BAKTAGenome Explorer: Neisseria polysaccharea (GCA_962715145.1)
Select a Genome:
|
BAKTA Annotations for GCA_962715145.1
|
Search & Sort all 4062 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1501 | CAUIXS010000005.1 | GCA962715145_00687 | gene | open | 18435-19346 | cysW | ||
| 1502 | CAUIXS010000005.1 | GCA962715145_00688 | gene | open | 19487-20560 | cysA | ||
| 1503 | CAUIXS010000005.1 | GCA962715145_00689 | gene | open | 20616-22142 | ilvA | ||
| 1504 | CAUIXS010000005.1 | GCA962715145_00690 | gene | open | 22290-23459 | dacC | ||
| 1505 | CAUIXS010000005.1 | GCA962715145_00691 | gene | open | 23621-26272 | |||
| 1506 | CAUIXS010000005.1 | GCA962715145_00692 | gene | open | 26342-27955 | |||
| 1507 | CAUIXS010000005.1 | GCA962715145_00693 | gene | open | 28615-29187 | rplY | ||
| 1508 | CAUIXS010000005.1 | GCA962715145_00694 | gene | open | 29254-30237 | prs | ||
| 1509 | CAUIXS010000005.1 | GCA962715145_00697 | gene | open | 30572-31417 | ispE | ||
| 1510 | CAUIXS010000005.1 | GCA962715145_00698 | gene | open | 31427-32008 | lolB | ||
| 1511 | CAUIXS010000005.1 | GCA962715145_00699 | gene | open | 32163-34007 | |||
| 1512 | CAUIXS010000005.1 | GCA962715145_00700 | gene | open | 34167-35003 | panC | ||
| 1513 | CAUIXS010000005.1 | GCA962715145_00701 | gene | open | 35126-35917 | panB | ||
| 1514 | CAUIXS010000005.1 | GCA962715145_00704 | gene | open | 36410-37201 | speE | ||
| 1515 | CAUIXS010000005.1 | GCA962715145_00705 | gene | open | 37256-37897 | |||
| 1516 | CAUIXS010000005.1 | GCA962715145_00706 | gene | open | 38207-39130 | rluA | ||
| 1517 | CAUIXS010000005.1 | GCA962715145_00707 | gene | open | 39279-39632 | |||
| 1518 | CAUIXS010000005.1 | GCA962715145_00708 | gene | open | 39692-40168 | |||
| 1519 | CAUIXS010000005.1 | GCA962715145_00709 | gene | open | 40478-41773 | hisS | ||
| 1520 | CAUIXS010000005.1 | GCA962715145_00710 | gene | open | 41774-42403 | yfgM | ||
| 1521 | CAUIXS010000005.1 | GCA962715145_00711 | gene | open | 42404-44011 | der | ||
| 1522 | CAUIXS010000005.1 | GCA962715145_00712 | gene | open | 44042-44941 | rdgC | ||
| 1523 | CAUIXS010000005.1 | GCA962715145_00713 | gene | open | 45003-45419 | |||
| 1524 | CAUIXS010000005.1 | GCA962715145_00714 | gene | open | 45485-46051 | dcd | ||
| 1525 | CAUIXS010000005.1 | GCA962715145_00715 | gene | open | 46115-46819 | |||
| 1526 | CAUIXS010000005.1 | GCA962715145_00716 | gene | open | 47021-47980 | phoH | ||
| 1527 | CAUIXS010000005.1 | GCA962715145_00717 | gene | open | 48045-48212 | |||
| 1528 | CAUIXS010000005.1 | GCA962715145_00718 | gene | open | 48556-48753 | |||
| 1529 | CAUIXS010000005.1 | GCA962715145_00719 | gene | open | 48737-49174 | |||
| 1530 | CAUIXS010000005.1 | GCA962715145_00720 | gene | open | 49333-49830 | |||
| 1531 | CAUIXS010000005.1 | GCA962715145_00721 | gene | open | 50324-50662 | |||
| 1532 | CAUIXS010000005.1 | GCA962715145_00722 | gene | open | 51358-52713 | pcnB | ||
| 1533 | CAUIXS010000005.1 | GCA962715145_00723 | gene | open | 53146-54846 | recJ | ||
| 1534 | CAUIXS010000005.1 | GCA962715145_00724 | gene | open | 54915-55628 | |||
| 1535 | CAUIXS010000005.1 | GCA962715145_00725 | gene | open | 55675-56181 | yjgA | ||
| 1536 | CAUIXS010000005.1 | GCA962715145_00726 | gene | open | 56336-57667 | pmbA | ||
| 1537 | CAUIXS010000005.1 | GCA962715145_00727 | gene | open | 58146-58349 | cspC | ||
| 1538 | CAUIXS010000005.1 | GCA962715145_00728 | gene | open | 58558-58896 | clpS | ||
| 1539 | CAUIXS010000005.1 | GCA962715145_00729 | gene | open | 58898-61189 | clpA | ||
| 1540 | CAUIXS010000005.1 | GCA962715145_00730 | gene | open | 61229-64327 | |||
| 1541 | CAUIXS010000005.1 | GCA962715145_00731 | gene | open | 64755-65996 | |||
| 1542 | CAUIXS010000005.1 | GCA962715145_00732 | gene | open | 66160-67011 | dinD | ||
| 1543 | CAUIXS010000005.1 | GCA962715145_00733 | gene | open | 67128-68672 | hsdM | ||
| 1544 | CAUIXS010000005.1 | GCA962715145_00734 | gene | open | 68746-69750 | rfaD | ||
| 1545 | CAUIXS010000005.1 | GCA962715145_00735 | gene | open | 69817-70776 | rfaE | ||
| 1546 | CAUIXS010000005.1 | GCA962715145_00736 | gene | open | 70881-71273 | |||
| 1547 | CAUIXS010000005.1 | GCA962715145_00737 | gene | open | 71369-72100 | pyrF | ||
| 1548 | CAUIXS010000005.1 | GCA962715145_00738 | gene | open | 72206-72853 | adk | ||
| 1549 | CAUIXS010000005.1 | GCA962715145_00739 | gene | open | 73068-73907 | htpX | ||
| 1550 | CAUIXS010000005.1 | GCA962715145_00740 | gene | open | 74144-75442 | purA | ||
| 1551 | CAUIXS010000005.1 | GCA962715145_00741 | gene | open | 75545-76696 | hisZ | ||
| 1552 | CAUIXS010000005.1 | GCA962715145_00742 | gene | open | 77031-78410 | norM | ||
| 1553 | CAUIXS010000005.1 | GCA962715145_00743 | gene | open | 78413-79495 | murB | ||
| 1554 | CAUIXS010000005.1 | GCA962715145_00744 | gene | open | 79513-80157 | acrR | ||
| 1555 | CAUIXS010000005.1 | GCA962715145_00745 | gene | open | 80835-81620 | |||
| 1556 | CAUIXS010000005.1 | GCA962715145_00746 | gene | open | 81674-82246 | |||
| 1557 | CAUIXS010000005.1 | GCA962715145_00747 | gene | open | 82266-83156 | nadK | ||
| 1558 | CAUIXS010000005.1 | GCA962715145_00748 | gene | open | 83181-83939 | rsuA | ||
| 1559 | CAUIXS010000005.1 | GCA962715145_00749 | gene | open | 83999-84664 | nfnB | ||
| 1560 | CAUIXS010000005.1 | GCA962715145_00750 | gene | open | 84860-85633 | folE2 | ||
| 1561 | CAUIXS010000005.1 | GCA962715145_00751 | gene | open | 85836-86993 | metC | ||
| 1562 | CAUIXS010000005.1 | GCA962715145_00752 | gene | open | 87057-88058 | hemB | ||
| 1563 | CAUIXS010000005.1 | GCA962715145_00753 | gene | open | 88203-88487 | yhbY | ||
| 1564 | CAUIXS010000005.1 | GCA962715145_00754 | gene | open | 88598-89218 | rlmE | ||
| 1565 | CAUIXS010000005.1 | GCA962715145_00755 | gene | open | 89282-91249 | ftsH | ||
| 1566 | CAUIXS010000005.1 | GCA962715145_00756 | gene | open | 91464-91901 | pasT | ||
| 1567 | CAUIXS010000005.1 | GCA962715145_00757 | gene | open | 91894-92172 | rnfH | ||
| 1568 | CAUIXS010000005.1 | GCA962715145_00758 | gene | open | 92207-92797 | pth | ||
| 1569 | CAUIXS010000005.1 | GCA962715145_00759 | gene | open | 92794-93063 | |||
| 1570 | CAUIXS010000005.1 | GCA962715145_00760 | gene | open | 93060-93419 | vanZ | ||
| 1571 | CAUIXS010000005.1 | GCA962715145_00761 | gene | open | 93648-95063 | citT | ||
| 1572 | CAUIXS010000005.1 | GCA962715145_00762 | gene | open | 95169-95678 | ppiB | ||
| 1573 | CAUIXS010000005.1 | GCA962715145_00763 | gene | open | 95785-97167 | pgm | ||
| 1574 | CAUIXS010000005.1 | GCA962715145_00764 | gene | open | 97222-97977 | glnQ | ||
| 1575 | CAUIXS010000005.1 | GCA962715145_00765 | gene | open | 97987-98511 | hisM | ||
| 1576 | CAUIXS010000005.1 | GCA962715145_00766 | gene | open | 98493-98702 | |||
| 1577 | CAUIXS010000005.1 | GCA962715145_00767 | gene | open | 98692-99516 | hisJ | ||
| 1578 | CAUIXS010000005.1 | GCA962715145_00768 | gene | open | 99788-100696 | efeB | ||
| 1579 | CAUIXS010000005.1 | GCA962715145_00769 | gene | open | 100929-104543 | recB | ||
| 1580 | CAUIXS010000005.1 | GCA962715145_00770 | gene | open | 104582-104941 | pspE | ||
| 1581 | CAUIXS010000005.1 | GCA962715145_00771 | gene | open | 105066-105545 | |||
| 1582 | CAUIXS010000005.1 | GCA962715145_00772 | gene | open | 105821-107200 | radA | ||
| 1583 | CAUIXS010000005.1 | GCA962715145_00773 | gene | open | 107388-108452 | hemE | ||
| 1584 | CAUIXS010000005.1 | GCA962715145_00774 | gene | open | 108784-109050 | |||
| 1585 | CAUIXS010000005.1 | GCA962715145_00775 | gene | open | 109083-110306 | hemYx | ||
| 1586 | CAUIXS010000005.1 | GCA962715145_00776 | gene | open | 110303-111637 | |||
| 1587 | CAUIXS010000005.1 | GCA962715145_00777 | gene | open | 111652-112401 | hemD | ||
| 1588 | CAUIXS010000005.1 | GCA962715145_00778 | gene | open | 112423-112845 | |||
| 1589 | CAUIXS010000005.1 | GCA962715145_00779 | gene | open | 113016-113333 | |||
| 1590 | CAUIXS010000005.1 | GCA962715145_00780 | gene | open | 113356-113982 | upp | ||
| 1591 | CAUIXS010000005.1 | GCA962715145_00781 | gene | open | 113972-114088 | |||
| 1592 | CAUIXS010000005.1 | GCA962715145_00782 | gene | open | 114088-114399 | grxD | ||
| 1593 | CAUIXS010000005.1 | GCA962715145_00783 | gene | open | 114500-114706 | |||
| 1594 | CAUIXS010000005.1 | GCA962715145_00784 | gene | open | 114755-115534 | |||
| 1595 | CAUIXS010000005.1 | GCA962715145_00785 | gene | open | 115539-115889 | pilZ | ||
| 1596 | CAUIXS010000005.1 | GCA962715145_00786 | gene | open | 115893-116870 | holB | ||
| 1597 | CAUIXS010000005.1 | GCA962715145_00787 | gene | open | 116904-118034 | pilT | ||
| 1598 | CAUIXS010000005.1 | GCA962715145_00788 | gene | open | 118202-118903 | mtnN | ||
| 1599 | CAUIXS010000005.1 | GCA962715145_00789 | gene | open | 119045-120838 | lepA | ||
| 1600 | CAUIXS010000005.1 | GCA962715145_00790 | gene | open | 120983-122002 | lepB | ||
| 1601 | CAUIXS010000005.1 | GCA962715145_00791 | gene | open | 122310-123350 | rhaT | ||
| 1602 | CAUIXS010000005.1 | GCA962715145_00792 | gene | open | 123686-124618 | cysK | ||
| 1603 | CAUIXS010000005.1 | GCA962715145_00793 | gene | open | 124728-124817 | |||
| 1604 | CAUIXS010000005.1 | GCA962715145_00794 | gene | open | 124814-125419 | |||
| 1605 | CAUIXS010000005.1 | GCA962715145_00795 | gene | open | 125416-126267 | dapF | ||
| 1606 | CAUIXS010000005.1 | GCA962715145_00796 | gene | open | 126382-126669 | barS | ||
| 1607 | CAUIXS010000005.1 | GCA962715145_00797 | gene | open | 126860-127174 | |||
| 1608 | CAUIXS010000005.1 | GCA962715145_00798 | gene | open | 127171-127839 | dsbD | ||
| 1609 | CAUIXS010000005.1 | GCA962715145_00799 | gene | open | 127914-130034 | pnp | ||
| 1610 | CAUIXS010000005.1 | GCA962715145_00800 | gene | open | 130271-131134 | purC | ||
| 1611 | CAUIXS010000005.1 | GCA962715145_00801 | gene | open | 131334-132197 | rfbD | ||
| 1612 | CAUIXS010000005.1 | GCA962715145_00802 | gene | open | 132573-132806 | |||
| 1613 | CAUIXS010000005.1 | GCA962715145_00803 | gene | open | 132847-133080 | |||
| 1614 | CAUIXS010000005.1 | GCA962715145_00804 | gene | open | 133103-133564 | |||
| 1615 | CAUIXS010000005.1 | GCA962715145_00805 | gene | open | 133715-134017 | |||
| 1616 | CAUIXS010000005.1 | GCA962715145_00806 | gene | open | 134072-134209 | |||
| 1617 | CAUIXS010000005.1 | GCA962715145_00807 | gene | open | 134390-134590 | bfd | ||
| 1618 | CAUIXS010000005.1 | GCA962715145_00808 | gene | open | 134772-135647 | xerD | ||
| 1619 | CAUIXS010000005.1 | GCA962715145_00809 | gene | open | 135701-136138 | bcp | ||
| 1620 | CAUIXS010000005.1 | GCA962715145_00810 | gene | open | 136442-137380 | dacC | ||
| 1621 | CAUIXS010000005.1 | GCA962715145_00811 | gene | open | 137515-137808 | hfq | ||
| 1622 | CAUIXS010000005.1 | GCA962715145_00812 | gene | open | 137893-138459 | |||
| 1623 | CAUIXS010000005.1 | GCA962715145_00813 | gene | open | 138513-138887 | sirB2 | ||
| 1624 | CAUIXS010000005.1 | GCA962715145_00814 | gene | open | 138897-139391 | folK | ||
| 1625 | CAUIXS010000005.1 | GCA962715145_00815 | gene | open | 139518-139997 | nimA | ||
| 1626 | CAUIXS010000005.1 | GCA962715145_00816 | gene | open | 140217-140954 | ubiE | ||
| 1627 | CAUIXS010000005.1 | GCA962715145_00817 | gene | open | 140997-141365 | gBBH | ||
| 1628 | CAUIXS010000005.1 | GCA962715145_00670 | gene | open | 7023-7112 | trnS | ||
| 1629 | CAUIXS010000005.1 | GCA962715145_00671 | gene | open | 7191-7281 | trnS | ||
| 1630 | CAUIXS010000005.1 | GCA962715145_00695 | gene | open | 30405-30480 | trnQ | ||
| 1631 | CAUIXS010000005.1 | GCA962715145_00696 | gene | open | 30489-30564 | trnQ | ||
| 1632 | CAUIXS010000005.1 | GCA962715145_00702 | gene | open | 36059-36134 | trnT | ||
| 1633 | CAUIXS010000005.1 | GCA962715145_00703 | gene | open | 36169-36244 | trnT | ||
| 1634 | CAUIXS010000005.1 | GCA962715145_00670 | tRNA | open | 7023-7112 | trnS | tRNA-Ser(cga) | |
| 1635 | CAUIXS010000005.1 | GCA962715145_00671 | tRNA | open | 7191-7281 | trnS | tRNA-Ser(tga) | |
| 1636 | CAUIXS010000005.1 | GCA962715145_00695 | tRNA | open | 30405-30480 | trnQ | tRNA-Gln(ttg) | |
| 1637 | CAUIXS010000005.1 | GCA962715145_00696 | tRNA | open | 30489-30564 | trnQ | tRNA-Gln(ttg) | |
| 1638 | CAUIXS010000005.1 | GCA962715145_00702 | tRNA | open | 36059-36134 | trnT | tRNA-Thr(tgt) | |
| 1639 | CAUIXS010000005.1 | GCA962715145_00703 | tRNA | open | 36169-36244 | trnT | tRNA-Thr(tgt) | |
| 1640 | CAUIXS010000006.1 | regulatory_region | open | 21310-21434 | Ribosomal S15 leader | |||
| 1641 | CAUIXS010000006.1 | repeat_region | open | 84781-92136 | CRISPR array with 111 repeats of length 32%2C consensus sequence TCAGCCGCCTTCAGGCGGCTGTGTGTTGAAAC and spacer length 34 | |||
| 1642 | CAUIXS010000006.1 | GCA962715145_00818 | CDS | open | 245-1180 | _na 311_aa | mntC | periplasmic binding protein MntC |
| 1643 | CAUIXS010000006.1 | GCA962715145_00819 | CDS | open | 1257-2132 | _na 291_aa | mntB | Manganese transport system membrane protein MntB |
| 1644 | CAUIXS010000006.1 | GCA962715145_00820 | CDS | open | 2156-2911 | _na 251_aa | mntA | ABC transporter ATP-binding protein MntA |
| 1645 | CAUIXS010000006.1 | GCA962715145_00821 | CDS | open | 3199-3564 | _na 121_aa | rplS | 50S ribosomal protein L19 |
| 1646 | CAUIXS010000006.1 | GCA962715145_00822 | CDS | open | 3580-4329 | _na 249_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 1647 | CAUIXS010000006.1 | GCA962715145_00823 | CDS | open | 4329-4838 | _na 169_aa | rimM | ribosome maturation factor RimM |
| 1648 | CAUIXS010000006.1 | GCA962715145_00824 | CDS | open | 4854-5099 | _na 81_aa | rpsP | 30S ribosomal protein S16 |
| 1649 | CAUIXS010000006.1 | GCA962715145_00825 | CDS | open | 5145-7571 | _na 808_aa | rimL | N-acetyltransferase domain-containing protein |
| 1650 | CAUIXS010000006.1 | GCA962715145_00826 | CDS | open | 7689-9095 | _na 468_aa | baeS | histidine kinase |
| 1651 | CAUIXS010000006.1 | GCA962715145_00827 | CDS | open | 9108-9785 | _na 225_aa | ompR | Response regulator transcription factor |
| 1652 | CAUIXS010000006.1 | GCA962715145_00828 | CDS | open | 9975-11789 | _na 604_aa | rfaL | Integral membrane protein |
| 1653 | CAUIXS010000006.1 | GCA962715145_00829 | CDS | open | 11779-12132 | _na 117_aa | DUF2069 domain-containing protein | |
| 1654 | CAUIXS010000006.1 | GCA962715145_00830 | CDS | open | 12141-12749 | _na 202_aa | maf | dTTP/UTP pyrophosphatase |
| 1655 | CAUIXS010000006.1 | GCA962715145_00831 | CDS | open | 12802-13572 | _na 256_aa | tatC | twin-arginine translocase subunit TatC |
| 1656 | CAUIXS010000006.1 | GCA962715145_00832 | CDS | open | 13587-14273 | _na 228_aa | tatB | Sec-independent protein translocase protein TatB |
| 1657 | CAUIXS010000006.1 | GCA962715145_00833 | CDS | open | 14277-14480 | _na 67_aa | tatA | Sec-independent protein translocase subunit TatA |
| 1658 | CAUIXS010000006.1 | GCA962715145_00834 | CDS | open | 14528-14851 | _na 107_aa | hitA | Protein HitA |
| 1659 | CAUIXS010000006.1 | GCA962715145_00835 | CDS | open | 14923-15246 | _na 107_aa | phosphoribosyl-ATP diphosphatase | |
| 1660 | CAUIXS010000006.1 | GCA962715145_00836 | CDS | open | 15387-16451 | _na 354_aa | budC | (R%2CR)-butanediol dehydrogenase |
| 1661 | CAUIXS010000006.1 | GCA962715145_00837 | CDS | open | 16656-17774 | _na 372_aa | acuC | Histone deacetylase 1 HD1 |
| 1662 | CAUIXS010000006.1 | GCA962715145_00838 | CDS | open | 17905-18171 | _na 88_aa | yajC | preprotein translocase subunit YajC |
| 1663 | CAUIXS010000006.1 | GCA962715145_00839 | CDS | open | 18383-20236 | _na 617_aa | secD | Protein translocase subunit SecD |
| 1664 | CAUIXS010000006.1 | GCA962715145_00840 | CDS | open | 20240-21175 | _na 311_aa | secF | Protein-export membrane protein SecF |
| 1665 | CAUIXS010000006.1 | GCA962715145_00841 | CDS | open | 21378-21647 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 1666 | CAUIXS010000006.1 | GCA962715145_00842 | CDS | open | 21924-23048 | _na 374_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 1667 | CAUIXS010000006.1 | GCA962715145_00843 | CDS | open | 23064-24029 | _na 321_aa | potB | ABC transporter permease%2C polyamine |
| 1668 | CAUIXS010000006.1 | GCA962715145_00844 | CDS | open | 24029-24916 | _na 295_aa | potC | Spermidine/putrescine ABC transporter%2C permease protein |
| 1669 | CAUIXS010000006.1 | GCA962715145_00845 | CDS | open | 25042-26337 | _na 431_aa | dadA | Oxidoreductase |
| 1670 | CAUIXS010000006.1 | GCA962715145_00846 | CDS | open | 26444-27703 | _na 419_aa | rho | transcription termination factor Rho |
| 1671 | CAUIXS010000006.1 | GCA962715145_00847 | CDS | open | 27927-30311 | _na 794_aa | ppsA | phosphoenolpyruvate synthase |
| 1672 | CAUIXS010000006.1 | GCA962715145_00848 | CDS | open | 30723-31544 | _na 273_aa | ppsR | Putative phosphoenolpyruvate synthase regulatory protein |
| 1673 | CAUIXS010000006.1 | GCA962715145_00849 | CDS | open | 31937-32599 | _na 220_aa | Phosphatase | |
| 1674 | CAUIXS010000006.1 | GCA962715145_00850 | CDS | open | 32596-33606 | _na 336_aa | czcD | Cation efflux protein cytoplasmic domain-containing protein |
| 1675 | CAUIXS010000006.1 | GCA962715145_00851 | CDS | open | 33652-34479 | _na 275_aa | Ferritin-like domain-containing protein | |
| 1676 | CAUIXS010000006.1 | GCA962715145_00852 | CDS | open | 34909-35532 | _na 207_aa | lolA | outer membrane lipoprotein chaperone LolA |
| 1677 | CAUIXS010000006.1 | GCA962715145_00853 | CDS | open | 35805-36944 | _na 379_aa | potD | Putrescine-binding periplasmic protein |
| 1678 | CAUIXS010000006.1 | GCA962715145_00854 | CDS | open | 37032-37409 | _na 125_aa | pglE | Glycosyltransferase PglE |
| 1679 | CAUIXS010000006.1 | GCA962715145_00855 | CDS | open | 37382-38140 | _na 252_aa | glycosyltransferase | |
| 1680 | CAUIXS010000006.1 | GCA962715145_00856 | CDS | open | 38181-38711 | _na 176_aa | paaY | Transferase |
| 1681 | CAUIXS010000006.1 | GCA962715145_00857 | CDS | open | 38965-39180 | _na 71_aa | hypothetical protein | |
| 1682 | CAUIXS010000006.1 | GCA962715145_00858 | CDS | open | 39084-40679 | _na 531_aa | prfC | peptide chain release factor 3 |
| 1683 | CAUIXS010000006.1 | GCA962715145_00859 | CDS | open | 40786-41181 | _na 131_aa | hisI | phosphoribosyl-AMP cyclohydrolase |
| 1684 | CAUIXS010000006.1 | GCA962715145_00860 | CDS | open | 41212-41979 | _na 255_aa | hisF | Imidazole glycerol phosphate synthase subunit HisF |
| 1685 | CAUIXS010000006.1 | GCA962715145_00861 | CDS | open | 41992-42729 | _na 245_aa | hisA | 1-(5-phosphoribosyl)-5-[(5-phosphoribosylamino)methylideneamino]imidazole-4-carboxamide isomerase |
| 1686 | CAUIXS010000006.1 | GCA962715145_00862 | CDS | open | 42762-43400 | _na 212_aa | hisH | imidazole glycerol phosphate synthase subunit HisH |
| 1687 | CAUIXS010000006.1 | GCA962715145_00863 | CDS | open | 43531-45033 | _na 500_aa | pta | phosphate acetyltransferase |
| 1688 | CAUIXS010000006.1 | GCA962715145_00864 | CDS | open | 45275-46339 | _na 354_aa | Fe(3+)-transporting ATPase | |
| 1689 | CAUIXS010000006.1 | GCA962715145_00865 | CDS | open | 46361-47878 | _na 505_aa | ABC transporter%2C permease protein | |
| 1690 | CAUIXS010000006.1 | GCA962715145_00866 | CDS | open | 47943-48938 | _na 331_aa | Major ferric iron binding protein | |
| 1691 | CAUIXS010000006.1 | GCA962715145_00867 | CDS | open | 49237-49707 | _na 156_aa | DUF4375 domain-containing protein | |
| 1692 | CAUIXS010000006.1 | GCA962715145_00868 | CDS | open | 49765-51141 | _na 458_aa | argH | argininosuccinate lyase |
| 1693 | CAUIXS010000006.1 | GCA962715145_00869 | CDS | open | 51160-52029 | _na 289_aa | galU | UTP--glucose-1-phosphate uridylyltransferase GalU |
| 1694 | CAUIXS010000006.1 | GCA962715145_00870 | CDS | open | 52057-52656 | _na 199_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 1695 | CAUIXS010000006.1 | GCA962715145_00871 | CDS | open | 52649-52882 | _na 77_aa | NGO_0222 family membrane protein | |
| 1696 | CAUIXS010000006.1 | GCA962715145_00872 | CDS | open | 52995-53528 | _na 177_aa | ppa | Inorganic pyrophosphatase |
| 1697 | CAUIXS010000006.1 | GCA962715145_00873 | CDS | open | 53630-54088 | _na 152_aa | nudB | dihydroneopterin triphosphate diphosphatase |
| 1698 | CAUIXS010000006.1 | GCA962715145_00875 | CDS | open | 54578-55009 | _na 143_aa | hypothetical protein | |
| 1699 | CAUIXS010000006.1 | GCA962715145_00876 | CDS | open | 55098-56555 | _na 485_aa | trkG | Trk system potassium uptake protein |
| 1700 | CAUIXS010000006.1 | GCA962715145_00877 | CDS | open | 56570-57400 | _na 276_aa | apaH | symmetrical bis(5'-nucleosyl)-tetraphosphatase |
| 1701 | CAUIXS010000006.1 | GCA962715145_00878 | CDS | open | 57478-57867 | _na 129_aa | ridA | Ribonuclease%2C putative |
| 1702 | CAUIXS010000006.1 | GCA962715145_00879 | CDS | open | 58004-58531 | _na 175_aa | nspA | outer membrane beta-barrel protein NspA |
| 1703 | CAUIXS010000006.1 | GCA962715145_00880 | CDS | open | 59060-60235 | _na 391_aa | hemW | radical SAM family heme chaperone HemW |
| 1704 | CAUIXS010000006.1 | GCA962715145_00881 | CDS | open | 60292-62817 | _na 841_aa | ligA | NAD-dependent DNA ligase LigA |
| 1705 | CAUIXS010000006.1 | GCA962715145_00882 | CDS | open | 62965-64251 | _na 428_aa | ftsN | Cell division protein ZipA |
| 1706 | CAUIXS010000006.1 | GCA962715145_00883 | CDS | open | 64445-65017 | _na 190_aa | ampD | 1%2C6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD |
| 1707 | CAUIXS010000006.1 | GCA962715145_00884 | CDS | open | 65101-66096 | _na 331_aa | mltG | Endolytic murein transglycosylase |
| 1708 | CAUIXS010000006.1 | GCA962715145_00885 | CDS | open | 66156-66776 | _na 206_aa | tmk | dTMP kinase |
| 1709 | CAUIXS010000006.1 | GCA962715145_00886 | CDS | open | 66998-68278 | _na 426_aa | sfcA | Malic enzyme |
| 1710 | CAUIXS010000006.1 | GCA962715145_00887 | CDS | open | 68367-68639 | _na 90_aa | Integral membrane protein | |
| 1711 | CAUIXS010000006.1 | GCA962715145_00888 | CDS | open | 68678-69715 | _na 345_aa | lpxK | tetraacyldisaccharide 4'-kinase |
| 1712 | CAUIXS010000006.1 | GCA962715145_00889 | CDS | open | 69760-70299 | _na 179_aa | hypothetical protein | |
| 1713 | CAUIXS010000006.1 | GCA962715145_00890 | CDS | open | 70411-70980 | _na 189_aa | DUF2059 domain-containing protein | |
| 1714 | CAUIXS010000006.1 | GCA962715145_00891 | CDS | open | 71209-71391 | _na 60_aa | trm112 | UPF0434 protein NMA0874 |
| 1715 | CAUIXS010000006.1 | GCA962715145_00892 | CDS | open | 71388-72149 | _na 253_aa | kdsB | 3-deoxy-manno-octulosonate cytidylyltransferase |
| 1716 | CAUIXS010000006.1 | GCA962715145_00893 | CDS | open | 72172-72687 | _na 171_aa | 3-deoxy-manno-octulosonate cytidylyltransferase | |
| 1717 | CAUIXS010000006.1 | GCA962715145_00895 | CDS | open | 73242-74027 | _na 261_aa | trpA | tryptophan synthase subunit alpha |
| 1718 | CAUIXS010000006.1 | GCA962715145_00896 | CDS | open | 74064-74936 | _na 290_aa | accD | acetyl-CoA carboxylase%2C carboxyltransferase subunit beta |
| 1719 | CAUIXS010000006.1 | GCA962715145_00897 | CDS | open | 74995-75606 | _na 203_aa | clpB | Clp protease ClpB |
| 1720 | CAUIXS010000006.1 | GCA962715145_00898 | CDS | open | 75714-75938 | _na 74_aa | tusA | Putative sulfur carrier protein NMB0681 |
| 1721 | CAUIXS010000006.1 | GCA962715145_00899 | CDS | open | 75969-76544 | _na 191_aa | NMCC_0638 family (lipo)protein | |
| 1722 | CAUIXS010000006.1 | GCA962715145_00900 | CDS | open | 76605-77639 | _na 344_aa | pyrC | dihydroorotase |
| 1723 | CAUIXS010000006.1 | GCA962715145_00901 | CDS | open | 77658-78134 | _na 158_aa | hypothetical protein | |
| 1724 | CAUIXS010000006.1 | GCA962715145_00902 | CDS | open | 78305-78730 | _na 141_aa | nusB | transcription antitermination factor NusB |
| 1725 | CAUIXS010000006.1 | GCA962715145_00903 | CDS | open | 78808-79284 | _na 158_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 1726 | CAUIXS010000006.1 | GCA962715145_00904 | CDS | open | 79339-79662 | _na 107_aa | DUF2185 domain-containing protein | |
| 1727 | CAUIXS010000006.1 | GCA962715145_00905 | CDS | open | 79829-80548 | _na 239_aa | rnc | ribonuclease III |
| 1728 | CAUIXS010000006.1 | GCA962715145_00906 | CDS | open | 80585-81520 | _na 311_aa | era | GTPase Era |
| 1729 | CAUIXS010000006.1 | GCA962715145_00907 | CDS | open | 81779-82057 | _na 92_aa | hypothetical protein | |
| 1730 | CAUIXS010000006.1 | GCA962715145_00908 | CDS | open | 82074-82676 | _na 200_aa | hypothetical protein | |
| 1731 | CAUIXS010000006.1 | GCA962715145_00909 | CDS | open | 83230-84243 | _na 337_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 1732 | CAUIXS010000006.1 | GCA962715145_00910 | CDS | open | 84250-84591 | _na 113_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 1733 | CAUIXS010000006.1 | GCA962715145_00911 | CDS | open | 92392-93102 | _na 236_aa | Integrase core domain | |
| 1734 | CAUIXS010000006.1 | GCA962715145_00912 | CDS | open | 93363-94016 | _na 217_aa | tnp | IS1595 family transposase |
| 1735 | CAUIXS010000006.1 | GCA962715145_00913 | CDS | open | 95044-95667 | _na 207_aa | phosphoribosylanthranilate isomerase | |
| 1736 | CAUIXS010000006.1 | GCA962715145_00914 | CDS | open | 95726-96217 | _na 163_aa | greB | transcription elongation factor GreB |
| 1737 | CAUIXS010000006.1 | GCA962715145_00915 | CDS | open | 96317-97861 | _na 514_aa | purF | amidophosphoribosyltransferase |
| 1738 | CAUIXS010000006.1 | GCA962715145_00916 | CDS | open | 98069-98566 | _na 165_aa | Bacteriocin production protein | |
| 1739 | CAUIXS010000006.1 | GCA962715145_00917 | CDS | open | 98559-99581 | _na 340_aa | ftsN | cell division protein FtsN |
| 1740 | CAUIXS010000006.1 | GCA962715145_00918 | CDS | open | 99594-100868 | _na 424_aa | folC | bifunctional tetrahydrofolate synthase/dihydrofolate synthase |
| 1741 | CAUIXS010000006.1 | GCA962715145_00919 | CDS | open | 100898-101338 | _na 146_aa | folI | FolI protein |
| 1742 | CAUIXS010000006.1 | GCA962715145_00920 | CDS | open | 101343-101702 | _na 119_aa | VacJ-like protein | |
| 1743 | CAUIXS010000006.1 | GCA962715145_00921 | CDS | open | 101775-102512 | _na 245_aa | glnQ | Glutamine ABC transporter%2C ATP-binding protein GlnQ |
| 1744 | CAUIXS010000006.1 | GCA962715145_00922 | CDS | open | 102545-103000 | _na 151_aa | Lipoprotein | |
| 1745 | CAUIXS010000006.1 | GCA962715145_00923 | CDS | open | 103113-103682 | _na 189_aa | RelA/SpoT domain-containing protein | |
| 1746 | CAUIXS010000006.1 | GCA962715145_00924 | CDS | open | 103698-104477 | _na 259_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 1747 | CAUIXS010000006.1 | GCA962715145_00925 | CDS | open | 104716-105618 | _na 300_aa | Putative membrane protein | |
| 1748 | CAUIXS010000006.1 | GCA962715145_00926 | CDS | open | 105636-106283 | _na 215_aa | Uracil-DNA glycosylase family protein | |
| 1749 | CAUIXS010000006.1 | GCA962715145_00927 | CDS | open | 106466-107668 | _na 400_aa | trpB | tryptophan synthase subunit beta |
| 1750 | CAUIXS010000006.1 | GCA962715145_00928 | CDS | open | 107761-108102 | _na 113_aa | hypothetical protein | |
| 1751 | CAUIXS010000006.1 | GCA962715145_00929 | CDS | open | 108370-110652 | _na 760_aa | comA | DNA internalization-related competence protein ComEC/Rec2 |
| 1752 | CAUIXS010000006.1 | GCA962715145_00930 | CDS | open | 110875-111678 | _na 267_aa | bamD | Outer membrane protein assembly factor BamD |
| 1753 | CAUIXS010000006.1 | GCA962715145_00931 | CDS | open | 111731-112801 | _na 356_aa | rluD | 23S rRNA pseudouridine(1911/1915/1917) synthase RluD |
| 1754 | CAUIXS010000006.1 | GCA962715145_00932 | CDS | open | 112954-113901 | _na 315_aa | yfeH | Transporter |
| 1755 | CAUIXS010000006.1 | GCA962715145_00933 | CDS | open | 114343-115122 | _na 259_aa | pgeF | peptidoglycan editing factor PgeF |
| 1756 | CAUIXS010000006.1 | GCA962715145_00934 | CDS | open | 115174-115653 | _na 159_aa | lptE | LPS-assembly lipoprotein LptE |
| 1757 | CAUIXS010000006.1 | GCA962715145_00935 | CDS | open | 115655-116653 | _na 332_aa | holA | DNA polymerase III subunit delta |
| 1758 | CAUIXS010000006.1 | GCA962715145_00936 | CDS | open | 116774-117193 | _na 139_aa | Magnesium transporter | |
| 1759 | CAUIXS010000006.1 | GCA962715145_00937 | CDS | open | 117218-117784 | _na 188_aa | yckC | RDD domain-containing protein |
| 1760 | CAUIXS010000006.1 | GCA962715145_00938 | CDS | open | 117868-118749 | _na 293_aa | yicC | Protein YicC |
| 1761 | CAUIXS010000006.1 | GCA962715145_00939 | CDS | open | 119199-120062 | _na 287_aa | rpoH | RNA polymerase sigma factor RpoH |
| 1762 | CAUIXS010000006.1 | GCA962715145_00940 | CDS | open | 120326-121864 | _na 512_aa | lnt | apolipoprotein N-acyltransferase |
| 1763 | CAUIXS010000006.1 | GCA962715145_00941 | CDS | open | 121956-122711 | _na 251_aa | hypothetical protein | |
| 1764 | CAUIXS010000006.1 | GCA962715145_00942 | CDS | open | 122736-123005 | _na 89_aa | hypothetical protein | |
| 1765 | CAUIXS010000006.1 | GCA962715145_00943 | CDS | open | 123057-123347 | _na 96_aa | Potassium/proton antiporter | |
| 1766 | CAUIXS010000006.1 | GCA962715145_00944 | CDS | open | 123410-123811 | _na 133_aa | Cytochrome c552 | |
| 1767 | CAUIXS010000006.1 | GCA962715145_00945 | CDS | open | 124002-125084 | _na 360_aa | hemH | ferrochelatase |
| 1768 | CAUIXS010000006.1 | GCA962715145_00946 | CDS | open | 125094-126209 | _na 371_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 1769 | CAUIXS010000006.1 | GCA962715145_00948 | CDS | open | 126518-128431 | _na 637_aa | thrS | threonine--tRNA ligase |
| 1770 | CAUIXS010000006.1 | GCA962715145_00949 | CDS | open | 128566-128970 | _na 134_aa | infC | translation initiation factor IF-3 |
| 1771 | CAUIXS010000006.1 | GCA962715145_00950 | CDS | open | 129117-129314 | _na 65_aa | infC | translation initiation factor IF-3 |
| 1772 | CAUIXS010000006.1 | GCA962715145_00951 | CDS | open | 129327-129686 | _na 119_aa | rplT | 50S ribosomal protein L20 |
| 1773 | CAUIXS010000006.1 | GCA962715145_00952 | CDS | open | 129861-130919 | _na 352_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 1774 | CAUIXS010000006.1 | GCA962715145_00953 | CDS | open | 131004-131984 | _na 326_aa | hrgA | HrgA protein |
| 1775 | CAUIXS010000006.1 | GCA962715145_00954 | CDS | open | 132066-134429 | _na 787_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 1776 | CAUIXS010000006.1 | GCA962715145_00955 | CDS | open | 134503-134805 | _na 100_aa | ihfA | integration host factor subunit alpha |
| 1777 | CAUIXS010000006.1 | GCA962715145_00956 | CDS | open | 134789-135097 | _na 102_aa | hypothetical protein | |
| 1778 | CAUIXS010000006.1 | GCA962715145_00818 | gene | open | 245-1180 | mntC | ||
| 1779 | CAUIXS010000006.1 | GCA962715145_00819 | gene | open | 1257-2132 | mntB | ||
| 1780 | CAUIXS010000006.1 | GCA962715145_00820 | gene | open | 2156-2911 | mntA | ||
| 1781 | CAUIXS010000006.1 | GCA962715145_00821 | gene | open | 3199-3564 | rplS | ||
| 1782 | CAUIXS010000006.1 | GCA962715145_00822 | gene | open | 3580-4329 | trmD | ||
| 1783 | CAUIXS010000006.1 | GCA962715145_00823 | gene | open | 4329-4838 | rimM | ||
| 1784 | CAUIXS010000006.1 | GCA962715145_00824 | gene | open | 4854-5099 | rpsP | ||
| 1785 | CAUIXS010000006.1 | GCA962715145_00825 | gene | open | 5145-7571 | rimL | ||
| 1786 | CAUIXS010000006.1 | GCA962715145_00826 | gene | open | 7689-9095 | baeS | ||
| 1787 | CAUIXS010000006.1 | GCA962715145_00827 | gene | open | 9108-9785 | ompR | ||
| 1788 | CAUIXS010000006.1 | GCA962715145_00828 | gene | open | 9975-11789 | rfaL | ||
| 1789 | CAUIXS010000006.1 | GCA962715145_00829 | gene | open | 11779-12132 | |||
| 1790 | CAUIXS010000006.1 | GCA962715145_00830 | gene | open | 12141-12749 | maf | ||
| 1791 | CAUIXS010000006.1 | GCA962715145_00831 | gene | open | 12802-13572 | tatC | ||
| 1792 | CAUIXS010000006.1 | GCA962715145_00832 | gene | open | 13587-14273 | tatB | ||
| 1793 | CAUIXS010000006.1 | GCA962715145_00833 | gene | open | 14277-14480 | tatA | ||
| 1794 | CAUIXS010000006.1 | GCA962715145_00834 | gene | open | 14528-14851 | hitA | ||
| 1795 | CAUIXS010000006.1 | GCA962715145_00835 | gene | open | 14923-15246 | |||
| 1796 | CAUIXS010000006.1 | GCA962715145_00836 | gene | open | 15387-16451 | budC | ||
| 1797 | CAUIXS010000006.1 | GCA962715145_00837 | gene | open | 16656-17774 | acuC | ||
| 1798 | CAUIXS010000006.1 | GCA962715145_00838 | gene | open | 17905-18171 | yajC | ||
| 1799 | CAUIXS010000006.1 | GCA962715145_00839 | gene | open | 18383-20236 | secD | ||
| 1800 | CAUIXS010000006.1 | GCA962715145_00840 | gene | open | 20240-21175 | secF | ||
| 1801 | CAUIXS010000006.1 | GCA962715145_00841 | gene | open | 21378-21647 | rpsO | ||
| 1802 | CAUIXS010000006.1 | GCA962715145_00842 | gene | open | 21924-23048 | potA | ||
| 1803 | CAUIXS010000006.1 | GCA962715145_00843 | gene | open | 23064-24029 | potB | ||
| 1804 | CAUIXS010000006.1 | GCA962715145_00844 | gene | open | 24029-24916 | potC | ||
| 1805 | CAUIXS010000006.1 | GCA962715145_00845 | gene | open | 25042-26337 | dadA | ||
| 1806 | CAUIXS010000006.1 | GCA962715145_00846 | gene | open | 26444-27703 | rho | ||
| 1807 | CAUIXS010000006.1 | GCA962715145_00847 | gene | open | 27927-30311 | ppsA | ||
| 1808 | CAUIXS010000006.1 | GCA962715145_00848 | gene | open | 30723-31544 | ppsR | ||
| 1809 | CAUIXS010000006.1 | GCA962715145_00849 | gene | open | 31937-32599 | |||
| 1810 | CAUIXS010000006.1 | GCA962715145_00850 | gene | open | 32596-33606 | czcD | ||
| 1811 | CAUIXS010000006.1 | GCA962715145_00851 | gene | open | 33652-34479 | |||
| 1812 | CAUIXS010000006.1 | GCA962715145_00852 | gene | open | 34909-35532 | lolA | ||
| 1813 | CAUIXS010000006.1 | GCA962715145_00853 | gene | open | 35805-36944 | potD | ||
| 1814 | CAUIXS010000006.1 | GCA962715145_00854 | gene | open | 37032-37409 | pglE | ||
| 1815 | CAUIXS010000006.1 | GCA962715145_00855 | gene | open | 37382-38140 | |||
| 1816 | CAUIXS010000006.1 | GCA962715145_00856 | gene | open | 38181-38711 | paaY | ||
| 1817 | CAUIXS010000006.1 | GCA962715145_00857 | gene | open | 38965-39180 | |||
| 1818 | CAUIXS010000006.1 | GCA962715145_00858 | gene | open | 39084-40679 | prfC | ||
| 1819 | CAUIXS010000006.1 | GCA962715145_00859 | gene | open | 40786-41181 | hisI | ||
| 1820 | CAUIXS010000006.1 | GCA962715145_00860 | gene | open | 41212-41979 | hisF | ||
| 1821 | CAUIXS010000006.1 | GCA962715145_00861 | gene | open | 41992-42729 | hisA | ||
| 1822 | CAUIXS010000006.1 | GCA962715145_00862 | gene | open | 42762-43400 | hisH | ||
| 1823 | CAUIXS010000006.1 | GCA962715145_00863 | gene | open | 43531-45033 | pta | ||
| 1824 | CAUIXS010000006.1 | GCA962715145_00864 | gene | open | 45275-46339 | |||
| 1825 | CAUIXS010000006.1 | GCA962715145_00865 | gene | open | 46361-47878 | |||
| 1826 | CAUIXS010000006.1 | GCA962715145_00866 | gene | open | 47943-48938 | |||
| 1827 | CAUIXS010000006.1 | GCA962715145_00867 | gene | open | 49237-49707 | |||
| 1828 | CAUIXS010000006.1 | GCA962715145_00868 | gene | open | 49765-51141 | argH | ||
| 1829 | CAUIXS010000006.1 | GCA962715145_00869 | gene | open | 51160-52029 | galU | ||
| 1830 | CAUIXS010000006.1 | GCA962715145_00870 | gene | open | 52057-52656 | rdgB | ||
| 1831 | CAUIXS010000006.1 | GCA962715145_00871 | gene | open | 52649-52882 | |||
| 1832 | CAUIXS010000006.1 | GCA962715145_00872 | gene | open | 52995-53528 | ppa | ||
| 1833 | CAUIXS010000006.1 | GCA962715145_00873 | gene | open | 53630-54088 | nudB | ||
| 1834 | CAUIXS010000006.1 | GCA962715145_00875 | gene | open | 54578-55009 | |||
| 1835 | CAUIXS010000006.1 | GCA962715145_00876 | gene | open | 55098-56555 | trkG | ||
| 1836 | CAUIXS010000006.1 | GCA962715145_00877 | gene | open | 56570-57400 | apaH | ||
| 1837 | CAUIXS010000006.1 | GCA962715145_00878 | gene | open | 57478-57867 | ridA | ||
| 1838 | CAUIXS010000006.1 | GCA962715145_00879 | gene | open | 58004-58531 | nspA | ||
| 1839 | CAUIXS010000006.1 | GCA962715145_00880 | gene | open | 59060-60235 | hemW | ||
| 1840 | CAUIXS010000006.1 | GCA962715145_00881 | gene | open | 60292-62817 | ligA | ||
| 1841 | CAUIXS010000006.1 | GCA962715145_00882 | gene | open | 62965-64251 | ftsN | ||
| 1842 | CAUIXS010000006.1 | GCA962715145_00883 | gene | open | 64445-65017 | ampD | ||
| 1843 | CAUIXS010000006.1 | GCA962715145_00884 | gene | open | 65101-66096 | mltG | ||
| 1844 | CAUIXS010000006.1 | GCA962715145_00885 | gene | open | 66156-66776 | tmk | ||
| 1845 | CAUIXS010000006.1 | GCA962715145_00886 | gene | open | 66998-68278 | sfcA | ||
| 1846 | CAUIXS010000006.1 | GCA962715145_00887 | gene | open | 68367-68639 | |||
| 1847 | CAUIXS010000006.1 | GCA962715145_00888 | gene | open | 68678-69715 | lpxK | ||
| 1848 | CAUIXS010000006.1 | GCA962715145_00889 | gene | open | 69760-70299 | |||
| 1849 | CAUIXS010000006.1 | GCA962715145_00890 | gene | open | 70411-70980 | |||
| 1850 | CAUIXS010000006.1 | GCA962715145_00891 | gene | open | 71209-71391 | trm112 | ||
| 1851 | CAUIXS010000006.1 | GCA962715145_00892 | gene | open | 71388-72149 | kdsB | ||
| 1852 | CAUIXS010000006.1 | GCA962715145_00893 | gene | open | 72172-72687 | |||
| 1853 | CAUIXS010000006.1 | GCA962715145_00895 | gene | open | 73242-74027 | trpA | ||
| 1854 | CAUIXS010000006.1 | GCA962715145_00896 | gene | open | 74064-74936 | accD | ||
| 1855 | CAUIXS010000006.1 | GCA962715145_00897 | gene | open | 74995-75606 | clpB | ||
| 1856 | CAUIXS010000006.1 | GCA962715145_00898 | gene | open | 75714-75938 | tusA | ||
| 1857 | CAUIXS010000006.1 | GCA962715145_00899 | gene | open | 75969-76544 | |||
| 1858 | CAUIXS010000006.1 | GCA962715145_00900 | gene | open | 76605-77639 | pyrC | ||
| 1859 | CAUIXS010000006.1 | GCA962715145_00901 | gene | open | 77658-78134 | |||
| 1860 | CAUIXS010000006.1 | GCA962715145_00902 | gene | open | 78305-78730 | nusB | ||
| 1861 | CAUIXS010000006.1 | GCA962715145_00903 | gene | open | 78808-79284 | ribH | ||
| 1862 | CAUIXS010000006.1 | GCA962715145_00904 | gene | open | 79339-79662 | |||
| 1863 | CAUIXS010000006.1 | GCA962715145_00905 | gene | open | 79829-80548 | rnc | ||
| 1864 | CAUIXS010000006.1 | GCA962715145_00906 | gene | open | 80585-81520 | era | ||
| 1865 | CAUIXS010000006.1 | GCA962715145_00907 | gene | open | 81779-82057 | |||
| 1866 | CAUIXS010000006.1 | GCA962715145_00908 | gene | open | 82074-82676 | |||
| 1867 | CAUIXS010000006.1 | GCA962715145_00909 | gene | open | 83230-84243 | cas1c | ||
| 1868 | CAUIXS010000006.1 | GCA962715145_00910 | gene | open | 84250-84591 | cas2 | ||
| 1869 | CAUIXS010000006.1 | GCA962715145_00911 | gene | open | 92392-93102 | |||
| 1870 | CAUIXS010000006.1 | GCA962715145_00912 | gene | open | 93363-94016 | tnp | ||
| 1871 | CAUIXS010000006.1 | GCA962715145_00913 | gene | open | 95044-95667 | |||
| 1872 | CAUIXS010000006.1 | GCA962715145_00914 | gene | open | 95726-96217 | greB | ||
| 1873 | CAUIXS010000006.1 | GCA962715145_00915 | gene | open | 96317-97861 | purF | ||
| 1874 | CAUIXS010000006.1 | GCA962715145_00916 | gene | open | 98069-98566 | |||
| 1875 | CAUIXS010000006.1 | GCA962715145_00917 | gene | open | 98559-99581 | ftsN | ||
| 1876 | CAUIXS010000006.1 | GCA962715145_00918 | gene | open | 99594-100868 | folC | ||
| 1877 | CAUIXS010000006.1 | GCA962715145_00919 | gene | open | 100898-101338 | folI | ||
| 1878 | CAUIXS010000006.1 | GCA962715145_00920 | gene | open | 101343-101702 | |||
| 1879 | CAUIXS010000006.1 | GCA962715145_00921 | gene | open | 101775-102512 | glnQ | ||
| 1880 | CAUIXS010000006.1 | GCA962715145_00922 | gene | open | 102545-103000 | |||
| 1881 | CAUIXS010000006.1 | GCA962715145_00923 | gene | open | 103113-103682 | |||
| 1882 | CAUIXS010000006.1 | GCA962715145_00924 | gene | open | 103698-104477 | rsmA | ||
| 1883 | CAUIXS010000006.1 | GCA962715145_00925 | gene | open | 104716-105618 | |||
| 1884 | CAUIXS010000006.1 | GCA962715145_00926 | gene | open | 105636-106283 | |||
| 1885 | CAUIXS010000006.1 | GCA962715145_00927 | gene | open | 106466-107668 | trpB | ||
| 1886 | CAUIXS010000006.1 | GCA962715145_00928 | gene | open | 107761-108102 | |||
| 1887 | CAUIXS010000006.1 | GCA962715145_00929 | gene | open | 108370-110652 | comA | ||
| 1888 | CAUIXS010000006.1 | GCA962715145_00930 | gene | open | 110875-111678 | bamD | ||
| 1889 | CAUIXS010000006.1 | GCA962715145_00931 | gene | open | 111731-112801 | rluD | ||
| 1890 | CAUIXS010000006.1 | GCA962715145_00932 | gene | open | 112954-113901 | yfeH | ||
| 1891 | CAUIXS010000006.1 | GCA962715145_00933 | gene | open | 114343-115122 | pgeF | ||
| 1892 | CAUIXS010000006.1 | GCA962715145_00934 | gene | open | 115174-115653 | lptE | ||
| 1893 | CAUIXS010000006.1 | GCA962715145_00935 | gene | open | 115655-116653 | holA | ||
| 1894 | CAUIXS010000006.1 | GCA962715145_00936 | gene | open | 116774-117193 | |||
| 1895 | CAUIXS010000006.1 | GCA962715145_00937 | gene | open | 117218-117784 | yckC | ||
| 1896 | CAUIXS010000006.1 | GCA962715145_00938 | gene | open | 117868-118749 | yicC | ||
| 1897 | CAUIXS010000006.1 | GCA962715145_00939 | gene | open | 119199-120062 | rpoH | ||
| 1898 | CAUIXS010000006.1 | GCA962715145_00940 | gene | open | 120326-121864 | lnt | ||
| 1899 | CAUIXS010000006.1 | GCA962715145_00941 | gene | open | 121956-122711 | |||
| 1900 | CAUIXS010000006.1 | GCA962715145_00942 | gene | open | 122736-123005 | |||
| 1901 | CAUIXS010000006.1 | GCA962715145_00943 | gene | open | 123057-123347 | |||
| 1902 | CAUIXS010000006.1 | GCA962715145_00944 | gene | open | 123410-123811 | |||
| 1903 | CAUIXS010000006.1 | GCA962715145_00945 | gene | open | 124002-125084 | hemH | ||
| 1904 | CAUIXS010000006.1 | GCA962715145_00946 | gene | open | 125094-126209 | tgt | ||
| 1905 | CAUIXS010000006.1 | GCA962715145_00948 | gene | open | 126518-128431 | thrS | ||
| 1906 | CAUIXS010000006.1 | GCA962715145_00949 | gene | open | 128566-128970 | infC | ||
| 1907 | CAUIXS010000006.1 | GCA962715145_00950 | gene | open | 129117-129314 | infC | ||
| 1908 | CAUIXS010000006.1 | GCA962715145_00951 | gene | open | 129327-129686 | rplT | ||
| 1909 | CAUIXS010000006.1 | GCA962715145_00952 | gene | open | 129861-130919 | pheS | ||
| 1910 | CAUIXS010000006.1 | GCA962715145_00953 | gene | open | 131004-131984 | hrgA | ||
| 1911 | CAUIXS010000006.1 | GCA962715145_00954 | gene | open | 132066-134429 | pheT | ||
| 1912 | CAUIXS010000006.1 | GCA962715145_00955 | gene | open | 134503-134805 | ihfA | ||
| 1913 | CAUIXS010000006.1 | GCA962715145_00956 | gene | open | 134789-135097 | |||
| 1914 | CAUIXS010000006.1 | GCA962715145_00874 | gene | open | 54297-54373 | trnP | ||
| 1915 | CAUIXS010000006.1 | GCA962715145_00894 | gene | open | 72878-72970 | trnS | ||
| 1916 | CAUIXS010000006.1 | GCA962715145_00947 | gene | open | 126389-126465 | trnV | ||
| 1917 | CAUIXS010000006.1 | GCA962715145_00874 | tRNA | open | 54297-54373 | trnP | tRNA-Pro(ggg) | |
| 1918 | CAUIXS010000006.1 | GCA962715145_00894 | tRNA | open | 72878-72970 | trnS | tRNA-Ser(gct) | |
| 1919 | CAUIXS010000006.1 | GCA962715145_00947 | tRNA | open | 126389-126465 | trnV | tRNA-Val(gac) | |
| 1920 | CAUIXS010000007.1 | GCA962715145_00962 | gene | open | 3863-4224 | ssrA | ||
| 1921 | CAUIXS010000007.1 | GCA962715145_00962 | tmRNA | open | 3863-4224 | ssrA | transfer-messenger RNA%2C SsrA | |
| 1922 | CAUIXS010000007.1 | GCA962715145_00981 | gene | open | 22679-22784 | aniS | ||
| 1923 | CAUIXS010000007.1 | GCA962715145_00981 | ncRNA | open | 22679-22784 | aniS | AniS | |
| 1924 | CAUIXS010000007.1 | GCA962715145_00957 | CDS | open | 132-494 | _na 120_aa | hypothetical protein | |
| 1925 | CAUIXS010000007.1 | GCA962715145_00958 | CDS | open | 793-975 | _na 60_aa | hypothetical protein | |
| 1926 | CAUIXS010000007.1 | GCA962715145_00959 | CDS | open | 1203-1436 | _na 77_aa | Transcriptional regulator | |
| 1927 | CAUIXS010000007.1 | GCA962715145_00960 | CDS | open | 1610-2290 | _na 226_aa | Phage associated protein | |
| 1928 | CAUIXS010000007.1 | GCA962715145_00961 | CDS | open | 2366-3583 | _na 405_aa | Tyrosine-type recombinase/integrase | |
| 1929 | CAUIXS010000007.1 | GCA962715145_00963 | CDS | open | 4288-4893 | _na 201_aa | smrB | Smr domain-containing protein |
| 1930 | CAUIXS010000007.1 | GCA962715145_00964 | CDS | open | 5283-5477 | _na 64_aa | hypothetical protein | |
| 1931 | CAUIXS010000007.1 | GCA962715145_00965 | CDS | open | 5474-6529 | _na 351_aa | sbp | Sulfate ABC transporter substrate-binding protein |
| 1932 | CAUIXS010000007.1 | GCA962715145_00966 | CDS | open | 6635-7117 | _na 160_aa | N-acetyltransferase domain-containing protein | |
| 1933 | CAUIXS010000007.1 | GCA962715145_00967 | CDS | open | 7180-8316 | _na 378_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 1934 | CAUIXS010000007.1 | GCA962715145_00968 | CDS | open | 8313-8858 | _na 181_aa | DUF1643 domain-containing protein | |
| 1935 | CAUIXS010000007.1 | GCA962715145_00969 | CDS | open | 8855-10330 | _na 491_aa | trpE | anthranilate synthase component I |
| 1936 | CAUIXS010000007.1 | GCA962715145_00970 | CDS | open | 10589-10807 | _na 72_aa | Integral membrane protein | |
| 1937 | CAUIXS010000007.1 | GCA962715145_00971 | CDS | open | 10828-12738 | _na 636_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 1938 | CAUIXS010000007.1 | GCA962715145_00972 | CDS | open | 12757-13401 | _na 214_aa | dedA | DedA family protein |
| 1939 | CAUIXS010000007.1 | GCA962715145_00973 | CDS | open | 13483-14193 | _na 236_aa | methyltransferase domain-containing protein | |
| 1940 | CAUIXS010000007.1 | GCA962715145_00974 | CDS | open | 14198-15118 | _na 306_aa | glycosyltransferase family 2 protein | |
| 1941 | CAUIXS010000007.1 | GCA962715145_00975 | CDS | open | 15115-15486 | _na 123_aa | gtrA | GtrA family protein |
| 1942 | CAUIXS010000007.1 | GCA962715145_00976 | CDS | open | 15488-17020 | _na 510_aa | hypothetical protein | |
| 1943 | CAUIXS010000007.1 | GCA962715145_00977 | CDS | open | 17345-18808 | _na 487_aa | guaB | IMP dehydrogenase |
| 1944 | CAUIXS010000007.1 | GCA962715145_00978 | CDS | open | 19135-19596 | _na 153_aa | Immunity protein 42 | |
| 1945 | CAUIXS010000007.1 | GCA962715145_00979 | CDS | open | 19687-22245 | _na 852_aa | glnD | [protein-PII] uridylyltransferase |
| 1946 | CAUIXS010000007.1 | GCA962715145_00980 | CDS | open | 22294-22614 | _na 106_aa | hipB | XRE family transcriptional regulator |
| 1947 | CAUIXS010000007.1 | GCA962715145_00982 | CDS | open | 22938-23411 | _na 157_aa | bfr | bacterioferritin |
| 1948 | CAUIXS010000007.1 | GCA962715145_00983 | CDS | open | 23439-23903 | _na 154_aa | bfr | bacterioferritin |
| 1949 | CAUIXS010000007.1 | GCA962715145_00984 | CDS | open | 24372-25355 | _na 327_aa | lipA | lipoyl synthase |
| 1950 | CAUIXS010000007.1 | GCA962715145_00985 | CDS | open | 25348-25971 | _na 207_aa | lipB | lipoyl(octanoyl) transferase LipB |
| 1951 | CAUIXS010000007.1 | GCA962715145_00986 | CDS | open | 25973-26248 | _na 91_aa | ybeD | UPF0250 protein NMB1218 |
| 1952 | CAUIXS010000007.1 | GCA962715145_00987 | CDS | open | 26431-27501 | _na 356_aa | ATP synthase F0%2C A subunit | |
| 1953 | CAUIXS010000007.1 | GCA962715145_00988 | CDS | open | 27706-28653 | _na 315_aa | hypothetical protein | |
| 1954 | CAUIXS010000007.1 | GCA962715145_00989 | CDS | open | 28668-29075 | _na 135_aa | ybbJ | NfeD-like C-terminal domain-containing protein |
| 1955 | CAUIXS010000007.1 | GCA962715145_00990 | CDS | open | 29156-29815 | _na 219_aa | ung | uracil-DNA glycosylase |
| 1956 | CAUIXS010000007.1 | GCA962715145_00991 | CDS | open | 29966-30952 | _na 328_aa | HTH araC/xylS-type domain-containing protein | |
| 1957 | CAUIXS010000007.1 | GCA962715145_00992 | CDS | open | 31050-31901 | _na 283_aa | Metallo-beta-lactamase domain-containing protein | |
| 1958 | CAUIXS010000007.1 | GCA962715145_00993 | CDS | open | 32015-32464 | _na 149_aa | HTH marR-type domain-containing protein | |
| 1959 | CAUIXS010000007.1 | GCA962715145_00994 | CDS | open | 32696-33133 | _na 145_aa | cytochrome b | |
| 1960 | CAUIXS010000007.1 | GCA962715145_00995 | CDS | open | 33162-33602 | _na 146_aa | Antibiotic biosynthesis monooxygenase | |
| 1961 | CAUIXS010000007.1 | GCA962715145_00996 | CDS | open | 33912-34049 | _na 45_aa | hypothetical protein | |
| 1962 | CAUIXS010000007.1 | GCA962715145_00997 | CDS | open | 34060-34575 | _na 171_aa | tfpC | Type IV pilus assembly protein C |
| 1963 | CAUIXS010000007.1 | GCA962715145_00998 | CDS | open | 35048-36970 | _na 640_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 1964 | CAUIXS010000007.1 | GCA962715145_00999 | CDS | open | 37047-37418 | _na 123_aa | rodA | Rod shape-determining protein RodA |
| 1965 | CAUIXS010000007.1 | GCA962715145_01000 | CDS | open | 37616-38923 | _na 435_aa | homoserine dehydrogenase | |
| 1966 | CAUIXS010000007.1 | GCA962715145_01001 | CDS | open | 38916-39350 | _na 144_aa | Phage associated protein | |
| 1967 | CAUIXS010000007.1 | GCA962715145_01002 | CDS | open | 39501-39770 | _na 89_aa | hupB | DNA-binding protein HU-beta |
| 1968 | CAUIXS010000007.1 | GCA962715145_01003 | CDS | open | 39952-42414 | _na 820_aa | lon | endopeptidase La |
| 1969 | CAUIXS010000007.1 | GCA962715145_01004 | CDS | open | 42665-43768 | _na 367_aa | hemK | Methyltransferase%2C HemK family |
| 1970 | CAUIXS010000007.1 | GCA962715145_01005 | CDS | open | 43848-45593 | _na 581_aa | recD | exodeoxyribonuclease V subunit alpha |
| 1971 | CAUIXS010000007.1 | GCA962715145_01006 | CDS | open | 45661-46356 | _na 231_aa | lolD | lipoprotein-releasing ABC transporter ATP-binding protein LolD |
| 1972 | CAUIXS010000007.1 | GCA962715145_01007 | CDS | open | 46349-47596 | _na 415_aa | lolC | lipoprotein-releasing ABC transporter permease subunit |
| 1973 | CAUIXS010000007.1 | GCA962715145_01008 | CDS | open | 47820-48098 | _na 92_aa | Periplasmic protein | |
| 1974 | CAUIXS010000007.1 | GCA962715145_01009 | CDS | open | 48154-48771 | _na 205_aa | recR | recombination mediator RecR |
| 1975 | CAUIXS010000007.1 | GCA962715145_01010 | CDS | open | 48838-50376 | _na 512_aa | surA | PpiC domain-containing protein |
| 1976 | CAUIXS010000007.1 | GCA962715145_01011 | CDS | open | 50463-50816 | _na 117_aa | Transcriptional regulator%2C Spx/MgsR family | |
| 1977 | CAUIXS010000007.1 | GCA962715145_01012 | CDS | open | 50965-52593 | _na 542_aa | uup | ABC-F family ATPase |
| 1978 | CAUIXS010000007.1 | GCA962715145_01013 | CDS | open | 52682-53935 | _na 417_aa | multifunctional CCA addition/repair protein | |
| 1979 | CAUIXS010000007.1 | GCA962715145_01014 | CDS | open | 54160-54468 | _na 102_aa | Phage associated protein | |
| 1980 | CAUIXS010000007.1 | GCA962715145_01015 | CDS | open | 54550-55581 | _na 343_aa | ruvB | Holliday junction branch migration DNA helicase RuvB |
| 1981 | CAUIXS010000007.1 | GCA962715145_01016 | CDS | open | 55922-66778 | _na 3618_aa | PLxRFG domain-containing protein | |
| 1982 | CAUIXS010000007.1 | GCA962715145_01017 | CDS | open | 66775-66999 | _na 74_aa | hypothetical protein | |
| 1983 | CAUIXS010000007.1 | GCA962715145_01019 | CDS | open | 67794-68471 | _na 225_aa | Gid protein | |
| 1984 | CAUIXS010000007.1 | GCA962715145_01020 | CDS | open | 68464-69057 | _na 197_aa | ribA | GTP cyclohydrolase-2 |
| 1985 | CAUIXS010000007.1 | GCA962715145_01021 | CDS | open | 69225-69551 | _na 108_aa | Glycosyl transferase family protein | |
| 1986 | CAUIXS010000007.1 | GCA962715145_01022 | CDS | open | 69583-70203 | _na 206_aa | Glycosyl transferase | |
| 1987 | CAUIXS010000007.1 | GCA962715145_01023 | CDS | open | 70399-71739 | _na 446_aa | ribBA | bifunctional 3%2C4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II |
| 1988 | CAUIXS010000007.1 | GCA962715145_01024 | CDS | open | 72009-72632 | _na 207_aa | EVE domain-containing protein | |
| 1989 | CAUIXS010000007.1 | GCA962715145_01025 | CDS | open | 72798-75272 | _na 824_aa | glycogen/starch/alpha-glucan phosphorylase | |
| 1990 | CAUIXS010000007.1 | GCA962715145_01026 | CDS | open | 75377-77368 | _na 663_aa | glgX | glycogen debranching protein GlgX |
| 1991 | CAUIXS010000007.1 | GCA962715145_01027 | CDS | open | 77860-79170 | _na 436_aa | rarA | Replication-associated recombination protein A |
| 1992 | CAUIXS010000007.1 | GCA962715145_01028 | CDS | open | 79286-79657 | _na 123_aa | Lipoprotein | |
| 1993 | CAUIXS010000007.1 | GCA962715145_01029 | CDS | open | 79730-81139 | _na 469_aa | thrC | threonine synthase |
| 1994 | CAUIXS010000007.1 | GCA962715145_01030 | CDS | open | 81198-81980 | _na 260_aa | Serine/threonine protein kinase | |
| 1995 | CAUIXS010000007.1 | GCA962715145_01031 | CDS | open | 82169-82945 | _na 258_aa | fpr | ferredoxin--NADP(+) reductase |
| 1996 | CAUIXS010000007.1 | GCA962715145_01032 | CDS | open | 83092-83235 | _na 47_aa | hypothetical protein | |
| 1997 | CAUIXS010000007.1 | GCA962715145_01033 | CDS | open | 83225-83731 | _na 168_aa | Integral membrane protein | |
| 1998 | CAUIXS010000007.1 | GCA962715145_01034 | CDS | open | 83912-86383 | _na 823_aa | zntA | Copper-exporting ATPase |
| 1999 | CAUIXS010000007.1 | GCA962715145_01035 | CDS | open | 86380-87561 | _na 393_aa | hflX | GTPase HflX |
| 2000 | CAUIXS010000007.1 | GCA962715145_01036 | CDS | open | 87566-88846 | _na 426_aa | ykwD | Serine protease |

