BAKTAGenome Explorer: Anaerococcus tetradius (GCA_947253505.1)
Select a Genome:
|
BAKTA Annotations for GCA_947253505.1
|
Search & Sort all 3265 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 501 | CAMXZL010000002.1 | GCA947253505_00183 | gene | open | 8716-10911 | |||
| 502 | CAMXZL010000002.1 | GCA947253505_00184 | gene | open | 10913-12913 | ligA | ||
| 503 | CAMXZL010000002.1 | GCA947253505_00185 | gene | open | 12915-13193 | gatC | ||
| 504 | CAMXZL010000002.1 | GCA947253505_00186 | gene | open | 13202-14614 | gatA | ||
| 505 | CAMXZL010000002.1 | GCA947253505_00187 | gene | open | 14604-16022 | gatB | ||
| 506 | CAMXZL010000002.1 | GCA947253505_00188 | gene | open | 16135-17400 | |||
| 507 | CAMXZL010000002.1 | GCA947253505_00189 | gene | open | 17400-18572 | |||
| 508 | CAMXZL010000002.1 | GCA947253505_00190 | gene | open | 18575-19696 | alr | ||
| 509 | CAMXZL010000002.1 | GCA947253505_00191 | gene | open | 19686-20036 | mazF | ||
| 510 | CAMXZL010000002.1 | GCA947253505_00192 | gene | open | 20100-21485 | murC | ||
| 511 | CAMXZL010000002.1 | GCA947253505_00193 | gene | open | 21620-22060 | rpiB | ||
| 512 | CAMXZL010000002.1 | GCA947253505_00194 | gene | open | 22132-22845 | deoD | ||
| 513 | CAMXZL010000002.1 | GCA947253505_00195 | gene | open | 22854-24293 | glmU | ||
| 514 | CAMXZL010000002.1 | GCA947253505_00196 | gene | open | 24245-25234 | prsA | ||
| 515 | CAMXZL010000002.1 | GCA947253505_00197 | gene | open | 25234-25833 | pth | ||
| 516 | CAMXZL010000002.1 | GCA947253505_00198 | gene | open | 25805-29329 | mfd | ||
| 517 | CAMXZL010000002.1 | GCA947253505_00199 | gene | open | 29314-30396 | prsA | ||
| 518 | CAMXZL010000002.1 | GCA947253505_00200 | gene | open | 30356-31327 | ppiC | ||
| 519 | CAMXZL010000002.1 | GCA947253505_00201 | gene | open | 31364-31642 | hupA | ||
| 520 | CAMXZL010000002.1 | GCA947253505_00202 | gene | open | 31820-33568 | rqcH | ||
| 521 | CAMXZL010000002.1 | GCA947253505_00203 | gene | open | 33658-34266 | gmk | ||
| 522 | CAMXZL010000002.1 | GCA947253505_00204 | gene | open | 34259-34447 | rpoZ | ||
| 523 | CAMXZL010000002.1 | GCA947253505_00205 | gene | open | 34441-35649 | coaBC | ||
| 524 | CAMXZL010000002.1 | GCA947253505_00206 | gene | open | 35618-37987 | priA | ||
| 525 | CAMXZL010000002.1 | GCA947253505_00207 | gene | open | 37997-39184 | ftsY | ||
| 526 | CAMXZL010000002.1 | GCA947253505_00208 | gene | open | 39320-40150 | rpsB | ||
| 527 | CAMXZL010000002.1 | GCA947253505_00209 | gene | open | 40161-40826 | tsf | ||
| 528 | CAMXZL010000002.1 | GCA947253505_00210 | gene | open | 40930-41847 | cysK | ||
| 529 | CAMXZL010000002.1 | GCA947253505_00211 | gene | open | 41834-42358 | epsC | ||
| 530 | CAMXZL010000002.1 | GCA947253505_00212 | gene | open | 42472-44025 | rny | ||
| 531 | CAMXZL010000002.1 | GCA947253505_00213 | gene | open | 44762-45751 | |||
| 532 | CAMXZL010000002.1 | GCA947253505_00214 | gene | open | 45804-47081 | |||
| 533 | CAMXZL010000002.1 | GCA947253505_00215 | gene | open | 47071-48018 | miaA | ||
| 534 | CAMXZL010000002.1 | GCA947253505_00216 | gene | open | 48008-49852 | mutL | ||
| 535 | CAMXZL010000002.1 | GCA947253505_00217 | gene | open | 49852-52458 | mutS | ||
| 536 | CAMXZL010000002.1 | GCA947253505_00218 | gene | open | 52519-53052 | |||
| 537 | CAMXZL010000002.1 | GCA947253505_00219 | gene | open | 53052-53486 | dut | ||
| 538 | CAMXZL010000002.1 | GCA947253505_00220 | gene | open | 53572-54792 | pepT | ||
| 539 | CAMXZL010000002.1 | GCA947253505_00221 | gene | open | 54860-55093 | ebpS | ||
| 540 | CAMXZL010000002.1 | GCA947253505_00222 | gene | open | 55145-56377 | |||
| 541 | CAMXZL010000002.1 | GCA947253505_00223 | gene | open | 56370-57011 | |||
| 542 | CAMXZL010000002.1 | GCA947253505_00224 | gene | open | 56995-58677 | rnjA | ||
| 543 | CAMXZL010000002.1 | GCA947253505_00225 | gene | open | 58680-59117 | |||
| 544 | CAMXZL010000002.1 | GCA947253505_00226 | gene | open | 59107-59349 | |||
| 545 | CAMXZL010000002.1 | GCA947253505_00227 | gene | open | 59342-59749 | ruvX | ||
| 546 | CAMXZL010000002.1 | GCA947253505_00228 | gene | open | 59754-60014 | ireB | ||
| 547 | CAMXZL010000002.1 | GCA947253505_00229 | gene | open | 60025-63048 | alaS | ||
| 548 | CAMXZL010000002.1 | GCA947253505_00230 | gene | open | 63059-63703 | |||
| 549 | CAMXZL010000002.1 | GCA947253505_00231 | gene | open | 63731-64039 | rsfS | ||
| 550 | CAMXZL010000002.1 | GCA947253505_00232 | gene | open | 64032-64598 | yqeK | ||
| 551 | CAMXZL010000002.1 | GCA947253505_00233 | gene | open | 64582-65187 | nadD | ||
| 552 | CAMXZL010000002.1 | GCA947253505_00234 | gene | open | 65187-65471 | yhbY | ||
| 553 | CAMXZL010000002.1 | GCA947253505_00235 | gene | open | 65480-66760 | obgE | ||
| 554 | CAMXZL010000002.1 | GCA947253505_00236 | gene | open | 66811-67104 | rpmA | ||
| 555 | CAMXZL010000002.1 | GCA947253505_00237 | gene | open | 67417-67725 | rplU | ||
| 556 | CAMXZL010000002.1 | GCA947253505_00238 | gene | open | 67741-68985 | |||
| 557 | CAMXZL010000002.1 | GCA947253505_00239 | gene | open | 68970-70103 | |||
| 558 | CAMXZL010000002.1 | GCA947253505_00240 | gene | open | 70172-71170 | yprB | ||
| 559 | CAMXZL010000002.1 | GCA947253505_00241 | gene | open | 71026-71748 | |||
| 560 | CAMXZL010000002.1 | GCA947253505_00242 | gene | open | 71729-72187 | lspA | ||
| 561 | CAMXZL010000002.1 | GCA947253505_00243 | gene | open | 72172-72951 | |||
| 562 | CAMXZL010000002.1 | GCA947253505_00244 | gene | open | 72982-73581 | sepF | ||
| 563 | CAMXZL010000002.1 | GCA947253505_00245 | gene | open | 73650-74633 | |||
| 564 | CAMXZL010000002.1 | GCA947253505_00246 | gene | open | 74641-75174 | plsY | ||
| 565 | CAMXZL010000002.1 | GCA947253505_00247 | gene | open | 75137-76531 | der | ||
| 566 | CAMXZL010000002.1 | GCA947253505_00248 | gene | open | 76677-77093 | |||
| 567 | CAMXZL010000002.1 | GCA947253505_00249 | gene | open | 77099-78847 | aspS | ||
| 568 | CAMXZL010000002.1 | GCA947253505_00250 | gene | open | 78856-79458 | |||
| 569 | CAMXZL010000002.1 | GCA947253505_00251 | gene | open | 79437-79907 | dtd | ||
| 570 | CAMXZL010000002.1 | GCA947253505_00252 | gene | open | 79907-82087 | spoT | ||
| 571 | CAMXZL010000002.1 | GCA947253505_00253 | gene | open | 82089-83822 | recJ | ||
| 572 | CAMXZL010000002.1 | GCA947253505_00254 | gene | open | 83883-84161 | yajC | ||
| 573 | CAMXZL010000002.1 | GCA947253505_00255 | gene | open | 84161-85279 | tgt | ||
| 574 | CAMXZL010000002.1 | GCA947253505_00256 | gene | open | 85288-86310 | queA | ||
| 575 | CAMXZL010000002.1 | GCA947253505_00257 | gene | open | 86312-87319 | ruvB | ||
| 576 | CAMXZL010000002.1 | GCA947253505_00258 | gene | open | 87328-87915 | ruvA | ||
| 577 | CAMXZL010000002.1 | GCA947253505_00259 | gene | open | 87915-88409 | ruvC | ||
| 578 | CAMXZL010000002.1 | GCA947253505_00260 | gene | open | 88439-89152 | |||
| 579 | CAMXZL010000002.1 | GCA947253505_00261 | gene | open | 89335-90078 | |||
| 580 | CAMXZL010000002.1 | GCA947253505_00262 | gene | open | 90080-90487 | |||
| 581 | CAMXZL010000002.1 | GCA947253505_00263 | gene | open | 90498-90971 | |||
| 582 | CAMXZL010000002.1 | GCA947253505_00264 | gene | open | 90953-91543 | rdgB | ||
| 583 | CAMXZL010000002.1 | GCA947253505_00265 | gene | open | 91594-93090 | |||
| 584 | CAMXZL010000002.1 | GCA947253505_00266 | gene | open | 93074-94549 | |||
| 585 | CAMXZL010000002.1 | GCA947253505_00267 | gene | open | 94540-95238 | ompR | ||
| 586 | CAMXZL010000002.1 | GCA947253505_00268 | gene | open | 95228-96130 | |||
| 587 | CAMXZL010000002.1 | GCA947253505_00269 | gene | open | 96118-97116 | |||
| 588 | CAMXZL010000002.1 | GCA947253505_00270 | gene | open | 97088-97633 | |||
| 589 | CAMXZL010000002.1 | GCA947253505_00271 | gene | open | 97667-98095 | |||
| 590 | CAMXZL010000002.1 | GCA947253505_00272 | gene | open | 99037-99393 | |||
| 591 | CAMXZL010000002.1 | GCA947253505_00273 | gene | open | 99412-100779 | |||
| 592 | CAMXZL010000002.1 | GCA947253505_00274 | gene | open | 100789-101538 | |||
| 593 | CAMXZL010000002.1 | GCA947253505_00275 | gene | open | 101522-102289 | |||
| 594 | CAMXZL010000002.1 | GCA947253505_00276 | gene | open | 102367-103200 | |||
| 595 | CAMXZL010000002.1 | GCA947253505_00277 | gene | open | 103299-104213 | |||
| 596 | CAMXZL010000002.1 | GCA947253505_00278 | gene | open | 104217-105920 | |||
| 597 | CAMXZL010000002.1 | GCA947253505_00279 | gene | open | 105981-106241 | ptsH | ||
| 598 | CAMXZL010000002.1 | GCA947253505_00280 | gene | open | 106319-107329 | lacI | ||
| 599 | CAMXZL010000002.1 | GCA947253505_00281 | gene | open | 107382-107825 | |||
| 600 | CAMXZL010000002.1 | GCA947253505_00282 | gene | open | 107836-108450 | |||
| 601 | CAMXZL010000002.1 | GCA947253505_00284 | gene | open | 108674-109570 | rluA | ||
| 602 | CAMXZL010000002.1 | GCA947253505_00285 | gene | open | 109620-110504 | |||
| 603 | CAMXZL010000002.1 | GCA947253505_00286 | gene | open | 110406-111929 | |||
| 604 | CAMXZL010000002.1 | GCA947253505_00287 | gene | open | 111922-113181 | |||
| 605 | CAMXZL010000002.1 | GCA947253505_00288 | gene | open | 113174-113677 | fHA | ||
| 606 | CAMXZL010000002.1 | GCA947253505_00289 | gene | open | 113790-115484 | |||
| 607 | CAMXZL010000002.1 | GCA947253505_00290 | gene | open | 115474-117402 | pulA | ||
| 608 | CAMXZL010000002.1 | GCA947253505_00291 | gene | open | 117365-119653 | |||
| 609 | CAMXZL010000002.1 | GCA947253505_00292 | gene | open | 119634-121067 | glgA | ||
| 610 | CAMXZL010000002.1 | GCA947253505_00293 | gene | open | 121069-122193 | glgD | ||
| 611 | CAMXZL010000002.1 | GCA947253505_00294 | gene | open | 122195-123328 | glgC | ||
| 612 | CAMXZL010000002.1 | GCA947253505_00296 | gene | open | 124311-125708 | |||
| 613 | CAMXZL010000002.1 | GCA947253505_00297 | gene | open | 125725-126708 | |||
| 614 | CAMXZL010000002.1 | GCA947253505_00298 | gene | open | 126701-127306 | recR | ||
| 615 | CAMXZL010000002.1 | GCA947253505_00299 | gene | open | 127306-127644 | |||
| 616 | CAMXZL010000002.1 | GCA947253505_00300 | gene | open | 127660-129477 | dnaX | ||
| 617 | CAMXZL010000002.1 | GCA947253505_00304 | gene | open | 130079-130558 | cbpB | ||
| 618 | CAMXZL010000002.1 | GCA947253505_00305 | gene | open | 130662-132317 | |||
| 619 | CAMXZL010000002.1 | GCA947253505_00306 | gene | open | 132365-133069 | |||
| 620 | CAMXZL010000002.1 | GCA947253505_00307 | gene | open | 133130-133705 | pyrE | ||
| 621 | CAMXZL010000002.1 | GCA947253505_00308 | gene | open | 133714-134613 | |||
| 622 | CAMXZL010000002.1 | GCA947253505_00309 | gene | open | 134598-135335 | |||
| 623 | CAMXZL010000002.1 | GCA947253505_00310 | gene | open | 135316-136179 | pyrF | ||
| 624 | CAMXZL010000002.1 | GCA947253505_00311 | gene | open | 136163-137356 | |||
| 625 | CAMXZL010000002.1 | GCA947253505_00312 | gene | open | 137357-137785 | |||
| 626 | CAMXZL010000002.1 | GCA947253505_00313 | gene | open | 137769-138707 | pyrB | ||
| 627 | CAMXZL010000002.1 | GCA947253505_00314 | gene | open | 138766-139296 | cyaB | ||
| 628 | CAMXZL010000002.1 | GCA947253505_00174 | gene | open | 1263-1338 | trnK | ||
| 629 | CAMXZL010000002.1 | GCA947253505_00301 | gene | open | 129597-129689 | trnS | ||
| 630 | CAMXZL010000002.1 | GCA947253505_00174 | tRNA | open | 1263-1338 | trnK | tRNA-Lys(ctt) | |
| 631 | CAMXZL010000002.1 | GCA947253505_00301 | tRNA | open | 129597-129689 | trnS | tRNA-Ser(gga) | |
| 632 | CAMXZL010000003.1 | repeat_region | open | 69723-69969 | CRISPR array with 4 repeats of length 37%2C consensus sequence AGTTTGAGAGTTATGTAATTTAAGTAGTAAGTAAAAC and spacer length 29 | |||
| 633 | CAMXZL010000003.1 | repeat_region | open | 70055-70631 | CRISPR array with 9 repeats of length 36%2C consensus sequence GTTTGAGAGTTATGTAATTTAAGTAGTAAGTAAAAC and spacer length 30 | |||
| 634 | CAMXZL010000003.1 | GCA947253505_00315 | CDS | open | 230-970 | _na 246_aa | hypothetical protein | |
| 635 | CAMXZL010000003.1 | GCA947253505_00316 | CDS | open | 1453-3993 | _na 846_aa | mgtA | magnesium-translocating P-type ATPase |
| 636 | CAMXZL010000003.1 | GCA947253505_00317 | CDS | open | 4236-6296 | _na 686_aa | Glutamate--ammonia ligase%2C catalytic domain protein | |
| 637 | CAMXZL010000003.1 | GCA947253505_00318 | CDS | open | 6348-8087 | _na 579_aa | Phosphoenolpyruvate carboxykinase | |
| 638 | CAMXZL010000003.1 | GCA947253505_00319 | CDS | open | 8131-8451 | _na 106_aa | Branched-chain amino acid transport protein (AzlD) | |
| 639 | CAMXZL010000003.1 | GCA947253505_00320 | CDS | open | 8444-9127 | _na 227_aa | azlC | Putative azaleucine resistance protein AzlC |
| 640 | CAMXZL010000003.1 | GCA947253505_00321 | CDS | open | 9246-10619 | _na 457_aa | FAD-dependent protein C-terminal domain-containing protein | |
| 641 | CAMXZL010000003.1 | GCA947253505_00322 | CDS | open | 10621-11454 | _na 277_aa | Serine aminopeptidase S33 domain-containing protein | |
| 642 | CAMXZL010000003.1 | GCA947253505_00323 | CDS | open | 11634-12764 | _na 376_aa | THUMP domain-containing protein | |
| 643 | CAMXZL010000003.1 | GCA947253505_00324 | CDS | open | 12808-14184 | _na 458_aa | ErfK/YbiS/YcfS/YnhG | |
| 644 | CAMXZL010000003.1 | GCA947253505_00325 | CDS | open | 14193-15017 | _na 274_aa | energy-coupling factor transporter ATPase | |
| 645 | CAMXZL010000003.1 | GCA947253505_00326 | CDS | open | 15014-15877 | _na 287_aa | energy-coupling factor transporter ATPase | |
| 646 | CAMXZL010000003.1 | GCA947253505_00327 | CDS | open | 15864-16658 | _na 264_aa | Cobalt transport protein | |
| 647 | CAMXZL010000003.1 | GCA947253505_00328 | CDS | open | 16655-17395 | _na 246_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 648 | CAMXZL010000003.1 | GCA947253505_00329 | CDS | open | 17392-17784 | _na 130_aa | hypothetical protein | |
| 649 | CAMXZL010000003.1 | GCA947253505_00330 | CDS | open | 17768-18922 | _na 384_aa | DUF4097 domain-containing protein | |
| 650 | CAMXZL010000003.1 | GCA947253505_00331 | CDS | open | 18963-20765 | _na 600_aa | recQ | DNA helicase RecQ |
| 651 | CAMXZL010000003.1 | GCA947253505_00332 | CDS | open | 20825-21835 | _na 336_aa | asnA | aspartate--ammonia ligase |
| 652 | CAMXZL010000003.1 | GCA947253505_00333 | CDS | open | 21988-22875 | _na 295_aa | modA | molybdate ABC transporter substrate-binding protein |
| 653 | CAMXZL010000003.1 | GCA947253505_00334 | CDS | open | 22883-23551 | _na 222_aa | modB | molybdate ABC transporter permease subunit |
| 654 | CAMXZL010000003.1 | GCA947253505_00335 | CDS | open | 23538-24551 | _na 337_aa | ABC transporter%2C ATP-binding protein | |
| 655 | CAMXZL010000003.1 | GCA947253505_00336 | CDS | open | 24553-25491 | _na 312_aa | moaA | GTP 3'%2C8-cyclase MoaA |
| 656 | CAMXZL010000003.1 | GCA947253505_00337 | CDS | open | 25492-25980 | _na 162_aa | moaC | cyclic pyranopterin monophosphate synthase MoaC |
| 657 | CAMXZL010000003.1 | GCA947253505_00338 | CDS | open | 25961-26395 | _na 144_aa | MOSC domain protein | |
| 658 | CAMXZL010000003.1 | GCA947253505_00339 | CDS | open | 26388-27362 | _na 324_aa | Molybdopterin molybdenumtransferase | |
| 659 | CAMXZL010000003.1 | GCA947253505_00340 | CDS | open | 27359-27844 | _na 161_aa | Molybdopterin biosynthesis mog family protein | |
| 660 | CAMXZL010000003.1 | GCA947253505_00341 | CDS | open | 27904-28596 | _na 230_aa | gntR | Transcriptional regulator%2C GntR family |
| 661 | CAMXZL010000003.1 | GCA947253505_00342 | CDS | open | 28813-30054 | _na 413_aa | dpaL | diaminopropionate ammonia-lyase |
| 662 | CAMXZL010000003.1 | GCA947253505_00343 | CDS | open | 30070-31266 | _na 398_aa | ygeW | knotted carbamoyltransferase YgeW |
| 663 | CAMXZL010000003.1 | GCA947253505_00344 | CDS | open | 31277-32614 | _na 445_aa | ygeY | YgeY family selenium metabolism-linked hydrolase |
| 664 | CAMXZL010000003.1 | GCA947253505_00345 | CDS | open | 32740-34101 | _na 453_aa | NCS1 family nucleobase:cation symporter-1 | |
| 665 | CAMXZL010000003.1 | GCA947253505_00346 | CDS | open | 34120-35490 | _na 456_aa | hydA | dihydropyrimidinase |
| 666 | CAMXZL010000003.1 | GCA947253505_00347 | CDS | open | 35429-36421 | _na 330_aa | arcC | carbamate kinase |
| 667 | CAMXZL010000003.1 | GCA947253505_00348 | CDS | open | 36542-39580 | _na 1012_aa | ygfK | putative selenate reductase subunit YgfK |
| 668 | CAMXZL010000003.1 | GCA947253505_00349 | CDS | open | 39595-40914 | _na 439_aa | ssnA | putative aminohydrolase SsnA |
| 669 | CAMXZL010000003.1 | GCA947253505_00350 | CDS | open | 40944-42251 | _na 435_aa | cytosine permease | |
| 670 | CAMXZL010000003.1 | GCA947253505_00351 | CDS | open | 42261-42437 | _na 58_aa | Lipoprotein | |
| 671 | CAMXZL010000003.1 | GCA947253505_00352 | CDS | open | 42437-42916 | _na 159_aa | nucleoside deaminase | |
| 672 | CAMXZL010000003.1 | GCA947253505_00353 | CDS | open | 42930-44306 | _na 458_aa | Putative permease | |
| 673 | CAMXZL010000003.1 | GCA947253505_00354 | CDS | open | 44336-45757 | _na 473_aa | pucK | Uric acid permease PucK |
| 674 | CAMXZL010000003.1 | GCA947253505_00355 | CDS | open | 46075-47445 | _na 456_aa | Putative permease | |
| 675 | CAMXZL010000003.1 | GCA947253505_00356 | CDS | open | 47683-49977 | _na 764_aa | xdhA | xanthine dehydrogenase subunit XdhA |
| 676 | CAMXZL010000003.1 | GCA947253505_00357 | CDS | open | 49991-50878 | _na 295_aa | xdhB | xanthine dehydrogenase subunit XdhB |
| 677 | CAMXZL010000003.1 | GCA947253505_00358 | CDS | open | 50868-51422 | _na 184_aa | xdhC | xanthine dehydrogenase subunit XdhC |
| 678 | CAMXZL010000003.1 | GCA947253505_00359 | CDS | open | 51783-53156 | _na 457_aa | hydA | dihydropyrimidinase |
| 679 | CAMXZL010000003.1 | GCA947253505_00360 | CDS | open | 53165-55804 | _na 879_aa | xdh | selenium-dependent xanthine dehydrogenase |
| 680 | CAMXZL010000003.1 | GCA947253505_00361 | CDS | open | 55791-56492 | _na 233_aa | yqeC | selenium cofactor biosynthesis protein YqeC |
| 681 | CAMXZL010000003.1 | GCA947253505_00362 | CDS | open | 56482-57054 | _na 190_aa | MobA-like NTP transferase domain-containing protein | |
| 682 | CAMXZL010000003.1 | GCA947253505_00363 | CDS | open | 57047-57850 | _na 267_aa | yqeB | selenium-dependent molybdenum cofactor biosynthesis protein YqeB |
| 683 | CAMXZL010000003.1 | GCA947253505_00364 | CDS | open | 57847-58653 | _na 268_aa | Putative xanthine dehydrogenase accessory factor | |
| 684 | CAMXZL010000003.1 | GCA947253505_00365 | CDS | open | 58769-59908 | _na 379_aa | Aminotransferase%2C class V | |
| 685 | CAMXZL010000003.1 | GCA947253505_00366 | CDS | open | 59898-60161 | _na 87_aa | Putative Se/S carrier protein-like domain-containing protein | |
| 686 | CAMXZL010000003.1 | GCA947253505_00367 | CDS | open | 60155-60754 | _na 199_aa | yedF | sulfurtransferase-like selenium metabolism protein YedF |
| 687 | CAMXZL010000003.1 | GCA947253505_00368 | CDS | open | 60765-61778 | _na 337_aa | selD | selenide%2C water dikinase SelD |
| 688 | CAMXZL010000003.1 | GCA947253505_00369 | CDS | open | 61963-63111 | _na 382_aa | cysteine desulfurase | |
| 689 | CAMXZL010000003.1 | GCA947253505_00370 | CDS | open | 63113-63355 | _na 80_aa | Putative Se/S carrier protein-like domain-containing protein | |
| 690 | CAMXZL010000003.1 | GCA947253505_00371 | CDS | open | 63743-67828 | _na 1361_aa | cas9 | type II CRISPR RNA-guided endonuclease Cas9 |
| 691 | CAMXZL010000003.1 | GCA947253505_00372 | CDS | open | 67825-68703 | _na 292_aa | cas1 | type II CRISPR-associated endonuclease Cas1 |
| 692 | CAMXZL010000003.1 | GCA947253505_00373 | CDS | open | 68693-69013 | _na 106_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 693 | CAMXZL010000003.1 | GCA947253505_00374 | CDS | open | 69010-69678 | _na 222_aa | csn2 | type II-A CRISPR-associated protein Csn2 |
| 694 | CAMXZL010000003.1 | GCA947253505_00375 | CDS | open | 70944-71063 | _na 39_aa | hypothetical protein | |
| 695 | CAMXZL010000003.1 | GCA947253505_00376 | CDS | open | 71193-72119 | _na 308_aa | Phosphate ABC transporter%2C phosphate-binding family protein | |
| 696 | CAMXZL010000003.1 | GCA947253505_00377 | CDS | open | 72121-72984 | _na 287_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 697 | CAMXZL010000003.1 | GCA947253505_00378 | CDS | open | 72994-73806 | _na 270_aa | pstA | phosphate ABC transporter permease PstA |
| 698 | CAMXZL010000003.1 | GCA947253505_00379 | CDS | open | 73827-74618 | _na 263_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 699 | CAMXZL010000003.1 | GCA947253505_00380 | CDS | open | 74620-75237 | _na 205_aa | phoU | PhoU family protein |
| 700 | CAMXZL010000003.1 | GCA947253505_00381 | CDS | open | 75238-75897 | _na 219_aa | walR | Putative transcriptional regulatory protein WalR |
| 701 | CAMXZL010000003.1 | GCA947253505_00382 | CDS | open | 75894-77519 | _na 541_aa | histidine kinase | |
| 702 | CAMXZL010000003.1 | GCA947253505_00383 | CDS | open | 77592-77873 | _na 93_aa | hypothetical protein | |
| 703 | CAMXZL010000003.1 | GCA947253505_00384 | CDS | open | 77891-79417 | _na 508_aa | nar1 | 4Fe-4S binding domain protein |
| 704 | CAMXZL010000003.1 | GCA947253505_00385 | CDS | open | 79707-81443 | _na 578_aa | ABC transporter%2C ATP-binding protein | |
| 705 | CAMXZL010000003.1 | GCA947253505_00386 | CDS | open | 81433-83088 | _na 551_aa | ABC transporter%2C ATP-binding protein | |
| 706 | CAMXZL010000003.1 | GCA947253505_00387 | CDS | open | 83156-84679 | _na 507_aa | murJ | murein biosynthesis integral membrane protein MurJ |
| 707 | CAMXZL010000003.1 | GCA947253505_00388 | CDS | open | 85295-87028 | _na 577_aa | VWFA domain-containing protein | |
| 708 | CAMXZL010000003.1 | GCA947253505_00389 | CDS | open | 87021-87926 | _na 301_aa | mMP0363 | ATPase associated with various cellular activities AAA_5 |
| 709 | CAMXZL010000003.1 | GCA947253505_00390 | CDS | open | 88104-100790 | _na 4228_aa | inlB | InlB B-repeat-containing protein |
| 710 | CAMXZL010000003.1 | GCA947253505_00391 | CDS | open | 100866-100970 | _na 34_aa | hypothetical protein | |
| 711 | CAMXZL010000003.1 | GCA947253505_00392 | CDS | open | 101160-108968 | _na 2602_aa | Repeat protein | |
| 712 | CAMXZL010000003.1 | GCA947253505_00393 | CDS | open | 108980-114601 | _na 1873_aa | Rib/alpha-like repeat protein | |
| 713 | CAMXZL010000003.1 | GCA947253505_00394 | CDS | open | 114716-115156 | _na 146_aa | marR | Transcriptional regulator%2C MarR family |
| 714 | CAMXZL010000003.1 | GCA947253505_00395 | CDS | open | 115156-116919 | _na 587_aa | ABC transporter%2C ATP-binding protein | |
| 715 | CAMXZL010000003.1 | GCA947253505_00396 | CDS | open | 116861-118780 | _na 639_aa | ABC transporter%2C ATP-binding protein | |
| 716 | CAMXZL010000003.1 | GCA947253505_00315 | gene | open | 230-970 | |||
| 717 | CAMXZL010000003.1 | GCA947253505_00316 | gene | open | 1453-3993 | mgtA | ||
| 718 | CAMXZL010000003.1 | GCA947253505_00317 | gene | open | 4236-6296 | |||
| 719 | CAMXZL010000003.1 | GCA947253505_00318 | gene | open | 6348-8087 | |||
| 720 | CAMXZL010000003.1 | GCA947253505_00319 | gene | open | 8131-8451 | |||
| 721 | CAMXZL010000003.1 | GCA947253505_00320 | gene | open | 8444-9127 | azlC | ||
| 722 | CAMXZL010000003.1 | GCA947253505_00321 | gene | open | 9246-10619 | |||
| 723 | CAMXZL010000003.1 | GCA947253505_00322 | gene | open | 10621-11454 | |||
| 724 | CAMXZL010000003.1 | GCA947253505_00323 | gene | open | 11634-12764 | |||
| 725 | CAMXZL010000003.1 | GCA947253505_00324 | gene | open | 12808-14184 | |||
| 726 | CAMXZL010000003.1 | GCA947253505_00325 | gene | open | 14193-15017 | |||
| 727 | CAMXZL010000003.1 | GCA947253505_00326 | gene | open | 15014-15877 | |||
| 728 | CAMXZL010000003.1 | GCA947253505_00327 | gene | open | 15864-16658 | |||
| 729 | CAMXZL010000003.1 | GCA947253505_00328 | gene | open | 16655-17395 | truA | ||
| 730 | CAMXZL010000003.1 | GCA947253505_00329 | gene | open | 17392-17784 | |||
| 731 | CAMXZL010000003.1 | GCA947253505_00330 | gene | open | 17768-18922 | |||
| 732 | CAMXZL010000003.1 | GCA947253505_00331 | gene | open | 18963-20765 | recQ | ||
| 733 | CAMXZL010000003.1 | GCA947253505_00332 | gene | open | 20825-21835 | asnA | ||
| 734 | CAMXZL010000003.1 | GCA947253505_00333 | gene | open | 21988-22875 | modA | ||
| 735 | CAMXZL010000003.1 | GCA947253505_00334 | gene | open | 22883-23551 | modB | ||
| 736 | CAMXZL010000003.1 | GCA947253505_00335 | gene | open | 23538-24551 | |||
| 737 | CAMXZL010000003.1 | GCA947253505_00336 | gene | open | 24553-25491 | moaA | ||
| 738 | CAMXZL010000003.1 | GCA947253505_00337 | gene | open | 25492-25980 | moaC | ||
| 739 | CAMXZL010000003.1 | GCA947253505_00338 | gene | open | 25961-26395 | |||
| 740 | CAMXZL010000003.1 | GCA947253505_00339 | gene | open | 26388-27362 | |||
| 741 | CAMXZL010000003.1 | GCA947253505_00340 | gene | open | 27359-27844 | |||
| 742 | CAMXZL010000003.1 | GCA947253505_00341 | gene | open | 27904-28596 | gntR | ||
| 743 | CAMXZL010000003.1 | GCA947253505_00342 | gene | open | 28813-30054 | dpaL | ||
| 744 | CAMXZL010000003.1 | GCA947253505_00343 | gene | open | 30070-31266 | ygeW | ||
| 745 | CAMXZL010000003.1 | GCA947253505_00344 | gene | open | 31277-32614 | ygeY | ||
| 746 | CAMXZL010000003.1 | GCA947253505_00345 | gene | open | 32740-34101 | |||
| 747 | CAMXZL010000003.1 | GCA947253505_00346 | gene | open | 34120-35490 | hydA | ||
| 748 | CAMXZL010000003.1 | GCA947253505_00347 | gene | open | 35429-36421 | arcC | ||
| 749 | CAMXZL010000003.1 | GCA947253505_00348 | gene | open | 36542-39580 | ygfK | ||
| 750 | CAMXZL010000003.1 | GCA947253505_00349 | gene | open | 39595-40914 | ssnA | ||
| 751 | CAMXZL010000003.1 | GCA947253505_00350 | gene | open | 40944-42251 | |||
| 752 | CAMXZL010000003.1 | GCA947253505_00351 | gene | open | 42261-42437 | |||
| 753 | CAMXZL010000003.1 | GCA947253505_00352 | gene | open | 42437-42916 | |||
| 754 | CAMXZL010000003.1 | GCA947253505_00353 | gene | open | 42930-44306 | |||
| 755 | CAMXZL010000003.1 | GCA947253505_00354 | gene | open | 44336-45757 | pucK | ||
| 756 | CAMXZL010000003.1 | GCA947253505_00355 | gene | open | 46075-47445 | |||
| 757 | CAMXZL010000003.1 | GCA947253505_00356 | gene | open | 47683-49977 | xdhA | ||
| 758 | CAMXZL010000003.1 | GCA947253505_00357 | gene | open | 49991-50878 | xdhB | ||
| 759 | CAMXZL010000003.1 | GCA947253505_00358 | gene | open | 50868-51422 | xdhC | ||
| 760 | CAMXZL010000003.1 | GCA947253505_00359 | gene | open | 51783-53156 | hydA | ||
| 761 | CAMXZL010000003.1 | GCA947253505_00360 | gene | open | 53165-55804 | xdh | ||
| 762 | CAMXZL010000003.1 | GCA947253505_00361 | gene | open | 55791-56492 | yqeC | ||
| 763 | CAMXZL010000003.1 | GCA947253505_00362 | gene | open | 56482-57054 | |||
| 764 | CAMXZL010000003.1 | GCA947253505_00363 | gene | open | 57047-57850 | yqeB | ||
| 765 | CAMXZL010000003.1 | GCA947253505_00364 | gene | open | 57847-58653 | |||
| 766 | CAMXZL010000003.1 | GCA947253505_00365 | gene | open | 58769-59908 | |||
| 767 | CAMXZL010000003.1 | GCA947253505_00366 | gene | open | 59898-60161 | |||
| 768 | CAMXZL010000003.1 | GCA947253505_00367 | gene | open | 60155-60754 | yedF | ||
| 769 | CAMXZL010000003.1 | GCA947253505_00368 | gene | open | 60765-61778 | selD | ||
| 770 | CAMXZL010000003.1 | GCA947253505_00369 | gene | open | 61963-63111 | |||
| 771 | CAMXZL010000003.1 | GCA947253505_00370 | gene | open | 63113-63355 | |||
| 772 | CAMXZL010000003.1 | GCA947253505_00371 | gene | open | 63743-67828 | cas9 | ||
| 773 | CAMXZL010000003.1 | GCA947253505_00372 | gene | open | 67825-68703 | cas1 | ||
| 774 | CAMXZL010000003.1 | GCA947253505_00373 | gene | open | 68693-69013 | cas2 | ||
| 775 | CAMXZL010000003.1 | GCA947253505_00374 | gene | open | 69010-69678 | csn2 | ||
| 776 | CAMXZL010000003.1 | GCA947253505_00375 | gene | open | 70944-71063 | |||
| 777 | CAMXZL010000003.1 | GCA947253505_00376 | gene | open | 71193-72119 | |||
| 778 | CAMXZL010000003.1 | GCA947253505_00377 | gene | open | 72121-72984 | pstC | ||
| 779 | CAMXZL010000003.1 | GCA947253505_00378 | gene | open | 72994-73806 | pstA | ||
| 780 | CAMXZL010000003.1 | GCA947253505_00379 | gene | open | 73827-74618 | pstB | ||
| 781 | CAMXZL010000003.1 | GCA947253505_00380 | gene | open | 74620-75237 | phoU | ||
| 782 | CAMXZL010000003.1 | GCA947253505_00381 | gene | open | 75238-75897 | walR | ||
| 783 | CAMXZL010000003.1 | GCA947253505_00382 | gene | open | 75894-77519 | |||
| 784 | CAMXZL010000003.1 | GCA947253505_00383 | gene | open | 77592-77873 | |||
| 785 | CAMXZL010000003.1 | GCA947253505_00384 | gene | open | 77891-79417 | nar1 | ||
| 786 | CAMXZL010000003.1 | GCA947253505_00385 | gene | open | 79707-81443 | |||
| 787 | CAMXZL010000003.1 | GCA947253505_00386 | gene | open | 81433-83088 | |||
| 788 | CAMXZL010000003.1 | GCA947253505_00387 | gene | open | 83156-84679 | murJ | ||
| 789 | CAMXZL010000003.1 | GCA947253505_00388 | gene | open | 85295-87028 | |||
| 790 | CAMXZL010000003.1 | GCA947253505_00389 | gene | open | 87021-87926 | mMP0363 | ||
| 791 | CAMXZL010000003.1 | GCA947253505_00390 | gene | open | 88104-100790 | inlB | ||
| 792 | CAMXZL010000003.1 | GCA947253505_00391 | gene | open | 100866-100970 | |||
| 793 | CAMXZL010000003.1 | GCA947253505_00392 | gene | open | 101160-108968 | |||
| 794 | CAMXZL010000003.1 | GCA947253505_00393 | gene | open | 108980-114601 | |||
| 795 | CAMXZL010000003.1 | GCA947253505_00394 | gene | open | 114716-115156 | marR | ||
| 796 | CAMXZL010000003.1 | GCA947253505_00395 | gene | open | 115156-116919 | |||
| 797 | CAMXZL010000003.1 | GCA947253505_00396 | gene | open | 116861-118780 | |||
| 798 | CAMXZL010000004.1 | regulatory_region | open | 82590-82680 | TPP riboswitch aptamer (THI element) | |||
| 799 | CAMXZL010000004.1 | regulatory_region | open | 95361-95475 | FMN riboswitch aptamer (RFN element) | |||
| 800 | CAMXZL010000004.1 | GCA947253505_00397 | CDS | open | 556-1272 | _na 238_aa | N-acetyltransferase domain-containing protein | |
| 801 | CAMXZL010000004.1 | GCA947253505_00399 | CDS | open | 1823-2275 | _na 150_aa | rpiB | Galactose-6-phosphate isomerase |
| 802 | CAMXZL010000004.1 | GCA947253505_00400 | CDS | open | 2285-2815 | _na 176_aa | lacB | galactose-6-phosphate isomerase subunit LacB |
| 803 | CAMXZL010000004.1 | GCA947253505_00401 | CDS | open | 2829-3158 | _na 109_aa | PTS system lactose-specific EIIA component | |
| 804 | CAMXZL010000004.1 | GCA947253505_00402 | CDS | open | 3162-4886 | _na 574_aa | lactose-specific PTS transporter subunit EIIC | |
| 805 | CAMXZL010000004.1 | GCA947253505_00403 | CDS | open | 4883-6286 | _na 467_aa | lacG | 6-phospho-beta-galactosidase |
| 806 | CAMXZL010000004.1 | GCA947253505_00404 | CDS | open | 6315-7097 | _na 260_aa | Lactose phosphotransferase system repressor | |
| 807 | CAMXZL010000004.1 | GCA947253505_00405 | CDS | open | 7180-8313 | _na 377_aa | agaS | Sugar isomerase%2C AgaS family |
| 808 | CAMXZL010000004.1 | GCA947253505_00406 | CDS | open | 8320-9021 | _na 233_aa | ubiC | UbiC transcription regulator-associated domain protein |
| 809 | CAMXZL010000004.1 | GCA947253505_00407 | CDS | open | 9035-10162 | _na 375_aa | nagA | N-acetylglucosamine-6-phosphate deacetylase |
| 810 | CAMXZL010000004.1 | GCA947253505_00408 | CDS | open | 10159-11088 | _na 309_aa | Tagatose-6-phosphate kinase | |
| 811 | CAMXZL010000004.1 | GCA947253505_00409 | CDS | open | 11085-12068 | _na 327_aa | lacD | Tagatose 1%2C6-diphosphate aldolase |
| 812 | CAMXZL010000004.1 | GCA947253505_00410 | CDS | open | 12126-12779 | _na 217_aa | Lipoprotein | |
| 813 | CAMXZL010000004.1 | GCA947253505_00411 | CDS | open | 13075-15003 | _na 642_aa | fixB | Acyl-CoA dehydrogenase domain protein |
| 814 | CAMXZL010000004.1 | GCA947253505_00412 | CDS | open | 15016-16260 | _na 414_aa | norV | Beta-lactamase domain protein |
| 815 | CAMXZL010000004.1 | GCA947253505_00413 | CDS | open | 16560-16865 | _na 101_aa | Lipoprotein | |
| 816 | CAMXZL010000004.1 | GCA947253505_00414 | CDS | open | 17036-17707 | _na 223_aa | Response regulator receiver domain protein | |
| 817 | CAMXZL010000004.1 | GCA947253505_00415 | CDS | open | 17670-18806 | _na 378_aa | histidine kinase | |
| 818 | CAMXZL010000004.1 | GCA947253505_00416 | CDS | open | 18853-18996 | _na 47_aa | Thioredoxin | |
| 819 | CAMXZL010000004.1 | GCA947253505_00417 | CDS | open | 18989-19846 | _na 285_aa | 4Fe-4S binding domain protein | |
| 820 | CAMXZL010000004.1 | GCA947253505_00418 | CDS | open | 19836-20516 | _na 226_aa | Antioxidant%2C AhpC/TSA family | |
| 821 | CAMXZL010000004.1 | GCA947253505_00419 | CDS | open | 20685-22421 | _na 578_aa | C39 family peptidase | |
| 822 | CAMXZL010000004.1 | GCA947253505_00420 | CDS | open | 22535-23953 | _na 472_aa | Putative aspartate ammonia-lyase | |
| 823 | CAMXZL010000004.1 | GCA947253505_00421 | CDS | open | 23956-25320 | _na 454_aa | Fumarate hydratase class II | |
| 824 | CAMXZL010000004.1 | GCA947253505_00422 | CDS | open | 25332-26480 | _na 382_aa | phosphoserine phosphatase | |
| 825 | CAMXZL010000004.1 | GCA947253505_00423 | CDS | open | 26908-27570 | _na 220_aa | sdaAB | L-serine ammonia-lyase%2C iron-sulfur-dependent subunit beta |
| 826 | CAMXZL010000004.1 | GCA947253505_00424 | CDS | open | 27572-28447 | _na 291_aa | sdaAA | L-serine ammonia-lyase%2C iron-sulfur-dependent%2C subunit alpha |
| 827 | CAMXZL010000004.1 | GCA947253505_00425 | CDS | open | 28517-29923 | _na 468_aa | Amino acid carrier protein | |
| 828 | CAMXZL010000004.1 | GCA947253505_00426 | CDS | open | 30246-31592 | _na 448_aa | norM | putative multidrug resistance protein NorM |
| 829 | CAMXZL010000004.1 | GCA947253505_00427 | CDS | open | 31638-32303 | _na 221_aa | HAD hydrolase%2C family IA%2C variant 3 | |
| 830 | CAMXZL010000004.1 | GCA947253505_00428 | CDS | open | 32438-32977 | _na 179_aa | Chromate transport protein | |
| 831 | CAMXZL010000004.1 | GCA947253505_00429 | CDS | open | 32970-33530 | _na 186_aa | Chromate transport protein | |
| 832 | CAMXZL010000004.1 | GCA947253505_00430 | CDS | open | 33621-36293 | _na 890_aa | mgtA | calcium-translocating P-type ATPase%2C PMCA-type |
| 833 | CAMXZL010000004.1 | GCA947253505_00431 | CDS | open | 36471-37493 | _na 340_aa | M42 glutamyl aminopeptidase | |
| 834 | CAMXZL010000004.1 | GCA947253505_00432 | CDS | open | 37503-38009 | _na 168_aa | Tubby C 2 | |
| 835 | CAMXZL010000004.1 | GCA947253505_00433 | CDS | open | 38057-39025 | _na 322_aa | lacI | Transcriptional regulator%2C LacI family |
| 836 | CAMXZL010000004.1 | GCA947253505_00434 | CDS | open | 39156-40565 | _na 469_aa | ptsG2 | PTS system sucrose-specific IIBC component |
| 837 | CAMXZL010000004.1 | GCA947253505_00435 | CDS | open | 40747-42096 | _na 449_aa | trkH | Potassium uptake protein%2C TrkH family |
| 838 | CAMXZL010000004.1 | GCA947253505_00436 | CDS | open | 42105-42758 | _na 217_aa | trkA | TrkA-N domain protein |
| 839 | CAMXZL010000004.1 | GCA947253505_00437 | CDS | open | 43063-43779 | _na 238_aa | Putative neutral zinc metallopeptidase | |
| 840 | CAMXZL010000004.1 | GCA947253505_00438 | CDS | open | 44010-44477 | _na 155_aa | ctsR | Transcriptional repressor of CtsR |
| 841 | CAMXZL010000004.1 | GCA947253505_00439 | CDS | open | 44479-45060 | _na 193_aa | UVR domain-containing protein | |
| 842 | CAMXZL010000004.1 | GCA947253505_00440 | CDS | open | 45057-46025 | _na 322_aa | ATP:guanido phosphotransferase%2C C-terminal catalytic domain protein | |
| 843 | CAMXZL010000004.1 | GCA947253505_00441 | CDS | open | 46025-48469 | _na 814_aa | Putative negative regulator of genetic competence ClpC/MecB | |
| 844 | CAMXZL010000004.1 | GCA947253505_00442 | CDS | open | 49078-50403 | _na 441_aa | ABC transporter%2C solute-binding protein | |
| 845 | CAMXZL010000004.1 | GCA947253505_00443 | CDS | open | 50555-50971 | _na 138_aa | DUF5658 domain-containing protein | |
| 846 | CAMXZL010000004.1 | GCA947253505_00444 | CDS | open | 50973-53003 | _na 676_aa | ABC transporter%2C permease protein | |
| 847 | CAMXZL010000004.1 | GCA947253505_00445 | CDS | open | 53005-53898 | _na 297_aa | malG | Binding-protein-dependent transport systems inner membrane component |
| 848 | CAMXZL010000004.1 | GCA947253505_00446 | CDS | open | 53908-54993 | _na 361_aa | malK | ABC transporter related |
| 849 | CAMXZL010000004.1 | GCA947253505_00447 | CDS | open | 55019-55477 | _na 152_aa | 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein | |
| 850 | CAMXZL010000004.1 | GCA947253505_00448 | CDS | open | 55559-56857 | _na 432_aa | Glutamate--cysteine ligase | |
| 851 | CAMXZL010000004.1 | GCA947253505_00449 | CDS | open | 56857-58224 | _na 455_aa | radA | DNA repair protein RadA |
| 852 | CAMXZL010000004.1 | GCA947253505_00450 | CDS | open | 59556-65711 | _na 2051_aa | FMN-binding protein | |
| 853 | CAMXZL010000004.1 | GCA947253505_00451 | CDS | open | 65776-66483 | _na 235_aa | Ferric reductase like transmembrane component | |
| 854 | CAMXZL010000004.1 | GCA947253505_00452 | CDS | open | 66646-67521 | _na 291_aa | Serine-type D-Ala-D-Ala carboxypeptidase | |
| 855 | CAMXZL010000004.1 | GCA947253505_00453 | CDS | open | 67578-68906 | _na 442_aa | Aminopeptidase | |
| 856 | CAMXZL010000004.1 | GCA947253505_00454 | CDS | open | 68993-69943 | _na 316_aa | manA | mannose-6-phosphate isomerase%2C class I |
| 857 | CAMXZL010000004.1 | GCA947253505_00455 | CDS | open | 69946-71241 | _na 431_aa | Hyaluronoglucosaminidase | |
| 858 | CAMXZL010000004.1 | GCA947253505_00456 | CDS | open | 71286-72155 | _na 289_aa | fructokinase | |
| 859 | CAMXZL010000004.1 | GCA947253505_00457 | CDS | open | 72207-73649 | _na 480_aa | nicotinate phosphoribosyltransferase | |
| 860 | CAMXZL010000004.1 | GCA947253505_00458 | CDS | open | 73770-74420 | _na 216_aa | HAD hydrolase%2C family IA%2C variant 1 | |
| 861 | CAMXZL010000004.1 | GCA947253505_00459 | CDS | open | 74420-74902 | _na 160_aa | PTS system sorbose subfamily IIB component | |
| 862 | CAMXZL010000004.1 | GCA947253505_00460 | CDS | open | 74954-75304 | _na 116_aa | SdpI/YhfL protein family protein | |
| 863 | CAMXZL010000004.1 | GCA947253505_00461 | CDS | open | 75400-76533 | _na 377_aa | Glycosyltransferase%2C group 1 family protein | |
| 864 | CAMXZL010000004.1 | GCA947253505_00462 | CDS | open | 76523-77542 | _na 339_aa | Glycosyltransferase%2C group 1 family protein | |
| 865 | CAMXZL010000004.1 | GCA947253505_00463 | CDS | open | 77526-78218 | _na 230_aa | DUF106 domain-containing protein | |
| 866 | CAMXZL010000004.1 | GCA947253505_00464 | CDS | open | 78379-78735 | _na 118_aa | DUF2089 domain-containing protein | |
| 867 | CAMXZL010000004.1 | GCA947253505_00465 | CDS | open | 78728-79780 | _na 350_aa | Conserved domain protein | |
| 868 | CAMXZL010000004.1 | GCA947253505_00466 | CDS | open | 79956-81077 | _na 373_aa | epsG | EpsG family protein |
| 869 | CAMXZL010000004.1 | GCA947253505_00467 | CDS | open | 81089-82246 | _na 385_aa | Chain length determinant protein | |
| 870 | CAMXZL010000004.1 | GCA947253505_00468 | CDS | open | 82317-82559 | _na 80_aa | SH3 domain protein | |
| 871 | CAMXZL010000004.1 | GCA947253505_00469 | CDS | open | 82706-83251 | _na 181_aa | thiT | energy-coupled thiamine transporter ThiT |
| 872 | CAMXZL010000004.1 | GCA947253505_00470 | CDS | open | 83284-84915 | _na 543_aa | ecsB | Bacterial ABC transporter protein EcsB |
| 873 | CAMXZL010000004.1 | GCA947253505_00471 | CDS | open | 84908-85660 | _na 250_aa | ABC transporter%2C ATP-binding protein | |
| 874 | CAMXZL010000004.1 | GCA947253505_00472 | CDS | open | 85799-86161 | _na 120_aa | gntR | Transcriptional regulator%2C GntR family |
| 875 | CAMXZL010000004.1 | GCA947253505_00473 | CDS | open | 86158-86841 | _na 227_aa | ABC transporter%2C ATP-binding protein | |
| 876 | CAMXZL010000004.1 | GCA947253505_00474 | CDS | open | 86842-87615 | _na 257_aa | ABC transporter permease | |
| 877 | CAMXZL010000004.1 | GCA947253505_00475 | CDS | open | 87734-88633 | _na 299_aa | Lipid kinase%2C YegS/Rv2252/BmrU family | |
| 878 | CAMXZL010000004.1 | GCA947253505_00476 | CDS | open | 88726-89205 | _na 159_aa | cdnL | Transcriptional regulator%2C CarD family |
| 879 | CAMXZL010000004.1 | GCA947253505_00477 | CDS | open | 89216-90319 | _na 367_aa | pilT | PilT protein domain protein |
| 880 | CAMXZL010000004.1 | GCA947253505_00478 | CDS | open | 90312-91016 | _na 234_aa | 2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase | |
| 881 | CAMXZL010000004.1 | GCA947253505_00479 | CDS | open | 91016-91492 | _na 158_aa | ispF | 2-C-methyl-D-erythritol 2%2C4-cyclodiphosphate synthase |
| 882 | CAMXZL010000004.1 | GCA947253505_00480 | CDS | open | 91492-92661 | _na 389_aa | metK | methionine adenosyltransferase |
| 883 | CAMXZL010000004.1 | GCA947253505_00481 | CDS | open | 92670-93719 | _na 349_aa | mreB | Cell shape-determining protein MreB |
| 884 | CAMXZL010000004.1 | GCA947253505_00482 | CDS | open | 93719-94408 | _na 229_aa | gpmA | 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase |
| 885 | CAMXZL010000004.1 | GCA947253505_00483 | CDS | open | 94629-95288 | _na 219_aa | Transcriptional regulatory protein%2C C-terminal domain protein | |
| 886 | CAMXZL010000004.1 | GCA947253505_00484 | CDS | open | 95534-96130 | _na 198_aa | Riboflavin transporter | |
| 887 | CAMXZL010000004.1 | GCA947253505_00485 | CDS | open | 96204-96650 | _na 148_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 888 | CAMXZL010000004.1 | GCA947253505_00486 | CDS | open | 96661-97320 | _na 219_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 889 | CAMXZL010000004.1 | GCA947253505_00487 | CDS | open | 97289-97729 | _na 146_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 890 | CAMXZL010000004.1 | GCA947253505_00488 | CDS | open | 97722-98732 | _na 336_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 891 | CAMXZL010000004.1 | GCA947253505_00489 | CDS | open | 98734-99087 | _na 117_aa | hypothetical protein | |
| 892 | CAMXZL010000004.1 | GCA947253505_00490 | CDS | open | 99080-100480 | _na 466_aa | Peptidase%2C S41 family | |
| 893 | CAMXZL010000004.1 | GCA947253505_00491 | CDS | open | 100587-101864 | _na 425_aa | Glutamate dehydrogenase | |
| 894 | CAMXZL010000004.1 | GCA947253505_00492 | CDS | open | 102002-103210 | _na 402_aa | Cell envelope-like function transcriptional attenuator common domain protein | |
| 895 | CAMXZL010000004.1 | GCA947253505_00493 | CDS | open | 103222-104232 | _na 336_aa | fni | type 2 isopentenyl-diphosphate Delta-isomerase |
| 896 | CAMXZL010000004.1 | GCA947253505_00494 | CDS | open | 104323-104583 | _na 86_aa | fakA | Fatty acid kinase subunit A-like middle domain-containing protein |
| 897 | CAMXZL010000004.1 | GCA947253505_00495 | CDS | open | 104704-105810 | _na 368_aa | telA | Toxic anion resistance protein TelA |
| 898 | CAMXZL010000004.1 | GCA947253505_00496 | CDS | open | 105807-106925 | _na 372_aa | 5-bromo-4-chloroindolyl phosphate hydrolysis protein | |
| 899 | CAMXZL010000004.1 | GCA947253505_00497 | CDS | open | 107017-109866 | _na 949_aa | Peptidase M16 inactive domain protein | |
| 900 | CAMXZL010000004.1 | GCA947253505_00498 | CDS | open | 110435-111424 | _na 329_aa | PTS system mannose-specific EIIAB component | |
| 901 | CAMXZL010000004.1 | GCA947253505_00499 | CDS | open | 111436-112251 | _na 271_aa | manY | Phosphotransferase system PTS sorbose-specific IIC subunit |
| 902 | CAMXZL010000004.1 | GCA947253505_00500 | CDS | open | 112263-113201 | _na 312_aa | manZ | PTS system mannose/fructose/sorbose family IID component |
| 903 | CAMXZL010000004.1 | GCA947253505_00501 | CDS | open | 113201-113560 | _na 119_aa | DUF956 domain-containing protein | |
| 904 | CAMXZL010000004.1 | GCA947253505_00397 | gene | open | 556-1272 | |||
| 905 | CAMXZL010000004.1 | GCA947253505_00399 | gene | open | 1823-2275 | rpiB | ||
| 906 | CAMXZL010000004.1 | GCA947253505_00400 | gene | open | 2285-2815 | lacB | ||
| 907 | CAMXZL010000004.1 | GCA947253505_00401 | gene | open | 2829-3158 | |||
| 908 | CAMXZL010000004.1 | GCA947253505_00402 | gene | open | 3162-4886 | |||
| 909 | CAMXZL010000004.1 | GCA947253505_00403 | gene | open | 4883-6286 | lacG | ||
| 910 | CAMXZL010000004.1 | GCA947253505_00404 | gene | open | 6315-7097 | |||
| 911 | CAMXZL010000004.1 | GCA947253505_00405 | gene | open | 7180-8313 | agaS | ||
| 912 | CAMXZL010000004.1 | GCA947253505_00406 | gene | open | 8320-9021 | ubiC | ||
| 913 | CAMXZL010000004.1 | GCA947253505_00407 | gene | open | 9035-10162 | nagA | ||
| 914 | CAMXZL010000004.1 | GCA947253505_00408 | gene | open | 10159-11088 | |||
| 915 | CAMXZL010000004.1 | GCA947253505_00409 | gene | open | 11085-12068 | lacD | ||
| 916 | CAMXZL010000004.1 | GCA947253505_00410 | gene | open | 12126-12779 | |||
| 917 | CAMXZL010000004.1 | GCA947253505_00411 | gene | open | 13075-15003 | fixB | ||
| 918 | CAMXZL010000004.1 | GCA947253505_00412 | gene | open | 15016-16260 | norV | ||
| 919 | CAMXZL010000004.1 | GCA947253505_00413 | gene | open | 16560-16865 | |||
| 920 | CAMXZL010000004.1 | GCA947253505_00414 | gene | open | 17036-17707 | |||
| 921 | CAMXZL010000004.1 | GCA947253505_00415 | gene | open | 17670-18806 | |||
| 922 | CAMXZL010000004.1 | GCA947253505_00416 | gene | open | 18853-18996 | |||
| 923 | CAMXZL010000004.1 | GCA947253505_00417 | gene | open | 18989-19846 | |||
| 924 | CAMXZL010000004.1 | GCA947253505_00418 | gene | open | 19836-20516 | |||
| 925 | CAMXZL010000004.1 | GCA947253505_00419 | gene | open | 20685-22421 | |||
| 926 | CAMXZL010000004.1 | GCA947253505_00420 | gene | open | 22535-23953 | |||
| 927 | CAMXZL010000004.1 | GCA947253505_00421 | gene | open | 23956-25320 | |||
| 928 | CAMXZL010000004.1 | GCA947253505_00422 | gene | open | 25332-26480 | |||
| 929 | CAMXZL010000004.1 | GCA947253505_00423 | gene | open | 26908-27570 | sdaAB | ||
| 930 | CAMXZL010000004.1 | GCA947253505_00424 | gene | open | 27572-28447 | sdaAA | ||
| 931 | CAMXZL010000004.1 | GCA947253505_00425 | gene | open | 28517-29923 | |||
| 932 | CAMXZL010000004.1 | GCA947253505_00426 | gene | open | 30246-31592 | norM | ||
| 933 | CAMXZL010000004.1 | GCA947253505_00427 | gene | open | 31638-32303 | |||
| 934 | CAMXZL010000004.1 | GCA947253505_00428 | gene | open | 32438-32977 | |||
| 935 | CAMXZL010000004.1 | GCA947253505_00429 | gene | open | 32970-33530 | |||
| 936 | CAMXZL010000004.1 | GCA947253505_00430 | gene | open | 33621-36293 | mgtA | ||
| 937 | CAMXZL010000004.1 | GCA947253505_00431 | gene | open | 36471-37493 | |||
| 938 | CAMXZL010000004.1 | GCA947253505_00432 | gene | open | 37503-38009 | |||
| 939 | CAMXZL010000004.1 | GCA947253505_00433 | gene | open | 38057-39025 | lacI | ||
| 940 | CAMXZL010000004.1 | GCA947253505_00434 | gene | open | 39156-40565 | ptsG2 | ||
| 941 | CAMXZL010000004.1 | GCA947253505_00435 | gene | open | 40747-42096 | trkH | ||
| 942 | CAMXZL010000004.1 | GCA947253505_00436 | gene | open | 42105-42758 | trkA | ||
| 943 | CAMXZL010000004.1 | GCA947253505_00437 | gene | open | 43063-43779 | |||
| 944 | CAMXZL010000004.1 | GCA947253505_00438 | gene | open | 44010-44477 | ctsR | ||
| 945 | CAMXZL010000004.1 | GCA947253505_00439 | gene | open | 44479-45060 | |||
| 946 | CAMXZL010000004.1 | GCA947253505_00440 | gene | open | 45057-46025 | |||
| 947 | CAMXZL010000004.1 | GCA947253505_00441 | gene | open | 46025-48469 | |||
| 948 | CAMXZL010000004.1 | GCA947253505_00442 | gene | open | 49078-50403 | |||
| 949 | CAMXZL010000004.1 | GCA947253505_00443 | gene | open | 50555-50971 | |||
| 950 | CAMXZL010000004.1 | GCA947253505_00444 | gene | open | 50973-53003 | |||
| 951 | CAMXZL010000004.1 | GCA947253505_00445 | gene | open | 53005-53898 | malG | ||
| 952 | CAMXZL010000004.1 | GCA947253505_00446 | gene | open | 53908-54993 | malK | ||
| 953 | CAMXZL010000004.1 | GCA947253505_00447 | gene | open | 55019-55477 | |||
| 954 | CAMXZL010000004.1 | GCA947253505_00448 | gene | open | 55559-56857 | |||
| 955 | CAMXZL010000004.1 | GCA947253505_00449 | gene | open | 56857-58224 | radA | ||
| 956 | CAMXZL010000004.1 | GCA947253505_00450 | gene | open | 59556-65711 | |||
| 957 | CAMXZL010000004.1 | GCA947253505_00451 | gene | open | 65776-66483 | |||
| 958 | CAMXZL010000004.1 | GCA947253505_00452 | gene | open | 66646-67521 | |||
| 959 | CAMXZL010000004.1 | GCA947253505_00453 | gene | open | 67578-68906 | |||
| 960 | CAMXZL010000004.1 | GCA947253505_00454 | gene | open | 68993-69943 | manA | ||
| 961 | CAMXZL010000004.1 | GCA947253505_00455 | gene | open | 69946-71241 | |||
| 962 | CAMXZL010000004.1 | GCA947253505_00456 | gene | open | 71286-72155 | |||
| 963 | CAMXZL010000004.1 | GCA947253505_00457 | gene | open | 72207-73649 | |||
| 964 | CAMXZL010000004.1 | GCA947253505_00458 | gene | open | 73770-74420 | |||
| 965 | CAMXZL010000004.1 | GCA947253505_00459 | gene | open | 74420-74902 | |||
| 966 | CAMXZL010000004.1 | GCA947253505_00460 | gene | open | 74954-75304 | |||
| 967 | CAMXZL010000004.1 | GCA947253505_00461 | gene | open | 75400-76533 | |||
| 968 | CAMXZL010000004.1 | GCA947253505_00462 | gene | open | 76523-77542 | |||
| 969 | CAMXZL010000004.1 | GCA947253505_00463 | gene | open | 77526-78218 | |||
| 970 | CAMXZL010000004.1 | GCA947253505_00464 | gene | open | 78379-78735 | |||
| 971 | CAMXZL010000004.1 | GCA947253505_00465 | gene | open | 78728-79780 | |||
| 972 | CAMXZL010000004.1 | GCA947253505_00466 | gene | open | 79956-81077 | epsG | ||
| 973 | CAMXZL010000004.1 | GCA947253505_00467 | gene | open | 81089-82246 | |||
| 974 | CAMXZL010000004.1 | GCA947253505_00468 | gene | open | 82317-82559 | |||
| 975 | CAMXZL010000004.1 | GCA947253505_00469 | gene | open | 82706-83251 | thiT | ||
| 976 | CAMXZL010000004.1 | GCA947253505_00470 | gene | open | 83284-84915 | ecsB | ||
| 977 | CAMXZL010000004.1 | GCA947253505_00471 | gene | open | 84908-85660 | |||
| 978 | CAMXZL010000004.1 | GCA947253505_00472 | gene | open | 85799-86161 | gntR | ||
| 979 | CAMXZL010000004.1 | GCA947253505_00473 | gene | open | 86158-86841 | |||
| 980 | CAMXZL010000004.1 | GCA947253505_00474 | gene | open | 86842-87615 | |||
| 981 | CAMXZL010000004.1 | GCA947253505_00475 | gene | open | 87734-88633 | |||
| 982 | CAMXZL010000004.1 | GCA947253505_00476 | gene | open | 88726-89205 | cdnL | ||
| 983 | CAMXZL010000004.1 | GCA947253505_00477 | gene | open | 89216-90319 | pilT | ||
| 984 | CAMXZL010000004.1 | GCA947253505_00478 | gene | open | 90312-91016 | |||
| 985 | CAMXZL010000004.1 | GCA947253505_00479 | gene | open | 91016-91492 | ispF | ||
| 986 | CAMXZL010000004.1 | GCA947253505_00480 | gene | open | 91492-92661 | metK | ||
| 987 | CAMXZL010000004.1 | GCA947253505_00481 | gene | open | 92670-93719 | mreB | ||
| 988 | CAMXZL010000004.1 | GCA947253505_00482 | gene | open | 93719-94408 | gpmA | ||
| 989 | CAMXZL010000004.1 | GCA947253505_00483 | gene | open | 94629-95288 | |||
| 990 | CAMXZL010000004.1 | GCA947253505_00484 | gene | open | 95534-96130 | |||
| 991 | CAMXZL010000004.1 | GCA947253505_00485 | gene | open | 96204-96650 | tsaE | ||
| 992 | CAMXZL010000004.1 | GCA947253505_00486 | gene | open | 96661-97320 | tsaB | ||
| 993 | CAMXZL010000004.1 | GCA947253505_00487 | gene | open | 97289-97729 | rimI | ||
| 994 | CAMXZL010000004.1 | GCA947253505_00488 | gene | open | 97722-98732 | tsaD | ||
| 995 | CAMXZL010000004.1 | GCA947253505_00489 | gene | open | 98734-99087 | |||
| 996 | CAMXZL010000004.1 | GCA947253505_00490 | gene | open | 99080-100480 | |||
| 997 | CAMXZL010000004.1 | GCA947253505_00491 | gene | open | 100587-101864 | |||
| 998 | CAMXZL010000004.1 | GCA947253505_00492 | gene | open | 102002-103210 | |||
| 999 | CAMXZL010000004.1 | GCA947253505_00493 | gene | open | 103222-104232 | fni | ||
| 1000 | CAMXZL010000004.1 | GCA947253505_00494 | gene | open | 104323-104583 | fakA |

