HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Dialister micraerophilus (GCA_947252495.1)

Select a Genome:
BAKTA Annotations for GCA_947252495.1
Genome Selected: Dialister micraerophilus
ContigsBases CDSrRNA tmRNAtRNA
30 1195451 1156 0 1 37
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 2414 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:2]    |    Number of Records Found: 2414 [5 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
501 CAMXVX010000002.1 GCA947252495_00235 gene open 89905-90381
502 CAMXVX010000002.1 GCA947252495_00236 gene open 90527-90964 mraZ
503 CAMXVX010000002.1 GCA947252495_00237 gene open 90971-91903 rsmH
504 CAMXVX010000002.1 GCA947252495_00238 gene open 91922-92311 ftsL
505 CAMXVX010000002.1 GCA947252495_00239 gene open 92372-93868
506 CAMXVX010000002.1 GCA947252495_00240 gene open 93873-95255
507 CAMXVX010000002.1 GCA947252495_00241 gene open 95255-96220 mraY
508 CAMXVX010000002.1 GCA947252495_00242 gene open 96292-97641 murD
509 CAMXVX010000002.1 GCA947252495_00243 gene open 97653-98771 murG
510 CAMXVX010000002.1 GCA947252495_00244 gene open 98768-100159 murC
511 CAMXVX010000002.1 GCA947252495_00245 gene open 100152-101087
512 CAMXVX010000002.1 GCA947252495_00246 gene open 101100-101954
513 CAMXVX010000002.1 GCA947252495_00247 gene open 102076-103104 ftsZ
514 CAMXVX010000002.1 GCA947252495_00248 gene open 103160-103663 nrdR
515 CAMXVX010000002.1 GCA947252495_00249 gene open 103660-104223 gmhA
516 CAMXVX010000002.1 GCA947252495_00250 gene open 104227-104736
517 CAMXVX010000002.1 GCA947252495_00251 gene open 104745-105737
518 CAMXVX010000002.1 GCA947252495_00252 gene open 105739-106524 trmH
519 CAMXVX010000002.1 GCA947252495_00253 gene open 106548-107405 ydjC
520 CAMXVX010000002.1 GCA947252495_00254 gene open 107405-107851 pheB
521 CAMXVX010000002.1 GCA947252495_00256 gene open 108032-108895
522 CAMXVX010000002.1 GCA947252495_00257 gene open 108907-109317 ndk
523 CAMXVX010000002.1 GCA947252495_00258 gene open 109356-111782 mutS2
524 CAMXVX010000002.1 GCA947252495_00259 gene open 111997-112848 degV
525 CAMXVX010000002.1 GCA947252495_00260 gene open 112863-114470
526 CAMXVX010000002.1 GCA947252495_00261 gene open 114531-115151 cobC
527 CAMXVX010000002.1 GCA947252495_00262 gene open 115234-116772 ppx
528 CAMXVX010000002.1 GCA947252495_00263 gene open 116916-118469
529 CAMXVX010000002.1 GCA947252495_00264 gene open 118472-120637 ppk1
530 CAMXVX010000002.1 GCA947252495_00265 gene open 121014-121991
531 CAMXVX010000002.1 GCA947252495_00266 gene open 122061-122492 lspA
532 CAMXVX010000002.1 GCA947252495_00267 gene open 122492-123415
533 CAMXVX010000002.1 GCA947252495_00269 gene open 124302-125105 thiM
534 CAMXVX010000002.1 GCA947252495_00270 gene open 125095-125733
535 CAMXVX010000002.1 GCA947252495_00168 gene open 21857-21945 trnL
536 CAMXVX010000002.1 GCA947252495_00169 gene open 21955-22028 trnC
537 CAMXVX010000002.1 GCA947252495_00170 gene open 22033-22107 trnG
538 CAMXVX010000002.1 GCA947252495_00171 gene open 22111-22187 trnD
539 CAMXVX010000002.1 GCA947252495_00255 gene open 107921-107997 trnP
540 CAMXVX010000002.1 GCA947252495_00168 tRNA open 21857-21945 trnL tRNA-Leu(taa)
541 CAMXVX010000002.1 GCA947252495_00169 tRNA open 21955-22028 trnC tRNA-Cys(gca)
542 CAMXVX010000002.1 GCA947252495_00170 tRNA open 22033-22107 trnG tRNA-Gly(gcc)
543 CAMXVX010000002.1 GCA947252495_00171 tRNA open 22111-22187 trnD tRNA-Asp(gtc)
544 CAMXVX010000002.1 GCA947252495_00255 tRNA open 107921-107997 trnP tRNA-Pro(ggg)
545 CAMXVX010000003.1 regulatory_region open 22524-22613 Glycine riboswitch aptamer
546 CAMXVX010000003.1 repeat_region open 39597-40302 CRISPR array with 11 repeats of length 36%2C consensus sequence GTTTTAGACATCTGTTGGATATAGGTAAACTGATAC and spacer length 30
547 CAMXVX010000003.1 GCA947252495_00271 CDS open 198-815 _na     205_aa hypothetical protein
548 CAMXVX010000003.1 GCA947252495_00272 CDS open 1362-1751 _na     129_aa Zinc ribbon domain-containing protein
549 CAMXVX010000003.1 GCA947252495_00273 CDS open 1764-2687 _na     307_aa Haloacid dehalogenase-like hydrolase
550 CAMXVX010000003.1 GCA947252495_00274 CDS open 2750-3979 _na     409_aa Sel1 repeat superfamily protein
551 CAMXVX010000003.1 GCA947252495_00275 CDS open 4105-5505 _na     466_aa Aspartate ammonia-lyase
552 CAMXVX010000003.1 GCA947252495_00276 CDS open 5566-5688 _na     40_aa hypothetical protein
553 CAMXVX010000003.1 GCA947252495_00278 CDS open 5901-6302 _na     133_aa OsmC/Ohr family protein
554 CAMXVX010000003.1 GCA947252495_00279 CDS open 6354-7664 _na     436_aa HTH araC/xylS-type domain-containing protein
555 CAMXVX010000003.1 GCA947252495_00280 CDS open 7828-8262 _na     144_aa DNA protection during starvation protein
556 CAMXVX010000003.1 GCA947252495_00281 CDS open 8600-10792 _na     730_aa nrdD anaerobic ribonucleoside-triphosphate reductase
557 CAMXVX010000003.1 GCA947252495_00282 CDS open 10840-11394 _na     184_aa nrdG anaerobic ribonucleoside-triphosphate reductase activating protein
558 CAMXVX010000003.1 GCA947252495_00283 CDS open 11647-12714 _na     355_aa ADP-ribosylglycohydrolase superfamily protein
559 CAMXVX010000003.1 GCA947252495_00284 CDS open 12864-15212 _na     782_aa recQ DNA helicase RecQ
560 CAMXVX010000003.1 GCA947252495_00285 CDS open 15213-16004 _na     263_aa thymidylate synthase
561 CAMXVX010000003.1 GCA947252495_00286 CDS open 16001-16480 _na     159_aa Dihydrofolate reductase
562 CAMXVX010000003.1 GCA947252495_00287 CDS open 16620-17951 _na     443_aa mepA Multidrug export protein MepA
563 CAMXVX010000003.1 GCA947252495_00288 CDS open 18233-19249 _na     338_aa nrdF class 1b ribonucleoside-diphosphate reductase subunit beta
564 CAMXVX010000003.1 GCA947252495_00289 CDS open 19249-19671 _na     140_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
565 CAMXVX010000003.1 GCA947252495_00290 CDS open 19693-21885 _na     730_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
566 CAMXVX010000003.1 GCA947252495_00293 CDS open 22708-24063 _na     451_aa AGCS family alanine:sodium (Na+) symporter
567 CAMXVX010000003.1 GCA947252495_00294 CDS open 24374-25612 _na     412_aa DAACS family dicarboxylate/amino acid:cation symporter
568 CAMXVX010000003.1 GCA947252495_00295 CDS open 25774-26724 _na     316_aa corA CorA family magnesium transporter
569 CAMXVX010000003.1 GCA947252495_00296 CDS open 26839-27465 _na     208_aa Nitroreductase domain-containing protein
570 CAMXVX010000003.1 GCA947252495_00297 CDS open 27670-29709 _na     679_aa ATPase dynein-related AAA domain-containing protein
571 CAMXVX010000003.1 GCA947252495_00298 CDS open 29693-31450 _na     585_aa DUF2357 domain-containing protein
572 CAMXVX010000003.1 GCA947252495_00299 CDS open 31406-31768 _na     120_aa hypothetical protein
573 CAMXVX010000003.1 GCA947252495_00300 CDS open 31921-32088 _na     55_aa hypothetical protein
574 CAMXVX010000003.1 GCA947252495_00301 CDS open 32027-33292 _na     421_aa uraA uracil permease
575 CAMXVX010000003.1 GCA947252495_00302 CDS open 33440-33862 _na     140_aa Putative acetyltransferase
576 CAMXVX010000003.1 GCA947252495_00303 CDS open 33882-34475 _na     197_aa HTH tetR-type domain-containing protein
577 CAMXVX010000003.1 GCA947252495_00304 CDS open 34963-38403 _na     1146_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
578 CAMXVX010000003.1 GCA947252495_00305 CDS open 38364-39281 _na     305_aa cas1 type II CRISPR-associated endonuclease Cas1
579 CAMXVX010000003.1 GCA947252495_00306 CDS open 39278-39586 _na     102_aa cas2 CRISPR-associated endonuclease Cas2
580 CAMXVX010000003.1 GCA947252495_00307 CDS open 40433-40708 _na     91_aa hypothetical protein
581 CAMXVX010000003.1 GCA947252495_00308 CDS open 40705-41262 _na     185_aa hypothetical protein
582 CAMXVX010000003.1 GCA947252495_00309 CDS open 41392-41745 _na     117_aa hypothetical protein
583 CAMXVX010000003.1 GCA947252495_00310 CDS open 41874-43274 _na     466_aa FAD dependent oxidoreductase
584 CAMXVX010000003.1 GCA947252495_00311 CDS open 43267-44559 _na     430_aa purB adenylosuccinate lyase
585 CAMXVX010000003.1 GCA947252495_00312 CDS open 44576-45865 _na     429_aa adenylosuccinate synthase
586 CAMXVX010000003.1 GCA947252495_00313 CDS open 45989-46417 _na     142_aa eamA EamA domain-containing protein
587 CAMXVX010000003.1 GCA947252495_00314 CDS open 46841-48097 _na     418_aa hisS histidine--tRNA ligase
588 CAMXVX010000003.1 GCA947252495_00315 CDS open 48839-49651 _na     270_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
589 CAMXVX010000003.1 GCA947252495_00316 CDS open 49756-50190 _na     144_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
590 CAMXVX010000003.1 GCA947252495_00317 CDS open 50187-51035 _na     282_aa lpxC UDP-3-O-acyl-N-acetylglucosamine deacetylase
591 CAMXVX010000003.1 GCA947252495_00318 CDS open 51270-51677 _na     135_aa Heat shock protein Hsp20
592 CAMXVX010000003.1 GCA947252495_00319 CDS open 52215-52319 _na     34_aa hypothetical protein
593 CAMXVX010000003.1 GCA947252495_00320 CDS open 52462-52566 _na     34_aa hypothetical protein
594 CAMXVX010000003.1 GCA947252495_00321 CDS open 52709-52828 _na     39_aa hypothetical protein
595 CAMXVX010000003.1 GCA947252495_00322 CDS open 53261-53650 _na     129_aa hypothetical protein
596 CAMXVX010000003.1 GCA947252495_00323 CDS open 54018-54218 _na     66_aa hypothetical protein
597 CAMXVX010000003.1 GCA947252495_00324 CDS open 54332-54469 _na     45_aa rpmH 50S ribosomal protein L34
598 CAMXVX010000003.1 GCA947252495_00325 CDS open 54462-54845 _na     127_aa rnpA ribonuclease P protein component
599 CAMXVX010000003.1 GCA947252495_00326 CDS open 54842-55051 _na     69_aa yidD membrane protein insertion efficiency factor YidD
600 CAMXVX010000003.1 GCA947252495_00327 CDS open 55159-55959 _na     266_aa ParB/SpoJ family partitioning protein
601 CAMXVX010000003.1 GCA947252495_00328 CDS open 55956-56840 _na     294_aa jag RNA-binding cell elongation regulator Jag/EloR
602 CAMXVX010000003.1 GCA947252495_00329 CDS open 56934-58130 _na     398_aa MFS family major facilitator transporter
603 CAMXVX010000003.1 GCA947252495_00330 CDS open 58405-61218 _na     937_aa ileS isoleucine--tRNA ligase
604 CAMXVX010000003.1 GCA947252495_00331 CDS open 61448-63514 _na     688_aa peptidoglycan glycosyltransferase
605 CAMXVX010000003.1 GCA947252495_00332 CDS open 63976-65682 _na     568_aa Fe3+ ABC superfamily ATP binding cassette transporter%2C permease protein
606 CAMXVX010000003.1 GCA947252495_00333 CDS open 65692-66774 _na     360_aa Iron (Fe3+) ABC superfamily ATP binding cassette transporter%2C ABC protein
607 CAMXVX010000003.1 GCA947252495_00334 CDS open 66841-67878 _na     345_aa Iron (Fe3+) ABC superfamily ATP binding cassette transporter%2C binding protein
608 CAMXVX010000003.1 GCA947252495_00335 CDS open 67897-69309 _na     470_aa gndA NADP-dependent phosphogluconate dehydrogenase
609 CAMXVX010000003.1 GCA947252495_00336 CDS open 69950-70696 _na     248_aa 3-oxoacyl-[acyl-carrier-protein] reductase
610 CAMXVX010000003.1 GCA947252495_00337 CDS open 70674-70790 _na     38_aa hypothetical protein
611 CAMXVX010000003.1 GCA947252495_00338 CDS open 70774-71619 _na     281_aa pdxS pyridoxal 5'-phosphate synthase lyase subunit PdxS
612 CAMXVX010000003.1 GCA947252495_00339 CDS open 71961-73448 _na     495_aa Aldehyde dehydrogenase
613 CAMXVX010000003.1 GCA947252495_00340 CDS open 73565-74197 _na     210_aa Protein of hypothetical function UPF0029
614 CAMXVX010000003.1 GCA947252495_00341 CDS open 74402-75346 _na     314_aa FAD:protein FMN transferase
615 CAMXVX010000003.1 GCA947252495_00342 CDS open 75400-75966 _na     188_aa exbB TonB family auxiliary protein ExbB
616 CAMXVX010000003.1 GCA947252495_00343 CDS open 75969-76391 _na     140_aa Iron-sulfur cluster-binding protein
617 CAMXVX010000003.1 GCA947252495_00344 CDS open 76388-77245 _na     285_aa tonB energy transducer TonB
618 CAMXVX010000003.1 GCA947252495_00345 CDS open 77294-78013 _na     239_aa tonB TonB family domain protein
619 CAMXVX010000003.1 GCA947252495_00346 CDS open 78062-79258 _na     398_aa Iron permease FTR1 family
620 CAMXVX010000003.1 GCA947252495_00347 CDS open 79295-79840 _na     181_aa High-affinity Fe2+ transporter
621 CAMXVX010000003.1 GCA947252495_00348 CDS open 79937-81196 _na     419_aa Membrane iron-sulfur containing protein FtrD-like domain-containing protein
622 CAMXVX010000003.1 GCA947252495_00349 CDS open 81212-82489 _na     425_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
623 CAMXVX010000003.1 GCA947252495_00350 CDS open 82494-83630 _na     378_aa ABC superfamily ATP binding cassette transporter%2C membrane protein
624 CAMXVX010000003.1 GCA947252495_00351 CDS open 83640-84305 _na     221_aa ABC superfamily ATP binding cassette transporter%2C ABC protein
625 CAMXVX010000003.1 GCA947252495_00352 CDS open 84302-84781 _na     159_aa Lipoprotein
626 CAMXVX010000003.1 GCA947252495_00353 CDS open 85189-87882 _na     897_aa RNA polymerase subunit alpha
627 CAMXVX010000003.1 GCA947252495_00354 CDS open 87971-89428 _na     485_aa Dolichyl-phosphate-mannose-protein mannosyltransferase
628 CAMXVX010000003.1 GCA947252495_00355 CDS open 89674-90732 _na     352_aa UDP-N-acetylglucosamine:undecaprenyl-P N-acetylglucosaminyl 1-P transferase
629 CAMXVX010000003.1 GCA947252495_00356 CDS open 90729-91871 _na     380_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
630 CAMXVX010000003.1 GCA947252495_00357 CDS open 92004-92243 _na     79_aa Glutathione ABC superfamily ATP binding cassette transporter%2C permease protein
631 CAMXVX010000003.1 GCA947252495_00358 CDS open 92247-92630 _na     127_aa ATP synthase subunit I
632 CAMXVX010000003.1 GCA947252495_00359 CDS open 92672-93337 _na     221_aa atpB F0F1 ATP synthase subunit A
633 CAMXVX010000003.1 GCA947252495_00360 CDS open 93431-93682 _na     83_aa atpE ATP synthase F0 subunit C
634 CAMXVX010000003.1 GCA947252495_00361 CDS open 93719-94213 _na     164_aa atpF F0F1 ATP synthase subunit B
635 CAMXVX010000003.1 GCA947252495_00362 CDS open 94210-94755 _na     181_aa atpH ATP synthase F1 subunit delta
636 CAMXVX010000003.1 GCA947252495_00363 CDS open 94777-96321 _na     514_aa atpA F0F1 ATP synthase subunit alpha
637 CAMXVX010000003.1 GCA947252495_00364 CDS open 96327-97217 _na     296_aa atpG ATP synthase F1 subunit gamma
638 CAMXVX010000003.1 GCA947252495_00365 CDS open 97253-98686 _na     477_aa atpD F0F1 ATP synthase subunit beta
639 CAMXVX010000003.1 GCA947252495_00366 CDS open 98690-99106 _na     138_aa atpC ATP synthase F1 subunit epsilon
640 CAMXVX010000003.1 GCA947252495_00367 CDS open 99243-100178 _na     311_aa Multifunctional fusion protein
641 CAMXVX010000003.1 GCA947252495_00368 CDS open 100201-100896 _na     231_aa ccdA2 thiol-disulfide oxidoreductase-associated membrane protein CcdA2
642 CAMXVX010000003.1 GCA947252495_00369 CDS open 100908-101450 _na     180_aa ccdA Cytochrome C-type biogenesis protein CcdA
643 CAMXVX010000003.1 GCA947252495_00370 CDS open 101541-102914 _na     457_aa aminopeptidase
644 CAMXVX010000003.1 GCA947252495_00371 CDS open 103057-103356 _na     99_aa Transposase
645 CAMXVX010000003.1 GCA947252495_00372 CDS open 103524-105479 _na     651_aa TRAP transporter
646 CAMXVX010000003.1 GCA947252495_00373 CDS open 105476-106459 _na     327_aa TRAP transporter solute receptor TAXI family protein
647 CAMXVX010000003.1 GCA947252495_00374 CDS open 106537-106992 _na     151_aa Cupin 2 conserved barrel domain protein
648 CAMXVX010000003.1 GCA947252495_00375 CDS open 107142-107843 _na     233_aa Pyridoxal phosphate homeostasis protein
649 CAMXVX010000003.1 GCA947252495_00376 CDS open 107840-108298 _na     152_aa sepF Cell division protein SepF
650 CAMXVX010000003.1 GCA947252495_00377 CDS open 108298-108705 _na     135_aa sepF Cell division protein SepF
651 CAMXVX010000003.1 GCA947252495_00378 CDS open 108702-109496 _na     264_aa proC pyrroline-5-carboxylate reductase
652 CAMXVX010000003.1 GCA947252495_00379 CDS open 109493-110284 _na     263_aa S4 domain protein
653 CAMXVX010000003.1 GCA947252495_00380 CDS open 110302-110919 _na     205_aa Septum site-determining protein divIVA
654 CAMXVX010000003.1 GCA947252495_00271 gene open 198-815
655 CAMXVX010000003.1 GCA947252495_00272 gene open 1362-1751
656 CAMXVX010000003.1 GCA947252495_00273 gene open 1764-2687
657 CAMXVX010000003.1 GCA947252495_00274 gene open 2750-3979
658 CAMXVX010000003.1 GCA947252495_00275 gene open 4105-5505
659 CAMXVX010000003.1 GCA947252495_00276 gene open 5566-5688
660 CAMXVX010000003.1 GCA947252495_00278 gene open 5901-6302
661 CAMXVX010000003.1 GCA947252495_00279 gene open 6354-7664
662 CAMXVX010000003.1 GCA947252495_00280 gene open 7828-8262
663 CAMXVX010000003.1 GCA947252495_00281 gene open 8600-10792 nrdD
664 CAMXVX010000003.1 GCA947252495_00282 gene open 10840-11394 nrdG
665 CAMXVX010000003.1 GCA947252495_00283 gene open 11647-12714
666 CAMXVX010000003.1 GCA947252495_00284 gene open 12864-15212 recQ
667 CAMXVX010000003.1 GCA947252495_00285 gene open 15213-16004
668 CAMXVX010000003.1 GCA947252495_00286 gene open 16001-16480
669 CAMXVX010000003.1 GCA947252495_00287 gene open 16620-17951 mepA
670 CAMXVX010000003.1 GCA947252495_00288 gene open 18233-19249 nrdF
671 CAMXVX010000003.1 GCA947252495_00289 gene open 19249-19671 nrdI
672 CAMXVX010000003.1 GCA947252495_00290 gene open 19693-21885 nrdE
673 CAMXVX010000003.1 GCA947252495_00293 gene open 22708-24063
674 CAMXVX010000003.1 GCA947252495_00294 gene open 24374-25612
675 CAMXVX010000003.1 GCA947252495_00295 gene open 25774-26724 corA
676 CAMXVX010000003.1 GCA947252495_00296 gene open 26839-27465
677 CAMXVX010000003.1 GCA947252495_00297 gene open 27670-29709
678 CAMXVX010000003.1 GCA947252495_00298 gene open 29693-31450
679 CAMXVX010000003.1 GCA947252495_00299 gene open 31406-31768
680 CAMXVX010000003.1 GCA947252495_00300 gene open 31921-32088
681 CAMXVX010000003.1 GCA947252495_00301 gene open 32027-33292 uraA
682 CAMXVX010000003.1 GCA947252495_00302 gene open 33440-33862
683 CAMXVX010000003.1 GCA947252495_00303 gene open 33882-34475
684 CAMXVX010000003.1 GCA947252495_00304 gene open 34963-38403 cas9
685 CAMXVX010000003.1 GCA947252495_00305 gene open 38364-39281 cas1
686 CAMXVX010000003.1 GCA947252495_00306 gene open 39278-39586 cas2
687 CAMXVX010000003.1 GCA947252495_00307 gene open 40433-40708
688 CAMXVX010000003.1 GCA947252495_00308 gene open 40705-41262
689 CAMXVX010000003.1 GCA947252495_00309 gene open 41392-41745
690 CAMXVX010000003.1 GCA947252495_00310 gene open 41874-43274
691 CAMXVX010000003.1 GCA947252495_00311 gene open 43267-44559 purB
692 CAMXVX010000003.1 GCA947252495_00312 gene open 44576-45865
693 CAMXVX010000003.1 GCA947252495_00313 gene open 45989-46417 eamA
694 CAMXVX010000003.1 GCA947252495_00314 gene open 46841-48097 hisS
695 CAMXVX010000003.1 GCA947252495_00315 gene open 48839-49651 lpxA
696 CAMXVX010000003.1 GCA947252495_00316 gene open 49756-50190 fabZ
697 CAMXVX010000003.1 GCA947252495_00317 gene open 50187-51035 lpxC
698 CAMXVX010000003.1 GCA947252495_00318 gene open 51270-51677
699 CAMXVX010000003.1 GCA947252495_00319 gene open 52215-52319
700 CAMXVX010000003.1 GCA947252495_00320 gene open 52462-52566
701 CAMXVX010000003.1 GCA947252495_00321 gene open 52709-52828
702 CAMXVX010000003.1 GCA947252495_00322 gene open 53261-53650
703 CAMXVX010000003.1 GCA947252495_00323 gene open 54018-54218
704 CAMXVX010000003.1 GCA947252495_00324 gene open 54332-54469 rpmH
705 CAMXVX010000003.1 GCA947252495_00325 gene open 54462-54845 rnpA
706 CAMXVX010000003.1 GCA947252495_00326 gene open 54842-55051 yidD
707 CAMXVX010000003.1 GCA947252495_00327 gene open 55159-55959
708 CAMXVX010000003.1 GCA947252495_00328 gene open 55956-56840 jag
709 CAMXVX010000003.1 GCA947252495_00329 gene open 56934-58130
710 CAMXVX010000003.1 GCA947252495_00330 gene open 58405-61218 ileS
711 CAMXVX010000003.1 GCA947252495_00331 gene open 61448-63514
712 CAMXVX010000003.1 GCA947252495_00332 gene open 63976-65682
713 CAMXVX010000003.1 GCA947252495_00333 gene open 65692-66774
714 CAMXVX010000003.1 GCA947252495_00334 gene open 66841-67878
715 CAMXVX010000003.1 GCA947252495_00335 gene open 67897-69309 gndA
716 CAMXVX010000003.1 GCA947252495_00336 gene open 69950-70696
717 CAMXVX010000003.1 GCA947252495_00337 gene open 70674-70790
718 CAMXVX010000003.1 GCA947252495_00338 gene open 70774-71619 pdxS
719 CAMXVX010000003.1 GCA947252495_00339 gene open 71961-73448
720 CAMXVX010000003.1 GCA947252495_00340 gene open 73565-74197
721 CAMXVX010000003.1 GCA947252495_00341 gene open 74402-75346
722 CAMXVX010000003.1 GCA947252495_00342 gene open 75400-75966 exbB
723 CAMXVX010000003.1 GCA947252495_00343 gene open 75969-76391
724 CAMXVX010000003.1 GCA947252495_00344 gene open 76388-77245 tonB
725 CAMXVX010000003.1 GCA947252495_00345 gene open 77294-78013 tonB
726 CAMXVX010000003.1 GCA947252495_00346 gene open 78062-79258
727 CAMXVX010000003.1 GCA947252495_00347 gene open 79295-79840
728 CAMXVX010000003.1 GCA947252495_00348 gene open 79937-81196
729 CAMXVX010000003.1 GCA947252495_00349 gene open 81212-82489
730 CAMXVX010000003.1 GCA947252495_00350 gene open 82494-83630
731 CAMXVX010000003.1 GCA947252495_00351 gene open 83640-84305
732 CAMXVX010000003.1 GCA947252495_00352 gene open 84302-84781
733 CAMXVX010000003.1 GCA947252495_00353 gene open 85189-87882
734 CAMXVX010000003.1 GCA947252495_00354 gene open 87971-89428
735 CAMXVX010000003.1 GCA947252495_00355 gene open 89674-90732
736 CAMXVX010000003.1 GCA947252495_00356 gene open 90729-91871 wecB
737 CAMXVX010000003.1 GCA947252495_00357 gene open 92004-92243
738 CAMXVX010000003.1 GCA947252495_00358 gene open 92247-92630
739 CAMXVX010000003.1 GCA947252495_00359 gene open 92672-93337 atpB
740 CAMXVX010000003.1 GCA947252495_00360 gene open 93431-93682 atpE
741 CAMXVX010000003.1 GCA947252495_00361 gene open 93719-94213 atpF
742 CAMXVX010000003.1 GCA947252495_00362 gene open 94210-94755 atpH
743 CAMXVX010000003.1 GCA947252495_00363 gene open 94777-96321 atpA
744 CAMXVX010000003.1 GCA947252495_00364 gene open 96327-97217 atpG
745 CAMXVX010000003.1 GCA947252495_00365 gene open 97253-98686 atpD
746 CAMXVX010000003.1 GCA947252495_00366 gene open 98690-99106 atpC
747 CAMXVX010000003.1 GCA947252495_00367 gene open 99243-100178
748 CAMXVX010000003.1 GCA947252495_00368 gene open 100201-100896 ccdA2
749 CAMXVX010000003.1 GCA947252495_00369 gene open 100908-101450 ccdA
750 CAMXVX010000003.1 GCA947252495_00370 gene open 101541-102914
751 CAMXVX010000003.1 GCA947252495_00371 gene open 103057-103356
752 CAMXVX010000003.1 GCA947252495_00372 gene open 103524-105479
753 CAMXVX010000003.1 GCA947252495_00373 gene open 105476-106459
754 CAMXVX010000003.1 GCA947252495_00374 gene open 106537-106992
755 CAMXVX010000003.1 GCA947252495_00375 gene open 107142-107843
756 CAMXVX010000003.1 GCA947252495_00376 gene open 107840-108298 sepF
757 CAMXVX010000003.1 GCA947252495_00377 gene open 108298-108705 sepF
758 CAMXVX010000003.1 GCA947252495_00378 gene open 108702-109496 proC
759 CAMXVX010000003.1 GCA947252495_00379 gene open 109493-110284
760 CAMXVX010000003.1 GCA947252495_00380 gene open 110302-110919
761 CAMXVX010000003.1 GCA947252495_00277 gene open 5757-5830 trnG
762 CAMXVX010000003.1 GCA947252495_00291 gene open 22034-22110 trnR
763 CAMXVX010000003.1 GCA947252495_00292 gene open 22114-22189 trnW
764 CAMXVX010000003.1 GCA947252495_00277 tRNA open 5757-5830 trnG tRNA-Gly(ccc)
765 CAMXVX010000003.1 GCA947252495_00291 tRNA open 22034-22110 trnR tRNA-Arg(acg)
766 CAMXVX010000003.1 GCA947252495_00292 tRNA open 22114-22189 trnW tRNA-Trp(cca)
767 CAMXVX010000004.1 GCA947252495_00381 CDS open 61-1887 _na     608_aa glmS glutamine--fructose-6-phosphate transaminase (isomerizing)
768 CAMXVX010000004.1 GCA947252495_00382 CDS open 1990-2568 _na     192_aa Yip1 domain-containing protein
769 CAMXVX010000004.1 GCA947252495_00383 CDS open 2578-3528 _na     316_aa Signal peptide peptidase
770 CAMXVX010000004.1 GCA947252495_00385 CDS open 3805-4575 _na     256_aa type III pantothenate kinase
771 CAMXVX010000004.1 GCA947252495_00386 CDS open 4593-5573 _na     326_aa birA Bifunctional ligase/repressor BirA
772 CAMXVX010000004.1 GCA947252495_00387 CDS open 5698-7062 _na     454_aa hslU ATP-dependent protease ATPase subunit HslU
773 CAMXVX010000004.1 GCA947252495_00388 CDS open 7063-7593 _na     176_aa hslV ATP-dependent protease subunit HslV
774 CAMXVX010000004.1 GCA947252495_00389 CDS open 7663-8958 _na     431_aa trmFO methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO
775 CAMXVX010000004.1 GCA947252495_00390 CDS open 8983-11301 _na     772_aa topA type I DNA topoisomerase
776 CAMXVX010000004.1 GCA947252495_00391 CDS open 11335-12426 _na     363_aa dprA DNA-processing protein DprA
777 CAMXVX010000004.1 GCA947252495_00392 CDS open 12428-13948 _na     506_aa comM Competence protein ComM
778 CAMXVX010000004.1 GCA947252495_00393 CDS open 13957-14310 _na     117_aa yraN YraN family protein
779 CAMXVX010000004.1 GCA947252495_00394 CDS open 14579-15373 _na     264_aa ribonuclease HII
780 CAMXVX010000004.1 GCA947252495_00395 CDS open 15370-16230 _na     286_aa ylqF ribosome biogenesis GTPase YlqF
781 CAMXVX010000004.1 GCA947252495_00396 CDS open 16323-17315 _na     330_aa PiT family inorganic phosphate transporter
782 CAMXVX010000004.1 GCA947252495_00397 CDS open 17308-17976 _na     222_aa TIGR00153 family protein
783 CAMXVX010000004.1 GCA947252495_00398 CDS open 18071-19375 _na     434_aa tetrahydrofolate synthase
784 CAMXVX010000004.1 GCA947252495_00399 CDS open 19422-22073 _na     883_aa valine--tRNA ligase
785 CAMXVX010000004.1 GCA947252495_00400 CDS open 22518-23243 _na     241_aa TVP38/TMEM64 family membrane protein
786 CAMXVX010000004.1 GCA947252495_00402 CDS open 23798-25060 _na     420_aa N-acetyllactosaminide beta-1%2C6-N-acetylglucosaminyl-transferase
787 CAMXVX010000004.1 GCA947252495_00403 CDS open 25057-25770 _na     237_aa pssA CDP-diacylglycerol--serine O-phosphatidyltransferase
788 CAMXVX010000004.1 GCA947252495_00404 CDS open 25772-26419 _na     215_aa phosphatidylserine decarboxylase family protein
789 CAMXVX010000004.1 GCA947252495_00405 CDS open 26421-27170 _na     249_aa Mannosaminyltransferase
790 CAMXVX010000004.1 GCA947252495_00406 CDS open 27316-29352 _na     678_aa recG ATP-dependent DNA helicase RecG
791 CAMXVX010000004.1 GCA947252495_00407 CDS open 29567-29758 _na     63_aa rpmB 50S ribosomal protein L28
792 CAMXVX010000004.1 GCA947252495_00408 CDS open 29865-30509 _na     214_aa Coenzyme F420:L-glutamate ligase-like domain-containing protein
793 CAMXVX010000004.1 GCA947252495_00409 CDS open 30510-31064 _na     184_aa DUF58 domain-containing protein
794 CAMXVX010000004.1 GCA947252495_00410 CDS open 31067-31840 _na     257_aa Glutamate racemase
795 CAMXVX010000004.1 GCA947252495_00411 CDS open 31840-32256 _na     138_aa Thioesterase
796 CAMXVX010000004.1 GCA947252495_00412 CDS open 32410-33627 _na     405_aa DUF697 domain-containing protein
797 CAMXVX010000004.1 GCA947252495_00413 CDS open 33762-34487 _na     241_aa 3-oxoacyl-[acyl-carrier-protein] reductase
798 CAMXVX010000004.1 GCA947252495_00414 CDS open 34548-35744 _na     398_aa Aminotransferase
799 CAMXVX010000004.1 GCA947252495_00415 CDS open 35881-36819 _na     312_aa bifunctional riboflavin kinase/FAD synthetase
800 CAMXVX010000004.1 GCA947252495_00416 CDS open 36821-37681 _na     286_aa truB tRNA pseudouridine(55) synthase TruB
801 CAMXVX010000004.1 GCA947252495_00417 CDS open 37681-38646 _na     321_aa DHH family phosphoesterase
802 CAMXVX010000004.1 GCA947252495_00418 CDS open 38643-38996 _na     117_aa rbfA 30S ribosome-binding factor RbfA
803 CAMXVX010000004.1 GCA947252495_00419 CDS open 39072-41630 _na     852_aa infB translation initiation factor IF-2
804 CAMXVX010000004.1 GCA947252495_00420 CDS open 41652-41957 _na     101_aa L7Ae family ribosomal protein
805 CAMXVX010000004.1 GCA947252495_00421 CDS open 41950-42216 _na     88_aa rnpM RNase P modulator RnpM
806 CAMXVX010000004.1 GCA947252495_00422 CDS open 42216-43337 _na     373_aa nusA Transcription termination/antitermination protein NusA
807 CAMXVX010000004.1 GCA947252495_00423 CDS open 43355-43825 _na     156_aa rimP Ribosome maturation factor RimP
808 CAMXVX010000004.1 GCA947252495_00424 CDS open 43956-45311 _na     451_aa AMP-dependent synthetase/ligase domain-containing protein
809 CAMXVX010000004.1 GCA947252495_00425 CDS open 45308-46462 _na     384_aa acetyl-CoA C-acetyltransferase
810 CAMXVX010000004.1 GCA947252495_00426 CDS open 46523-47053 _na     176_aa Biotin transporter
811 CAMXVX010000004.1 GCA947252495_00427 CDS open 47361-48080 _na     239_aa rnc ribonuclease III
812 CAMXVX010000004.1 GCA947252495_00428 CDS open 48093-49337 _na     414_aa fabF beta-ketoacyl-ACP synthase II
813 CAMXVX010000004.1 GCA947252495_00429 CDS open 49481-49714 _na     77_aa acyl carrier protein
814 CAMXVX010000004.1 GCA947252495_00430 CDS open 49754-50497 _na     247_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
815 CAMXVX010000004.1 GCA947252495_00431 CDS open 50497-51447 _na     316_aa fabD ACP S-malonyltransferase
816 CAMXVX010000004.1 GCA947252495_00432 CDS open 51467-52459 _na     330_aa Beta-ketoacyl-[acyl-carrier-protein] synthase III
817 CAMXVX010000004.1 GCA947252495_00433 CDS open 52461-53492 _na     343_aa plsX phosphate acyltransferase PlsX
818 CAMXVX010000004.1 GCA947252495_00434 CDS open 53489-54052 _na     187_aa fapR Transcription regulator FapR
819 CAMXVX010000004.1 GCA947252495_00435 CDS open 54317-55372 _na     351_aa 2-nitropropane dioxygenase family oxidoreductase
820 CAMXVX010000004.1 GCA947252495_00436 CDS open 55429-56016 _na     195_aa pyrE orotate phosphoribosyltransferase
821 CAMXVX010000004.1 GCA947252495_00437 CDS open 56016-56747 _na     243_aa pyrF orotidine-5'-phosphate decarboxylase
822 CAMXVX010000004.1 GCA947252495_00438 CDS open 56844-57776 _na     310_aa Arylsulfotransferase N-terminal domain-containing protein
823 CAMXVX010000004.1 GCA947252495_00439 CDS open 57788-58780 _na     330_aa Phosphodiester glycosidase domain-containing protein
824 CAMXVX010000004.1 GCA947252495_00440 CDS open 58761-59630 _na     289_aa Polysaccharide deacetylase
825 CAMXVX010000004.1 GCA947252495_00441 CDS open 59917-61011 _na     364_aa N-acetylmuramoyl-L-alanine amidase
826 CAMXVX010000004.1 GCA947252495_00442 CDS open 61008-61544 _na     178_aa GerMN domain-containing protein
827 CAMXVX010000004.1 GCA947252495_00443 CDS open 61616-62590 _na     324_aa L-asparaginase
828 CAMXVX010000004.1 GCA947252495_00444 CDS open 62656-64161 _na     501_aa IMP dehydrogenase
829 CAMXVX010000004.1 GCA947252495_00445 CDS open 64240-67863 _na     1207_aa PolC-type DNA polymerase III
830 CAMXVX010000004.1 GCA947252495_00446 CDS open 67890-69344 _na     484_aa vanW VanW like protein
831 CAMXVX010000004.1 GCA947252495_00447 CDS open 69341-70345 _na     334_aa holA DNA polymerase III subunit delta
832 CAMXVX010000004.1 GCA947252495_00448 CDS open 70358-72541 _na     727_aa Competence protein EC
833 CAMXVX010000004.1 GCA947252495_00449 CDS open 72538-73080 _na     180_aa ComEA protein
834 CAMXVX010000004.1 GCA947252495_00450 CDS open 73126-73599 _na     157_aa ATPase subunit H
835 CAMXVX010000004.1 GCA947252495_00451 CDS open 73610-74101 _na     163_aa coaD pantetheine-phosphate adenylyltransferase
836 CAMXVX010000004.1 GCA947252495_00452 CDS open 74101-74661 _na     186_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
837 CAMXVX010000004.1 GCA947252495_00453 CDS open 74658-75683 _na     341_aa Glycerol-3-phosphate dehydrogenase [NAD(P)+]
838 CAMXVX010000004.1 GCA947252495_00454 CDS open 75709-76269 _na     186_aa plsY glycerol-3-phosphate 1-O-acyltransferase PlsY
839 CAMXVX010000004.1 GCA947252495_00455 CDS open 76281-77612 _na     443_aa der ribosome biogenesis GTPase Der
840 CAMXVX010000004.1 GCA947252495_00456 CDS open 77787-79679 _na     630_aa bifunctional 4-hydroxy-3-methylbut-2-enyl diphosphate reductase/30S ribosomal protein S1
841 CAMXVX010000004.1 GCA947252495_00457 CDS open 79708-80334 _na     208_aa 1-acyl-sn-glycerol-3-phosphate acyltransferase
842 CAMXVX010000004.1 GCA947252495_00458 CDS open 80346-81005 _na     219_aa cmk (d)CMP kinase
843 CAMXVX010000004.1 GCA947252495_00459 CDS open 80998-82251 _na     417_aa Pyridine nucleotide-disulfide oxidoreductase
844 CAMXVX010000004.1 GCA947252495_00460 CDS open 82235-82957 _na     240_aa Pseudouridine synthase
845 CAMXVX010000004.1 GCA947252495_00461 CDS open 82954-83487 _na     177_aa scpB SMC-Scp complex subunit ScpB
846 CAMXVX010000004.1 GCA947252495_00462 CDS open 83489-84196 _na     235_aa Segregation and condensation protein A
847 CAMXVX010000004.1 GCA947252495_00463 CDS open 84403-84996 _na     197_aa rpsD 30S ribosomal protein S4
848 CAMXVX010000004.1 GCA947252495_00464 CDS open 85405-86184 _na     259_aa hypothetical protein
849 CAMXVX010000004.1 GCA947252495_00465 CDS open 86207-86698 _na     163_aa Flavodoxin-like domain-containing protein
850 CAMXVX010000004.1 GCA947252495_00466 CDS open 86799-87227 _na     142_aa sufU Fe-S cluster assembly sulfur transfer protein SufU
851 CAMXVX010000004.1 GCA947252495_00467 CDS open 87227-88447 _na     406_aa Cysteine desulfurase
852 CAMXVX010000004.1 GCA947252495_00468 CDS open 88449-89504 _na     351_aa Iron-regulated ABC superfamily ATP binding cassette transporter membrane component (SufB)
853 CAMXVX010000004.1 GCA947252495_00469 CDS open 89515-90927 _na     470_aa sufB Fe-S cluster assembly protein SufB
854 CAMXVX010000004.1 GCA947252495_00470 CDS open 90929-91672 _na     247_aa sufC Fe-S cluster assembly ATPase SufC
855 CAMXVX010000004.1 GCA947252495_00471 CDS open 91924-92706 _na     260_aa Arginine ABC superfamily ATP binding cassette transporter%2C binding protein
856 CAMXVX010000004.1 GCA947252495_00472 CDS open 92973-93563 _na     196_aa dedA DedA family protein
857 CAMXVX010000004.1 GCA947252495_00473 CDS open 93630-95297 _na     555_aa Dolichyl-phosphate-mannose-protein mannosyltransferase
858 CAMXVX010000004.1 GCA947252495_00474 CDS open 95272-95991 _na     239_aa Uracil-DNA glycosylase-like domain-containing protein
859 CAMXVX010000004.1 GCA947252495_00475 CDS open 96028-96426 _na     132_aa GtrA/DPMS transmembrane domain-containing protein
860 CAMXVX010000004.1 GCA947252495_00476 CDS open 96432-97130 _na     232_aa DUF4176 domain-containing protein
861 CAMXVX010000004.1 GCA947252495_00477 CDS open 97114-97731 _na     205_aa Transglycosylase SLT domain protein
862 CAMXVX010000004.1 GCA947252495_00478 CDS open 97734-98345 _na     203_aa coaE dephospho-CoA kinase
863 CAMXVX010000004.1 GCA947252495_00479 CDS open 98345-100918 _na     857_aa polA DNA polymerase I
864 CAMXVX010000004.1 GCA947252495_00381 gene open 61-1887 glmS
865 CAMXVX010000004.1 GCA947252495_00382 gene open 1990-2568
866 CAMXVX010000004.1 GCA947252495_00383 gene open 2578-3528
867 CAMXVX010000004.1 GCA947252495_00385 gene open 3805-4575
868 CAMXVX010000004.1 GCA947252495_00386 gene open 4593-5573 birA
869 CAMXVX010000004.1 GCA947252495_00387 gene open 5698-7062 hslU
870 CAMXVX010000004.1 GCA947252495_00388 gene open 7063-7593 hslV
871 CAMXVX010000004.1 GCA947252495_00389 gene open 7663-8958 trmFO
872 CAMXVX010000004.1 GCA947252495_00390 gene open 8983-11301 topA
873 CAMXVX010000004.1 GCA947252495_00391 gene open 11335-12426 dprA
874 CAMXVX010000004.1 GCA947252495_00392 gene open 12428-13948 comM
875 CAMXVX010000004.1 GCA947252495_00393 gene open 13957-14310 yraN
876 CAMXVX010000004.1 GCA947252495_00394 gene open 14579-15373
877 CAMXVX010000004.1 GCA947252495_00395 gene open 15370-16230 ylqF
878 CAMXVX010000004.1 GCA947252495_00396 gene open 16323-17315
879 CAMXVX010000004.1 GCA947252495_00397 gene open 17308-17976
880 CAMXVX010000004.1 GCA947252495_00398 gene open 18071-19375
881 CAMXVX010000004.1 GCA947252495_00399 gene open 19422-22073
882 CAMXVX010000004.1 GCA947252495_00400 gene open 22518-23243
883 CAMXVX010000004.1 GCA947252495_00402 gene open 23798-25060
884 CAMXVX010000004.1 GCA947252495_00403 gene open 25057-25770 pssA
885 CAMXVX010000004.1 GCA947252495_00404 gene open 25772-26419
886 CAMXVX010000004.1 GCA947252495_00405 gene open 26421-27170
887 CAMXVX010000004.1 GCA947252495_00406 gene open 27316-29352 recG
888 CAMXVX010000004.1 GCA947252495_00407 gene open 29567-29758 rpmB
889 CAMXVX010000004.1 GCA947252495_00408 gene open 29865-30509
890 CAMXVX010000004.1 GCA947252495_00409 gene open 30510-31064
891 CAMXVX010000004.1 GCA947252495_00410 gene open 31067-31840
892 CAMXVX010000004.1 GCA947252495_00411 gene open 31840-32256
893 CAMXVX010000004.1 GCA947252495_00412 gene open 32410-33627
894 CAMXVX010000004.1 GCA947252495_00413 gene open 33762-34487
895 CAMXVX010000004.1 GCA947252495_00414 gene open 34548-35744
896 CAMXVX010000004.1 GCA947252495_00415 gene open 35881-36819
897 CAMXVX010000004.1 GCA947252495_00416 gene open 36821-37681 truB
898 CAMXVX010000004.1 GCA947252495_00417 gene open 37681-38646
899 CAMXVX010000004.1 GCA947252495_00418 gene open 38643-38996 rbfA
900 CAMXVX010000004.1 GCA947252495_00419 gene open 39072-41630 infB
901 CAMXVX010000004.1 GCA947252495_00420 gene open 41652-41957
902 CAMXVX010000004.1 GCA947252495_00421 gene open 41950-42216 rnpM
903 CAMXVX010000004.1 GCA947252495_00422 gene open 42216-43337 nusA
904 CAMXVX010000004.1 GCA947252495_00423 gene open 43355-43825 rimP
905 CAMXVX010000004.1 GCA947252495_00424 gene open 43956-45311
906 CAMXVX010000004.1 GCA947252495_00425 gene open 45308-46462
907 CAMXVX010000004.1 GCA947252495_00426 gene open 46523-47053
908 CAMXVX010000004.1 GCA947252495_00427 gene open 47361-48080 rnc
909 CAMXVX010000004.1 GCA947252495_00428 gene open 48093-49337 fabF
910 CAMXVX010000004.1 GCA947252495_00429 gene open 49481-49714
911 CAMXVX010000004.1 GCA947252495_00430 gene open 49754-50497 fabG
912 CAMXVX010000004.1 GCA947252495_00431 gene open 50497-51447 fabD
913 CAMXVX010000004.1 GCA947252495_00432 gene open 51467-52459
914 CAMXVX010000004.1 GCA947252495_00433 gene open 52461-53492 plsX
915 CAMXVX010000004.1 GCA947252495_00434 gene open 53489-54052 fapR
916 CAMXVX010000004.1 GCA947252495_00435 gene open 54317-55372
917 CAMXVX010000004.1 GCA947252495_00436 gene open 55429-56016 pyrE
918 CAMXVX010000004.1 GCA947252495_00437 gene open 56016-56747 pyrF
919 CAMXVX010000004.1 GCA947252495_00438 gene open 56844-57776
920 CAMXVX010000004.1 GCA947252495_00439 gene open 57788-58780
921 CAMXVX010000004.1 GCA947252495_00440 gene open 58761-59630
922 CAMXVX010000004.1 GCA947252495_00441 gene open 59917-61011
923 CAMXVX010000004.1 GCA947252495_00442 gene open 61008-61544
924 CAMXVX010000004.1 GCA947252495_00443 gene open 61616-62590
925 CAMXVX010000004.1 GCA947252495_00444 gene open 62656-64161
926 CAMXVX010000004.1 GCA947252495_00445 gene open 64240-67863
927 CAMXVX010000004.1 GCA947252495_00446 gene open 67890-69344 vanW
928 CAMXVX010000004.1 GCA947252495_00447 gene open 69341-70345 holA
929 CAMXVX010000004.1 GCA947252495_00448 gene open 70358-72541
930 CAMXVX010000004.1 GCA947252495_00449 gene open 72538-73080
931 CAMXVX010000004.1 GCA947252495_00450 gene open 73126-73599
932 CAMXVX010000004.1 GCA947252495_00451 gene open 73610-74101 coaD
933 CAMXVX010000004.1 GCA947252495_00452 gene open 74101-74661 rsmD
934 CAMXVX010000004.1 GCA947252495_00453 gene open 74658-75683
935 CAMXVX010000004.1 GCA947252495_00454 gene open 75709-76269 plsY
936 CAMXVX010000004.1 GCA947252495_00455 gene open 76281-77612 der
937 CAMXVX010000004.1 GCA947252495_00456 gene open 77787-79679
938 CAMXVX010000004.1 GCA947252495_00457 gene open 79708-80334
939 CAMXVX010000004.1 GCA947252495_00458 gene open 80346-81005 cmk
940 CAMXVX010000004.1 GCA947252495_00459 gene open 80998-82251
941 CAMXVX010000004.1 GCA947252495_00460 gene open 82235-82957
942 CAMXVX010000004.1 GCA947252495_00461 gene open 82954-83487 scpB
943 CAMXVX010000004.1 GCA947252495_00462 gene open 83489-84196
944 CAMXVX010000004.1 GCA947252495_00463 gene open 84403-84996 rpsD
945 CAMXVX010000004.1 GCA947252495_00464 gene open 85405-86184
946 CAMXVX010000004.1 GCA947252495_00465 gene open 86207-86698
947 CAMXVX010000004.1 GCA947252495_00466 gene open 86799-87227 sufU
948 CAMXVX010000004.1 GCA947252495_00467 gene open 87227-88447
949 CAMXVX010000004.1 GCA947252495_00468 gene open 88449-89504
950 CAMXVX010000004.1 GCA947252495_00469 gene open 89515-90927 sufB
951 CAMXVX010000004.1 GCA947252495_00470 gene open 90929-91672 sufC
952 CAMXVX010000004.1 GCA947252495_00471 gene open 91924-92706
953 CAMXVX010000004.1 GCA947252495_00472 gene open 92973-93563 dedA
954 CAMXVX010000004.1 GCA947252495_00473 gene open 93630-95297
955 CAMXVX010000004.1 GCA947252495_00474 gene open 95272-95991
956 CAMXVX010000004.1 GCA947252495_00475 gene open 96028-96426
957 CAMXVX010000004.1 GCA947252495_00476 gene open 96432-97130
958 CAMXVX010000004.1 GCA947252495_00477 gene open 97114-97731
959 CAMXVX010000004.1 GCA947252495_00478 gene open 97734-98345 coaE
960 CAMXVX010000004.1 GCA947252495_00479 gene open 98345-100918 polA
961 CAMXVX010000004.1 GCA947252495_00384 gene open 3639-3714 trnE
962 CAMXVX010000004.1 GCA947252495_00401 gene open 23650-23735 trnL
963 CAMXVX010000004.1 GCA947252495_00480 gene open 101043-101128 trnL
964 CAMXVX010000004.1 GCA947252495_00481 gene open 101158-101244 trnL
965 CAMXVX010000004.1 GCA947252495_00482 gene open 101254-101321 trnF
966 CAMXVX010000004.1 GCA947252495_00384 tRNA open 3639-3714 trnE tRNA-Glu(ctc)
967 CAMXVX010000004.1 GCA947252495_00401 tRNA open 23650-23735 trnL tRNA-Leu(caa)
968 CAMXVX010000004.1 GCA947252495_00480 tRNA open 101043-101128 trnL tRNA-Leu(cag)
969 CAMXVX010000004.1 GCA947252495_00481 tRNA open 101158-101244 trnL tRNA-Leu(gag)
970 CAMXVX010000004.1 GCA947252495_00482 tRNA open 101254-101321 trnF tRNA-Phe(gaa)
971 CAMXVX010000005.1 regulatory_region open 17255-17347 Glycine riboswitch aptamer
972 CAMXVX010000005.1 regulatory_region open 23874-24096 T-box leader
973 CAMXVX010000005.1 GCA947252495_00483 CDS open 23-454 _na     143_aa yadA YadA C-terminal domain-containing protein
974 CAMXVX010000005.1 GCA947252495_00484 CDS open 637-1137 _na     166_aa Tfp pilus assembly protein FimT/FimU
975 CAMXVX010000005.1 GCA947252495_00485 CDS open 1137-1505 _na     122_aa hypothetical protein
976 CAMXVX010000005.1 GCA947252495_00486 CDS open 1502-2017 _na     171_aa type II secretion system protein
977 CAMXVX010000005.1 GCA947252495_00487 CDS open 2010-2405 _na     131_aa pilX Type 4 fimbrial biogenesis protein PilX N-terminal domain-containing protein
978 CAMXVX010000005.1 GCA947252495_00488 CDS open 2407-3726 _na     439_aa pilN Fimbrial assembly protein PilN
979 CAMXVX010000005.1 GCA947252495_00489 CDS open 3719-4168 _na     149_aa Prepilin-type cleavage/methylation N-terminal domain protein
980 CAMXVX010000005.1 GCA947252495_00490 CDS open 4171-4728 _na     185_aa Shikimate kinase
981 CAMXVX010000005.1 GCA947252495_00491 CDS open 4763-6121 _na     452_aa CBS domain protein
982 CAMXVX010000005.1 GCA947252495_00492 CDS open 6105-6542 _na     145_aa hypothetical protein
983 CAMXVX010000005.1 GCA947252495_00493 CDS open 6739-7062 _na     107_aa trxA thioredoxin
984 CAMXVX010000005.1 GCA947252495_00494 CDS open 7453-8214 _na     253_aa Sporulation initiation inhibitor protein Soj
985 CAMXVX010000005.1 GCA947252495_00495 CDS open 8207-9058 _na     283_aa Chromosome partitioning protein SpoOJ
986 CAMXVX010000005.1 GCA947252495_00496 CDS open 9060-9644 _na     194_aa DUF4446 domain-containing protein
987 CAMXVX010000005.1 GCA947252495_00497 CDS open 9641-10534 _na     297_aa M23 peptidase domain protein
988 CAMXVX010000005.1 GCA947252495_00498 CDS open 10583-11266 _na     227_aa DNA alkylation repair enzyme
989 CAMXVX010000005.1 GCA947252495_00499 CDS open 11322-12455 _na     377_aa Type II general secretion pathway (GSP) E protein
990 CAMXVX010000005.1 GCA947252495_00500 CDS open 12465-13469 _na     334_aa 4-diphosphocytidyl-2-C-methyl-D-erythritol kinase
991 CAMXVX010000005.1 GCA947252495_00501 CDS open 13470-14648 _na     392_aa Type IV pilus assembly protein
992 CAMXVX010000005.1 GCA947252495_00503 CDS open 14790-15923 _na     377_aa SAP domain-containing protein
993 CAMXVX010000005.1 GCA947252495_00504 CDS open 16001-17068 _na     355_aa Xaa-Pro dipeptidase
994 CAMXVX010000005.1 GCA947252495_00505 CDS open 17431-18843 _na     470_aa AGCS family alanine:sodium (Na+) symporter
995 CAMXVX010000005.1 GCA947252495_00506 CDS open 18972-19577 _na     201_aa DUF805 domain-containing protein
996 CAMXVX010000005.1 GCA947252495_00507 CDS open 19674-21128 _na     484_aa Long-chain-fatty-acid-CoA ligase
997 CAMXVX010000005.1 GCA947252495_00508 CDS open 21481-22137 _na     218_aa Manganese transport regulator
998 CAMXVX010000005.1 GCA947252495_00509 CDS open 22332-23753 _na     473_aa dnaB replicative DNA helicase
999 CAMXVX010000005.1 GCA947252495_00510 CDS open 24389-25444 _na     351_aa Outer membrane protein beta-barrel domain-containing protein
1000 CAMXVX010000005.1 GCA947252495_00511 CDS open 25685-27169 _na     494_aa dnaA chromosomal replication initiator protein DnaA