HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Prevotella bivia (GCA_947254575.1)

Select a Genome:
BAKTA Annotations for GCA_947254575.1
Genome Selected: Prevotella bivia
ContigsBases CDSrRNA tmRNAtRNA
72 2394447 2050 0 1 40
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4197 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:4]    |    Number of Records Found: 4197 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1501 CAMYDY010000008.1 GCA947254575_00748 gene open 62959-63714 dapB
1502 CAMYDY010000008.1 GCA947254575_00749 gene open 64023-64448
1503 CAMYDY010000008.1 GCA947254575_00750 gene open 64528-65826
1504 CAMYDY010000008.1 GCA947254575_00751 gene open 65904-66314
1505 CAMYDY010000008.1 GCA947254575_00752 gene open 66345-67475 dprA
1506 CAMYDY010000008.1 GCA947254575_00753 gene open 67490-68422
1507 CAMYDY010000008.1 GCA947254575_00754 gene open 68775-69314 yfcE
1508 CAMYDY010000008.1 GCA947254575_00755 gene open 69350-70327 dusB
1509 CAMYDY010000008.1 GCA947254575_00702 gene open 276-349 trnN
1510 CAMYDY010000008.1 GCA947254575_00702 tRNA open 276-349 trnN tRNA-Asn(gtt)
1511 CAMYDY010000009.1 GCA947254575_00756 CDS open 30-320 _na     96_aa rpsF 30S ribosomal protein S6
1512 CAMYDY010000009.1 GCA947254575_00757 CDS open 323-592 _na     89_aa rpsR 30S ribosomal protein S18
1513 CAMYDY010000009.1 GCA947254575_00758 CDS open 609-1124 _na     171_aa rplI 50S ribosomal protein L9
1514 CAMYDY010000009.1 GCA947254575_00759 CDS open 1247-2320 _na     357_aa NadR/Ttd14 AAA domain-containing protein
1515 CAMYDY010000009.1 GCA947254575_00760 CDS open 2553-3470 _na     305_aa metA homoserine O-succinyltransferase
1516 CAMYDY010000009.1 GCA947254575_00761 CDS open 3486-5426 _na     646_aa Collagenase-like protease
1517 CAMYDY010000009.1 GCA947254575_00762 CDS open 5445-6533 _na     362_aa Zinc ribbon domain-containing protein
1518 CAMYDY010000009.1 GCA947254575_00763 CDS open 6629-9121 _na     830_aa TonB-dependent receptor
1519 CAMYDY010000009.1 GCA947254575_00764 CDS open 9426-11033 _na     535_aa Tetratricopeptide repeat protein
1520 CAMYDY010000009.1 GCA947254575_00765 CDS open 11116-11892 _na     258_aa Acyl-ACP thioesterase
1521 CAMYDY010000009.1 GCA947254575_00766 CDS open 11877-12836 _na     319_aa DUF6057 domain-containing protein
1522 CAMYDY010000009.1 GCA947254575_00767 CDS open 12852-14930 _na     692_aa 1%2C4-alpha-glucan branching enzyme
1523 CAMYDY010000009.1 GCA947254575_00768 CDS open 14949-15995 _na     348_aa MORN repeat protein
1524 CAMYDY010000009.1 GCA947254575_00769 CDS open 16414-16548 _na     44_aa hypothetical protein
1525 CAMYDY010000009.1 GCA947254575_00770 CDS open 16608-19199 _na     863_aa gyrA DNA gyrase subunit A
1526 CAMYDY010000009.1 GCA947254575_00771 CDS open 19252-20511 _na     419_aa Tetratricopeptide repeat protein
1527 CAMYDY010000009.1 GCA947254575_00772 CDS open 20654-21715 _na     353_aa Tetratricopeptide repeat protein
1528 CAMYDY010000009.1 GCA947254575_00773 CDS open 21756-22919 _na     387_aa Tetratricopeptide repeat protein
1529 CAMYDY010000009.1 GCA947254575_00774 CDS open 22909-24225 _na     438_aa DNA/RNA helicase%2C superfamily II
1530 CAMYDY010000009.1 GCA947254575_00775 CDS open 24426-25502 _na     358_aa serC 3-phosphoserine/phosphohydroxythreonine transaminase
1531 CAMYDY010000009.1 GCA947254575_00776 CDS open 25591-26508 _na     305_aa Phosphoglycerate dehydrogenase-like oxidoreductase
1532 CAMYDY010000009.1 GCA947254575_00777 CDS open 26642-27889 _na     415_aa DUF1015 domain-containing protein
1533 CAMYDY010000009.1 GCA947254575_00778 CDS open 27909-28502 _na     197_aa Impact N-terminal domain-containing protein
1534 CAMYDY010000009.1 GCA947254575_00780 CDS open 28743-29999 _na     418_aa UDP-glucose 6-dehydrogenase
1535 CAMYDY010000009.1 GCA947254575_00781 CDS open 30158-31663 _na     501_aa Glutamate--ammonia ligase%2C catalytic domain protein
1536 CAMYDY010000009.1 GCA947254575_00782 CDS open 31872-32390 _na     172_aa N-acetyltransferase domain-containing protein
1537 CAMYDY010000009.1 GCA947254575_00783 CDS open 32411-33775 _na     454_aa hemN oxygen-independent coproporphyrinogen III oxidase
1538 CAMYDY010000009.1 GCA947254575_00784 CDS open 34244-36037 _na     597_aa abc-f ribosomal protection-like ABC-F family protein
1539 CAMYDY010000009.1 GCA947254575_00785 CDS open 36043-36648 _na     201_aa yihA ribosome biogenesis GTP-binding protein YihA/YsxC
1540 CAMYDY010000009.1 GCA947254575_00786 CDS open 36741-37730 _na     329_aa Oxidoreductase%2C NAD-binding domain protein
1541 CAMYDY010000009.1 GCA947254575_00787 CDS open 37768-38946 _na     392_aa DUF4421 domain-containing protein
1542 CAMYDY010000009.1 GCA947254575_00788 CDS open 38943-39902 _na     319_aa Xylanase
1543 CAMYDY010000009.1 GCA947254575_00789 CDS open 39888-41786 _na     632_aa recQ ATP-dependent DNA helicase RecQ
1544 CAMYDY010000009.1 GCA947254575_00790 CDS open 41822-43546 _na     574_aa recJ single-stranded-DNA-specific exonuclease RecJ
1545 CAMYDY010000009.1 GCA947254575_00791 CDS open 43640-44866 _na     408_aa Aminopeptidase
1546 CAMYDY010000009.1 GCA947254575_00792 CDS open 44937-46337 _na     466_aa Xaa-Pro aminopeptidase
1547 CAMYDY010000009.1 GCA947254575_00793 CDS open 46429-47289 _na     286_aa Serine protease
1548 CAMYDY010000009.1 GCA947254575_00794 CDS open 47589-48467 _na     292_aa ftsX Cell division protein FtsX
1549 CAMYDY010000009.1 GCA947254575_00795 CDS open 48494-48730 _na     78_aa DUF3098 domain-containing protein
1550 CAMYDY010000009.1 GCA947254575_00796 CDS open 48730-49587 _na     285_aa undecaprenyl-diphosphate phosphatase
1551 CAMYDY010000009.1 GCA947254575_00797 CDS open 49618-50325 _na     235_aa truB tRNA pseudouridine(55) synthase TruB
1552 CAMYDY010000009.1 GCA947254575_00798 CDS open 50335-51519 _na     394_aa S-adenosylmethionine:tRNA-ribosyltransferase-isomerase (Queuine synthetase)
1553 CAMYDY010000009.1 GCA947254575_00799 CDS open 51526-51936 _na     136_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
1554 CAMYDY010000009.1 GCA947254575_00800 CDS open 52217-52417 _na     66_aa HTH cro/C1-type domain-containing protein
1555 CAMYDY010000009.1 GCA947254575_00801 CDS open 52422-52910 _na     162_aa Dihydrofolate reductase
1556 CAMYDY010000009.1 GCA947254575_00802 CDS open 53011-53805 _na     264_aa thymidylate synthase
1557 CAMYDY010000009.1 GCA947254575_00803 CDS open 53827-55182 _na     451_aa SAM-dependent MTase RsmB/NOP-type domain-containing protein
1558 CAMYDY010000009.1 GCA947254575_00804 CDS open 55194-57044 _na     616_aa DNA topoisomerase
1559 CAMYDY010000009.1 GCA947254575_00805 CDS open 57372-60725 _na     1117_aa secA preprotein translocase subunit SecA
1560 CAMYDY010000009.1 GCA947254575_00806 CDS open 60940-61311 _na     123_aa hypothetical protein
1561 CAMYDY010000009.1 GCA947254575_00807 CDS open 61311-62618 _na     435_aa DUF4105 domain-containing protein
1562 CAMYDY010000009.1 GCA947254575_00808 CDS open 62693-64003 _na     436_aa Long-chain fatty acid transport protein
1563 CAMYDY010000009.1 GCA947254575_00809 CDS open 64010-64678 _na     222_aa lptC LPS export ABC transporter periplasmic protein LptC
1564 CAMYDY010000009.1 GCA947254575_00810 CDS open 64692-65957 _na     421_aa CBS domain protein
1565 CAMYDY010000009.1 GCA947254575_00811 CDS open 66051-68198 _na     715_aa Peptidylprolyl isomerase
1566 CAMYDY010000009.1 GCA947254575_00812 CDS open 68295-69335 _na     346_aa Exopolyphosphatase-like enzyme
1567 CAMYDY010000009.1 GCA947254575_00813 CDS open 69411-70322 _na     303_aa Nucleotidyltransferase
1568 CAMYDY010000009.1 GCA947254575_00756 gene open 30-320 rpsF
1569 CAMYDY010000009.1 GCA947254575_00757 gene open 323-592 rpsR
1570 CAMYDY010000009.1 GCA947254575_00758 gene open 609-1124 rplI
1571 CAMYDY010000009.1 GCA947254575_00759 gene open 1247-2320
1572 CAMYDY010000009.1 GCA947254575_00760 gene open 2553-3470 metA
1573 CAMYDY010000009.1 GCA947254575_00761 gene open 3486-5426
1574 CAMYDY010000009.1 GCA947254575_00762 gene open 5445-6533
1575 CAMYDY010000009.1 GCA947254575_00763 gene open 6629-9121
1576 CAMYDY010000009.1 GCA947254575_00764 gene open 9426-11033
1577 CAMYDY010000009.1 GCA947254575_00765 gene open 11116-11892
1578 CAMYDY010000009.1 GCA947254575_00766 gene open 11877-12836
1579 CAMYDY010000009.1 GCA947254575_00767 gene open 12852-14930
1580 CAMYDY010000009.1 GCA947254575_00768 gene open 14949-15995
1581 CAMYDY010000009.1 GCA947254575_00769 gene open 16414-16548
1582 CAMYDY010000009.1 GCA947254575_00770 gene open 16608-19199 gyrA
1583 CAMYDY010000009.1 GCA947254575_00771 gene open 19252-20511
1584 CAMYDY010000009.1 GCA947254575_00772 gene open 20654-21715
1585 CAMYDY010000009.1 GCA947254575_00773 gene open 21756-22919
1586 CAMYDY010000009.1 GCA947254575_00774 gene open 22909-24225
1587 CAMYDY010000009.1 GCA947254575_00775 gene open 24426-25502 serC
1588 CAMYDY010000009.1 GCA947254575_00776 gene open 25591-26508
1589 CAMYDY010000009.1 GCA947254575_00777 gene open 26642-27889
1590 CAMYDY010000009.1 GCA947254575_00778 gene open 27909-28502
1591 CAMYDY010000009.1 GCA947254575_00780 gene open 28743-29999
1592 CAMYDY010000009.1 GCA947254575_00781 gene open 30158-31663
1593 CAMYDY010000009.1 GCA947254575_00782 gene open 31872-32390
1594 CAMYDY010000009.1 GCA947254575_00783 gene open 32411-33775 hemN
1595 CAMYDY010000009.1 GCA947254575_00784 gene open 34244-36037 abc-f
1596 CAMYDY010000009.1 GCA947254575_00785 gene open 36043-36648 yihA
1597 CAMYDY010000009.1 GCA947254575_00786 gene open 36741-37730
1598 CAMYDY010000009.1 GCA947254575_00787 gene open 37768-38946
1599 CAMYDY010000009.1 GCA947254575_00788 gene open 38943-39902
1600 CAMYDY010000009.1 GCA947254575_00789 gene open 39888-41786 recQ
1601 CAMYDY010000009.1 GCA947254575_00790 gene open 41822-43546 recJ
1602 CAMYDY010000009.1 GCA947254575_00791 gene open 43640-44866
1603 CAMYDY010000009.1 GCA947254575_00792 gene open 44937-46337
1604 CAMYDY010000009.1 GCA947254575_00793 gene open 46429-47289
1605 CAMYDY010000009.1 GCA947254575_00794 gene open 47589-48467 ftsX
1606 CAMYDY010000009.1 GCA947254575_00795 gene open 48494-48730
1607 CAMYDY010000009.1 GCA947254575_00796 gene open 48730-49587
1608 CAMYDY010000009.1 GCA947254575_00797 gene open 49618-50325 truB
1609 CAMYDY010000009.1 GCA947254575_00798 gene open 50335-51519
1610 CAMYDY010000009.1 GCA947254575_00799 gene open 51526-51936 folK
1611 CAMYDY010000009.1 GCA947254575_00800 gene open 52217-52417
1612 CAMYDY010000009.1 GCA947254575_00801 gene open 52422-52910
1613 CAMYDY010000009.1 GCA947254575_00802 gene open 53011-53805
1614 CAMYDY010000009.1 GCA947254575_00803 gene open 53827-55182
1615 CAMYDY010000009.1 GCA947254575_00804 gene open 55194-57044
1616 CAMYDY010000009.1 GCA947254575_00805 gene open 57372-60725 secA
1617 CAMYDY010000009.1 GCA947254575_00806 gene open 60940-61311
1618 CAMYDY010000009.1 GCA947254575_00807 gene open 61311-62618
1619 CAMYDY010000009.1 GCA947254575_00808 gene open 62693-64003
1620 CAMYDY010000009.1 GCA947254575_00809 gene open 64010-64678 lptC
1621 CAMYDY010000009.1 GCA947254575_00810 gene open 64692-65957
1622 CAMYDY010000009.1 GCA947254575_00811 gene open 66051-68198
1623 CAMYDY010000009.1 GCA947254575_00812 gene open 68295-69335
1624 CAMYDY010000009.1 GCA947254575_00813 gene open 69411-70322
1625 CAMYDY010000009.1 GCA947254575_00779 gene open 28546-28634 trnS
1626 CAMYDY010000009.1 GCA947254575_00779 tRNA open 28546-28634 trnS tRNA-Ser(cga)
1627 CAMYDY010000010.1 repeat_region open 6325-8379 CRISPR array with 27 repeats of length 47%2C consensus sequence GTTGTGTTTGATACCACAAAGATAGAAATTTTCAAGCAAATCACAAC and spacer length 29
1628 CAMYDY010000010.1 GCA947254575_00814 CDS open 473-4930 _na     1485_aa cas9 type II CRISPR RNA-guided endonuclease Cas9
1629 CAMYDY010000010.1 GCA947254575_00815 CDS open 4940-5872 _na     310_aa cas1 type II CRISPR-associated endonuclease Cas1
1630 CAMYDY010000010.1 GCA947254575_00816 CDS open 5874-6215 _na     113_aa cas2 CRISPR-associated endonuclease Cas2
1631 CAMYDY010000010.1 GCA947254575_00817 CDS open 8474-9016 _na     180_aa Phage integrase SAM-like domain-containing protein
1632 CAMYDY010000010.1 GCA947254575_00819 CDS open 9482-10519 _na     345_aa asnA aspartate--ammonia ligase
1633 CAMYDY010000010.1 GCA947254575_00820 CDS open 10662-11549 _na     295_aa Acyltransferase
1634 CAMYDY010000010.1 GCA947254575_00821 CDS open 11561-12625 _na     354_aa Peptidylarginine deiminase-like enzyme
1635 CAMYDY010000010.1 GCA947254575_00822 CDS open 12923-13033 _na     36_aa hypothetical protein
1636 CAMYDY010000010.1 GCA947254575_00823 CDS open 13387-14202 _na     271_aa Nif3-like dinuclear metal center hexameric protein
1637 CAMYDY010000010.1 GCA947254575_00824 CDS open 14238-15062 _na     274_aa C4-type zinc ribbon domain-containing protein
1638 CAMYDY010000010.1 GCA947254575_00825 CDS open 15528-15704 _na     58_aa hypothetical protein
1639 CAMYDY010000010.1 GCA947254575_00826 CDS open 15769-16623 _na     284_aa GLPGLI family protein
1640 CAMYDY010000010.1 GCA947254575_00827 CDS open 16620-19199 _na     859_aa TonB-dependent receptor
1641 CAMYDY010000010.1 GCA947254575_00828 CDS open 19550-20782 _na     410_aa Sigma-54 interaction domain protein
1642 CAMYDY010000010.1 GCA947254575_00829 CDS open 20779-21369 _na     196_aa Lipoprotein
1643 CAMYDY010000010.1 GCA947254575_00830 CDS open 21381-22148 _na     255_aa Tetratricopeptide repeat protein
1644 CAMYDY010000010.1 GCA947254575_00831 CDS open 22159-22524 _na     121_aa secG preprotein translocase subunit SecG
1645 CAMYDY010000010.1 GCA947254575_00833 CDS open 22821-23603 _na     260_aa lpxA acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase
1646 CAMYDY010000010.1 GCA947254575_00834 CDS open 23693-25072 _na     459_aa nodT Efflux transporter%2C outer membrane factor lipoprotein%2C NodT family
1647 CAMYDY010000010.1 GCA947254575_00835 CDS open 25092-28364 _na     1090_aa RND transporter%2C HAE1 family
1648 CAMYDY010000010.1 GCA947254575_00836 CDS open 28395-29729 _na     444_aa RND family efflux transporter%2C MFP subunit
1649 CAMYDY010000010.1 GCA947254575_00837 CDS open 29860-31284 _na     474_aa Putative domain HDIG-containing protein
1650 CAMYDY010000010.1 GCA947254575_00838 CDS open 31422-32258 _na     278_aa Antioxidant%2C AhpC/TSA family
1651 CAMYDY010000010.1 GCA947254575_00839 CDS open 32480-33172 _na     230_aa queuosine precursor transporter
1652 CAMYDY010000010.1 GCA947254575_00840 CDS open 33177-33635 _na     152_aa queF preQ(1) synthase
1653 CAMYDY010000010.1 GCA947254575_00841 CDS open 33721-36744 _na     1007_aa Pyruvate phosphate dikinase%2C PEP/pyruvate binding domain protein
1654 CAMYDY010000010.1 GCA947254575_00842 CDS open 36943-37158 _na     71_aa DNA (cytosine-5-)-methyltransferase
1655 CAMYDY010000010.1 GCA947254575_00843 CDS open 37340-40267 _na     975_aa Outer membrane protein beta-barrel domain-containing protein
1656 CAMYDY010000010.1 GCA947254575_00844 CDS open 40359-41045 _na     228_aa Response regulator with CheY-like receiver domain and winged-helix DNA-binding domain
1657 CAMYDY010000010.1 GCA947254575_00845 CDS open 41053-42375 _na     440_aa MATE efflux family protein
1658 CAMYDY010000010.1 GCA947254575_00846 CDS open 42394-42534 _na     46_aa Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein
1659 CAMYDY010000010.1 GCA947254575_00847 CDS open 42648-44840 _na     730_aa Dipeptidyl aminopeptidase/acylaminoacyl peptidase
1660 CAMYDY010000010.1 GCA947254575_00848 CDS open 44926-45315 _na     129_aa pqqD PqqD family protein
1661 CAMYDY010000010.1 GCA947254575_00849 CDS open 45340-45831 _na     163_aa Peptidase S24-like protein
1662 CAMYDY010000010.1 GCA947254575_00850 CDS open 45834-46721 _na     295_aa scmC SynChlorMet cassette protein ScmC
1663 CAMYDY010000010.1 GCA947254575_00851 CDS open 46815-47273 _na     152_aa DUF4136 domain-containing protein
1664 CAMYDY010000010.1 GCA947254575_00852 CDS open 47310-48170 _na     286_aa DNA-directed RNA polymerase%2C sigma subunit (Sigma70/sigma32)
1665 CAMYDY010000010.1 GCA947254575_00853 CDS open 48360-48530 _na     56_aa hypothetical protein
1666 CAMYDY010000010.1 GCA947254575_00854 CDS open 48798-49346 _na     182_aa Nucleotide modification associated domain-containing protein
1667 CAMYDY010000010.1 GCA947254575_00855 CDS open 49333-50796 _na     487_aa Triosephosphate isomerase
1668 CAMYDY010000010.1 GCA947254575_00856 CDS open 50830-51591 _na     253_aa tpiA triose-phosphate isomerase
1669 CAMYDY010000010.1 GCA947254575_00857 CDS open 51676-52413 _na     245_aa Sporulation and cell division repeat protein
1670 CAMYDY010000010.1 GCA947254575_00858 CDS open 52434-53027 _na     197_aa folE GTP cyclohydrolase I FolE
1671 CAMYDY010000010.1 GCA947254575_00859 CDS open 53063-53773 _na     236_aa Lipoprotein
1672 CAMYDY010000010.1 GCA947254575_00860 CDS open 53777-54526 _na     249_aa exodeoxyribonuclease III
1673 CAMYDY010000010.1 GCA947254575_00861 CDS open 54538-55290 _na     250_aa SGNH hydrolase-type esterase domain-containing protein
1674 CAMYDY010000010.1 GCA947254575_00862 CDS open 55300-56766 _na     488_aa Putative membrane protein involved in D-alanine export
1675 CAMYDY010000010.1 GCA947254575_00863 CDS open 56781-57233 _na     150_aa tRNA-specific adenosine deaminase
1676 CAMYDY010000010.1 GCA947254575_00864 CDS open 57315-57680 _na     121_aa UPF0102 protein PrebiDRAFT_2176
1677 CAMYDY010000010.1 GCA947254575_00865 CDS open 57700-58488 _na     262_aa Biotin-(Acetyl-CoA carboxylase) ligase
1678 CAMYDY010000010.1 GCA947254575_00866 CDS open 58512-59222 _na     236_aa pyrH UMP kinase
1679 CAMYDY010000010.1 GCA947254575_00867 CDS open 59364-59894 _na     176_aa yhcR Endonuclease YhcR N-terminal domain-containing protein
1680 CAMYDY010000010.1 GCA947254575_00868 CDS open 60249-62327 _na     692_aa Cytochrome C biogenesis protein transmembrane region
1681 CAMYDY010000010.1 GCA947254575_00869 CDS open 62559-63362 _na     267_aa MFS transporter
1682 CAMYDY010000010.1 GCA947254575_00870 CDS open 63454-63927 _na     157_aa MFS transporter
1683 CAMYDY010000010.1 GCA947254575_00871 CDS open 64546-65445 _na     299_aa diaminopimelate dehydrogenase
1684 CAMYDY010000010.1 GCA947254575_00872 CDS open 65619-66119 _na     166_aa RNA polymerase sigma factor%2C sigma-70 family
1685 CAMYDY010000010.1 GCA947254575_00873 CDS open 66116-66847 _na     243_aa hypothetical protein
1686 CAMYDY010000010.1 GCA947254575_00874 CDS open 66844-67695 _na     283_aa GLPGLI family protein
1687 CAMYDY010000010.1 GCA947254575_00875 CDS open 67789-68157 _na     122_aa Putative superoxide reductase
1688 CAMYDY010000010.1 GCA947254575_00876 CDS open 68573-69565 _na     330_aa Transposase family protein
1689 CAMYDY010000010.1 GCA947254575_00877 CDS open 69531-69917 _na     128_aa Transposase
1690 CAMYDY010000010.1 GCA947254575_00814 gene open 473-4930 cas9
1691 CAMYDY010000010.1 GCA947254575_00815 gene open 4940-5872 cas1
1692 CAMYDY010000010.1 GCA947254575_00816 gene open 5874-6215 cas2
1693 CAMYDY010000010.1 GCA947254575_00817 gene open 8474-9016
1694 CAMYDY010000010.1 GCA947254575_00819 gene open 9482-10519 asnA
1695 CAMYDY010000010.1 GCA947254575_00820 gene open 10662-11549
1696 CAMYDY010000010.1 GCA947254575_00821 gene open 11561-12625
1697 CAMYDY010000010.1 GCA947254575_00822 gene open 12923-13033
1698 CAMYDY010000010.1 GCA947254575_00823 gene open 13387-14202
1699 CAMYDY010000010.1 GCA947254575_00824 gene open 14238-15062
1700 CAMYDY010000010.1 GCA947254575_00825 gene open 15528-15704
1701 CAMYDY010000010.1 GCA947254575_00826 gene open 15769-16623
1702 CAMYDY010000010.1 GCA947254575_00827 gene open 16620-19199
1703 CAMYDY010000010.1 GCA947254575_00828 gene open 19550-20782
1704 CAMYDY010000010.1 GCA947254575_00829 gene open 20779-21369
1705 CAMYDY010000010.1 GCA947254575_00830 gene open 21381-22148
1706 CAMYDY010000010.1 GCA947254575_00831 gene open 22159-22524 secG
1707 CAMYDY010000010.1 GCA947254575_00833 gene open 22821-23603 lpxA
1708 CAMYDY010000010.1 GCA947254575_00834 gene open 23693-25072 nodT
1709 CAMYDY010000010.1 GCA947254575_00835 gene open 25092-28364
1710 CAMYDY010000010.1 GCA947254575_00836 gene open 28395-29729
1711 CAMYDY010000010.1 GCA947254575_00837 gene open 29860-31284
1712 CAMYDY010000010.1 GCA947254575_00838 gene open 31422-32258
1713 CAMYDY010000010.1 GCA947254575_00839 gene open 32480-33172
1714 CAMYDY010000010.1 GCA947254575_00840 gene open 33177-33635 queF
1715 CAMYDY010000010.1 GCA947254575_00841 gene open 33721-36744
1716 CAMYDY010000010.1 GCA947254575_00842 gene open 36943-37158
1717 CAMYDY010000010.1 GCA947254575_00843 gene open 37340-40267
1718 CAMYDY010000010.1 GCA947254575_00844 gene open 40359-41045
1719 CAMYDY010000010.1 GCA947254575_00845 gene open 41053-42375
1720 CAMYDY010000010.1 GCA947254575_00846 gene open 42394-42534
1721 CAMYDY010000010.1 GCA947254575_00847 gene open 42648-44840
1722 CAMYDY010000010.1 GCA947254575_00848 gene open 44926-45315 pqqD
1723 CAMYDY010000010.1 GCA947254575_00849 gene open 45340-45831
1724 CAMYDY010000010.1 GCA947254575_00850 gene open 45834-46721 scmC
1725 CAMYDY010000010.1 GCA947254575_00851 gene open 46815-47273
1726 CAMYDY010000010.1 GCA947254575_00852 gene open 47310-48170
1727 CAMYDY010000010.1 GCA947254575_00853 gene open 48360-48530
1728 CAMYDY010000010.1 GCA947254575_00854 gene open 48798-49346
1729 CAMYDY010000010.1 GCA947254575_00855 gene open 49333-50796
1730 CAMYDY010000010.1 GCA947254575_00856 gene open 50830-51591 tpiA
1731 CAMYDY010000010.1 GCA947254575_00857 gene open 51676-52413
1732 CAMYDY010000010.1 GCA947254575_00858 gene open 52434-53027 folE
1733 CAMYDY010000010.1 GCA947254575_00859 gene open 53063-53773
1734 CAMYDY010000010.1 GCA947254575_00860 gene open 53777-54526
1735 CAMYDY010000010.1 GCA947254575_00861 gene open 54538-55290
1736 CAMYDY010000010.1 GCA947254575_00862 gene open 55300-56766
1737 CAMYDY010000010.1 GCA947254575_00863 gene open 56781-57233
1738 CAMYDY010000010.1 GCA947254575_00864 gene open 57315-57680
1739 CAMYDY010000010.1 GCA947254575_00865 gene open 57700-58488
1740 CAMYDY010000010.1 GCA947254575_00866 gene open 58512-59222 pyrH
1741 CAMYDY010000010.1 GCA947254575_00867 gene open 59364-59894 yhcR
1742 CAMYDY010000010.1 GCA947254575_00868 gene open 60249-62327
1743 CAMYDY010000010.1 GCA947254575_00869 gene open 62559-63362
1744 CAMYDY010000010.1 GCA947254575_00870 gene open 63454-63927
1745 CAMYDY010000010.1 GCA947254575_00871 gene open 64546-65445
1746 CAMYDY010000010.1 GCA947254575_00872 gene open 65619-66119
1747 CAMYDY010000010.1 GCA947254575_00873 gene open 66116-66847
1748 CAMYDY010000010.1 GCA947254575_00874 gene open 66844-67695
1749 CAMYDY010000010.1 GCA947254575_00875 gene open 67789-68157
1750 CAMYDY010000010.1 GCA947254575_00876 gene open 68573-69565
1751 CAMYDY010000010.1 GCA947254575_00877 gene open 69531-69917
1752 CAMYDY010000010.1 GCA947254575_00818 gene open 9109-9180 trnR
1753 CAMYDY010000010.1 GCA947254575_00832 gene open 22615-22691 trnH
1754 CAMYDY010000010.1 GCA947254575_00818 tRNA open 9109-9180 trnR tRNA-Arg(ccg)
1755 CAMYDY010000010.1 GCA947254575_00832 tRNA open 22615-22691 trnH tRNA-His(gtg)
1756 CAMYDY010000011.1 repeat_region open 64694-64942 CRISPR array with 3 repeats of length 52%2C consensus sequence TTTTTGTTGCATCTACTTTTCACGACTTTCCACGACATAAGTTTGCCTGCAT and spacer length 46
1757 CAMYDY010000011.1 GCA947254575_00878 CDS open 132-284 _na     50_aa hypothetical protein
1758 CAMYDY010000011.1 GCA947254575_00879 CDS open 334-2601 _na     755_aa Lipoprotein
1759 CAMYDY010000011.1 GCA947254575_00880 CDS open 2765-3529 _na     254_aa Acyltransferase
1760 CAMYDY010000011.1 GCA947254575_00881 CDS open 3546-4754 _na     402_aa Ser/Thr phosphatase family protein
1761 CAMYDY010000011.1 GCA947254575_00882 CDS open 4852-6195 _na     447_aa dihydroorotase
1762 CAMYDY010000011.1 GCA947254575_00883 CDS open 6230-7081 _na     283_aa DUF4369 domain-containing protein
1763 CAMYDY010000011.1 GCA947254575_00884 CDS open 7177-7599 _na     140_aa DUF4199 domain-containing protein
1764 CAMYDY010000011.1 GCA947254575_00885 CDS open 7605-7934 _na     109_aa Septum formation initiator
1765 CAMYDY010000011.1 GCA947254575_00886 CDS open 8168-9955 _na     595_aa DNA polymerase III subunit gamma/tau
1766 CAMYDY010000011.1 GCA947254575_00887 CDS open 10129-11586 _na     485_aa Trk-type K+ transport system%2C membrane component
1767 CAMYDY010000011.1 GCA947254575_00888 CDS open 11590-12930 _na     446_aa trkA Trk system potassium transporter TrkA
1768 CAMYDY010000011.1 GCA947254575_00889 CDS open 12939-14888 _na     649_aa dxs 1-deoxy-D-xylulose-5-phosphate synthase
1769 CAMYDY010000011.1 GCA947254575_00890 CDS open 15541-17838 _na     765_aa GTP pyrophosphokinase
1770 CAMYDY010000011.1 GCA947254575_00891 CDS open 17886-18674 _na     262_aa DUF5683 domain-containing protein
1771 CAMYDY010000011.1 GCA947254575_00892 CDS open 18767-19678 _na     303_aa ParB-like protein
1772 CAMYDY010000011.1 GCA947254575_00893 CDS open 19705-20469 _na     254_aa parA AAA domain-containing protein
1773 CAMYDY010000011.1 GCA947254575_00894 CDS open 20583-21353 _na     256_aa surE 5'/3'-nucleotidase SurE
1774 CAMYDY010000011.1 GCA947254575_00895 CDS open 21417-22565 _na     382_aa lpxB lipid-A-disaccharide synthase
1775 CAMYDY010000011.1 GCA947254575_00896 CDS open 22719-24728 _na     669_aa DNA primase
1776 CAMYDY010000011.1 GCA947254575_00897 CDS open 24742-26163 _na     473_aa cls cardiolipin synthase
1777 CAMYDY010000011.1 GCA947254575_00898 CDS open 26222-26965 _na     247_aa Glycosyl transferase
1778 CAMYDY010000011.1 GCA947254575_00899 CDS open 27107-30616 _na     1169_aa mfd transcription-repair coupling factor
1779 CAMYDY010000011.1 GCA947254575_00900 CDS open 30958-32409 _na     483_aa ATP-dependent endonuclease
1780 CAMYDY010000011.1 GCA947254575_00901 CDS open 32423-33280 _na     285_aa Endonuclease
1781 CAMYDY010000011.1 GCA947254575_00902 CDS open 33295-33996 _na     233_aa Membrane protein
1782 CAMYDY010000011.1 GCA947254575_00903 CDS open 34018-34506 _na     162_aa lrgA LrgA
1783 CAMYDY010000011.1 GCA947254575_00904 CDS open 34650-35495 _na     281_aa DUF3822 domain-containing protein
1784 CAMYDY010000011.1 GCA947254575_00905 CDS open 35514-36044 _na     176_aa rsmD 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD
1785 CAMYDY010000011.1 GCA947254575_00906 CDS open 36139-36477 _na     112_aa Transcriptional regulator
1786 CAMYDY010000011.1 GCA947254575_00907 CDS open 36660-39317 _na     885_aa alaS alanine--tRNA ligase
1787 CAMYDY010000011.1 GCA947254575_00908 CDS open 39493-40140 _na     215_aa SprT-like domain-containing protein
1788 CAMYDY010000011.1 GCA947254575_00909 CDS open 40197-41063 _na     288_aa Phosphatidate cytidylyltransferase
1789 CAMYDY010000011.1 GCA947254575_00910 CDS open 41069-43225 _na     718_aa ftsH ATP-dependent zinc metalloprotease FtsH
1790 CAMYDY010000011.1 GCA947254575_00911 CDS open 43243-43602 _na     119_aa rsfS ribosome silencing factor
1791 CAMYDY010000011.1 GCA947254575_00913 CDS open 43969-44352 _na     127_aa Rhodanese-related sulfurtransferase
1792 CAMYDY010000011.1 GCA947254575_00914 CDS open 44698-45162 _na     154_aa doxX DoxX family protein
1793 CAMYDY010000011.1 GCA947254575_00915 CDS open 45574-45834 _na     86_aa hypothetical protein
1794 CAMYDY010000011.1 GCA947254575_00916 CDS open 46090-47022 _na     310_aa DUF2179 domain-containing protein
1795 CAMYDY010000011.1 GCA947254575_00917 CDS open 47019-48179 _na     386_aa mnmA tRNA 2-thiouridine(34) synthase MnmA
1796 CAMYDY010000011.1 GCA947254575_00918 CDS open 48319-50052 _na     577_aa Glycosyl hydrolase family 25
1797 CAMYDY010000011.1 GCA947254575_00919 CDS open 50319-51245 _na     308_aa corA Magnesium transporter CorA
1798 CAMYDY010000011.1 GCA947254575_00920 CDS open 51409-53166 _na     585_aa DUF349 domain-containing protein
1799 CAMYDY010000011.1 GCA947254575_00921 CDS open 53349-54293 _na     314_aa rsgA ribosome small subunit-dependent GTPase A
1800 CAMYDY010000011.1 GCA947254575_00922 CDS open 54375-54935 _na     186_aa frr ribosome recycling factor
1801 CAMYDY010000011.1 GCA947254575_00923 CDS open 55016-55492 _na     158_aa GAF domain-containing protein
1802 CAMYDY010000011.1 GCA947254575_00924 CDS open 55483-56298 _na     271_aa rsmA 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA
1803 CAMYDY010000011.1 GCA947254575_00925 CDS open 56376-57371 _na     331_aa Integral membrane protein
1804 CAMYDY010000011.1 GCA947254575_00926 CDS open 57405-58859 _na     484_aa Aminoacyl-histidine dipeptidase
1805 CAMYDY010000011.1 GCA947254575_00927 CDS open 58949-59659 _na     236_aa Haloacid dehalogenase superfamily protein%2C subfamily IA%2C variant 3 with third motif having DD or ED
1806 CAMYDY010000011.1 GCA947254575_00928 CDS open 60024-61382 _na     452_aa glucose-6-phosphate isomerase
1807 CAMYDY010000011.1 GCA947254575_00929 CDS open 61389-62459 _na     356_aa Glycerol-3-phosphate dehydrogenase
1808 CAMYDY010000011.1 GCA947254575_00930 CDS open 62712-64439 _na     575_aa lysS lysine--tRNA ligase
1809 CAMYDY010000011.1 GCA947254575_00878 gene open 132-284
1810 CAMYDY010000011.1 GCA947254575_00879 gene open 334-2601
1811 CAMYDY010000011.1 GCA947254575_00880 gene open 2765-3529
1812 CAMYDY010000011.1 GCA947254575_00881 gene open 3546-4754
1813 CAMYDY010000011.1 GCA947254575_00882 gene open 4852-6195
1814 CAMYDY010000011.1 GCA947254575_00883 gene open 6230-7081
1815 CAMYDY010000011.1 GCA947254575_00884 gene open 7177-7599
1816 CAMYDY010000011.1 GCA947254575_00885 gene open 7605-7934
1817 CAMYDY010000011.1 GCA947254575_00886 gene open 8168-9955
1818 CAMYDY010000011.1 GCA947254575_00887 gene open 10129-11586
1819 CAMYDY010000011.1 GCA947254575_00888 gene open 11590-12930 trkA
1820 CAMYDY010000011.1 GCA947254575_00889 gene open 12939-14888 dxs
1821 CAMYDY010000011.1 GCA947254575_00890 gene open 15541-17838
1822 CAMYDY010000011.1 GCA947254575_00891 gene open 17886-18674
1823 CAMYDY010000011.1 GCA947254575_00892 gene open 18767-19678
1824 CAMYDY010000011.1 GCA947254575_00893 gene open 19705-20469 parA
1825 CAMYDY010000011.1 GCA947254575_00894 gene open 20583-21353 surE
1826 CAMYDY010000011.1 GCA947254575_00895 gene open 21417-22565 lpxB
1827 CAMYDY010000011.1 GCA947254575_00896 gene open 22719-24728
1828 CAMYDY010000011.1 GCA947254575_00897 gene open 24742-26163 cls
1829 CAMYDY010000011.1 GCA947254575_00898 gene open 26222-26965
1830 CAMYDY010000011.1 GCA947254575_00899 gene open 27107-30616 mfd
1831 CAMYDY010000011.1 GCA947254575_00900 gene open 30958-32409
1832 CAMYDY010000011.1 GCA947254575_00901 gene open 32423-33280
1833 CAMYDY010000011.1 GCA947254575_00902 gene open 33295-33996
1834 CAMYDY010000011.1 GCA947254575_00903 gene open 34018-34506 lrgA
1835 CAMYDY010000011.1 GCA947254575_00904 gene open 34650-35495
1836 CAMYDY010000011.1 GCA947254575_00905 gene open 35514-36044 rsmD
1837 CAMYDY010000011.1 GCA947254575_00906 gene open 36139-36477
1838 CAMYDY010000011.1 GCA947254575_00907 gene open 36660-39317 alaS
1839 CAMYDY010000011.1 GCA947254575_00908 gene open 39493-40140
1840 CAMYDY010000011.1 GCA947254575_00909 gene open 40197-41063
1841 CAMYDY010000011.1 GCA947254575_00910 gene open 41069-43225 ftsH
1842 CAMYDY010000011.1 GCA947254575_00911 gene open 43243-43602 rsfS
1843 CAMYDY010000011.1 GCA947254575_00913 gene open 43969-44352
1844 CAMYDY010000011.1 GCA947254575_00914 gene open 44698-45162 doxX
1845 CAMYDY010000011.1 GCA947254575_00915 gene open 45574-45834
1846 CAMYDY010000011.1 GCA947254575_00916 gene open 46090-47022
1847 CAMYDY010000011.1 GCA947254575_00917 gene open 47019-48179 mnmA
1848 CAMYDY010000011.1 GCA947254575_00918 gene open 48319-50052
1849 CAMYDY010000011.1 GCA947254575_00919 gene open 50319-51245 corA
1850 CAMYDY010000011.1 GCA947254575_00920 gene open 51409-53166
1851 CAMYDY010000011.1 GCA947254575_00921 gene open 53349-54293 rsgA
1852 CAMYDY010000011.1 GCA947254575_00922 gene open 54375-54935 frr
1853 CAMYDY010000011.1 GCA947254575_00923 gene open 55016-55492
1854 CAMYDY010000011.1 GCA947254575_00924 gene open 55483-56298 rsmA
1855 CAMYDY010000011.1 GCA947254575_00925 gene open 56376-57371
1856 CAMYDY010000011.1 GCA947254575_00926 gene open 57405-58859
1857 CAMYDY010000011.1 GCA947254575_00927 gene open 58949-59659
1858 CAMYDY010000011.1 GCA947254575_00928 gene open 60024-61382
1859 CAMYDY010000011.1 GCA947254575_00929 gene open 61389-62459
1860 CAMYDY010000011.1 GCA947254575_00930 gene open 62712-64439 lysS
1861 CAMYDY010000011.1 GCA947254575_00912 gene open 43818-43888 trnQ
1862 CAMYDY010000011.1 GCA947254575_00912 tRNA open 43818-43888 trnQ tRNA-Gln(ctg)
1863 CAMYDY010000012.1 GCA947254575_00931 CDS open 113-586 _na     157_aa Beta-lactamase-inhibitor-like PepSY-like domain-containing protein
1864 CAMYDY010000012.1 GCA947254575_00932 CDS open 737-2398 _na     553_aa Starch synthase
1865 CAMYDY010000012.1 GCA947254575_00933 CDS open 2426-4984 _na     852_aa Alpha-glucan phosphorylase
1866 CAMYDY010000012.1 GCA947254575_00934 CDS open 5209-6441 _na     410_aa ABC-type transport system%2C involved in lipoprotein release%2C permease component
1867 CAMYDY010000012.1 GCA947254575_00935 CDS open 6448-6783 _na     111_aa rbfA 30S ribosome-binding factor RbfA
1868 CAMYDY010000012.1 GCA947254575_00936 CDS open 6890-7522 _na     210_aa O-methyltransferase
1869 CAMYDY010000012.1 GCA947254575_00937 CDS open 7525-7941 _na     138_aa aroQ type II 3-dehydroquinate dehydratase
1870 CAMYDY010000012.1 GCA947254575_00938 CDS open 7950-8186 _na     78_aa HpaII restriction endonuclease
1871 CAMYDY010000012.1 GCA947254575_00939 CDS open 8183-8296 _na     37_aa hypothetical protein
1872 CAMYDY010000012.1 GCA947254575_00940 CDS open 8356-9288 _na     310_aa xerD site-specific tyrosine recombinase XerD
1873 CAMYDY010000012.1 GCA947254575_00941 CDS open 9776-9877 _na     33_aa hypothetical protein
1874 CAMYDY010000012.1 GCA947254575_00942 CDS open 9864-10514 _na     216_aa DUF2975 domain-containing protein
1875 CAMYDY010000012.1 GCA947254575_00943 CDS open 10531-10734 _na     67_aa XRE family transcriptional regulator
1876 CAMYDY010000012.1 GCA947254575_00944 CDS open 10830-13646 _na     938_aa Peptidase M16 inactive domain protein
1877 CAMYDY010000012.1 GCA947254575_00945 CDS open 13802-15094 _na     430_aa metK methionine adenosyltransferase
1878 CAMYDY010000012.1 GCA947254575_00946 CDS open 15103-16035 _na     310_aa DUF4271 domain-containing protein
1879 CAMYDY010000012.1 GCA947254575_00947 CDS open 16042-16788 _na     248_aa Uroporphyrinogen-III synthase
1880 CAMYDY010000012.1 GCA947254575_00948 CDS open 16798-17295 _na     165_aa rnpA ribonuclease P protein component
1881 CAMYDY010000012.1 GCA947254575_00949 CDS open 17292-17567 _na     91_aa yidD membrane protein insertion efficiency factor YidD
1882 CAMYDY010000012.1 GCA947254575_00950 CDS open 17639-18937 _na     432_aa tyrS tyrosine--tRNA ligase
1883 CAMYDY010000012.1 GCA947254575_00951 CDS open 19016-20437 _na     473_aa ATPase
1884 CAMYDY010000012.1 GCA947254575_00952 CDS open 20785-22848 _na     687_aa Outer membrane protein beta-barrel domain-containing protein
1885 CAMYDY010000012.1 GCA947254575_00953 CDS open 22955-23689 _na     244_aa Response regulator with CheY-like receiver domain and winged-helix DNA-binding domain
1886 CAMYDY010000012.1 GCA947254575_00954 CDS open 23902-24867 _na     321_aa Cation diffusion facilitator family transporter
1887 CAMYDY010000012.1 GCA947254575_00956 CDS open 25195-25743 _na     182_aa Glutathione peroxidase
1888 CAMYDY010000012.1 GCA947254575_00957 CDS open 26058-26333 _na     91_aa Bacterial nucleoid DNA-binding protein
1889 CAMYDY010000012.1 GCA947254575_00958 CDS open 26576-27532 _na     318_aa Protease
1890 CAMYDY010000012.1 GCA947254575_00959 CDS open 27603-28667 _na     354_aa Endonuclease/exonuclease/phosphatase family protein
1891 CAMYDY010000012.1 GCA947254575_00960 CDS open 28771-31797 _na     1008_aa secDF protein translocase subunit SecDF
1892 CAMYDY010000012.1 GCA947254575_00961 CDS open 32704-34110 _na     468_aa ltrA group II intron reverse transcriptase/maturase
1893 CAMYDY010000012.1 GCA947254575_00962 CDS open 34505-35674 _na     389_aa CD-NTase-associated protein 12/Pycsar effector protein TIR domain-containing protein
1894 CAMYDY010000012.1 GCA947254575_00963 CDS open 36285-36494 _na     69_aa Trasnmembrane protein found in conjugate transposon
1895 CAMYDY010000012.1 GCA947254575_00964 CDS open 36507-36725 _na     72_aa Transposase
1896 CAMYDY010000012.1 GCA947254575_00965 CDS open 36737-37033 _na     98_aa Intein
1897 CAMYDY010000012.1 GCA947254575_00966 CDS open 37030-37620 _na     196_aa DUF4942 domain-containing protein
1898 CAMYDY010000012.1 GCA947254575_00967 CDS open 37638-38054 _na     138_aa PcfK-like protein
1899 CAMYDY010000012.1 GCA947254575_00968 CDS open 38076-38606 _na     176_aa Antirestriction protein
1900 CAMYDY010000012.1 GCA947254575_00969 CDS open 38623-39897 _na     424_aa PcfJ-like protein
1901 CAMYDY010000012.1 GCA947254575_00970 CDS open 39924-40178 _na     84_aa hypothetical protein
1902 CAMYDY010000012.1 GCA947254575_00971 CDS open 40558-41352 _na     264_aa TIGR02391 family protein
1903 CAMYDY010000012.1 GCA947254575_00972 CDS open 41336-42184 _na     282_aa DUF4935 domain-containing protein
1904 CAMYDY010000012.1 GCA947254575_00973 CDS open 42304-42813 _na     169_aa rrrD Lysozyme
1905 CAMYDY010000012.1 GCA947254575_00974 CDS open 42797-43225 _na     142_aa DUF3872 domain-containing protein
1906 CAMYDY010000012.1 GCA947254575_00975 CDS open 43279-44133 _na     284_aa Zinc finger CHC2-type domain-containing protein
1907 CAMYDY010000012.1 GCA947254575_00976 CDS open 44133-44717 _na     194_aa traO Conjugative transposon protein TraO
1908 CAMYDY010000012.1 GCA947254575_00977 CDS open 44719-45639 _na     306_aa traN conjugative transposon protein TraN
1909 CAMYDY010000012.1 GCA947254575_00978 CDS open 45678-47045 _na     455_aa traM conjugative transposon protein TraM
1910 CAMYDY010000012.1 GCA947254575_00979 CDS open 46996-47328 _na     110_aa DUF3989 domain-containing protein
1911 CAMYDY010000012.1 GCA947254575_00980 CDS open 47325-47948 _na     207_aa traK conjugative transposon protein TraK
1912 CAMYDY010000012.1 GCA947254575_00981 CDS open 47968-49044 _na     358_aa traJ conjugative transposon protein TraJ
1913 CAMYDY010000012.1 GCA947254575_00982 CDS open 49047-49676 _na     209_aa Conjugal transfer protein
1914 CAMYDY010000012.1 GCA947254575_00983 CDS open 49826-52312 _na     828_aa traC Conjugal transfer ATP-binding protein TraC
1915 CAMYDY010000012.1 GCA947254575_00984 CDS open 52309-52686 _na     125_aa traF Conjugal transfer protein TraF
1916 CAMYDY010000012.1 GCA947254575_00985 CDS open 52691-52990 _na     99_aa traE putative conserved transmembrane protein found in conjugate transposon TraE
1917 CAMYDY010000012.1 GCA947254575_00986 CDS open 53133-53738 _na     201_aa Conjugal transfer protein
1918 CAMYDY010000012.1 GCA947254575_00987 CDS open 53726-54466 _na     246_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
1919 CAMYDY010000012.1 GCA947254575_00988 CDS open 54496-55086 _na     196_aa traD Conjugative transposon protein TraD
1920 CAMYDY010000012.1 GCA947254575_00989 CDS open 55083-55433 _na     116_aa DUF3408 domain-containing protein
1921 CAMYDY010000012.1 GCA947254575_00990 CDS open 55459-55887 _na     142_aa DUF3408 domain-containing protein
1922 CAMYDY010000012.1 GCA947254575_00991 CDS open 55871-56653 _na     260_aa CobQ/CobB/MinD/ParA nucleotide binding domain-containing protein
1923 CAMYDY010000012.1 GCA947254575_00992 CDS open 57450-57863 _na     137_aa mobA MobA protein
1924 CAMYDY010000012.1 GCA947254575_00993 CDS open 57848-59083 _na     411_aa Relaxase/mobilization nuclease domain protein
1925 CAMYDY010000012.1 GCA947254575_00994 CDS open 59268-61277 _na     669_aa virD4 YWFCY domain-containing protein
1926 CAMYDY010000012.1 GCA947254575_00995 CDS open 61342-61785 _na     147_aa B box-type domain-containing protein
1927 CAMYDY010000012.1 GCA947254575_00996 CDS open 61980-62615 _na     211_aa labA NYN domain-containing protein
1928 CAMYDY010000012.1 GCA947254575_00997 CDS open 62720-63085 _na     121_aa rteC RteC protein
1929 CAMYDY010000012.1 GCA947254575_00931 gene open 113-586
1930 CAMYDY010000012.1 GCA947254575_00932 gene open 737-2398
1931 CAMYDY010000012.1 GCA947254575_00933 gene open 2426-4984
1932 CAMYDY010000012.1 GCA947254575_00934 gene open 5209-6441
1933 CAMYDY010000012.1 GCA947254575_00935 gene open 6448-6783 rbfA
1934 CAMYDY010000012.1 GCA947254575_00936 gene open 6890-7522
1935 CAMYDY010000012.1 GCA947254575_00937 gene open 7525-7941 aroQ
1936 CAMYDY010000012.1 GCA947254575_00938 gene open 7950-8186
1937 CAMYDY010000012.1 GCA947254575_00939 gene open 8183-8296
1938 CAMYDY010000012.1 GCA947254575_00940 gene open 8356-9288 xerD
1939 CAMYDY010000012.1 GCA947254575_00941 gene open 9776-9877
1940 CAMYDY010000012.1 GCA947254575_00942 gene open 9864-10514
1941 CAMYDY010000012.1 GCA947254575_00943 gene open 10531-10734
1942 CAMYDY010000012.1 GCA947254575_00944 gene open 10830-13646
1943 CAMYDY010000012.1 GCA947254575_00945 gene open 13802-15094 metK
1944 CAMYDY010000012.1 GCA947254575_00946 gene open 15103-16035
1945 CAMYDY010000012.1 GCA947254575_00947 gene open 16042-16788
1946 CAMYDY010000012.1 GCA947254575_00948 gene open 16798-17295 rnpA
1947 CAMYDY010000012.1 GCA947254575_00949 gene open 17292-17567 yidD
1948 CAMYDY010000012.1 GCA947254575_00950 gene open 17639-18937 tyrS
1949 CAMYDY010000012.1 GCA947254575_00951 gene open 19016-20437
1950 CAMYDY010000012.1 GCA947254575_00952 gene open 20785-22848
1951 CAMYDY010000012.1 GCA947254575_00953 gene open 22955-23689
1952 CAMYDY010000012.1 GCA947254575_00954 gene open 23902-24867
1953 CAMYDY010000012.1 GCA947254575_00956 gene open 25195-25743
1954 CAMYDY010000012.1 GCA947254575_00957 gene open 26058-26333
1955 CAMYDY010000012.1 GCA947254575_00958 gene open 26576-27532
1956 CAMYDY010000012.1 GCA947254575_00959 gene open 27603-28667
1957 CAMYDY010000012.1 GCA947254575_00960 gene open 28771-31797 secDF
1958 CAMYDY010000012.1 GCA947254575_00961 gene open 32704-34110 ltrA
1959 CAMYDY010000012.1 GCA947254575_00962 gene open 34505-35674
1960 CAMYDY010000012.1 GCA947254575_00963 gene open 36285-36494
1961 CAMYDY010000012.1 GCA947254575_00964 gene open 36507-36725
1962 CAMYDY010000012.1 GCA947254575_00965 gene open 36737-37033
1963 CAMYDY010000012.1 GCA947254575_00966 gene open 37030-37620
1964 CAMYDY010000012.1 GCA947254575_00967 gene open 37638-38054
1965 CAMYDY010000012.1 GCA947254575_00968 gene open 38076-38606
1966 CAMYDY010000012.1 GCA947254575_00969 gene open 38623-39897
1967 CAMYDY010000012.1 GCA947254575_00970 gene open 39924-40178
1968 CAMYDY010000012.1 GCA947254575_00971 gene open 40558-41352
1969 CAMYDY010000012.1 GCA947254575_00972 gene open 41336-42184
1970 CAMYDY010000012.1 GCA947254575_00973 gene open 42304-42813 rrrD
1971 CAMYDY010000012.1 GCA947254575_00974 gene open 42797-43225
1972 CAMYDY010000012.1 GCA947254575_00975 gene open 43279-44133
1973 CAMYDY010000012.1 GCA947254575_00976 gene open 44133-44717 traO
1974 CAMYDY010000012.1 GCA947254575_00977 gene open 44719-45639 traN
1975 CAMYDY010000012.1 GCA947254575_00978 gene open 45678-47045 traM
1976 CAMYDY010000012.1 GCA947254575_00979 gene open 46996-47328
1977 CAMYDY010000012.1 GCA947254575_00980 gene open 47325-47948 traK
1978 CAMYDY010000012.1 GCA947254575_00981 gene open 47968-49044 traJ
1979 CAMYDY010000012.1 GCA947254575_00982 gene open 49047-49676
1980 CAMYDY010000012.1 GCA947254575_00983 gene open 49826-52312 traC
1981 CAMYDY010000012.1 GCA947254575_00984 gene open 52309-52686 traF
1982 CAMYDY010000012.1 GCA947254575_00985 gene open 52691-52990 traE
1983 CAMYDY010000012.1 GCA947254575_00986 gene open 53133-53738
1984 CAMYDY010000012.1 GCA947254575_00987 gene open 53726-54466
1985 CAMYDY010000012.1 GCA947254575_00988 gene open 54496-55086 traD
1986 CAMYDY010000012.1 GCA947254575_00989 gene open 55083-55433
1987 CAMYDY010000012.1 GCA947254575_00990 gene open 55459-55887
1988 CAMYDY010000012.1 GCA947254575_00991 gene open 55871-56653
1989 CAMYDY010000012.1 GCA947254575_00992 gene open 57450-57863 mobA
1990 CAMYDY010000012.1 GCA947254575_00993 gene open 57848-59083
1991 CAMYDY010000012.1 GCA947254575_00994 gene open 59268-61277 virD4
1992 CAMYDY010000012.1 GCA947254575_00995 gene open 61342-61785
1993 CAMYDY010000012.1 GCA947254575_00996 gene open 61980-62615 labA
1994 CAMYDY010000012.1 GCA947254575_00997 gene open 62720-63085 rteC
1995 CAMYDY010000012.1 GCA947254575_00955 gene open 24939-25009 trnQ
1996 CAMYDY010000012.1 GCA947254575_00955 tRNA open 24939-25009 trnQ tRNA-Gln(ttg)
1997 CAMYDY010000013.1 GCA947254575_00998 CDS open 114-221 _na     35_aa hypothetical protein
1998 CAMYDY010000013.1 GCA947254575_00999 CDS open 237-635 _na     132_aa hypothetical protein
1999 CAMYDY010000013.1 GCA947254575_01000 CDS open 731-1666 _na     311_aa trxB thioredoxin-disulfide reductase
2000 CAMYDY010000013.1 GCA947254575_01001 CDS open 1841-2947 _na     368_aa bifunctional methionine sulfoxide reductase B/A protein