na     46_aa ykgO type B 50S ribosomal protein L36
1447 CAMURA010000013.1 GCA947097335_00736 CDS open 34325-34591 _na     88_aa rpmE2 type B 50S ribosomal protein L31
1448 CAMURA010000013.1 GCA947097335_00737 CDS open 34809-35369 _na     186_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
1449 CAMURA010000013.1 GCA947097335_00738 CDS open 35523-37289 _na     588_aa dsbD Thiol:disulfide interchange protein DsbD
1450 CAMURA010000013.1 GCA947097335_00739 CDS open 37401-38213 _na     270_aa 5'-nucleotidase%2C lipoprotein e(P4) family
1451 CAMURA010000013.1 GCA947097335_00740 CDS open 38343-39404 _na     353_aa znuA zinc ABC transporter substrate-binding protein ZnuA
1452 CAMURA010000013.1 GCA947097335_00700 gene open 351-803 pal
1453 CAMURA010000013.1 GCA947097335_00701 gene open 818-2098 tolB
1454 CAMURA010000013.1 GCA947097335_00702 gene open 2132-3247 tolA
1455 CAMURA010000013.1 GCA947097335_00703 gene open 3265-3687 tolR
1456 CAMURA010000013.1 GCA947097335_00704 gene open 3773-4462 tolQ
1457 CAMURA010000013.1 GCA947097335_00705 gene open 4492-4896 ybgC
1458 CAMURA010000013.1 GCA947097335_00706 gene open 5011-5298 ybgE
1459 CAMURA010000013.1 GCA947097335_00707 gene open 5303-5401
1460 CAMURA010000013.1 GCA947097335_00708 gene open 5412-6551 cydB
1461 CAMURA010000013.1 GCA947097335_00709 gene open 6566-8131
1462 CAMURA010000013.1 GCA947097335_00710 gene open 8576-8899 ruvB
1463 CAMURA010000013.1 GCA947097335_00711 gene open 8951-9964 ruvB
1464 CAMURA010000013.1 GCA947097335_00712 gene open 9980-10594 ruvA
1465 CAMURA010000013.1 GCA947097335_00713 gene open 10658-11230 ruvC
1466 CAMURA010000013.1 GCA947097335_00714 gene open 11288-11719
1467 CAMURA010000013.1 GCA947097335_00715 gene open 11729-12469 tACO1
1468 CAMURA010000013.1 GCA947097335_00716 gene open 12482-12862
1469 CAMURA010000013.1 GCA947097335_00717 gene open 13040-14308 mntH
1470 CAMURA010000013.1 GCA947097335_00718 gene open 14581-16347 aspS
1471 CAMURA010000013.1 GCA947097335_00719 gene open 16514-17236 cmoA
1472 CAMURA010000013.1 GCA947097335_00720 gene open 17332-19896
1473 CAMURA010000013.1 GCA947097335_00721 gene open 20197-22296
1474 CAMURA010000013.1 GCA947097335_00722 gene open 22444-22851 gloA
1475 CAMURA010000013.1 GCA947097335_00723 gene open 22939-23592 rnt
1476 CAMURA010000013.1 GCA947097335_00724 gene open 23950-25299 gntP
1477 CAMURA010000013.1 GCA947097335_00725 gene open 25356-25928
1478 CAMURA010000013.1 GCA947097335_00726 gene open 25984-27408 miaB
1479 CAMURA010000013.1 GCA947097335_00727 gene open 27695-28423 queH
1480 CAMURA010000013.1 GCA947097335_00728 gene open 28425-29414 ispB
1481 CAMURA010000013.1 GCA947097335_00729 gene open 29655-29966 rplU
1482 CAMURA010000013.1 GCA947097335_00730 gene open 29987-30244 rpmA
1483 CAMURA010000013.1 GCA947097335_00731 gene open 30275-31228
1484 CAMURA010000013.1 GCA947097335_00732 gene open 31256-32431 cgtA
1485 CAMURA010000013.1 GCA947097335_00733 gene open 32505-32987 smpB
1486 CAMURA010000013.1 GCA947097335_00734 gene open 33227-33931 arcA
1487 CAMURA010000013.1 GCA947097335_00735 gene open 34175-34315 ykgO
1488 CAMURA010000013.1 GCA947097335_00736 gene open 34325-34591 rpmE2
1489 CAMURA010000013.1 GCA947097335_00737 gene open 34809-35369
1490 CAMURA010000013.1 GCA947097335_00738 gene open 35523-37289 dsbD
1491 CAMURA010000013.1 GCA947097335_00739 gene open 37401-38213
1492 CAMURA010000013.1 GCA947097335_00740 gene open 38343-39404 znuA
1493 CAMURA010000013.1 GCA947097335_00699 gene open 79-154 trnK
1494 CAMURA010000013.1 GCA947097335_00699 tRNA open 79-154 trnK tRNA-Lys(ttt)
1495 CAMURA010000014.1 GCA947097335_00741 CDS open 1622-1738 _na     38_aa hypothetical protein
1496 CAMURA010000014.1 GCA947097335_00742 CDS open 1820-2452 _na     210_aa zevA zinc transporter binding subunit ZevA
1497 CAMURA010000014.1 GCA947097335_00743 CDS open 2467-3501 _na     344_aa zevB zinc transporter permease subunit ZevB
1498 CAMURA010000014.1 GCA947097335_00745 CDS open 4112-6154 _na     680_aa uvrB excinuclease ABC subunit UvrB
1499 CAMURA010000014.1 GCA947097335_00746 CDS open 6234-7619 _na     461_aa Protease do
1500 CAMURA010000014.1 GCA947097335_00747 CDS open 7807-8214 _na     135_aa Z-ring associated protein G