BAKTAGenome Explorer: Alloprevotella sp. HMT-473 (GCA_947097345.1)
Select a Genome:
|
BAKTA Annotations for GCA_947097345.1
|
Search & Sort all 3556 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3001 | CAMURC010000117.1 | GCA947097345_01497 | gene | open | 527-859 | |||
| 3002 | CAMURC010000117.1 | GCA947097345_01498 | gene | open | 859-1242 | merR | ||
| 3003 | CAMURC010000117.1 | GCA947097345_01499 | gene | open | 1239-3305 | |||
| 3004 | CAMURC010000117.1 | GCA947097345_01500 | gene | open | 3293-3598 | |||
| 3005 | CAMURC010000117.1 | GCA947097345_01501 | gene | open | 3816-5117 | |||
| 3006 | CAMURC010000117.1 | GCA947097345_01502 | gene | open | 5121-5708 | rloB | ||
| 3007 | CAMURC010000117.1 | GCA947097345_01503 | gene | open | 5806-7473 | |||
| 3008 | CAMURC010000118.1 | GCA947097345_01505 | gene | open | 3599-3705 | Bacteroidales_small_SRP | ||
| 3009 | CAMURC010000118.1 | GCA947097345_01505 | ncRNA | open | 3599-3705 | Bacteroidales small SRP | ||
| 3010 | CAMURC010000118.1 | GCA947097345_01504 | CDS | open | 597-3281 | _na 894_aa | hypothetical protein | |
| 3011 | CAMURC010000118.1 | GCA947097345_01507 | CDS | open | 4098-4784 | _na 228_aa | ftsE | Putative cell division ATP-binding protein FtsE |
| 3012 | CAMURC010000118.1 | GCA947097345_01508 | CDS | open | 4929-6242 | _na 437_aa | Aspartokinase | |
| 3013 | CAMURC010000118.1 | GCA947097345_01509 | CDS | open | 6383-7522 | _na 379_aa | lysA | diaminopimelate decarboxylase |
| 3014 | CAMURC010000118.1 | GCA947097345_01504 | gene | open | 597-3281 | |||
| 3015 | CAMURC010000118.1 | GCA947097345_01507 | gene | open | 4098-4784 | ftsE | ||
| 3016 | CAMURC010000118.1 | GCA947097345_01508 | gene | open | 4929-6242 | |||
| 3017 | CAMURC010000118.1 | GCA947097345_01509 | gene | open | 6383-7522 | lysA | ||
| 3018 | CAMURC010000118.1 | GCA947097345_01506 | gene | open | 3706-3779 | trnT | ||
| 3019 | CAMURC010000118.1 | GCA947097345_01506 | tRNA | open | 3706-3779 | trnT | tRNA-Thr(tgt) | |
| 3020 | CAMURC010000119.1 | GCA947097345_01510 | CDS | open | 206-796 | _na 196_aa | hypothetical protein | |
| 3021 | CAMURC010000119.1 | GCA947097345_01511 | CDS | open | 1091-3118 | _na 675_aa | pulA | type I pullulanase |
| 3022 | CAMURC010000119.1 | GCA947097345_01512 | CDS | open | 3704-4564 | _na 286_aa | ompA | OmpA family protein |
| 3023 | CAMURC010000119.1 | GCA947097345_01513 | CDS | open | 4646-5695 | _na 349_aa | Antioxidant%2C AhpC/TSA family | |
| 3024 | CAMURC010000119.1 | GCA947097345_01514 | CDS | open | 5698-7098 | _na 466_aa | Thioredoxin domain-containing protein | |
| 3025 | CAMURC010000119.1 | GCA947097345_01510 | gene | open | 206-796 | |||
| 3026 | CAMURC010000119.1 | GCA947097345_01511 | gene | open | 1091-3118 | pulA | ||
| 3027 | CAMURC010000119.1 | GCA947097345_01512 | gene | open | 3704-4564 | ompA | ||
| 3028 | CAMURC010000119.1 | GCA947097345_01513 | gene | open | 4646-5695 | |||
| 3029 | CAMURC010000119.1 | GCA947097345_01514 | gene | open | 5698-7098 | |||
| 3030 | CAMURC010000120.1 | GCA947097345_01515 | CDS | open | 36-2819 | _na 927_aa | SpoIID/LytB domain protein | |
| 3031 | CAMURC010000120.1 | GCA947097345_01516 | CDS | open | 2812-4095 | _na 427_aa | Transporter%2C major facilitator family protein | |
| 3032 | CAMURC010000120.1 | GCA947097345_01517 | CDS | open | 4120-4713 | _na 197_aa | DUF4199 domain-containing protein | |
| 3033 | CAMURC010000120.1 | GCA947097345_01518 | CDS | open | 4841-5104 | _na 87_aa | hypothetical protein | |
| 3034 | CAMURC010000120.1 | GCA947097345_01519 | CDS | open | 5201-6178 | _na 325_aa | Glycosyltransferase%2C group 2 family protein | |
| 3035 | CAMURC010000120.1 | GCA947097345_01520 | CDS | open | 6225-6749 | _na 174_aa | Lipoprotein | |
| 3036 | CAMURC010000120.1 | GCA947097345_01521 | CDS | open | 6915-7151 | _na 78_aa | hypothetical protein | |
| 3037 | CAMURC010000120.1 | GCA947097345_01515 | gene | open | 36-2819 | |||
| 3038 | CAMURC010000120.1 | GCA947097345_01516 | gene | open | 2812-4095 | |||
| 3039 | CAMURC010000120.1 | GCA947097345_01517 | gene | open | 4120-4713 | |||
| 3040 | CAMURC010000120.1 | GCA947097345_01518 | gene | open | 4841-5104 | |||
| 3041 | CAMURC010000120.1 | GCA947097345_01519 | gene | open | 5201-6178 | |||
| 3042 | CAMURC010000120.1 | GCA947097345_01520 | gene | open | 6225-6749 | |||
| 3043 | CAMURC010000120.1 | GCA947097345_01521 | gene | open | 6915-7151 | |||
| 3044 | CAMURC010000121.1 | GCA947097345_01522 | CDS | open | 357-1757 | _na 466_aa | NADH:ubiquinone reductase (non-electrogenic) | |
| 3045 | CAMURC010000121.1 | GCA947097345_01523 | CDS | open | 1900-2955 | _na 351_aa | Glycerol-3-phosphate dehydrogenase | |
| 3046 | CAMURC010000121.1 | GCA947097345_01524 | CDS | open | 3144-4874 | _na 576_aa | lysS | lysine--tRNA ligase |
| 3047 | CAMURC010000121.1 | GCA947097345_01525 | CDS | open | 5262-5948 | _na 228_aa | queuosine precursor transporter | |
| 3048 | CAMURC010000121.1 | GCA947097345_01526 | CDS | open | 6125-7150 | _na 341_aa | hypothetical protein | |
| 3049 | CAMURC010000121.1 | GCA947097345_01522 | gene | open | 357-1757 | |||
| 3050 | CAMURC010000121.1 | GCA947097345_01523 | gene | open | 1900-2955 | |||
| 3051 | CAMURC010000121.1 | GCA947097345_01524 | gene | open | 3144-4874 | lysS | ||
| 3052 | CAMURC010000121.1 | GCA947097345_01525 | gene | open | 5262-5948 | |||
| 3053 | CAMURC010000121.1 | GCA947097345_01526 | gene | open | 6125-7150 | |||
| 3054 | CAMURC010000122.1 | GCA947097345_01527 | CDS | open | 138-572 | _na 144_aa | Phospholipase | |
| 3055 | CAMURC010000122.1 | GCA947097345_01528 | CDS | open | 598-2070 | _na 490_aa | 3-phosphoshikimate 1-carboxyvinyltransferase | |
| 3056 | CAMURC010000122.1 | GCA947097345_01529 | CDS | open | 2092-2748 | _na 218_aa | SNARE-like domain protein | |
| 3057 | CAMURC010000122.1 | GCA947097345_01530 | CDS | open | 2927-4471 | _na 514_aa | Clostripain family protein | |
| 3058 | CAMURC010000122.1 | GCA947097345_01531 | CDS | open | 4479-5336 | _na 285_aa | DUF4230 domain-containing protein | |
| 3059 | CAMURC010000122.1 | GCA947097345_01532 | CDS | open | 5333-6013 | _na 226_aa | DUF4230 domain-containing protein | |
| 3060 | CAMURC010000122.1 | GCA947097345_01533 | CDS | open | 6124-6693 | _na 189_aa | DUF4738 domain-containing protein | |
| 3061 | CAMURC010000122.1 | GCA947097345_01527 | gene | open | 138-572 | |||
| 3062 | CAMURC010000122.1 | GCA947097345_01528 | gene | open | 598-2070 | |||
| 3063 | CAMURC010000122.1 | GCA947097345_01529 | gene | open | 2092-2748 | |||
| 3064 | CAMURC010000122.1 | GCA947097345_01530 | gene | open | 2927-4471 | |||
| 3065 | CAMURC010000122.1 | GCA947097345_01531 | gene | open | 4479-5336 | |||
| 3066 | CAMURC010000122.1 | GCA947097345_01532 | gene | open | 5333-6013 | |||
| 3067 | CAMURC010000122.1 | GCA947097345_01533 | gene | open | 6124-6693 | |||
| 3068 | CAMURC010000122.1 | GCA947097345_01534 | gene | open | 6842-6915 | trnH | ||
| 3069 | CAMURC010000122.1 | GCA947097345_01534 | tRNA | open | 6842-6915 | trnH | tRNA-His(gtg) | |
| 3070 | CAMURC010000123.1 | GCA947097345_01535 | CDS | open | 250-1320 | _na 356_aa | pdxA | 4-hydroxythreonine-4-phosphate dehydrogenase PdxA |
| 3071 | CAMURC010000123.1 | GCA947097345_01536 | CDS | open | 1375-4020 | _na 881_aa | Carboxypeptidase-like regulatory domain-containing protein | |
| 3072 | CAMURC010000123.1 | GCA947097345_01537 | CDS | open | 4192-4932 | _na 246_aa | Nucleotidyl transferase domain-containing protein | |
| 3073 | CAMURC010000123.1 | GCA947097345_01538 | CDS | open | 5170-6021 | _na 283_aa | ATP-grasp domain-containing protein | |
| 3074 | CAMURC010000123.1 | GCA947097345_01535 | gene | open | 250-1320 | pdxA | ||
| 3075 | CAMURC010000123.1 | GCA947097345_01536 | gene | open | 1375-4020 | |||
| 3076 | CAMURC010000123.1 | GCA947097345_01537 | gene | open | 4192-4932 | |||
| 3077 | CAMURC010000123.1 | GCA947097345_01538 | gene | open | 5170-6021 | |||
| 3078 | CAMURC010000124.1 | GCA947097345_01539 | CDS | open | 291-716 | _na 141_aa | tonB | TonB family domain protein |
| 3079 | CAMURC010000124.1 | GCA947097345_01540 | CDS | open | 1612-1767 | _na 51_aa | hypothetical protein | |
| 3080 | CAMURC010000124.1 | GCA947097345_01541 | CDS | open | 1813-2643 | _na 276_aa | ATPase AAA-type core domain-containing protein | |
| 3081 | CAMURC010000124.1 | GCA947097345_01542 | CDS | open | 2674-3822 | _na 382_aa | DUF4435 domain-containing protein | |
| 3082 | CAMURC010000124.1 | GCA947097345_01543 | CDS | open | 3841-5280 | _na 479_aa | Transporter%2C SSS family | |
| 3083 | CAMURC010000124.1 | GCA947097345_01544 | CDS | open | 5555-6457 | _na 300_aa | diaminopimelate dehydrogenase | |
| 3084 | CAMURC010000124.1 | GCA947097345_01539 | gene | open | 291-716 | tonB | ||
| 3085 | CAMURC010000124.1 | GCA947097345_01540 | gene | open | 1612-1767 | |||
| 3086 | CAMURC010000124.1 | GCA947097345_01541 | gene | open | 1813-2643 | |||
| 3087 | CAMURC010000124.1 | GCA947097345_01542 | gene | open | 2674-3822 | |||
| 3088 | CAMURC010000124.1 | GCA947097345_01543 | gene | open | 3841-5280 | |||
| 3089 | CAMURC010000124.1 | GCA947097345_01544 | gene | open | 5555-6457 | |||
| 3090 | CAMURC010000125.1 | GCA947097345_01545 | CDS | open | 228-1730 | _na 500_aa | gldK | Putative gliding motility-associated lipoprotein GldK |
| 3091 | CAMURC010000125.1 | GCA947097345_01546 | CDS | open | 1736-2722 | _na 328_aa | Bacteroidetes-specific putative membrane protein | |
| 3092 | CAMURC010000125.1 | GCA947097345_01547 | CDS | open | 2918-3187 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 3093 | CAMURC010000125.1 | GCA947097345_01548 | CDS | open | 4094-5728 | _na 544_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 3094 | CAMURC010000125.1 | GCA947097345_01549 | CDS | open | 5715-6383 | _na 222_aa | Restriction endonuclease | |
| 3095 | CAMURC010000125.1 | GCA947097345_01550 | CDS | open | 6414-6617 | _na 67_aa | HTH cro/C1-type domain-containing protein | |
| 3096 | CAMURC010000125.1 | GCA947097345_01545 | gene | open | 228-1730 | gldK | ||
| 3097 | CAMURC010000125.1 | GCA947097345_01546 | gene | open | 1736-2722 | |||
| 3098 | CAMURC010000125.1 | GCA947097345_01547 | gene | open | 2918-3187 | rpsO | ||
| 3099 | CAMURC010000125.1 | GCA947097345_01548 | gene | open | 4094-5728 | |||
| 3100 | CAMURC010000125.1 | GCA947097345_01549 | gene | open | 5715-6383 | |||
| 3101 | CAMURC010000125.1 | GCA947097345_01550 | gene | open | 6414-6617 | |||
| 3102 | CAMURC010000126.1 | GCA947097345_01551 | CDS | open | 298-588 | _na 96_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3103 | CAMURC010000126.1 | GCA947097345_01552 | CDS | open | 611-1639 | _na 342_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 3104 | CAMURC010000126.1 | GCA947097345_01553 | CDS | open | 1668-2348 | _na 226_aa | cas4 | CRISPR-associated protein Cas4 |
| 3105 | CAMURC010000126.1 | GCA947097345_01554 | CDS | open | 2471-3313 | _na 280_aa | cas7c | type I-C CRISPR-associated protein Cas7/Csd2 |
| 3106 | CAMURC010000126.1 | GCA947097345_01555 | CDS | open | 3487-5418 | _na 643_aa | cas8c | type I-C CRISPR-associated protein Cas8c/Csd1 |
| 3107 | CAMURC010000126.1 | GCA947097345_01556 | CDS | open | 5415-6128 | _na 237_aa | cas5c | type I-C CRISPR-associated protein Cas5c |
| 3108 | CAMURC010000126.1 | GCA947097345_01551 | gene | open | 298-588 | cas2 | ||
| 3109 | CAMURC010000126.1 | GCA947097345_01552 | gene | open | 611-1639 | cas1c | ||
| 3110 | CAMURC010000126.1 | GCA947097345_01553 | gene | open | 1668-2348 | cas4 | ||
| 3111 | CAMURC010000126.1 | GCA947097345_01554 | gene | open | 2471-3313 | cas7c | ||
| 3112 | CAMURC010000126.1 | GCA947097345_01555 | gene | open | 3487-5418 | cas8c | ||
| 3113 | CAMURC010000126.1 | GCA947097345_01556 | gene | open | 5415-6128 | cas5c | ||
| 3114 | CAMURC010000127.1 | GCA947097345_01557 | CDS | open | 84-743 | _na 219_aa | Formate/nitrite transporter | |
| 3115 | CAMURC010000127.1 | GCA947097345_01558 | CDS | open | 908-1912 | _na 334_aa | DUF2179 domain-containing protein | |
| 3116 | CAMURC010000127.1 | GCA947097345_01559 | CDS | open | 2105-2905 | _na 266_aa | DNA/RNA non-specific endonuclease | |
| 3117 | CAMURC010000127.1 | GCA947097345_01560 | CDS | open | 2940-3278 | _na 112_aa | Putative translation initiation factor SUI1 | |
| 3118 | CAMURC010000127.1 | GCA947097345_01561 | CDS | open | 3327-3941 | _na 204_aa | YgjP-like metallopeptidase domain-containing protein | |
| 3119 | CAMURC010000127.1 | GCA947097345_01562 | CDS | open | 4481-4690 | _na 69_aa | hypothetical protein | |
| 3120 | CAMURC010000127.1 | GCA947097345_01563 | CDS | open | 4750-5487 | _na 245_aa | Peptidyl-prolyl cis-trans isomerase | |
| 3121 | CAMURC010000127.1 | GCA947097345_01564 | CDS | open | 5520-6374 | _na 284_aa | dTDP-4-dehydrorhamnose reductase | |
| 3122 | CAMURC010000127.1 | GCA947097345_01557 | gene | open | 84-743 | |||
| 3123 | CAMURC010000127.1 | GCA947097345_01558 | gene | open | 908-1912 | |||
| 3124 | CAMURC010000127.1 | GCA947097345_01559 | gene | open | 2105-2905 | |||
| 3125 | CAMURC010000127.1 | GCA947097345_01560 | gene | open | 2940-3278 | |||
| 3126 | CAMURC010000127.1 | GCA947097345_01561 | gene | open | 3327-3941 | |||
| 3127 | CAMURC010000127.1 | GCA947097345_01562 | gene | open | 4481-4690 | |||
| 3128 | CAMURC010000127.1 | GCA947097345_01563 | gene | open | 4750-5487 | |||
| 3129 | CAMURC010000127.1 | GCA947097345_01564 | gene | open | 5520-6374 | |||
| 3130 | CAMURC010000128.1 | GCA947097345_01565 | CDS | open | 400-3129 | _na 909_aa | TonB-dependent receptor | |
| 3131 | CAMURC010000128.1 | GCA947097345_01566 | CDS | open | 3313-4551 | _na 412_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 3132 | CAMURC010000128.1 | GCA947097345_01567 | CDS | open | 4725-6089 | _na 454_aa | hisS | histidine--tRNA ligase |
| 3133 | CAMURC010000128.1 | GCA947097345_01565 | gene | open | 400-3129 | |||
| 3134 | CAMURC010000128.1 | GCA947097345_01566 | gene | open | 3313-4551 | |||
| 3135 | CAMURC010000128.1 | GCA947097345_01567 | gene | open | 4725-6089 | hisS | ||
| 3136 | CAMURC010000129.1 | GCA947097345_01568 | CDS | open | 252-536 | _na 94_aa | hypothetical protein | |
| 3137 | CAMURC010000129.1 | GCA947097345_01569 | CDS | open | 706-3753 | _na 1015_aa | TonB-dependent receptor plug domain protein | |
| 3138 | CAMURC010000129.1 | GCA947097345_01570 | CDS | open | 3897-6065 | _na 722_aa | Alpha-glucosidase | |
| 3139 | CAMURC010000129.1 | GCA947097345_01568 | gene | open | 252-536 | |||
| 3140 | CAMURC010000129.1 | GCA947097345_01569 | gene | open | 706-3753 | |||
| 3141 | CAMURC010000129.1 | GCA947097345_01570 | gene | open | 3897-6065 | |||
| 3142 | CAMURC010000130.1 | GCA947097345_01571 | CDS | open | 303-1388 | _na 361_aa | Trypsin | |
| 3143 | CAMURC010000130.1 | GCA947097345_01572 | CDS | open | 1486-2487 | _na 333_aa | ribD | bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD |
| 3144 | CAMURC010000130.1 | GCA947097345_01573 | CDS | open | 2510-2761 | _na 83_aa | hypothetical protein | |
| 3145 | CAMURC010000130.1 | GCA947097345_01574 | CDS | open | 2877-4373 | _na 498_aa | cysS | cysteine--tRNA ligase |
| 3146 | CAMURC010000130.1 | GCA947097345_01575 | CDS | open | 4533-5993 | _na 486_aa | exo-alpha-sialidase | |
| 3147 | CAMURC010000130.1 | GCA947097345_01571 | gene | open | 303-1388 | |||
| 3148 | CAMURC010000130.1 | GCA947097345_01572 | gene | open | 1486-2487 | ribD | ||
| 3149 | CAMURC010000130.1 | GCA947097345_01573 | gene | open | 2510-2761 | |||
| 3150 | CAMURC010000130.1 | GCA947097345_01574 | gene | open | 2877-4373 | cysS | ||
| 3151 | CAMURC010000130.1 | GCA947097345_01575 | gene | open | 4533-5993 | |||
| 3152 | CAMURC010000131.1 | GCA947097345_01576 | CDS | open | 547-2493 | _na 648_aa | thrS | threonine--tRNA ligase |
| 3153 | CAMURC010000131.1 | GCA947097345_01577 | CDS | open | 2816-3079 | _na 87_aa | Transglycosylase associated protein | |
| 3154 | CAMURC010000131.1 | GCA947097345_01578 | CDS | open | 4518-5582 | _na 354_aa | Putative 3-deoxy-7-phosphoheptulonate synthase | |
| 3155 | CAMURC010000131.1 | GCA947097345_01576 | gene | open | 547-2493 | thrS | ||
| 3156 | CAMURC010000131.1 | GCA947097345_01577 | gene | open | 2816-3079 | |||
| 3157 | CAMURC010000131.1 | GCA947097345_01578 | gene | open | 4518-5582 | |||
| 3158 | CAMURC010000132.1 | GCA947097345_01579 | CDS | open | 425-1369 | _na 314_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 3159 | CAMURC010000132.1 | GCA947097345_01580 | CDS | open | 1557-3380 | _na 607_aa | Peptidase%2C U32 family | |
| 3160 | CAMURC010000132.1 | GCA947097345_01581 | CDS | open | 3377-5200 | _na 607_aa | Tetratricopeptide repeat protein | |
| 3161 | CAMURC010000132.1 | GCA947097345_01582 | CDS | open | 5280-5834 | _na 184_aa | def | peptide deformylase |
| 3162 | CAMURC010000132.1 | GCA947097345_01583 | CDS | open | 5874-6293 | _na 139_aa | ruvX | Holliday junction resolvase RuvX |
| 3163 | CAMURC010000132.1 | GCA947097345_01579 | gene | open | 425-1369 | |||
| 3164 | CAMURC010000132.1 | GCA947097345_01580 | gene | open | 1557-3380 | |||
| 3165 | CAMURC010000132.1 | GCA947097345_01581 | gene | open | 3377-5200 | |||
| 3166 | CAMURC010000132.1 | GCA947097345_01582 | gene | open | 5280-5834 | def | ||
| 3167 | CAMURC010000132.1 | GCA947097345_01583 | gene | open | 5874-6293 | ruvX | ||
| 3168 | CAMURC010000133.1 | GCA947097345_01584 | CDS | open | 710-2470 | _na 586_aa | putative transporter | |
| 3169 | CAMURC010000133.1 | GCA947097345_01585 | CDS | open | 2621-2791 | _na 56_aa | Ferredoxin | |
| 3170 | CAMURC010000133.1 | GCA947097345_01586 | CDS | open | 2818-3063 | _na 81_aa | hypothetical protein | |
| 3171 | CAMURC010000133.1 | GCA947097345_01587 | CDS | open | 3064-3306 | _na 80_aa | relE | Toxin-antitoxin system%2C toxin component%2C RelE domain protein |
| 3172 | CAMURC010000133.1 | GCA947097345_01588 | CDS | open | 3406-4680 | _na 424_aa | Malic enzyme%2C NAD binding domain protein | |
| 3173 | CAMURC010000133.1 | GCA947097345_01589 | CDS | open | 4884-5366 | _na 160_aa | Arginine repressor | |
| 3174 | CAMURC010000133.1 | GCA947097345_01584 | gene | open | 710-2470 | |||
| 3175 | CAMURC010000133.1 | GCA947097345_01585 | gene | open | 2621-2791 | |||
| 3176 | CAMURC010000133.1 | GCA947097345_01586 | gene | open | 2818-3063 | |||
| 3177 | CAMURC010000133.1 | GCA947097345_01587 | gene | open | 3064-3306 | relE | ||
| 3178 | CAMURC010000133.1 | GCA947097345_01588 | gene | open | 3406-4680 | |||
| 3179 | CAMURC010000133.1 | GCA947097345_01589 | gene | open | 4884-5366 | |||
| 3180 | CAMURC010000134.1 | GCA947097345_01590 | CDS | open | 843-1166 | _na 107_aa | hypothetical protein | |
| 3181 | CAMURC010000134.1 | GCA947097345_01591 | CDS | open | 1640-2863 | _na 407_aa | dprA | DNA-processing protein DprA |
| 3182 | CAMURC010000134.1 | GCA947097345_01592 | CDS | open | 2818-3651 | _na 277_aa | HAD hydrolase%2C family IA%2C variant 3 | |
| 3183 | CAMURC010000134.1 | GCA947097345_01593 | CDS | open | 3750-5084 | _na 444_aa | glucose-6-phosphate isomerase | |
| 3184 | CAMURC010000134.1 | GCA947097345_01594 | CDS | open | 5293-6096 | _na 267_aa | Peptidase M20 dimerisation domain-containing protein | |
| 3185 | CAMURC010000134.1 | GCA947097345_01590 | gene | open | 843-1166 | |||
| 3186 | CAMURC010000134.1 | GCA947097345_01591 | gene | open | 1640-2863 | dprA | ||
| 3187 | CAMURC010000134.1 | GCA947097345_01592 | gene | open | 2818-3651 | |||
| 3188 | CAMURC010000134.1 | GCA947097345_01593 | gene | open | 3750-5084 | |||
| 3189 | CAMURC010000134.1 | GCA947097345_01594 | gene | open | 5293-6096 | |||
| 3190 | CAMURC010000135.1 | GCA947097345_01595 | CDS | open | 134-1174 | _na 346_aa | DHHA1 domain protein | |
| 3191 | CAMURC010000135.1 | GCA947097345_01596 | CDS | open | 1835-3475 | _na 546_aa | Outer membrane protein transport protein%2C Ompp1/FadL/TodX family | |
| 3192 | CAMURC010000135.1 | GCA947097345_01597 | CDS | open | 3602-4720 | _na 372_aa | hypothetical protein | |
| 3193 | CAMURC010000135.1 | GCA947097345_01598 | CDS | open | 4911-5819 | _na 302_aa | Pseudouridine synthase | |
| 3194 | CAMURC010000135.1 | GCA947097345_01595 | gene | open | 134-1174 | |||
| 3195 | CAMURC010000135.1 | GCA947097345_01596 | gene | open | 1835-3475 | |||
| 3196 | CAMURC010000135.1 | GCA947097345_01597 | gene | open | 3602-4720 | |||
| 3197 | CAMURC010000135.1 | GCA947097345_01598 | gene | open | 4911-5819 | |||
| 3198 | CAMURC010000136.1 | GCA947097345_01599 | CDS | open | 3-608 | _na 201_aa | Arylsulfatase domain protein | |
| 3199 | CAMURC010000136.1 | GCA947097345_01600 | CDS | open | 1086-1754 | _na 222_aa | NlpC/P60 family protein | |
| 3200 | CAMURC010000136.1 | GCA947097345_01601 | CDS | open | 2099-2290 | _na 63_aa | rpsU | 30S ribosomal protein S21 |
| 3201 | CAMURC010000136.1 | GCA947097345_01602 | CDS | open | 2491-3414 | _na 307_aa | Phage integrase%2C SAM-like domain protein | |
| 3202 | CAMURC010000136.1 | GCA947097345_01603 | CDS | open | 3565-3855 | _na 96_aa | Ribosomal subunit interface protein | |
| 3203 | CAMURC010000136.1 | GCA947097345_01607 | CDS | open | 4312-5493 | _na 393_aa | tuf | elongation factor Tu |
| 3204 | CAMURC010000136.1 | GCA947097345_01599 | gene | open | 3-608 | |||
| 3205 | CAMURC010000136.1 | GCA947097345_01600 | gene | open | 1086-1754 | |||
| 3206 | CAMURC010000136.1 | GCA947097345_01601 | gene | open | 2099-2290 | rpsU | ||
| 3207 | CAMURC010000136.1 | GCA947097345_01602 | gene | open | 2491-3414 | |||
| 3208 | CAMURC010000136.1 | GCA947097345_01603 | gene | open | 3565-3855 | |||
| 3209 | CAMURC010000136.1 | GCA947097345_01607 | gene | open | 4312-5493 | tuf | ||
| 3210 | CAMURC010000136.1 | GCA947097345_01604 | gene | open | 3963-4045 | trnY | ||
| 3211 | CAMURC010000136.1 | GCA947097345_01605 | gene | open | 4066-4138 | trnG | ||
| 3212 | CAMURC010000136.1 | GCA947097345_01606 | gene | open | 4155-4226 | trnT | ||
| 3213 | CAMURC010000136.1 | GCA947097345_01604 | tRNA | open | 3963-4045 | trnY | tRNA-Tyr(gta) | |
| 3214 | CAMURC010000136.1 | GCA947097345_01605 | tRNA | open | 4066-4138 | trnG | tRNA-Gly(tcc) | |
| 3215 | CAMURC010000136.1 | GCA947097345_01606 | tRNA | open | 4155-4226 | trnT | tRNA-Thr(ggt) | |
| 3216 | CAMURC010000137.1 | GCA947097345_01608 | CDS | open | 20-2737 | _na 905_aa | hypothetical protein | |
| 3217 | CAMURC010000137.1 | GCA947097345_01609 | CDS | open | 3139-3957 | _na 272_aa | Transcriptional regulator AbiEi antitoxin N-terminal domain-containing protein | |
| 3218 | CAMURC010000137.1 | GCA947097345_01610 | CDS | open | 3947-4864 | _na 305_aa | Nucleotidyl transferase%2C PF08843 family | |
| 3219 | CAMURC010000137.1 | GCA947097345_01608 | gene | open | 20-2737 | |||
| 3220 | CAMURC010000137.1 | GCA947097345_01609 | gene | open | 3139-3957 | |||
| 3221 | CAMURC010000137.1 | GCA947097345_01610 | gene | open | 3947-4864 | |||
| 3222 | CAMURC010000138.1 | GCA947097345_01611 | CDS | open | 1305-1970 | _na 221_aa | ribonuclease HII | |
| 3223 | CAMURC010000138.1 | GCA947097345_01612 | CDS | open | 2082-2399 | _na 105_aa | UPF0145 protein HMPREF9999_02345 | |
| 3224 | CAMURC010000138.1 | GCA947097345_01613 | CDS | open | 2584-4398 | _na 604_aa | ompA | OmpA family protein |
| 3225 | CAMURC010000138.1 | GCA947097345_01614 | CDS | open | 4443-5471 | _na 342_aa | hypothetical protein | |
| 3226 | CAMURC010000138.1 | GCA947097345_01611 | gene | open | 1305-1970 | |||
| 3227 | CAMURC010000138.1 | GCA947097345_01612 | gene | open | 2082-2399 | |||
| 3228 | CAMURC010000138.1 | GCA947097345_01613 | gene | open | 2584-4398 | ompA | ||
| 3229 | CAMURC010000138.1 | GCA947097345_01614 | gene | open | 4443-5471 | |||
| 3230 | CAMURC010000139.1 | GCA947097345_01615 | CDS | open | 22-222 | _na 66_aa | hypothetical protein | |
| 3231 | CAMURC010000139.1 | GCA947097345_01616 | CDS | open | 258-926 | _na 222_aa | NigD-like C-terminal beta sandwich domain-containing protein | |
| 3232 | CAMURC010000139.1 | GCA947097345_01617 | CDS | open | 1045-2130 | _na 361_aa | N-acetyltransferase domain-containing protein | |
| 3233 | CAMURC010000139.1 | GCA947097345_01618 | CDS | open | 2123-3367 | _na 414_aa | Phytase-like domain-containing protein | |
| 3234 | CAMURC010000139.1 | GCA947097345_01619 | CDS | open | 3790-4395 | _na 201_aa | DUF3575 domain-containing protein | |
| 3235 | CAMURC010000139.1 | GCA947097345_01620 | CDS | open | 4627-5235 | _na 202_aa | DUF3575 domain-containing protein | |
| 3236 | CAMURC010000139.1 | GCA947097345_01615 | gene | open | 22-222 | |||
| 3237 | CAMURC010000139.1 | GCA947097345_01616 | gene | open | 258-926 | |||
| 3238 | CAMURC010000139.1 | GCA947097345_01617 | gene | open | 1045-2130 | |||
| 3239 | CAMURC010000139.1 | GCA947097345_01618 | gene | open | 2123-3367 | |||
| 3240 | CAMURC010000139.1 | GCA947097345_01619 | gene | open | 3790-4395 | |||
| 3241 | CAMURC010000139.1 | GCA947097345_01620 | gene | open | 4627-5235 | |||
| 3242 | CAMURC010000140.1 | repeat_region | open | 16-886 | CRISPR array with 13 repeats of length 33%2C consensus sequence GTCGCAGCCCGCTTGGGCTGCGTGAATTGAAAC and spacer length 33 | |||
| 3243 | CAMURC010000140.1 | GCA947097345_01621 | CDS | open | 1432-3108 | _na 558_aa | Glycosyl hydrolase family 25 | |
| 3244 | CAMURC010000140.1 | GCA947097345_01622 | CDS | open | 3350-4264 | _na 304_aa | Dihydrodipicolinate synthetase family protein | |
| 3245 | CAMURC010000140.1 | GCA947097345_01623 | CDS | open | 4920-5309 | _na 129_aa | hypothetical protein | |
| 3246 | CAMURC010000140.1 | GCA947097345_01621 | gene | open | 1432-3108 | |||
| 3247 | CAMURC010000140.1 | GCA947097345_01622 | gene | open | 3350-4264 | |||
| 3248 | CAMURC010000140.1 | GCA947097345_01623 | gene | open | 4920-5309 | |||
| 3249 | CAMURC010000141.1 | GCA947097345_01624 | CDS | open | 40-717 | _na 225_aa | DUF5715 domain-containing protein | |
| 3250 | CAMURC010000141.1 | GCA947097345_01625 | CDS | open | 908-1858 | _na 316_aa | TPM domain-containing protein | |
| 3251 | CAMURC010000141.1 | GCA947097345_01626 | CDS | open | 1970-2560 | _na 196_aa | lemA | LemA family protein |
| 3252 | CAMURC010000141.1 | GCA947097345_01627 | CDS | open | 2715-3884 | _na 389_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 3253 | CAMURC010000141.1 | GCA947097345_01628 | CDS | open | 3951-4382 | _na 143_aa | Essential protein Yae1 N-terminal domain-containing protein | |
| 3254 | CAMURC010000141.1 | GCA947097345_01629 | CDS | open | 4663-5289 | _na 208_aa | hypothetical protein | |
| 3255 | CAMURC010000141.1 | GCA947097345_01624 | gene | open | 40-717 | |||
| 3256 | CAMURC010000141.1 | GCA947097345_01625 | gene | open | 908-1858 | |||
| 3257 | CAMURC010000141.1 | GCA947097345_01626 | gene | open | 1970-2560 | lemA | ||
| 3258 | CAMURC010000141.1 | GCA947097345_01627 | gene | open | 2715-3884 | |||
| 3259 | CAMURC010000141.1 | GCA947097345_01628 | gene | open | 3951-4382 | |||
| 3260 | CAMURC010000141.1 | GCA947097345_01629 | gene | open | 4663-5289 | |||
| 3261 | CAMURC010000142.1 | GCA947097345_01630 | CDS | open | 322-1365 | _na 347_aa | reverse transcriptase family protein | |
| 3262 | CAMURC010000142.1 | GCA947097345_01631 | CDS | open | 1510-2847 | _na 445_aa | hypothetical protein | |
| 3263 | CAMURC010000142.1 | GCA947097345_01632 | CDS | open | 3423-5270 | _na 615_aa | Arylsulfatase | |
| 3264 | CAMURC010000142.1 | GCA947097345_01630 | gene | open | 322-1365 | |||
| 3265 | CAMURC010000142.1 | GCA947097345_01631 | gene | open | 1510-2847 | |||
| 3266 | CAMURC010000142.1 | GCA947097345_01632 | gene | open | 3423-5270 | |||
| 3267 | CAMURC010000143.1 | GCA947097345_01633 | CDS | open | 59-592 | _na 177_aa | hypothetical protein | |
| 3268 | CAMURC010000143.1 | GCA947097345_01634 | CDS | open | 703-1332 | _na 209_aa | Cytidylate kinase | |
| 3269 | CAMURC010000143.1 | GCA947097345_01635 | CDS | open | 1571-2491 | _na 306_aa | Mce/MlaD domain-containing protein | |
| 3270 | CAMURC010000143.1 | GCA947097345_01636 | CDS | open | 2502-4328 | _na 608_aa | N-acetylmuramoyl-L-alanine amidase | |
| 3271 | CAMURC010000143.1 | GCA947097345_01637 | CDS | open | 4337-4489 | _na 50_aa | hypothetical protein | |
| 3272 | CAMURC010000143.1 | GCA947097345_01638 | CDS | open | 4631-5047 | _na 138_aa | hypothetical protein | |
| 3273 | CAMURC010000143.1 | GCA947097345_01633 | gene | open | 59-592 | |||
| 3274 | CAMURC010000143.1 | GCA947097345_01634 | gene | open | 703-1332 | |||
| 3275 | CAMURC010000143.1 | GCA947097345_01635 | gene | open | 1571-2491 | |||
| 3276 | CAMURC010000143.1 | GCA947097345_01636 | gene | open | 2502-4328 | |||
| 3277 | CAMURC010000143.1 | GCA947097345_01637 | gene | open | 4337-4489 | |||
| 3278 | CAMURC010000143.1 | GCA947097345_01638 | gene | open | 4631-5047 | |||
| 3279 | CAMURC010000144.1 | GCA947097345_01639 | CDS | open | 809-1015 | _na 68_aa | hypothetical protein | |
| 3280 | CAMURC010000144.1 | GCA947097345_01640 | CDS | open | 1106-1270 | _na 54_aa | hypothetical protein | |
| 3281 | CAMURC010000144.1 | GCA947097345_01641 | CDS | open | 1442-1726 | _na 94_aa | hypothetical protein | |
| 3282 | CAMURC010000144.1 | GCA947097345_01642 | CDS | open | 2018-2452 | _na 144_aa | hypothetical protein | |
| 3283 | CAMURC010000144.1 | GCA947097345_01643 | CDS | open | 2471-3169 | _na 232_aa | hypothetical protein | |
| 3284 | CAMURC010000144.1 | GCA947097345_01644 | CDS | open | 3233-3679 | _na 148_aa | hypothetical protein | |
| 3285 | CAMURC010000144.1 | GCA947097345_01645 | CDS | open | 3855-4406 | _na 183_aa | hypothetical protein | |
| 3286 | CAMURC010000144.1 | GCA947097345_01646 | CDS | open | 4451-4819 | _na 122_aa | hypothetical protein | |
| 3287 | CAMURC010000144.1 | GCA947097345_01639 | gene | open | 809-1015 | |||
| 3288 | CAMURC010000144.1 | GCA947097345_01640 | gene | open | 1106-1270 | |||
| 3289 | CAMURC010000144.1 | GCA947097345_01641 | gene | open | 1442-1726 | |||
| 3290 | CAMURC010000144.1 | GCA947097345_01642 | gene | open | 2018-2452 | |||
| 3291 | CAMURC010000144.1 | GCA947097345_01643 | gene | open | 2471-3169 | |||
| 3292 | CAMURC010000144.1 | GCA947097345_01644 | gene | open | 3233-3679 | |||
| 3293 | CAMURC010000144.1 | GCA947097345_01645 | gene | open | 3855-4406 | |||
| 3294 | CAMURC010000144.1 | GCA947097345_01646 | gene | open | 4451-4819 | |||
| 3295 | CAMURC010000145.1 | GCA947097345_01647 | CDS | open | 110-1777 | _na 555_aa | DUF349 domain-containing protein | |
| 3296 | CAMURC010000145.1 | GCA947097345_01648 | CDS | open | 1931-2122 | _na 63_aa | hypothetical protein | |
| 3297 | CAMURC010000145.1 | GCA947097345_01649 | CDS | open | 2289-3092 | _na 267_aa | trmH | RNA methyltransferase%2C TrmH family |
| 3298 | CAMURC010000145.1 | GCA947097345_01650 | CDS | open | 3536-4495 | _na 319_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 3299 | CAMURC010000145.1 | GCA947097345_01647 | gene | open | 110-1777 | |||
| 3300 | CAMURC010000145.1 | GCA947097345_01648 | gene | open | 1931-2122 | |||
| 3301 | CAMURC010000145.1 | GCA947097345_01649 | gene | open | 2289-3092 | trmH | ||
| 3302 | CAMURC010000145.1 | GCA947097345_01650 | gene | open | 3536-4495 | |||
| 3303 | CAMURC010000146.1 | GCA947097345_01651 | CDS | open | 969-1322 | _na 117_aa | hypothetical protein | |
| 3304 | CAMURC010000146.1 | GCA947097345_01652 | CDS | open | 1416-1838 | _na 140_aa | clpS | ATP-dependent Clp protease adapter protein ClpS |
| 3305 | CAMURC010000146.1 | GCA947097345_01653 | CDS | open | 1869-2165 | _na 98_aa | Transporter suffix domain-containing protein | |
| 3306 | CAMURC010000146.1 | GCA947097345_01654 | CDS | open | 3018-4394 | _na 458_aa | hypothetical protein | |
| 3307 | CAMURC010000146.1 | GCA947097345_01655 | CDS | open | 4635-4862 | _na 75_aa | hypothetical protein | |
| 3308 | CAMURC010000146.1 | GCA947097345_01651 | gene | open | 969-1322 | |||
| 3309 | CAMURC010000146.1 | GCA947097345_01652 | gene | open | 1416-1838 | clpS | ||
| 3310 | CAMURC010000146.1 | GCA947097345_01653 | gene | open | 1869-2165 | |||
| 3311 | CAMURC010000146.1 | GCA947097345_01654 | gene | open | 3018-4394 | |||
| 3312 | CAMURC010000146.1 | GCA947097345_01655 | gene | open | 4635-4862 | |||
| 3313 | CAMURC010000147.1 | GCA947097345_01658 | CDS | open | 305-1546 | _na 413_aa | UDP-glucose 6-dehydrogenase | |
| 3314 | CAMURC010000147.1 | GCA947097345_01661 | CDS | open | 2236-2397 | _na 53_aa | aldo/keto reductase | |
| 3315 | CAMURC010000147.1 | GCA947097345_01662 | CDS | open | 2611-3555 | _na 314_aa | Sugar transport protein | |
| 3316 | CAMURC010000147.1 | GCA947097345_01658 | gene | open | 305-1546 | |||
| 3317 | CAMURC010000147.1 | GCA947097345_01661 | gene | open | 2236-2397 | |||
| 3318 | CAMURC010000147.1 | GCA947097345_01662 | gene | open | 2611-3555 | |||
| 3319 | CAMURC010000147.1 | GCA947097345_01656 | gene | open | 2-77 | trnS | ||
| 3320 | CAMURC010000147.1 | GCA947097345_01657 | gene | open | 89-163 | trnE | ||
| 3321 | CAMURC010000147.1 | GCA947097345_01659 | gene | open | 1717-1792 | trnK | ||
| 3322 | CAMURC010000147.1 | GCA947097345_01660 | gene | open | 1832-1904 | trnK | ||
| 3323 | CAMURC010000147.1 | GCA947097345_01656 | tRNA | open | 2-77 | trnS | tRNA-Ser(gct) | |
| 3324 | CAMURC010000147.1 | GCA947097345_01657 | tRNA | open | 89-163 | trnE | tRNA-Glu(ctc) | |
| 3325 | CAMURC010000147.1 | GCA947097345_01659 | tRNA | open | 1717-1792 | trnK | tRNA-Lys(ctt) | |
| 3326 | CAMURC010000147.1 | GCA947097345_01660 | tRNA | open | 1832-1904 | trnK | tRNA-Lys(ctt) | |
| 3327 | CAMURC010000148.1 | GCA947097345_01663 | CDS | open | 50-1015 | _na 321_aa | Phospho-N-acetylmuramoyl-pentapeptide-transferase | |
| 3328 | CAMURC010000148.1 | GCA947097345_01664 | CDS | open | 1046-2434 | _na 462_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 3329 | CAMURC010000148.1 | GCA947097345_01665 | CDS | open | 2447-3688 | _na 413_aa | ftsW | putative peptidoglycan glycosyltransferase FtsW |
| 3330 | CAMURC010000148.1 | GCA947097345_01666 | CDS | open | 3709-4416 | _na 235_aa | peptidylprolyl isomerase | |
| 3331 | CAMURC010000148.1 | GCA947097345_01667 | CDS | open | 4495-4734 | _na 79_aa | hypothetical protein | |
| 3332 | CAMURC010000148.1 | GCA947097345_01663 | gene | open | 50-1015 | |||
| 3333 | CAMURC010000148.1 | GCA947097345_01664 | gene | open | 1046-2434 | murD | ||
| 3334 | CAMURC010000148.1 | GCA947097345_01665 | gene | open | 2447-3688 | ftsW | ||
| 3335 | CAMURC010000148.1 | GCA947097345_01666 | gene | open | 3709-4416 | |||
| 3336 | CAMURC010000148.1 | GCA947097345_01667 | gene | open | 4495-4734 | |||
| 3337 | CAMURC010000149.1 | GCA947097345_01668 | CDS | open | 80-799 | _na 239_aa | DUF5020 domain-containing protein | |
| 3338 | CAMURC010000149.1 | GCA947097345_01669 | CDS | open | 1025-2350 | _na 441_aa | NCS2 family permease | |
| 3339 | CAMURC010000149.1 | GCA947097345_01670 | CDS | open | 2851-3303 | _na 150_aa | DUF4190 domain-containing protein | |
| 3340 | CAMURC010000149.1 | GCA947097345_01671 | CDS | open | 3419-4258 | _na 279_aa | yitL | YitL family protein |
| 3341 | CAMURC010000149.1 | GCA947097345_01672 | CDS | open | 4271-4693 | _na 140_aa | hypothetical protein | |
| 3342 | CAMURC010000149.1 | GCA947097345_01668 | gene | open | 80-799 | |||
| 3343 | CAMURC010000149.1 | GCA947097345_01669 | gene | open | 1025-2350 | |||
| 3344 | CAMURC010000149.1 | GCA947097345_01670 | gene | open | 2851-3303 | |||
| 3345 | CAMURC010000149.1 | GCA947097345_01671 | gene | open | 3419-4258 | yitL | ||
| 3346 | CAMURC010000149.1 | GCA947097345_01672 | gene | open | 4271-4693 | |||
| 3347 | CAMURC010000150.1 | GCA947097345_01673 | CDS | open | 313-3642 | _na 1109_aa | Bacterial surface protein 26-residue PARCEL repeat-containing domain protein | |
| 3348 | CAMURC010000150.1 | GCA947097345_01673 | gene | open | 313-3642 | |||
| 3349 | CAMURC010000151.1 | GCA947097345_01674 | CDS | open | 324-1325 | _na 333_aa | DUF4929 domain-containing protein | |
| 3350 | CAMURC010000151.1 | GCA947097345_01675 | CDS | open | 1642-4434 | _na 930_aa | Peptidase%2C M16 family | |
| 3351 | CAMURC010000151.1 | GCA947097345_01674 | gene | open | 324-1325 | |||
| 3352 | CAMURC010000151.1 | GCA947097345_01675 | gene | open | 1642-4434 | |||
| 3353 | CAMURC010000152.1 | GCA947097345_01676 | CDS | open | 1316-2638 | _na 440_aa | ATPase | |
| 3354 | CAMURC010000152.1 | GCA947097345_01677 | CDS | open | 3201-4247 | _na 348_aa | hypothetical protein | |
| 3355 | CAMURC010000152.1 | GCA947097345_01676 | gene | open | 1316-2638 | |||
| 3356 | CAMURC010000152.1 | GCA947097345_01677 | gene | open | 3201-4247 | |||
| 3357 | CAMURC010000153.1 | GCA947097345_01678 | CDS | open | 140-577 | _na 145_aa | trxA | thioredoxin |
| 3358 | CAMURC010000153.1 | GCA947097345_01679 | CDS | open | 980-1684 | _na 234_aa | RloB-like protein | |
| 3359 | CAMURC010000153.1 | GCA947097345_01680 | CDS | open | 1694-2908 | _na 404_aa | ATPase AAA-type core domain-containing protein | |
| 3360 | CAMURC010000153.1 | GCA947097345_01681 | CDS | open | 3339-4199 | _na 286_aa | Abi family protein | |
| 3361 | CAMURC010000153.1 | GCA947097345_01678 | gene | open | 140-577 | trxA | ||
| 3362 | CAMURC010000153.1 | GCA947097345_01679 | gene | open | 980-1684 | |||
| 3363 | CAMURC010000153.1 | GCA947097345_01680 | gene | open | 1694-2908 | |||
| 3364 | CAMURC010000153.1 | GCA947097345_01681 | gene | open | 3339-4199 | |||
| 3365 | CAMURC010000154.1 | GCA947097345_01682 | CDS | open | 149-784 | _na 211_aa | hypothetical protein | |
| 3366 | CAMURC010000154.1 | GCA947097345_01683 | CDS | open | 1746-3320 | _na 524_aa | Divergent AAA domain protein | |
| 3367 | CAMURC010000154.1 | GCA947097345_01684 | CDS | open | 3506-4276 | _na 256_aa | ABC transporter%2C ATP-binding protein | |
| 3368 | CAMURC010000154.1 | GCA947097345_01682 | gene | open | 149-784 | |||
| 3369 | CAMURC010000154.1 | GCA947097345_01683 | gene | open | 1746-3320 | |||
| 3370 | CAMURC010000154.1 | GCA947097345_01684 | gene | open | 3506-4276 | |||
| 3371 | CAMURC010000155.1 | GCA947097345_01685 | CDS | open | 1466-2590 | _na 374_aa | DUF6242 domain-containing protein | |
| 3372 | CAMURC010000155.1 | GCA947097345_01686 | CDS | open | 2748-3452 | _na 234_aa | Outer membrane protein beta-barrel domain-containing protein | |
| 3373 | CAMURC010000155.1 | GCA947097345_01687 | CDS | open | 3456-4187 | _na 243_aa | isoprenyl transferase | |
| 3374 | CAMURC010000155.1 | GCA947097345_01685 | gene | open | 1466-2590 | |||
| 3375 | CAMURC010000155.1 | GCA947097345_01686 | gene | open | 2748-3452 | |||
| 3376 | CAMURC010000155.1 | GCA947097345_01687 | gene | open | 3456-4187 | |||
| 3377 | CAMURC010000156.1 | GCA947097345_01688 | CDS | open | 301-1422 | _na 373_aa | Iron-sulfur cluster carrier protein | |
| 3378 | CAMURC010000156.1 | GCA947097345_01689 | CDS | open | 1450-1752 | _na 100_aa | Stress responsive A/B barrel domain protein | |
| 3379 | CAMURC010000156.1 | GCA947097345_01690 | CDS | open | 1805-2581 | _na 258_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 3380 | CAMURC010000156.1 | GCA947097345_01691 | CDS | open | 2574-2771 | _na 65_aa | xseB | exodeoxyribonuclease VII small subunit |
| 3381 | CAMURC010000156.1 | GCA947097345_01692 | CDS | open | 2805-4133 | _na 442_aa | xseA | exodeoxyribonuclease VII large subunit |
| 3382 | CAMURC010000156.1 | GCA947097345_01688 | gene | open | 301-1422 | |||
| 3383 | CAMURC010000156.1 | GCA947097345_01689 | gene | open | 1450-1752 | |||
| 3384 | CAMURC010000156.1 | GCA947097345_01690 | gene | open | 1805-2581 | trmB | ||
| 3385 | CAMURC010000156.1 | GCA947097345_01691 | gene | open | 2574-2771 | xseB | ||
| 3386 | CAMURC010000156.1 | GCA947097345_01692 | gene | open | 2805-4133 | xseA | ||
| 3387 | CAMURC010000157.1 | GCA947097345_01693 | CDS | open | 29-1867 | _na 612_aa | hypothetical protein | |
| 3388 | CAMURC010000157.1 | GCA947097345_01694 | CDS | open | 1950-2516 | _na 188_aa | DUF4878 domain-containing protein | |
| 3389 | CAMURC010000157.1 | GCA947097345_01695 | CDS | open | 2772-4124 | _na 450_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 3390 | CAMURC010000157.1 | GCA947097345_01693 | gene | open | 29-1867 | |||
| 3391 | CAMURC010000157.1 | GCA947097345_01694 | gene | open | 1950-2516 | |||
| 3392 | CAMURC010000157.1 | GCA947097345_01695 | gene | open | 2772-4124 | |||
| 3393 | CAMURC010000158.1 | GCA947097345_01696 | CDS | open | 138-1328 | _na 396_aa | Putative 23S rRNA m5C1962 methyltransferase | |
| 3394 | CAMURC010000158.1 | GCA947097345_01697 | CDS | open | 1347-1964 | _na 205_aa | 3'-5' exonuclease | |
| 3395 | CAMURC010000158.1 | GCA947097345_01698 | CDS | open | 1997-2512 | _na 171_aa | DUF5063 domain-containing protein | |
| 3396 | CAMURC010000158.1 | GCA947097345_01699 | CDS | open | 2564-3505 | _na 313_aa | hypothetical protein | |
| 3397 | CAMURC010000158.1 | GCA947097345_01700 | CDS | open | 3509-4045 | _na 178_aa | 1%2C4-alpha-glucan-branching enzyme | |
| 3398 | CAMURC010000158.1 | GCA947097345_01696 | gene | open | 138-1328 | |||
| 3399 | CAMURC010000158.1 | GCA947097345_01697 | gene | open | 1347-1964 | |||
| 3400 | CAMURC010000158.1 | GCA947097345_01698 | gene | open | 1997-2512 | |||
| 3401 | CAMURC010000158.1 | GCA947097345_01699 | gene | open | 2564-3505 | |||
| 3402 | CAMURC010000158.1 | GCA947097345_01700 | gene | open | 3509-4045 | |||
| 3403 | CAMURC010000159.1 | GCA947097345_01701 | CDS | open | 12-1046 | _na 344_aa | gldL | Gliding motility-associated protein GldL |
| 3404 | CAMURC010000159.1 | GCA947097345_01702 | CDS | open | 1088-2641 | _na 517_aa | gldM | Gliding motility-associated protein GldM |
| 3405 | CAMURC010000159.1 | GCA947097345_01703 | CDS | open | 2891-4012 | _na 373_aa | gldN | Gliding motility-associated protein GldN |
| 3406 | CAMURC010000159.1 | GCA947097345_01701 | gene | open | 12-1046 | gldL | ||
| 3407 | CAMURC010000159.1 | GCA947097345_01702 | gene | open | 1088-2641 | gldM | ||
| 3408 | CAMURC010000159.1 | GCA947097345_01703 | gene | open | 2891-4012 | gldN | ||
| 3409 | CAMURC010000160.1 | GCA947097345_01704 | CDS | open | 39-251 | _na 70_aa | hypothetical protein | |
| 3410 | CAMURC010000160.1 | GCA947097345_01705 | CDS | open | 404-1537 | _na 377_aa | lysylphosphatidylglycerol synthase transmembrane domain-containing protein | |
| 3411 | CAMURC010000160.1 | GCA947097345_01706 | CDS | open | 1565-2293 | _na 242_aa | HAD hydrolase%2C family IA%2C variant 3 | |
| 3412 | CAMURC010000160.1 | GCA947097345_01707 | CDS | open | 2464-3903 | _na 479_aa | hypothetical protein | |
| 3413 | CAMURC010000160.1 | GCA947097345_01704 | gene | open | 39-251 | |||
| 3414 | CAMURC010000160.1 | GCA947097345_01705 | gene | open | 404-1537 | |||
| 3415 | CAMURC010000160.1 | GCA947097345_01706 | gene | open | 1565-2293 | |||
| 3416 | CAMURC010000160.1 | GCA947097345_01707 | gene | open | 2464-3903 | |||
| 3417 | CAMURC010000161.1 | GCA947097345_01708 | CDS | open | 1935-3245 | _na 436_aa | IgA Peptidase M64 | |
| 3418 | CAMURC010000161.1 | GCA947097345_01708 | gene | open | 1935-3245 | |||
| 3419 | CAMURC010000162.1 | GCA947097345_01709 | CDS | open | 3-983 | _na 326_aa | hypothetical protein | |
| 3420 | CAMURC010000162.1 | GCA947097345_01710 | CDS | open | 1103-2155 | _na 350_aa | Glycosyltransferase%2C group 2 family protein | |
| 3421 | CAMURC010000162.1 | GCA947097345_01711 | CDS | open | 2296-3003 | _na 235_aa | Tetrapyrrole methylase family protein | |
| 3422 | CAMURC010000162.1 | GCA947097345_01712 | CDS | open | 3235-3600 | _na 121_aa | crcB | fluoride efflux transporter CrcB |
| 3423 | CAMURC010000162.1 | GCA947097345_01709 | gene | open | 3-983 | |||
| 3424 | CAMURC010000162.1 | GCA947097345_01710 | gene | open | 1103-2155 | |||
| 3425 | CAMURC010000162.1 | GCA947097345_01711 | gene | open | 2296-3003 | |||
| 3426 | CAMURC010000162.1 | GCA947097345_01712 | gene | open | 3235-3600 | crcB | ||
| 3427 | CAMURC010000163.1 | GCA947097345_01713 | CDS | open | 131-1744 | _na 537_aa | susD | SusD family protein |
| 3428 | CAMURC010000163.1 | GCA947097345_01714 | CDS | open | 1756-3762 | _na 668_aa | TonB-dependent receptor domain-containing protein | |
| 3429 | CAMURC010000163.1 | GCA947097345_01713 | gene | open | 131-1744 | susD | ||
| 3430 | CAMURC010000163.1 | GCA947097345_01714 | gene | open | 1756-3762 | |||
| 3431 | CAMURC010000164.1 | GCA947097345_01715 | CDS | open | 21-359 | _na 112_aa | hypothetical protein | |
| 3432 | CAMURC010000164.1 | GCA947097345_01716 | CDS | open | 504-2693 | _na 729_aa | Glutamate--ammonia ligase%2C catalytic domain protein | |
| 3433 | CAMURC010000164.1 | GCA947097345_01717 | CDS | open | 3002-3523 | _na 173_aa | Rhodanese-like protein | |
| 3434 | CAMURC010000164.1 | GCA947097345_01715 | gene | open | 21-359 | |||
| 3435 | CAMURC010000164.1 | GCA947097345_01716 | gene | open | 504-2693 | |||
| 3436 | CAMURC010000164.1 | GCA947097345_01717 | gene | open | 3002-3523 | |||
| 3437 | CAMURC010000165.1 | GCA947097345_01718 | CDS | open | 72-1709 | _na 545_aa | Arylsulfatase | |
| 3438 | CAMURC010000165.1 | GCA947097345_01719 | CDS | open | 1811-3193 | _na 460_aa | Ser/Thr phosphatase family protein | |
| 3439 | CAMURC010000165.1 | GCA947097345_01718 | gene | open | 72-1709 | |||
| 3440 | CAMURC010000165.1 | GCA947097345_01719 | gene | open | 1811-3193 | |||
| 3441 | CAMURC010000166.1 | GCA947097345_01720 | CDS | open | 721-2304 | _na 527_aa | atpA | F0F1 ATP synthase subunit alpha |
| 3442 | CAMURC010000166.1 | GCA947097345_01721 | CDS | open | 2340-2903 | _na 187_aa | F0F1 ATP synthase subunit delta | |
| 3443 | CAMURC010000166.1 | GCA947097345_01722 | CDS | open | 2947-3459 | _na 170_aa | atpF | F0F1 ATP synthase subunit B |
| 3444 | CAMURC010000166.1 | GCA947097345_01723 | CDS | open | 3494-3619 | _na 41_aa | hypothetical protein | |
| 3445 | CAMURC010000166.1 | GCA947097345_01720 | gene | open | 721-2304 | atpA | ||
| 3446 | CAMURC010000166.1 | GCA947097345_01721 | gene | open | 2340-2903 | |||
| 3447 | CAMURC010000166.1 | GCA947097345_01722 | gene | open | 2947-3459 | atpF | ||
| 3448 | CAMURC010000166.1 | GCA947097345_01723 | gene | open | 3494-3619 | |||
| 3449 | CAMURC010000167.1 | GCA947097345_01724 | CDS | open | 198-1535 | _na 445_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 3450 | CAMURC010000167.1 | GCA947097345_01725 | CDS | open | 1600-2877 | _na 425_aa | serS | serine--tRNA ligase |
| 3451 | CAMURC010000167.1 | GCA947097345_01726 | CDS | open | 3256-3483 | _na 75_aa | hypothetical protein | |
| 3452 | CAMURC010000167.1 | GCA947097345_01724 | gene | open | 198-1535 | gdhA | ||
| 3453 | CAMURC010000167.1 | GCA947097345_01725 | gene | open | 1600-2877 | serS | ||
| 3454 | CAMURC010000167.1 | GCA947097345_01726 | gene | open | 3256-3483 | |||
| 3455 | CAMURC010000168.1 | GCA947097345_01727 | CDS | open | 200-1285 | _na 361_aa | atpB | F0F1 ATP synthase subunit A |
| 3456 | CAMURC010000168.1 | GCA947097345_01728 | CDS | open | 1263-1682 | _na 139_aa | psiE | Protein PsiE |
| 3457 | CAMURC010000168.1 | GCA947097345_01729 | CDS | open | 1679-1942 | _na 87_aa | ATP synthase F1 subunit epsilon | |
| 3458 | CAMURC010000168.1 | GCA947097345_01730 | CDS | open | 1948-3480 | _na 510_aa | atpD | F0F1 ATP synthase subunit beta |
| 3459 | CAMURC010000168.1 | GCA947097345_01727 | gene | open | 200-1285 | atpB | ||
| 3460 | CAMURC010000168.1 | GCA947097345_01728 | gene | open | 1263-1682 | psiE | ||
| 3461 | CAMURC010000168.1 | GCA947097345_01729 | gene | open | 1679-1942 | |||
| 3462 | CAMURC010000168.1 | GCA947097345_01730 | gene | open | 1948-3480 | atpD | ||
| 3463 | CAMURC010000169.1 | GCA947097345_01731 | CDS | open | 25-888 | _na 287_aa | MotA/TolQ/ExbB proton channel family protein | |
| 3464 | CAMURC010000169.1 | GCA947097345_01732 | CDS | open | 1223-2776 | _na 517_aa | dnaB | replicative DNA helicase |
| 3465 | CAMURC010000169.1 | GCA947097345_01731 | gene | open | 25-888 | |||
| 3466 | CAMURC010000169.1 | GCA947097345_01732 | gene | open | 1223-2776 | dnaB | ||
| 3467 | CAMURC010000170.1 | GCA947097345_01733 | CDS | open | 765-1229 | _na 154_aa | rimP | ribosome assembly cofactor RimP |
| 3468 | CAMURC010000170.1 | GCA947097345_01734 | CDS | open | 1330-2574 | _na 414_aa | nusA | Transcription termination/antitermination protein NusA |
| 3469 | CAMURC010000170.1 | GCA947097345_01733 | gene | open | 765-1229 | rimP | ||
| 3470 | CAMURC010000170.1 | GCA947097345_01734 | gene | open | 1330-2574 | nusA | ||
| 3471 | CAMURC010000171.1 | GCA947097345_01735 | CDS | open | 258-2264 | _na 668_aa | hypothetical protein | |
| 3472 | CAMURC010000171.1 | GCA947097345_01736 | CDS | open | 2598-2882 | _na 94_aa | hypothetical protein | |
| 3473 | CAMURC010000171.1 | GCA947097345_01735 | gene | open | 258-2264 | |||
| 3474 | CAMURC010000171.1 | GCA947097345_01736 | gene | open | 2598-2882 | |||
| 3475 | CAMURC010000172.1 | GCA947097345_01737 | CDS | open | 23-196 | _na 57_aa | hypothetical protein | |
| 3476 | CAMURC010000172.1 | GCA947097345_01738 | CDS | open | 451-1443 | _na 330_aa | Lactate/malate dehydrogenase%2C NAD binding domain protein | |
| 3477 | CAMURC010000172.1 | GCA947097345_01739 | CDS | open | 1461-1601 | _na 46_aa | hypothetical protein | |
| 3478 | CAMURC010000172.1 | GCA947097345_01740 | CDS | open | 1826-2209 | _na 127_aa | DUF1232 domain-containing protein | |
| 3479 | CAMURC010000172.1 | GCA947097345_01741 | CDS | open | 2462-2695 | _na 77_aa | hypothetical protein | |
| 3480 | CAMURC010000172.1 | GCA947097345_01737 | gene | open | 23-196 | |||
| 3481 | CAMURC010000172.1 | GCA947097345_01738 | gene | open | 451-1443 | |||
| 3482 | CAMURC010000172.1 | GCA947097345_01739 | gene | open | 1461-1601 | |||
| 3483 | CAMURC010000172.1 | GCA947097345_01740 | gene | open | 1826-2209 | |||
| 3484 | CAMURC010000172.1 | GCA947097345_01741 | gene | open | 2462-2695 | |||
| 3485 | CAMURC010000172.1 | GCA947097345_01742 | gene | open | 3279-3349 | trnQ | ||
| 3486 | CAMURC010000172.1 | GCA947097345_01742 | tRNA | open | 3279-3349 | trnQ | tRNA-Gln(ttg) | |
| 3487 | CAMURC010000173.1 | GCA947097345_01743 | CDS | open | 93-347 | _na 84_aa | hypothetical protein | |
| 3488 | CAMURC010000173.1 | GCA947097345_01744 | CDS | open | 230-1030 | _na 266_aa | Glycosyltransferase%2C group 2 family protein | |
| 3489 | CAMURC010000173.1 | GCA947097345_01745 | CDS | open | 1039-2289 | _na 416_aa | Glycosyltransferase%2C group 1 family protein | |
| 3490 | CAMURC010000173.1 | GCA947097345_01746 | CDS | open | 2324-3184 | _na 286_aa | Lanthionine synthetase C-like protein | |
| 3491 | CAMURC010000173.1 | GCA947097345_01743 | gene | open | 93-347 | |||
| 3492 | CAMURC010000173.1 | GCA947097345_01744 | gene | open | 230-1030 | |||
| 3493 | CAMURC010000173.1 | GCA947097345_01745 | gene | open | 1039-2289 | |||
| 3494 | CAMURC010000173.1 | GCA947097345_01746 | gene | open | 2324-3184 | |||
| 3495 | CAMURC010000174.1 | GCA947097345_01747 | CDS | open | 83-940 | _na 285_aa | Endolytic murein transglycosylase | |
| 3496 | CAMURC010000174.1 | GCA947097345_01748 | CDS | open | 1076-2389 | _na 437_aa | DUF3078 domain-containing protein | |
| 3497 | CAMURC010000174.1 | GCA947097345_01749 | CDS | open | 2408-3190 | _na 260_aa | DUF4827 domain-containing protein | |
| 3498 | CAMURC010000174.1 | GCA947097345_01747 | gene | open | 83-940 | |||
| 3499 | CAMURC010000174.1 | GCA947097345_01748 | gene | open | 1076-2389 | |||
| 3500 | CAMURC010000174.1 | GCA947097345_01749 | gene | open | 2408-3190 |

