HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptostreptococcus anaerobius (GCA_947253115.1)

Select a Genome:
BAKTA Annotations for GCA_947253115.1
Genome Selected: Peptostreptococcus anaerobius
ContigsBases CDSrRNA tmRNAtRNA
83 2012644 1802 0 1 14
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3681 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:3]    |    Number of Records Found: 3681 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1001 CAMXYO010000007.1 GCA947253115_00483 gene open 33247-33396
1002 CAMXYO010000007.1 GCA947253115_00484 gene open 33863-34060
1003 CAMXYO010000007.1 GCA947253115_00485 gene open 34134-36566
1004 CAMXYO010000007.1 GCA947253115_00486 gene open 36636-37346
1005 CAMXYO010000007.1 GCA947253115_00487 gene open 37346-38578
1006 CAMXYO010000007.1 GCA947253115_00488 gene open 38580-39581
1007 CAMXYO010000007.1 GCA947253115_00489 gene open 39758-41008
1008 CAMXYO010000007.1 GCA947253115_00490 gene open 41070-41747
1009 CAMXYO010000007.1 GCA947253115_00491 gene open 41734-43482
1010 CAMXYO010000007.1 GCA947253115_00492 gene open 43719-44054
1011 CAMXYO010000007.1 GCA947253115_00493 gene open 43997-44560
1012 CAMXYO010000007.1 GCA947253115_00494 gene open 44849-45013
1013 CAMXYO010000007.1 GCA947253115_00495 gene open 45263-45703 lytR
1014 CAMXYO010000007.1 GCA947253115_00496 gene open 45713-46138
1015 CAMXYO010000007.1 GCA947253115_00497 gene open 46503-46721
1016 CAMXYO010000007.1 GCA947253115_00498 gene open 46853-47128
1017 CAMXYO010000007.1 GCA947253115_00499 gene open 47306-47512
1018 CAMXYO010000007.1 GCA947253115_00500 gene open 47536-48210
1019 CAMXYO010000007.1 GCA947253115_00501 gene open 48197-49171
1020 CAMXYO010000007.1 GCA947253115_00502 gene open 49285-49974 lolD
1021 CAMXYO010000007.1 GCA947253115_00503 gene open 49961-52465
1022 CAMXYO010000007.1 GCA947253115_00504 gene open 52683-53993
1023 CAMXYO010000007.1 GCA947253115_00505 gene open 54238-55329
1024 CAMXYO010000007.1 GCA947253115_00506 gene open 55336-56517
1025 CAMXYO010000007.1 GCA947253115_00507 gene open 56722-57282 dapB
1026 CAMXYO010000008.1 GCA947253115_00508 CDS open 418-570 _na     50_aa Acyl-CoA dehydrogenase/oxidase N-terminal domain-containing protein
1027 CAMXYO010000008.1 GCA947253115_00509 CDS open 895-1950 _na     351_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
1028 CAMXYO010000008.1 GCA947253115_00510 CDS open 1952-2338 _na     128_aa Holo-[acyl-carrier-protein] synthase
1029 CAMXYO010000008.1 GCA947253115_00511 CDS open 2594-2707 _na     37_aa hypothetical protein
1030 CAMXYO010000008.1 GCA947253115_00512 CDS open 2724-3536 _na     270_aa Transketolase%2C thiamine diphosphate binding domain protein
1031 CAMXYO010000008.1 GCA947253115_00513 CDS open 3546-4484 _na     312_aa Transketolase%2C pyridine binding domain protein
1032 CAMXYO010000008.1 GCA947253115_00514 CDS open 4509-5669 _na     386_aa Peptidase%2C S41 family
1033 CAMXYO010000008.1 GCA947253115_00515 CDS open 5741-6811 _na     356_aa cobT nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase
1034 CAMXYO010000008.1 GCA947253115_00516 CDS open 6799-7371 _na     190_aa Adenosylcobinamide kinase
1035 CAMXYO010000008.1 GCA947253115_00517 CDS open 7380-8195 _na     271_aa cobS adenosylcobinamide-GDP ribazoletransferase
1036 CAMXYO010000008.1 GCA947253115_00518 CDS open 8222-8863 _na     213_aa Alpha-ribazole phosphatase
1037 CAMXYO010000008.1 GCA947253115_00519 CDS open 8863-9828 _na     321_aa cobyric acid synthase
1038 CAMXYO010000008.1 GCA947253115_00520 CDS open 9832-11205 _na     457_aa cobyrinate a%2Cc-diamide synthase
1039 CAMXYO010000008.1 GCA947253115_00521 CDS open 11210-12187 _na     325_aa cbiB adenosylcobinamide-phosphate synthase CbiB
1040 CAMXYO010000008.1 GCA947253115_00522 CDS open 12335-13480 _na     381_aa Aminotransferase
1041 CAMXYO010000008.1 GCA947253115_00523 CDS open 13490-14131 _na     213_aa cobalt-precorrin-8 methylmutase
1042 CAMXYO010000008.1 GCA947253115_00524 CDS open 14140-15312 _na     390_aa cbiD cobalt-precorrin-5B (C(1))-methyltransferase CbiD
1043 CAMXYO010000008.1 GCA947253115_00525 CDS open 15309-15941 _na     210_aa cbiE Precorrin-6y C5%2C15-methyltransferase (Decarboxylating)%2C CbiE subunit
1044 CAMXYO010000008.1 GCA947253115_00526 CDS open 16007-16579 _na     190_aa cbiT Precorrin-6Y C5%2C15-methyltransferase (Decarboxylating)%2C CbiT subunit
1045 CAMXYO010000008.1 GCA947253115_00527 CDS open 16733-17506 _na     257_aa cobalt-precorrin-4 methyltransferase
1046 CAMXYO010000008.1 GCA947253115_00528 CDS open 17469-18734 _na     421_aa cbiG CbiG
1047 CAMXYO010000008.1 GCA947253115_00529 CDS open 18731-19456 _na     241_aa Precorrin-3B C(17)-methyltransferase
1048 CAMXYO010000008.1 GCA947253115_00530 CDS open 19453-20217 _na     254_aa cobK precorrin-6A reductase
1049 CAMXYO010000008.1 GCA947253115_00531 CDS open 20269-21060 _na     263_aa Cobalt chelatase (CbiK)
1050 CAMXYO010000008.1 GCA947253115_00532 CDS open 21064-21771 _na     235_aa cobalt-factor II C(20)-methyltransferase
1051 CAMXYO010000008.1 GCA947253115_00533 CDS open 21785-22243 _na     152_aa Flavodoxin
1052 CAMXYO010000008.1 GCA947253115_00534 CDS open 22333-23271 _na     312_aa ABC transporter%2C substrate-binding protein
1053 CAMXYO010000008.1 GCA947253115_00535 CDS open 23445-24185 _na     246_aa yusV putative siderophore transport system ATP-binding protein YusV
1054 CAMXYO010000008.1 GCA947253115_00536 CDS open 24186-25058 _na     290_aa ABC 3 transport family protein
1055 CAMXYO010000008.1 GCA947253115_00537 CDS open 25058-26164 _na     368_aa ABC 3 transport family protein
1056 CAMXYO010000008.1 GCA947253115_00538 CDS open 26406-27410 _na     334_aa asrA anaerobic sulfite reductase subunit AsrA
1057 CAMXYO010000008.1 GCA947253115_00539 CDS open 27426-28226 _na     266_aa asrB anaerobic sulfite reductase subunit AsrB
1058 CAMXYO010000008.1 GCA947253115_00540 CDS open 28238-29212 _na     324_aa asrC sulfite reductase subunit C
1059 CAMXYO010000008.1 GCA947253115_00541 CDS open 29407-30162 _na     251_aa Formate/nitrite transporter
1060 CAMXYO010000008.1 GCA947253115_00542 CDS open 30113-30850 _na     245_aa TIGR01906 family protein
1061 CAMXYO010000008.1 GCA947253115_00543 CDS open 31076-32041 _na     321_aa hemC hydroxymethylbilane synthase
1062 CAMXYO010000008.1 GCA947253115_00544 CDS open 32045-33613 _na     522_aa uroporphyrinogen-III C-methyltransferase
1063 CAMXYO010000008.1 GCA947253115_00545 CDS open 33613-34059 _na     148_aa precorrin-2 dehydrogenase
1064 CAMXYO010000008.1 GCA947253115_00546 CDS open 34198-36558 _na     786_aa DNA 3'-5' helicase
1065 CAMXYO010000008.1 GCA947253115_00547 CDS open 36616-37968 _na     450_aa M18 family aminopeptidase
1066 CAMXYO010000008.1 GCA947253115_00548 CDS open 38146-38670 _na     174_aa Peptidyl-prolyl cis-trans isomerase
1067 CAMXYO010000008.1 GCA947253115_00549 CDS open 38697-39605 _na     302_aa manganese-dependent inorganic pyrophosphatase
1068 CAMXYO010000008.1 GCA947253115_00550 CDS open 39793-40977 _na     394_aa 5-formyltetrahydrofolate cyclo-ligase
1069 CAMXYO010000008.1 GCA947253115_00551 CDS open 41120-41848 _na     242_aa ecsA ABC-type transporter ATP-binding protein EcsA
1070 CAMXYO010000008.1 GCA947253115_00552 CDS open 41841-43469 _na     542_aa ATP synthase F0%2C A subunit
1071 CAMXYO010000008.1 GCA947253115_00553 CDS open 43581-44714 _na     377_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
1072 CAMXYO010000008.1 GCA947253115_00554 CDS open 44876-45382 _na     168_aa tpx thiol peroxidase
1073 CAMXYO010000008.1 GCA947253115_00555 CDS open 45550-46152 _na     200_aa dcd dCTP deaminase
1074 CAMXYO010000008.1 GCA947253115_00556 CDS open 46318-47982 _na     554_aa Lipoprotein
1075 CAMXYO010000008.1 GCA947253115_00557 CDS open 48085-48486 _na     133_aa Fluoroacetyl-CoA-specific thioesterase-like domain-containing protein
1076 CAMXYO010000008.1 GCA947253115_00558 CDS open 48777-50018 _na     413_aa DUF1858 domain-containing protein
1077 CAMXYO010000008.1 GCA947253115_00559 CDS open 50078-50773 _na     231_aa hypB CobW/P47K family protein
1078 CAMXYO010000008.1 GCA947253115_00560 CDS open 50785-51783 _na     332_aa ABC transporter%2C ATP-binding protein
1079 CAMXYO010000008.1 GCA947253115_00561 CDS open 51987-52406 _na     139_aa hicB Toxin-antitoxin system%2C antitoxin component%2C HicB family
1080 CAMXYO010000008.1 GCA947253115_00562 CDS open 52568-52747 _na     59_aa ParB-like nuclease domain
1081 CAMXYO010000008.1 GCA947253115_00563 CDS open 52717-53007 _na     96_aa Tox-URI2 domain-containing protein
1082 CAMXYO010000008.1 GCA947253115_00564 CDS open 53204-53563 _na     119_aa hypothetical protein
1083 CAMXYO010000008.1 GCA947253115_00565 CDS open 53694-53825 _na     43_aa hypothetical protein
1084 CAMXYO010000008.1 GCA947253115_00566 CDS open 53982-54146 _na     54_aa hypothetical protein
1085 CAMXYO010000008.1 GCA947253115_00567 CDS open 54184-54348 _na     54_aa Cysteine-rich CPCC domain-containing protein
1086 CAMXYO010000008.1 GCA947253115_00568 CDS open 54348-54662 _na     104_aa yjcQ YjcQ protein
1087 CAMXYO010000008.1 GCA947253115_00508 gene open 418-570
1088 CAMXYO010000008.1 GCA947253115_00509 gene open 895-1950 lytC
1089 CAMXYO010000008.1 GCA947253115_00510 gene open 1952-2338
1090 CAMXYO010000008.1 GCA947253115_00511 gene open 2594-2707
1091 CAMXYO010000008.1 GCA947253115_00512 gene open 2724-3536
1092 CAMXYO010000008.1 GCA947253115_00513 gene open 3546-4484
1093 CAMXYO010000008.1 GCA947253115_00514 gene open 4509-5669
1094 CAMXYO010000008.1 GCA947253115_00515 gene open 5741-6811 cobT
1095 CAMXYO010000008.1 GCA947253115_00516 gene open 6799-7371
1096 CAMXYO010000008.1 GCA947253115_00517 gene open 7380-8195 cobS
1097 CAMXYO010000008.1 GCA947253115_00518 gene open 8222-8863
1098 CAMXYO010000008.1 GCA947253115_00519 gene open 8863-9828
1099 CAMXYO010000008.1 GCA947253115_00520 gene open 9832-11205
1100 CAMXYO010000008.1 GCA947253115_00521 gene open 11210-12187 cbiB
1101 CAMXYO010000008.1 GCA947253115_00522 gene open 12335-13480
1102 CAMXYO010000008.1 GCA947253115_00523 gene open 13490-14131
1103 CAMXYO010000008.1 GCA947253115_00524 gene open 14140-15312 cbiD
1104 CAMXYO010000008.1 GCA947253115_00525 gene open 15309-15941 cbiE
1105 CAMXYO010000008.1 GCA947253115_00526 gene open 16007-16579 cbiT
1106 CAMXYO010000008.1 GCA947253115_00527 gene open 16733-17506
1107 CAMXYO010000008.1 GCA947253115_00528 gene open 17469-18734 cbiG
1108 CAMXYO010000008.1 GCA947253115_00529 gene open 18731-19456
1109 CAMXYO010000008.1 GCA947253115_00530 gene open 19453-20217 cobK
1110 CAMXYO010000008.1 GCA947253115_00531 gene open 20269-21060
1111 CAMXYO010000008.1 GCA947253115_00532 gene open 21064-21771
1112 CAMXYO010000008.1 GCA947253115_00533 gene open 21785-22243
1113 CAMXYO010000008.1 GCA947253115_00534 gene open 22333-23271
1114 CAMXYO010000008.1 GCA947253115_00535 gene open 23445-24185 yusV
1115 CAMXYO010000008.1 GCA947253115_00536 gene open 24186-25058
1116 CAMXYO010000008.1 GCA947253115_00537 gene open 25058-26164
1117 CAMXYO010000008.1 GCA947253115_00538 gene open 26406-27410 asrA
1118 CAMXYO010000008.1 GCA947253115_00539 gene open 27426-28226 asrB
1119 CAMXYO010000008.1 GCA947253115_00540 gene open 28238-29212 asrC
1120 CAMXYO010000008.1 GCA947253115_00541 gene open 29407-30162
1121 CAMXYO010000008.1 GCA947253115_00542 gene open 30113-30850
1122 CAMXYO010000008.1 GCA947253115_00543 gene open 31076-32041 hemC
1123 CAMXYO010000008.1 GCA947253115_00544 gene open 32045-33613
1124 CAMXYO010000008.1 GCA947253115_00545 gene open 33613-34059
1125 CAMXYO010000008.1 GCA947253115_00546 gene open 34198-36558
1126 CAMXYO010000008.1 GCA947253115_00547 gene open 36616-37968
1127 CAMXYO010000008.1 GCA947253115_00548 gene open 38146-38670
1128 CAMXYO010000008.1 GCA947253115_00549 gene open 38697-39605
1129 CAMXYO010000008.1 GCA947253115_00550 gene open 39793-40977
1130 CAMXYO010000008.1 GCA947253115_00551 gene open 41120-41848 ecsA
1131 CAMXYO010000008.1 GCA947253115_00552 gene open 41841-43469
1132 CAMXYO010000008.1 GCA947253115_00553 gene open 43581-44714 lytC
1133 CAMXYO010000008.1 GCA947253115_00554 gene open 44876-45382 tpx
1134 CAMXYO010000008.1 GCA947253115_00555 gene open 45550-46152 dcd
1135 CAMXYO010000008.1 GCA947253115_00556 gene open 46318-47982
1136 CAMXYO010000008.1 GCA947253115_00557 gene open 48085-48486
1137 CAMXYO010000008.1 GCA947253115_00558 gene open 48777-50018
1138 CAMXYO010000008.1 GCA947253115_00559 gene open 50078-50773 hypB
1139 CAMXYO010000008.1 GCA947253115_00560 gene open 50785-51783
1140 CAMXYO010000008.1 GCA947253115_00561 gene open 51987-52406 hicB
1141 CAMXYO010000008.1 GCA947253115_00562 gene open 52568-52747
1142 CAMXYO010000008.1 GCA947253115_00563 gene open 52717-53007
1143 CAMXYO010000008.1 GCA947253115_00564 gene open 53204-53563
1144 CAMXYO010000008.1 GCA947253115_00565 gene open 53694-53825
1145 CAMXYO010000008.1 GCA947253115_00566 gene open 53982-54146
1146 CAMXYO010000008.1 GCA947253115_00567 gene open 54184-54348
1147 CAMXYO010000008.1 GCA947253115_00568 gene open 54348-54662 yjcQ
1148 CAMXYO010000009.1 regulatory_region open 18168-18267 SAM riboswitch aptamer (S box leader)
1149 CAMXYO010000009.1 repeat_region open 53289-54173 CRISPR array with 14 repeats of length 29%2C consensus sequence ATGTAATAGAATCAAAGTGAAATGTAAAT and spacer length 36
1150 CAMXYO010000009.1 GCA947253115_00573 CDS open 647-1498 _na     283_aa cdaA diadenylate cyclase CdaA
1151 CAMXYO010000009.1 GCA947253115_00574 CDS open 1512-2435 _na     307_aa YbbR-like protein
1152 CAMXYO010000009.1 GCA947253115_00575 CDS open 3044-4177 _na     377_aa buk butyrate kinase
1153 CAMXYO010000009.1 GCA947253115_00576 CDS open 4254-4928 _na     224_aa ATP-binding protein
1154 CAMXYO010000009.1 GCA947253115_00577 CDS open 4981-5199 _na     72_aa 4Fe-4S binding domain protein
1155 CAMXYO010000009.1 GCA947253115_00578 CDS open 5220-6281 _na     353_aa porA 2-ketoisovalerate ferredoxin oxidoreductase
1156 CAMXYO010000009.1 GCA947253115_00579 CDS open 6281-7069 _na     262_aa Thiamine pyrophosphate enzyme%2C C-terminal TPP binding domain protein
1157 CAMXYO010000009.1 GCA947253115_00580 CDS open 7070-7627 _na     185_aa porG 2-oxoacid:acceptor oxidoreductase%2C gamma subunit%2C pyruvate/2-ketoisovalerate family
1158 CAMXYO010000009.1 GCA947253115_00581 CDS open 7805-9154 _na     449_aa glmM phosphoglucosamine mutase
1159 CAMXYO010000009.1 GCA947253115_00582 CDS open 9365-10618 _na     417_aa murA UDP-N-acetylglucosamine 1-carboxyvinyltransferase
1160 CAMXYO010000009.1 GCA947253115_00583 CDS open 10655-11665 _na     336_aa mreB Cell shape-determining protein MreB
1161 CAMXYO010000009.1 GCA947253115_00584 CDS open 11732-12880 _na     382_aa Glycosyltransferase subfamily 4-like N-terminal domain-containing protein
1162 CAMXYO010000009.1 GCA947253115_00585 CDS open 12882-14090 _na     402_aa tuaD UDP-glucose 6-dehydrogenase tuaD
1163 CAMXYO010000009.1 GCA947253115_00586 CDS open 14103-15203 _na     366_aa wecB non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase
1164 CAMXYO010000009.1 GCA947253115_00587 CDS open 15204-16421 _na     405_aa GDP-mannose-dependent alpha-(1-6)-phosphatidylinositol monomannoside mannosyltransferase
1165 CAMXYO010000009.1 GCA947253115_00588 CDS open 16438-18009 _na     523_aa murJ murein biosynthesis integral membrane protein MurJ
1166 CAMXYO010000009.1 GCA947253115_00589 CDS open 18353-19561 _na     402_aa metK methionine adenosyltransferase
1167 CAMXYO010000009.1 GCA947253115_00590 CDS open 19854-21041 _na     395_aa Branched-chain amino acid transport system carrier protein
1168 CAMXYO010000009.1 GCA947253115_00591 CDS open 21316-23538 _na     740_aa recD2 ATP-dependent RecD2 DNA helicase
1169 CAMXYO010000009.1 GCA947253115_00592 CDS open 23546-24367 _na     273_aa comF ComF family protein
1170 CAMXYO010000009.1 GCA947253115_00593 CDS open 24397-26919 _na     840_aa lytC N-acetylmuramoyl-L-alanine amidase LytC
1171 CAMXYO010000009.1 GCA947253115_00594 CDS open 27054-28670 _na     538_aa ytgP putative cell division protein ytgP
1172 CAMXYO010000009.1 GCA947253115_00595 CDS open 28838-29785 _na     315_aa Tetrapyrrole methylase
1173 CAMXYO010000009.1 GCA947253115_00596 CDS open 29909-30109 _na     66_aa rpmE 50S ribosomal protein L31
1174 CAMXYO010000009.1 GCA947253115_00597 CDS open 30197-30520 _na     107_aa Branched-chain amino acid transport protein (AzlD)
1175 CAMXYO010000009.1 GCA947253115_00598 CDS open 30510-31220 _na     236_aa ygaZ Inner membrane protein YgaZ
1176 CAMXYO010000009.1 GCA947253115_00599 CDS open 31459-31704 _na     81_aa hypothetical protein
1177 CAMXYO010000009.1 GCA947253115_00600 CDS open 31719-32279 _na     186_aa Bacterial toxin 50 domain-containing protein
1178 CAMXYO010000009.1 GCA947253115_00601 CDS open 32293-32526 _na     77_aa hypothetical protein
1179 CAMXYO010000009.1 GCA947253115_00602 CDS open 33173-34081 _na     302_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
1180 CAMXYO010000009.1 GCA947253115_00603 CDS open 34255-34797 _na     180_aa accB acetyl-CoA carboxylase biotin carboxyl carrier protein
1181 CAMXYO010000009.1 GCA947253115_00604 CDS open 34799-36148 _na     449_aa accC acetyl-CoA carboxylase biotin carboxylase subunit
1182 CAMXYO010000009.1 GCA947253115_00605 CDS open 36151-37011 _na     286_aa accD acetyl-CoA carboxylase%2C carboxyltransferase subunit beta
1183 CAMXYO010000009.1 GCA947253115_00606 CDS open 37072-37815 _na     247_aa acetyl-CoA carboxytransferase
1184 CAMXYO010000009.1 GCA947253115_00607 CDS open 37830-38519 _na     229_aa marR Transcriptional regulator%2C MarR family
1185 CAMXYO010000009.1 GCA947253115_00608 CDS open 38509-39519 _na     336_aa 3-oxoacyl-[acyl-carrier-protein] synthase 3
1186 CAMXYO010000009.1 GCA947253115_00609 CDS open 39680-39910 _na     76_aa Acyl carrier protein
1187 CAMXYO010000009.1 GCA947253115_00610 CDS open 39910-40863 _na     317_aa Nitronate monooxygenase
1188 CAMXYO010000009.1 GCA947253115_00611 CDS open 40856-41788 _na     310_aa Malonyl CoA-acyl carrier protein transacylase
1189 CAMXYO010000009.1 GCA947253115_00612 CDS open 41804-42550 _na     248_aa fabG 3-oxoacyl-[acyl-carrier-protein] reductase
1190 CAMXYO010000009.1 GCA947253115_00613 CDS open 42573-43808 _na     411_aa fabF beta-ketoacyl-ACP synthase II
1191 CAMXYO010000009.1 GCA947253115_00614 CDS open 43823-44269 _na     148_aa fabZ 3-hydroxyacyl-ACP dehydratase FabZ
1192 CAMXYO010000009.1 GCA947253115_00615 CDS open 44641-45390 _na     249_aa cas6 CRISPR-associated endoribonuclease Cas6
1193 CAMXYO010000009.1 GCA947253115_00616 CDS open 45411-47138 _na     575_aa CRISPR-associated cxxc_cxxc protein Cst1
1194 CAMXYO010000009.1 GCA947253115_00617 CDS open 47149-48042 _na     297_aa cas7i type I-B CRISPR-associated protein Cas7/Cst2/DevR
1195 CAMXYO010000009.1 GCA947253115_00618 CDS open 48029-48796 _na     255_aa Putative CRISPR-associated protein Cas5%2C Tneap subtype
1196 CAMXYO010000009.1 GCA947253115_00619 CDS open 48859-51240 _na     793_aa CRISPR-associated helicase Cas3
1197 CAMXYO010000009.1 GCA947253115_00620 CDS open 51257-51748 _na     163_aa cas4 CRISPR-associated protein Cas4
1198 CAMXYO010000009.1 GCA947253115_00621 CDS open 51767-52756 _na     329_aa cas1b type I-B CRISPR-associated endonuclease Cas1b
1199 CAMXYO010000009.1 GCA947253115_00622 CDS open 52759-53037 _na     92_aa cas2 CRISPR-associated endonuclease Cas2
1200 CAMXYO010000009.1 GCA947253115_00573 gene open 647-1498 cdaA
1201 CAMXYO010000009.1 GCA947253115_00574 gene open 1512-2435
1202 CAMXYO010000009.1 GCA947253115_00575 gene open 3044-4177 buk
1203 CAMXYO010000009.1 GCA947253115_00576 gene open 4254-4928
1204 CAMXYO010000009.1 GCA947253115_00577 gene open 4981-5199
1205 CAMXYO010000009.1 GCA947253115_00578 gene open 5220-6281 porA
1206 CAMXYO010000009.1 GCA947253115_00579 gene open 6281-7069
1207 CAMXYO010000009.1 GCA947253115_00580 gene open 7070-7627 porG
1208 CAMXYO010000009.1 GCA947253115_00581 gene open 7805-9154 glmM
1209 CAMXYO010000009.1 GCA947253115_00582 gene open 9365-10618 murA
1210 CAMXYO010000009.1 GCA947253115_00583 gene open 10655-11665 mreB
1211 CAMXYO010000009.1 GCA947253115_00584 gene open 11732-12880
1212 CAMXYO010000009.1 GCA947253115_00585 gene open 12882-14090 tuaD
1213 CAMXYO010000009.1 GCA947253115_00586 gene open 14103-15203 wecB
1214 CAMXYO010000009.1 GCA947253115_00587 gene open 15204-16421
1215 CAMXYO010000009.1 GCA947253115_00588 gene open 16438-18009 murJ
1216 CAMXYO010000009.1 GCA947253115_00589 gene open 18353-19561 metK
1217 CAMXYO010000009.1 GCA947253115_00590 gene open 19854-21041
1218 CAMXYO010000009.1 GCA947253115_00591 gene open 21316-23538 recD2
1219 CAMXYO010000009.1 GCA947253115_00592 gene open 23546-24367 comF
1220 CAMXYO010000009.1 GCA947253115_00593 gene open 24397-26919 lytC
1221 CAMXYO010000009.1 GCA947253115_00594 gene open 27054-28670 ytgP
1222 CAMXYO010000009.1 GCA947253115_00595 gene open 28838-29785
1223 CAMXYO010000009.1 GCA947253115_00596 gene open 29909-30109 rpmE
1224 CAMXYO010000009.1 GCA947253115_00597 gene open 30197-30520
1225 CAMXYO010000009.1 GCA947253115_00598 gene open 30510-31220 ygaZ
1226 CAMXYO010000009.1 GCA947253115_00599 gene open 31459-31704
1227 CAMXYO010000009.1 GCA947253115_00600 gene open 31719-32279
1228 CAMXYO010000009.1 GCA947253115_00601 gene open 32293-32526
1229 CAMXYO010000009.1 GCA947253115_00602 gene open 33173-34081 prmC
1230 CAMXYO010000009.1 GCA947253115_00603 gene open 34255-34797 accB
1231 CAMXYO010000009.1 GCA947253115_00604 gene open 34799-36148 accC
1232 CAMXYO010000009.1 GCA947253115_00605 gene open 36151-37011 accD
1233 CAMXYO010000009.1 GCA947253115_00606 gene open 37072-37815
1234 CAMXYO010000009.1 GCA947253115_00607 gene open 37830-38519 marR
1235 CAMXYO010000009.1 GCA947253115_00608 gene open 38509-39519
1236 CAMXYO010000009.1 GCA947253115_00609 gene open 39680-39910
1237 CAMXYO010000009.1 GCA947253115_00610 gene open 39910-40863
1238 CAMXYO010000009.1 GCA947253115_00611 gene open 40856-41788
1239 CAMXYO010000009.1 GCA947253115_00612 gene open 41804-42550 fabG
1240 CAMXYO010000009.1 GCA947253115_00613 gene open 42573-43808 fabF
1241 CAMXYO010000009.1 GCA947253115_00614 gene open 43823-44269 fabZ
1242 CAMXYO010000009.1 GCA947253115_00615 gene open 44641-45390 cas6
1243 CAMXYO010000009.1 GCA947253115_00616 gene open 45411-47138
1244 CAMXYO010000009.1 GCA947253115_00617 gene open 47149-48042 cas7i
1245 CAMXYO010000009.1 GCA947253115_00618 gene open 48029-48796
1246 CAMXYO010000009.1 GCA947253115_00619 gene open 48859-51240
1247 CAMXYO010000009.1 GCA947253115_00620 gene open 51257-51748 cas4
1248 CAMXYO010000009.1 GCA947253115_00621 gene open 51767-52756 cas1b
1249 CAMXYO010000009.1 GCA947253115_00622 gene open 52759-53037 cas2
1250 CAMXYO010000009.1 GCA947253115_00569 gene open 162-237 trnfM
1251 CAMXYO010000009.1 GCA947253115_00570 gene open 245-316 trnE
1252 CAMXYO010000009.1 GCA947253115_00571 gene open 341-417 trnD
1253 CAMXYO010000009.1 GCA947253115_00572 gene open 422-496 trnG
1254 CAMXYO010000009.1 GCA947253115_00569 tRNA open 162-237 trnfM tRNA-fMet(cat)
1255 CAMXYO010000009.1 GCA947253115_00570 tRNA open 245-316 trnE tRNA-Glu(ttc)
1256 CAMXYO010000009.1 GCA947253115_00571 tRNA open 341-417 trnD tRNA-Asp(gtc)
1257 CAMXYO010000009.1 GCA947253115_00572 tRNA open 422-496 trnG tRNA-Gly(gcc)
1258 CAMXYO010000010.1 GCA947253115_00623 CDS open 132-1277 _na     381_aa C4-dicarboxylate transporter/malic acid transport protein
1259 CAMXYO010000010.1 GCA947253115_00624 CDS open 1401-1952 _na     183_aa hpf ribosome hibernation-promoting factor%2C HPF/YfiA family
1260 CAMXYO010000010.1 GCA947253115_00625 CDS open 2102-3112 _na     336_aa PhoH-like protein
1261 CAMXYO010000010.1 GCA947253115_00626 CDS open 3119-3595 _na     158_aa ybeY rRNA maturation RNase YbeY
1262 CAMXYO010000010.1 GCA947253115_00627 CDS open 3585-4334 _na     249_aa PAP2 family protein
1263 CAMXYO010000010.1 GCA947253115_00628 CDS open 4449-5348 _na     299_aa era GTPase Era
1264 CAMXYO010000010.1 GCA947253115_00629 CDS open 5377-6756 _na     459_aa mgtE magnesium transporter
1265 CAMXYO010000010.1 GCA947253115_00630 CDS open 6858-7604 _na     248_aa recO DNA repair protein RecO
1266 CAMXYO010000010.1 GCA947253115_00631 CDS open 7616-8221 _na     201_aa DUF4342 domain-containing protein
1267 CAMXYO010000010.1 GCA947253115_00632 CDS open 8325-9209 _na     294_aa glyQ glycine--tRNA ligase subunit alpha
1268 CAMXYO010000010.1 GCA947253115_00633 CDS open 9202-11265 _na     687_aa Glycine--tRNA ligase beta subunit
1269 CAMXYO010000010.1 GCA947253115_00634 CDS open 11554-12186 _na     210_aa Control catabolite protein of gluconeogenesis
1270 CAMXYO010000010.1 GCA947253115_00635 CDS open 12200-13039 _na     279_aa Putative pyruvate%2C phosphate dikinase regulatory protein
1271 CAMXYO010000010.1 GCA947253115_00636 CDS open 13057-15702 _na     881_aa ppdK pyruvate%2C phosphate dikinase
1272 CAMXYO010000010.1 GCA947253115_00637 CDS open 16036-16503 _na     155_aa GtrA-like protein
1273 CAMXYO010000010.1 GCA947253115_00638 CDS open 16644-17114 _na     156_aa Putative small multi-drug export protein
1274 CAMXYO010000010.1 GCA947253115_00639 CDS open 17210-18133 _na     307_aa Nucleotidyl transferase domain-containing protein
1275 CAMXYO010000010.1 GCA947253115_00640 CDS open 18365-19618 _na     417_aa Protease 3
1276 CAMXYO010000010.1 GCA947253115_00641 CDS open 19618-22047 _na     809_aa Stage III sporulation protein E
1277 CAMXYO010000010.1 GCA947253115_00642 CDS open 22087-23436 _na     449_aa rimO 30S ribosomal protein S12 methylthiotransferase RimO
1278 CAMXYO010000010.1 GCA947253115_00643 CDS open 23449-23988 _na     179_aa pgsA CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase
1279 CAMXYO010000010.1 GCA947253115_00644 CDS open 24280-25335 _na     351_aa recA recombinase RecA
1280 CAMXYO010000010.1 GCA947253115_00645 CDS open 25692-27239 _na     515_aa rny ribonuclease Y
1281 CAMXYO010000010.1 GCA947253115_00646 CDS open 27446-29227 _na     593_aa UvrD-like helicase ATP-binding domain-containing protein
1282 CAMXYO010000010.1 GCA947253115_00647 CDS open 29362-31197 _na     611_aa Glycoside hydrolase 123 catalytic domain-containing protein
1283 CAMXYO010000010.1 GCA947253115_00648 CDS open 31373-31696 _na     107_aa copG CopG family transcriptional regulator
1284 CAMXYO010000010.1 GCA947253115_00649 CDS open 31767-32537 _na     256_aa KilA-N DNA-binding domain-containing protein
1285 CAMXYO010000010.1 GCA947253115_00650 CDS open 32770-33999 _na     409_aa ABC transporter%2C solute-binding protein
1286 CAMXYO010000010.1 GCA947253115_00651 CDS open 34083-34967 _na     294_aa ABC transporter%2C permease protein
1287 CAMXYO010000010.1 GCA947253115_00652 CDS open 34968-35882 _na     304_aa ABC transporter%2C permease protein
1288 CAMXYO010000010.1 GCA947253115_00653 CDS open 36056-37396 _na     446_aa nox H2O-forming NADH oxidase
1289 CAMXYO010000010.1 GCA947253115_00654 CDS open 37764-37970 _na     68_aa DUF1659 domain-containing protein
1290 CAMXYO010000010.1 GCA947253115_00655 CDS open 38014-38244 _na     76_aa DUF2922 domain-containing protein
1291 CAMXYO010000010.1 GCA947253115_00656 CDS open 38759-39661 _na     300_aa hypothetical protein
1292 CAMXYO010000010.1 GCA947253115_00657 CDS open 40112-42355 _na     747_aa Putative cell wall binding repeat 2
1293 CAMXYO010000010.1 GCA947253115_00658 CDS open 42610-42918 _na     102_aa Transposase IS204/IS1001/IS1096/IS1165 zinc-finger domain-containing protein
1294 CAMXYO010000010.1 GCA947253115_00659 CDS open 43103-43264 _na     53_aa Transposase IS204/IS1001/IS1096/IS1165 DDE domain-containing protein
1295 CAMXYO010000010.1 GCA947253115_00660 CDS open 43344-44153 _na     269_aa undecaprenyl-diphosphate phosphatase
1296 CAMXYO010000010.1 GCA947253115_00661 CDS open 44783-45235 _na     150_aa marR Multiple antibiotic resistance protein marR
1297 CAMXYO010000010.1 GCA947253115_00662 CDS open 45382-46581 _na     399_aa Aminotransferase
1298 CAMXYO010000010.1 GCA947253115_00663 CDS open 47009-47959 _na     316_aa galT galactose-1-phosphate uridylyltransferase
1299 CAMXYO010000010.1 GCA947253115_00664 CDS open 48214-50115 _na     633_aa Glutamine synthetase
1300 CAMXYO010000010.1 GCA947253115_00665 CDS open 50606-52021 _na     471_aa Divergent AAA domain protein
1301 CAMXYO010000010.1 GCA947253115_00666 CDS open 52098-53321 _na     407_aa tyrS tyrosine--tRNA ligase
1302 CAMXYO010000010.1 GCA947253115_00623 gene open 132-1277
1303 CAMXYO010000010.1 GCA947253115_00624 gene open 1401-1952 hpf
1304 CAMXYO010000010.1 GCA947253115_00625 gene open 2102-3112
1305 CAMXYO010000010.1 GCA947253115_00626 gene open 3119-3595 ybeY
1306 CAMXYO010000010.1 GCA947253115_00627 gene open 3585-4334
1307 CAMXYO010000010.1 GCA947253115_00628 gene open 4449-5348 era
1308 CAMXYO010000010.1 GCA947253115_00629 gene open 5377-6756 mgtE
1309 CAMXYO010000010.1 GCA947253115_00630 gene open 6858-7604 recO
1310 CAMXYO010000010.1 GCA947253115_00631 gene open 7616-8221
1311 CAMXYO010000010.1 GCA947253115_00632 gene open 8325-9209 glyQ
1312 CAMXYO010000010.1 GCA947253115_00633 gene open 9202-11265
1313 CAMXYO010000010.1 GCA947253115_00634 gene open 11554-12186
1314 CAMXYO010000010.1 GCA947253115_00635 gene open 12200-13039
1315 CAMXYO010000010.1 GCA947253115_00636 gene open 13057-15702 ppdK
1316 CAMXYO010000010.1 GCA947253115_00637 gene open 16036-16503
1317 CAMXYO010000010.1 GCA947253115_00638 gene open 16644-17114
1318 CAMXYO010000010.1 GCA947253115_00639 gene open 17210-18133
1319 CAMXYO010000010.1 GCA947253115_00640 gene open 18365-19618
1320 CAMXYO010000010.1 GCA947253115_00641 gene open 19618-22047
1321 CAMXYO010000010.1 GCA947253115_00642 gene open 22087-23436 rimO
1322 CAMXYO010000010.1 GCA947253115_00643 gene open 23449-23988 pgsA
1323 CAMXYO010000010.1 GCA947253115_00644 gene open 24280-25335 recA
1324 CAMXYO010000010.1 GCA947253115_00645 gene open 25692-27239 rny
1325 CAMXYO010000010.1 GCA947253115_00646 gene open 27446-29227
1326 CAMXYO010000010.1 GCA947253115_00647 gene open 29362-31197
1327 CAMXYO010000010.1 GCA947253115_00648 gene open 31373-31696 copG
1328 CAMXYO010000010.1 GCA947253115_00649 gene open 31767-32537
1329 CAMXYO010000010.1 GCA947253115_00650 gene open 32770-33999
1330 CAMXYO010000010.1 GCA947253115_00651 gene open 34083-34967
1331 CAMXYO010000010.1 GCA947253115_00652 gene open 34968-35882
1332 CAMXYO010000010.1 GCA947253115_00653 gene open 36056-37396 nox
1333 CAMXYO010000010.1 GCA947253115_00654 gene open 37764-37970
1334 CAMXYO010000010.1 GCA947253115_00655 gene open 38014-38244
1335 CAMXYO010000010.1 GCA947253115_00656 gene open 38759-39661
1336 CAMXYO010000010.1 GCA947253115_00657 gene open 40112-42355
1337 CAMXYO010000010.1 GCA947253115_00658 gene open 42610-42918
1338 CAMXYO010000010.1 GCA947253115_00659 gene open 43103-43264
1339 CAMXYO010000010.1 GCA947253115_00660 gene open 43344-44153
1340 CAMXYO010000010.1 GCA947253115_00661 gene open 44783-45235 marR
1341 CAMXYO010000010.1 GCA947253115_00662 gene open 45382-46581
1342 CAMXYO010000010.1 GCA947253115_00663 gene open 47009-47959 galT
1343 CAMXYO010000010.1 GCA947253115_00664 gene open 48214-50115
1344 CAMXYO010000010.1 GCA947253115_00665 gene open 50606-52021
1345 CAMXYO010000010.1 GCA947253115_00666 gene open 52098-53321 tyrS
1346 CAMXYO010000011.1 regulatory_region open 23089-23154 pemK RNA
1347 CAMXYO010000011.1 GCA947253115_00667 CDS open 633-5858 _na     1741_aa DEAD/DEAH box helicase
1348 CAMXYO010000011.1 GCA947253115_00668 CDS open 5863-6906 _na     347_aa hypothetical protein
1349 CAMXYO010000011.1 GCA947253115_00669 CDS open 6888-8393 _na     501_aa hypothetical protein
1350 CAMXYO010000011.1 GCA947253115_00670 CDS open 8550-8909 _na     119_aa hypothetical protein
1351 CAMXYO010000011.1 GCA947253115_00671 CDS open 8919-10499 _na     526_aa hypothetical protein
1352 CAMXYO010000011.1 GCA947253115_00672 CDS open 10589-10879 _na     96_aa hypothetical protein
1353 CAMXYO010000011.1 GCA947253115_00673 CDS open 10959-11891 _na     310_aa hcpC Beta-lactamase hcpC
1354 CAMXYO010000011.1 GCA947253115_00674 CDS open 11888-12307 _na     139_aa ORF6N domain
1355 CAMXYO010000011.1 GCA947253115_00675 CDS open 12375-12590 _na     71_aa yozG HTH cro/C1-type domain-containing protein
1356 CAMXYO010000011.1 GCA947253115_00676 CDS open 13257-13922 _na     221_aa rhuM virulence RhuM family protein
1357 CAMXYO010000011.1 GCA947253115_00677 CDS open 14180-17236 _na     1018_aa type III restriction-modification system endonuclease
1358 CAMXYO010000011.1 GCA947253115_00678 CDS open 17250-17834 _na     194_aa hypothetical protein
1359 CAMXYO010000011.1 GCA947253115_00679 CDS open 17944-19437 _na     497_aa spoIVCA Recombinase
1360 CAMXYO010000011.1 GCA947253115_00680 CDS open 19430-21097 _na     555_aa spoIVCA Recombinase
1361 CAMXYO010000011.1 GCA947253115_00681 CDS open 21097-22782 _na     561_aa spoIVCA Resolvase%2C N-terminal domain protein
1362 CAMXYO010000011.1 GCA947253115_00682 CDS open 22878-23027 _na     49_aa hypothetical protein
1363 CAMXYO010000011.1 GCA947253115_00683 CDS open 23485-23895 _na     136_aa Sigma-70 family RNA polymerase sigma factor
1364 CAMXYO010000011.1 GCA947253115_00684 CDS open 24152-25513 _na     453_aa mepA Multidrug export protein MepA
1365 CAMXYO010000011.1 GCA947253115_00685 CDS open 25529-27301 _na     590_aa ABC transporter%2C ATP-binding protein
1366 CAMXYO010000011.1 GCA947253115_00686 CDS open 27258-28991 _na     577_aa ABC superfamily ATP binding cassette transporter%2C ABC/membrane protein
1367 CAMXYO010000011.1 GCA947253115_00687 CDS open 29223-30197 _na     324_aa araC AraC family transcriptional regulator
1368 CAMXYO010000011.1 GCA947253115_00688 CDS open 30458-31348 _na     296_aa nikB Nickel transport system permease protein nikB
1369 CAMXYO010000011.1 GCA947253115_00689 CDS open 31349-32167 _na     272_aa Oligopeptide/nickel ABC superfamily ATP binding cassette transporter%2C permease protein
1370 CAMXYO010000011.1 GCA947253115_00690 CDS open 32170-32973 _na     267_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein
1371 CAMXYO010000011.1 GCA947253115_00691 CDS open 32957-33736 _na     259_aa Oligopeptide ABC superfamily ATP binding cassette transporter%2C ABC protein
1372 CAMXYO010000011.1 GCA947253115_00692 CDS open 33808-35442 _na     544_aa Solute-binding protein family 5 domain-containing protein
1373 CAMXYO010000011.1 GCA947253115_00693 CDS open 35619-35978 _na     119_aa Bacterial mobilisation domain-containing protein
1374 CAMXYO010000011.1 GCA947253115_00694 CDS open 35979-37310 _na     443_aa relaxase/mobilization nuclease domain-containing protein
1375 CAMXYO010000011.1 GCA947253115_00695 CDS open 37312-38565 _na     417_aa Cytosine-specific methyltransferase
1376 CAMXYO010000011.1 GCA947253115_00696 CDS open 38594-39871 _na     425_aa Response regulator
1377 CAMXYO010000011.1 GCA947253115_00697 CDS open 39876-42038 _na     720_aa histidine kinase
1378 CAMXYO010000011.1 GCA947253115_00698 CDS open 42040-43005 _na     321_aa Type-2 restriction enzyme haeiii
1379 CAMXYO010000011.1 GCA947253115_00699 CDS open 43019-44041 _na     340_aa Cytosine-specific methyltransferase
1380 CAMXYO010000011.1 GCA947253115_00700 CDS open 44043-44264 _na     73_aa HTH cro/C1-type domain-containing protein
1381 CAMXYO010000011.1 GCA947253115_00701 CDS open 44412-45071 _na     219_aa Single-strand binding family protein
1382 CAMXYO010000011.1 GCA947253115_00702 CDS open 45124-46479 _na     451_aa Helicase
1383 CAMXYO010000011.1 GCA947253115_00703 CDS open 46613-48283 _na     556_aa ltrA group II intron reverse transcriptase/maturase
1384 CAMXYO010000011.1 GCA947253115_00704 CDS open 48839-52879 _na     1346_aa site-specific DNA-methyltransferase (adenine-specific)
1385 CAMXYO010000011.1 GCA947253115_00667 gene open 633-5858
1386 CAMXYO010000011.1 GCA947253115_00668 gene open 5863-6906
1387 CAMXYO010000011.1 GCA947253115_00669 gene open 6888-8393
1388 CAMXYO010000011.1 GCA947253115_00670 gene open 8550-8909
1389 CAMXYO010000011.1 GCA947253115_00671 gene open 8919-10499
1390 CAMXYO010000011.1 GCA947253115_00672 gene open 10589-10879
1391 CAMXYO010000011.1 GCA947253115_00673 gene open 10959-11891 hcpC
1392 CAMXYO010000011.1 GCA947253115_00674 gene open 11888-12307
1393 CAMXYO010000011.1 GCA947253115_00675 gene open 12375-12590 yozG
1394 CAMXYO010000011.1 GCA947253115_00676 gene open 13257-13922 rhuM
1395 CAMXYO010000011.1 GCA947253115_00677 gene open 14180-17236
1396 CAMXYO010000011.1 GCA947253115_00678 gene open 17250-17834
1397 CAMXYO010000011.1 GCA947253115_00679 gene open 17944-19437 spoIVCA
1398 CAMXYO010000011.1 GCA947253115_00680 gene open 19430-21097 spoIVCA
1399 CAMXYO010000011.1 GCA947253115_00681 gene open 21097-22782 spoIVCA
1400 CAMXYO010000011.1 GCA947253115_00682 gene open 22878-23027
1401 CAMXYO010000011.1 GCA947253115_00683 gene open 23485-23895
1402 CAMXYO010000011.1 GCA947253115_00684 gene open 24152-25513 mepA
1403 CAMXYO010000011.1 GCA947253115_00685 gene open 25529-27301
1404 CAMXYO010000011.1 GCA947253115_00686 gene open 27258-28991
1405 CAMXYO010000011.1 GCA947253115_00687 gene open 29223-30197 araC
1406 CAMXYO010000011.1 GCA947253115_00688 gene open 30458-31348 nikB
1407 CAMXYO010000011.1 GCA947253115_00689 gene open 31349-32167
1408 CAMXYO010000011.1 GCA947253115_00690 gene open 32170-32973
1409 CAMXYO010000011.1 GCA947253115_00691 gene open 32957-33736
1410 CAMXYO010000011.1 GCA947253115_00692 gene open 33808-35442
1411 CAMXYO010000011.1 GCA947253115_00693 gene open 35619-35978
1412 CAMXYO010000011.1 GCA947253115_00694 gene open 35979-37310
1413 CAMXYO010000011.1 GCA947253115_00695 gene open 37312-38565
1414 CAMXYO010000011.1 GCA947253115_00696 gene open 38594-39871
1415 CAMXYO010000011.1 GCA947253115_00697 gene open 39876-42038
1416 CAMXYO010000011.1 GCA947253115_00698 gene open 42040-43005
1417 CAMXYO010000011.1 GCA947253115_00699 gene open 43019-44041
1418 CAMXYO010000011.1 GCA947253115_00700 gene open 44043-44264
1419 CAMXYO010000011.1 GCA947253115_00701 gene open 44412-45071
1420 CAMXYO010000011.1 GCA947253115_00702 gene open 45124-46479
1421 CAMXYO010000011.1 GCA947253115_00703 gene open 46613-48283 ltrA
1422 CAMXYO010000011.1 GCA947253115_00704 gene open 48839-52879
1423 CAMXYO010000012.1 regulatory_region open 23047-23249 T-box leader
1424 CAMXYO010000012.1 GCA947253115_00705 CDS open 40-1683 _na     547_aa RNA helicase
1425 CAMXYO010000012.1 GCA947253115_00706 CDS open 1910-2920 _na     336_aa 4-phosphoerythronate dehydrogenase
1426 CAMXYO010000012.1 GCA947253115_00707 CDS open 3001-4014 _na     337_aa Electron transfer flavoprotein FAD-binding domain protein
1427 CAMXYO010000012.1 GCA947253115_00708 CDS open 4037-4822 _na     261_aa etfB electron transfer flavoprotein subunit beta
1428 CAMXYO010000012.1 GCA947253115_00709 CDS open 4838-5980 _na     380_aa caiA Acyl-CoA dehydrogenase%2C C-terminal domain protein
1429 CAMXYO010000012.1 GCA947253115_00710 CDS open 6004-7125 _na     373_aa (R)-2-hydroxyglutaryl-CoA dehydratase subunit beta
1430 CAMXYO010000012.1 GCA947253115_00711 CDS open 7125-8357 _na     410_aa hgdB 2-hydroxyglutaryl-CoA dehydratase%2C D-component
1431 CAMXYO010000012.1 GCA947253115_00712 CDS open 8466-9677 _na     403_aa 3-methyl-2-oxobutanoate dehydrogenase (2-methylpropanoyl-transferring)
1432 CAMXYO010000012.1 GCA947253115_00713 CDS open 10273-11442 _na     389_aa Tat pathway signal sequence domain protein
1433 CAMXYO010000012.1 GCA947253115_00714 CDS open 11555-13267 _na     570_aa (S)-limonene 6-monooxygenase
1434 CAMXYO010000012.1 GCA947253115_00715 CDS open 13522-13671 _na     49_aa hypothetical protein
1435 CAMXYO010000012.1 GCA947253115_00716 CDS open 13762-14664 _na     300_aa Phospholipase%2C patatin family
1436 CAMXYO010000012.1 GCA947253115_00717 CDS open 14682-15863 _na     393_aa putative tRNA sulfurtransferase
1437 CAMXYO010000012.1 GCA947253115_00718 CDS open 15891-17054 _na     387_aa Aminotransferase%2C class V
1438 CAMXYO010000012.1 GCA947253115_00719 CDS open 17274-18227 _na     317_aa Transporter%2C auxin efflux carrier (AEC) family protein
1439 CAMXYO010000012.1 GCA947253115_00720 CDS open 18341-18847 _na     168_aa YdbS-like PH domain-containing protein
1440 CAMXYO010000012.1 GCA947253115_00721 CDS open 18848-20410 _na     520_aa YdbS-like PH domain-containing protein
1441 CAMXYO010000012.1 GCA947253115_00722 CDS open 20587-21327 _na     246_aa artM Arginine transport ATP-binding protein ArtM
1442 CAMXYO010000012.1 GCA947253115_00723 CDS open 21336-22001 _na     221_aa ABC transporter%2C permease protein
1443 CAMXYO010000012.1 GCA947253115_00724 CDS open 22043-22888 _na     281_aa artP Arginine-binding extracellular protein ArtP
1444 CAMXYO010000012.1 GCA947253115_00725 CDS open 23350-25227 _na     625_aa DNA 3'-5' helicase
1445 CAMXYO010000012.1 GCA947253115_00726 CDS open 25266-26831 _na     521_aa clcA H(+)/Cl(-) exchange transporter ClcA
1446 CAMXYO010000012.1 GCA947253115_00727 CDS open 26857-27774 _na     305_aa folD Bifunctional protein FolD
1447 CAMXYO010000012.1 GCA947253115_00728 CDS open 27791-28414 _na     207_aa Formiminotransferase-cyclodeaminase
1448 CAMXYO010000012.1 GCA947253115_00729 CDS open 28722-30398 _na     558_aa formate--tetrahydrofolate ligase
1449 CAMXYO010000012.1 GCA947253115_00730 CDS open 30928-31908 _na     326_aa hypothetical protein
1450 CAMXYO010000012.1 GCA947253115_00731 CDS open 31952-32164 _na     70_aa HTH cro/C1-type domain-containing protein
1451 CAMXYO010000012.1 GCA947253115_00732 CDS open 32271-32699 _na     142_aa flavodoxin
1452 CAMXYO010000012.1 GCA947253115_00733 CDS open 32715-33299 _na     194_aa DUF3793 domain-containing protein
1453 CAMXYO010000012.1 GCA947253115_00734 CDS open 33546-34871 _na     441_aa Thiol-disulfide oxidoreductase
1454 CAMXYO010000012.1 GCA947253115_00735 CDS open 34853-36019 _na     388_aa Tetratricopeptide repeat protein
1455 CAMXYO010000012.1 GCA947253115_00736 CDS open 35988-37040 _na     350_aa hypothetical protein
1456 CAMXYO010000012.1 GCA947253115_00737 CDS open 37196-37399 _na     67_aa hypothetical protein
1457 CAMXYO010000012.1 GCA947253115_00738 CDS open 37371-38825 _na     484_aa Carbon starvation protein A
1458 CAMXYO010000012.1 GCA947253115_00739 CDS open 39153-40865 _na     570_aa argS arginine--tRNA ligase
1459 CAMXYO010000012.1 GCA947253115_00740 CDS open 40988-41461 _na     157_aa 2-thiouracil desulfurase
1460 CAMXYO010000012.1 GCA947253115_00741 CDS open 41482-43905 _na     807_aa mutS2 endonuclease MutS2
1461 CAMXYO010000012.1 GCA947253115_00742 CDS open 44113-45564 _na     483_aa Cytosol non-specific dipeptidase
1462 CAMXYO010000012.1 GCA947253115_00743 CDS open 45977-46825 _na     282_aa degV EDD domain protein%2C DegV family
1463 CAMXYO010000012.1 GCA947253115_00744 CDS open 46838-47350 _na     170_aa trmL tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL
1464 CAMXYO010000012.1 GCA947253115_00745 CDS open 47298-47978 _na     226_aa nth endonuclease III
1465 CAMXYO010000012.1 GCA947253115_00746 CDS open 47978-49630 _na     550_aa Phosphoribulokinase/uridine kinase family protein
1466 CAMXYO010000012.1 GCA947253115_00747 CDS open 49734-50366 _na     210_aa lepB signal peptidase I
1467 CAMXYO010000012.1 GCA947253115_00748 CDS open 50370-51788 _na     472_aa Ribosomal RNA small subunit methyltransferase F
1468 CAMXYO010000012.1 GCA947253115_00705 gene open 40-1683
1469 CAMXYO010000012.1 GCA947253115_00706 gene open 1910-2920
1470 CAMXYO010000012.1 GCA947253115_00707 gene open 3001-4014
1471 CAMXYO010000012.1 GCA947253115_00708 gene open 4037-4822 etfB
1472 CAMXYO010000012.1 GCA947253115_00709 gene open 4838-5980 caiA
1473 CAMXYO010000012.1 GCA947253115_00710 gene open 6004-7125
1474 CAMXYO010000012.1 GCA947253115_00711 gene open 7125-8357 hgdB
1475 CAMXYO010000012.1 GCA947253115_00712 gene open 8466-9677
1476 CAMXYO010000012.1 GCA947253115_00713 gene open 10273-11442
1477 CAMXYO010000012.1 GCA947253115_00714 gene open 11555-13267
1478 CAMXYO010000012.1 GCA947253115_00715 gene open 13522-13671
1479 CAMXYO010000012.1 GCA947253115_00716 gene open 13762-14664
1480 CAMXYO010000012.1 GCA947253115_00717 gene open 14682-15863
1481 CAMXYO010000012.1 GCA947253115_00718 gene open 15891-17054
1482 CAMXYO010000012.1 GCA947253115_00719 gene open 17274-18227
1483 CAMXYO010000012.1 GCA947253115_00720 gene open 18341-18847
1484 CAMXYO010000012.1 GCA947253115_00721 gene open 18848-20410
1485 CAMXYO010000012.1 GCA947253115_00722 gene open 20587-21327 artM
1486 CAMXYO010000012.1 GCA947253115_00723 gene open 21336-22001
1487 CAMXYO010000012.1 GCA947253115_00724 gene open 22043-22888 artP
1488 CAMXYO010000012.1 GCA947253115_00725 gene open 23350-25227
1489 CAMXYO010000012.1 GCA947253115_00726 gene open 25266-26831 clcA
1490 CAMXYO010000012.1 GCA947253115_00727 gene open 26857-27774 folD
1491 CAMXYO010000012.1 GCA947253115_00728 gene open 27791-28414
1492 CAMXYO010000012.1 GCA947253115_00729 gene open 28722-30398
1493 CAMXYO010000012.1 GCA947253115_00730 gene open 30928-31908
1494 CAMXYO010000012.1 GCA947253115_00731 gene open 31952-32164
1495 CAMXYO010000012.1 GCA947253115_00732 gene open 32271-32699
1496 CAMXYO010000012.1 GCA947253115_00733 gene open 32715-33299
1497 CAMXYO010000012.1 GCA947253115_00734 gene open 33546-34871
1498 CAMXYO010000012.1 GCA947253115_00735 gene open 34853-36019
1499 CAMXYO010000012.1 GCA947253115_00736 gene open 35988-37040
1500 CAMXYO010000012.1 GCA947253115_00737 gene open 37196-37399