BAKTAGenome Explorer: Neisseria polysaccharea (GCA_963394865.1)
Select a Genome:
|
BAKTA Annotations for GCA_963394865.1
|
Search & Sort all 3859 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 3501 | CAUJPH010000029.1 | GCA963394865_01745 | gene | open | 14444-15157 | cpoB | ||
| 3502 | CAUJPH010000029.1 | GCA963394865_01746 | gene | open | 15157-15825 | trmR | ||
| 3503 | CAUJPH010000029.1 | GCA963394865_01747 | gene | open | 15836-16021 | |||
| 3504 | CAUJPH010000029.1 | GCA963394865_01748 | gene | open | 16165-18141 | mutL | ||
| 3505 | CAUJPH010000029.1 | GCA963394865_01749 | gene | open | 18236-20365 | dnaX | ||
| 3506 | CAUJPH010000029.1 | GCA963394865_01750 | gene | open | 20444-20779 | ybaB | ||
| 3507 | CAUJPH010000030.1 | GCA963394865_01751 | CDS | open | 242-442 | _na 66_aa | bfd | Bacterioferritin-associated ferredoxin |
| 3508 | CAUJPH010000030.1 | GCA963394865_01752 | CDS | open | 624-1499 | _na 291_aa | xerD | site-specific tyrosine recombinase XerD |
| 3509 | CAUJPH010000030.1 | GCA963394865_01753 | CDS | open | 1553-1990 | _na 145_aa | bcp | thioredoxin-dependent peroxiredoxin |
| 3510 | CAUJPH010000030.1 | GCA963394865_01754 | CDS | open | 2414-3352 | _na 312_aa | dacC | D-alanyl-D-alanine carboxypeptidase |
| 3511 | CAUJPH010000030.1 | GCA963394865_01755 | CDS | open | 3481-3774 | _na 97_aa | hfq | RNA chaperone Hfq |
| 3512 | CAUJPH010000030.1 | GCA963394865_01756 | CDS | open | 3859-4425 | _na 188_aa | Putative rRNA methylase | |
| 3513 | CAUJPH010000030.1 | GCA963394865_01757 | CDS | open | 4479-4853 | _na 124_aa | sirB2 | SirB family protein |
| 3514 | CAUJPH010000030.1 | GCA963394865_01758 | CDS | open | 4863-5357 | _na 164_aa | folK | 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase |
| 3515 | CAUJPH010000030.1 | GCA963394865_01759 | CDS | open | 5492-5965 | _na 157_aa | nimA | Lipoprotein |
| 3516 | CAUJPH010000030.1 | GCA963394865_01760 | CDS | open | 6185-6922 | _na 245_aa | ubiE | bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE |
| 3517 | CAUJPH010000030.1 | GCA963394865_01761 | CDS | open | 6965-7333 | _na 122_aa | gBBH | Gamma-butyrobetaine hydroxylase-like N-terminal domain-containing protein |
| 3518 | CAUJPH010000030.1 | GCA963394865_01762 | CDS | open | 7453-9072 | _na 539_aa | dadA | FAD dependent oxidoreductase domain-containing protein |
| 3519 | CAUJPH010000030.1 | GCA963394865_01763 | CDS | open | 10155-10640 | _na 161_aa | fxsA | FxsA protein |
| 3520 | CAUJPH010000030.1 | GCA963394865_01764 | CDS | open | 10900-11139 | _na 79_aa | Phage associated protein | |
| 3521 | CAUJPH010000030.1 | GCA963394865_01765 | CDS | open | 11353-12654 | _na 433_aa | bioA | adenosylmethionine--8-amino-7-oxononanoate transaminase |
| 3522 | CAUJPH010000030.1 | GCA963394865_01766 | CDS | open | 12651-13298 | _na 215_aa | bioD | dethiobiotin synthase |
| 3523 | CAUJPH010000030.1 | GCA963394865_01767 | CDS | open | 13313-13789 | _na 158_aa | ubiC | Chorismate lyase |
| 3524 | CAUJPH010000030.1 | GCA963394865_01768 | CDS | open | 13819-14709 | _na 296_aa | ubiA | 4-hydroxybenzoate octaprenyltransferase |
| 3525 | CAUJPH010000030.1 | GCA963394865_01769 | CDS | open | 14894-15343 | _na 149_aa | ptsN | PTS IIA-like nitrogen regulatory protein PtsN |
| 3526 | CAUJPH010000030.1 | GCA963394865_01770 | CDS | open | 15345-16307 | _na 320_aa | hprK | HPr(Ser) kinase/phosphatase |
| 3527 | CAUJPH010000030.1 | GCA963394865_01771 | CDS | open | 16288-17142 | _na 284_aa | rapZ | RNase adapter RapZ |
| 3528 | CAUJPH010000030.1 | GCA963394865_01772 | CDS | open | 17223-18164 | _na 313_aa | ylqF | ribosome biogenesis GTPase YlqF |
| 3529 | CAUJPH010000030.1 | GCA963394865_01773 | CDS | open | 18265-18867 | _na 200_aa | scpB | Segregation and condensation protein B |
| 3530 | CAUJPH010000030.1 | GCA963394865_01774 | CDS | open | 19051-20724 | _na 557_aa | recN | DNA repair protein RecN |
| 3531 | CAUJPH010000030.1 | GCA963394865_01751 | gene | open | 242-442 | bfd | ||
| 3532 | CAUJPH010000030.1 | GCA963394865_01752 | gene | open | 624-1499 | xerD | ||
| 3533 | CAUJPH010000030.1 | GCA963394865_01753 | gene | open | 1553-1990 | bcp | ||
| 3534 | CAUJPH010000030.1 | GCA963394865_01754 | gene | open | 2414-3352 | dacC | ||
| 3535 | CAUJPH010000030.1 | GCA963394865_01755 | gene | open | 3481-3774 | hfq | ||
| 3536 | CAUJPH010000030.1 | GCA963394865_01756 | gene | open | 3859-4425 | |||
| 3537 | CAUJPH010000030.1 | GCA963394865_01757 | gene | open | 4479-4853 | sirB2 | ||
| 3538 | CAUJPH010000030.1 | GCA963394865_01758 | gene | open | 4863-5357 | folK | ||
| 3539 | CAUJPH010000030.1 | GCA963394865_01759 | gene | open | 5492-5965 | nimA | ||
| 3540 | CAUJPH010000030.1 | GCA963394865_01760 | gene | open | 6185-6922 | ubiE | ||
| 3541 | CAUJPH010000030.1 | GCA963394865_01761 | gene | open | 6965-7333 | gBBH | ||
| 3542 | CAUJPH010000030.1 | GCA963394865_01762 | gene | open | 7453-9072 | dadA | ||
| 3543 | CAUJPH010000030.1 | GCA963394865_01763 | gene | open | 10155-10640 | fxsA | ||
| 3544 | CAUJPH010000030.1 | GCA963394865_01764 | gene | open | 10900-11139 | |||
| 3545 | CAUJPH010000030.1 | GCA963394865_01765 | gene | open | 11353-12654 | bioA | ||
| 3546 | CAUJPH010000030.1 | GCA963394865_01766 | gene | open | 12651-13298 | bioD | ||
| 3547 | CAUJPH010000030.1 | GCA963394865_01767 | gene | open | 13313-13789 | ubiC | ||
| 3548 | CAUJPH010000030.1 | GCA963394865_01768 | gene | open | 13819-14709 | ubiA | ||
| 3549 | CAUJPH010000030.1 | GCA963394865_01769 | gene | open | 14894-15343 | ptsN | ||
| 3550 | CAUJPH010000030.1 | GCA963394865_01770 | gene | open | 15345-16307 | hprK | ||
| 3551 | CAUJPH010000030.1 | GCA963394865_01771 | gene | open | 16288-17142 | rapZ | ||
| 3552 | CAUJPH010000030.1 | GCA963394865_01772 | gene | open | 17223-18164 | ylqF | ||
| 3553 | CAUJPH010000030.1 | GCA963394865_01773 | gene | open | 18265-18867 | scpB | ||
| 3554 | CAUJPH010000030.1 | GCA963394865_01774 | gene | open | 19051-20724 | recN | ||
| 3555 | CAUJPH010000030.1 | GCA963394865_01775 | gene | open | 20835-20911 | trnR | ||
| 3556 | CAUJPH010000030.1 | GCA963394865_01776 | gene | open | 20929-21003 | trnE | ||
| 3557 | CAUJPH010000030.1 | GCA963394865_01775 | tRNA | open | 20835-20911 | trnR | tRNA-Arg(acg) | |
| 3558 | CAUJPH010000030.1 | GCA963394865_01776 | tRNA | open | 20929-21003 | trnE | tRNA-Glu(ttc) | |
| 3559 | CAUJPH010000031.1 | GCA963394865_01777 | CDS | open | 48-263 | _na 71_aa | hypothetical protein | |
| 3560 | CAUJPH010000031.1 | GCA963394865_01778 | CDS | open | 276-584 | _na 102_aa | hypothetical protein | |
| 3561 | CAUJPH010000031.1 | GCA963394865_01779 | CDS | open | 665-1528 | _na 287_aa | rpoH | RNA polymerase sigma factor RpoH |
| 3562 | CAUJPH010000031.1 | GCA963394865_01780 | CDS | open | 1906-3501 | _na 531_aa | lnt | apolipoprotein N-acyltransferase |
| 3563 | CAUJPH010000031.1 | GCA963394865_01781 | CDS | open | 3534-3920 | _na 128_aa | Inner membrane protein | |
| 3564 | CAUJPH010000031.1 | GCA963394865_01782 | CDS | open | 4001-4273 | _na 90_aa | hypothetical protein | |
| 3565 | CAUJPH010000031.1 | GCA963394865_01783 | CDS | open | 4456-4776 | _na 106_aa | potassium:proton antiporter | |
| 3566 | CAUJPH010000031.1 | GCA963394865_01784 | CDS | open | 4880-5170 | _na 96_aa | Potassium/proton antiporter | |
| 3567 | CAUJPH010000031.1 | GCA963394865_01785 | CDS | open | 5233-5634 | _na 133_aa | Cytochrome c552 | |
| 3568 | CAUJPH010000031.1 | GCA963394865_01786 | CDS | open | 5825-6907 | _na 360_aa | hemH | ferrochelatase |
| 3569 | CAUJPH010000031.1 | GCA963394865_01787 | CDS | open | 6919-8034 | _na 371_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 3570 | CAUJPH010000031.1 | GCA963394865_01789 | CDS | open | 8342-10255 | _na 637_aa | thrS | threonine--tRNA ligase |
| 3571 | CAUJPH010000031.1 | GCA963394865_01790 | CDS | open | 10390-10794 | _na 134_aa | infC | translation initiation factor IF-3 |
| 3572 | CAUJPH010000031.1 | GCA963394865_01791 | CDS | open | 10941-11138 | _na 65_aa | infC | translation initiation factor IF-3 |
| 3573 | CAUJPH010000031.1 | GCA963394865_01792 | CDS | open | 11151-11510 | _na 119_aa | rplT | 50S ribosomal protein L20 |
| 3574 | CAUJPH010000031.1 | GCA963394865_01793 | CDS | open | 11685-12743 | _na 352_aa | pheS | phenylalanine--tRNA ligase subunit alpha |
| 3575 | CAUJPH010000031.1 | GCA963394865_01794 | CDS | open | 12867-15230 | _na 787_aa | pheT | phenylalanine--tRNA ligase subunit beta |
| 3576 | CAUJPH010000031.1 | GCA963394865_01795 | CDS | open | 15303-15605 | _na 100_aa | ihfA | integration host factor subunit alpha |
| 3577 | CAUJPH010000031.1 | GCA963394865_01796 | CDS | open | 15589-15897 | _na 102_aa | hypothetical protein | |
| 3578 | CAUJPH010000031.1 | GCA963394865_01797 | CDS | open | 16697-16948 | _na 83_aa | Zinc ribbon domain-containing protein | |
| 3579 | CAUJPH010000031.1 | GCA963394865_01777 | gene | open | 48-263 | |||
| 3580 | CAUJPH010000031.1 | GCA963394865_01778 | gene | open | 276-584 | |||
| 3581 | CAUJPH010000031.1 | GCA963394865_01779 | gene | open | 665-1528 | rpoH | ||
| 3582 | CAUJPH010000031.1 | GCA963394865_01780 | gene | open | 1906-3501 | lnt | ||
| 3583 | CAUJPH010000031.1 | GCA963394865_01781 | gene | open | 3534-3920 | |||
| 3584 | CAUJPH010000031.1 | GCA963394865_01782 | gene | open | 4001-4273 | |||
| 3585 | CAUJPH010000031.1 | GCA963394865_01783 | gene | open | 4456-4776 | |||
| 3586 | CAUJPH010000031.1 | GCA963394865_01784 | gene | open | 4880-5170 | |||
| 3587 | CAUJPH010000031.1 | GCA963394865_01785 | gene | open | 5233-5634 | |||
| 3588 | CAUJPH010000031.1 | GCA963394865_01786 | gene | open | 5825-6907 | hemH | ||
| 3589 | CAUJPH010000031.1 | GCA963394865_01787 | gene | open | 6919-8034 | tgt | ||
| 3590 | CAUJPH010000031.1 | GCA963394865_01789 | gene | open | 8342-10255 | thrS | ||
| 3591 | CAUJPH010000031.1 | GCA963394865_01790 | gene | open | 10390-10794 | infC | ||
| 3592 | CAUJPH010000031.1 | GCA963394865_01791 | gene | open | 10941-11138 | infC | ||
| 3593 | CAUJPH010000031.1 | GCA963394865_01792 | gene | open | 11151-11510 | rplT | ||
| 3594 | CAUJPH010000031.1 | GCA963394865_01793 | gene | open | 11685-12743 | pheS | ||
| 3595 | CAUJPH010000031.1 | GCA963394865_01794 | gene | open | 12867-15230 | pheT | ||
| 3596 | CAUJPH010000031.1 | GCA963394865_01795 | gene | open | 15303-15605 | ihfA | ||
| 3597 | CAUJPH010000031.1 | GCA963394865_01796 | gene | open | 15589-15897 | |||
| 3598 | CAUJPH010000031.1 | GCA963394865_01797 | gene | open | 16697-16948 | |||
| 3599 | CAUJPH010000031.1 | GCA963394865_01788 | gene | open | 8213-8289 | trnV | ||
| 3600 | CAUJPH010000031.1 | GCA963394865_01788 | tRNA | open | 8213-8289 | trnV | tRNA-Val(gac) | |
| 3601 | CAUJPH010000032.1 | GCA963394865_01798 | CDS | open | 392-1513 | _na 373_aa | dnaJ | molecular chaperone DnaJ |
| 3602 | CAUJPH010000032.1 | GCA963394865_01799 | CDS | open | 1708-3726 | _na 672_aa | oPT | OPT family oligopeptide transporter |
| 3603 | CAUJPH010000032.1 | GCA963394865_01800 | CDS | open | 3770-4327 | _na 185_aa | rfbC | dTDP-4-dehydrorhamnose 3%2C5-epimerase |
| 3604 | CAUJPH010000032.1 | GCA963394865_01801 | CDS | open | 4409-5275 | _na 288_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 3605 | CAUJPH010000032.1 | GCA963394865_01802 | CDS | open | 5338-6420 | _na 360_aa | rfbB | dTDP-glucose 4%2C6-dehydratase |
| 3606 | CAUJPH010000032.1 | GCA963394865_01803 | CDS | open | 6421-7437 | _na 338_aa | galE | UDP-glucose 4-epimerase GalE |
| 3607 | CAUJPH010000032.1 | GCA963394865_01804 | CDS | open | 7551-9824 | _na 757_aa | tex | putative protein NMB0075 |
| 3608 | CAUJPH010000032.1 | GCA963394865_01805 | CDS | open | 10023-10364 | _na 113_aa | Lipoprotein | |
| 3609 | CAUJPH010000032.1 | GCA963394865_01806 | CDS | open | 10539-11753 | _na 404_aa | gltS | sodium/glutamate symporter |
| 3610 | CAUJPH010000032.1 | GCA963394865_01807 | CDS | open | 11853-12866 | _na 337_aa | yecT | lysozyme inhibitor LprI family protein |
| 3611 | CAUJPH010000032.1 | GCA963394865_01808 | CDS | open | 12877-13074 | _na 65_aa | Cyanate hydratase N-terminal domain-containing protein | |
| 3612 | CAUJPH010000032.1 | GCA963394865_01798 | gene | open | 392-1513 | dnaJ | ||
| 3613 | CAUJPH010000032.1 | GCA963394865_01799 | gene | open | 1708-3726 | oPT | ||
| 3614 | CAUJPH010000032.1 | GCA963394865_01800 | gene | open | 3770-4327 | rfbC | ||
| 3615 | CAUJPH010000032.1 | GCA963394865_01801 | gene | open | 4409-5275 | rfbA | ||
| 3616 | CAUJPH010000032.1 | GCA963394865_01802 | gene | open | 5338-6420 | rfbB | ||
| 3617 | CAUJPH010000032.1 | GCA963394865_01803 | gene | open | 6421-7437 | galE | ||
| 3618 | CAUJPH010000032.1 | GCA963394865_01804 | gene | open | 7551-9824 | tex | ||
| 3619 | CAUJPH010000032.1 | GCA963394865_01805 | gene | open | 10023-10364 | |||
| 3620 | CAUJPH010000032.1 | GCA963394865_01806 | gene | open | 10539-11753 | gltS | ||
| 3621 | CAUJPH010000032.1 | GCA963394865_01807 | gene | open | 11853-12866 | yecT | ||
| 3622 | CAUJPH010000032.1 | GCA963394865_01808 | gene | open | 12877-13074 | |||
| 3623 | CAUJPH010000033.1 | GCA963394865_01809 | CDS | open | 130-489 | _na 119_aa | immunity 8 family protein | |
| 3624 | CAUJPH010000033.1 | GCA963394865_01810 | CDS | open | 1279-1596 | _na 105_aa | hypothetical protein | |
| 3625 | CAUJPH010000033.1 | GCA963394865_01811 | CDS | open | 1593-2975 | _na 460_aa | mafB | polymorphic toxin MafB class 3 |
| 3626 | CAUJPH010000033.1 | GCA963394865_01812 | CDS | open | 3015-3977 | _na 320_aa | mafA | adhesin MafA |
| 3627 | CAUJPH010000033.1 | GCA963394865_01813 | CDS | open | 4504-5223 | _na 239_aa | pyrH | UMP kinase |
| 3628 | CAUJPH010000033.1 | GCA963394865_01814 | CDS | open | 5442-6296 | _na 284_aa | tsf | translation elongation factor Ts |
| 3629 | CAUJPH010000033.1 | GCA963394865_01815 | CDS | open | 6418-7146 | _na 242_aa | rpsB | 30S ribosomal protein S2 |
| 3630 | CAUJPH010000033.1 | GCA963394865_01816 | CDS | open | 7319-7552 | _na 77_aa | Integral membrane protein | |
| 3631 | CAUJPH010000033.1 | GCA963394865_01817 | CDS | open | 7630-8211 | _na 193_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 3632 | CAUJPH010000033.1 | GCA963394865_01818 | CDS | open | 8272-8862 | _na 196_aa | rimL | N-acetyltransferase domain-containing protein |
| 3633 | CAUJPH010000033.1 | GCA963394865_01819 | CDS | open | 9247-10713 | _na 488_aa | mqo | malate:quinone oxidoreductase |
| 3634 | CAUJPH010000033.1 | GCA963394865_01820 | CDS | open | 10901-11275 | _na 124_aa | adhesin | |
| 3635 | CAUJPH010000033.1 | GCA963394865_01821 | CDS | open | 11512-11811 | _na 99_aa | RsaL-like HTH domain-containing protein | |
| 3636 | CAUJPH010000033.1 | GCA963394865_01822 | CDS | open | 11965-12744 | _na 259_aa | map | type I methionyl aminopeptidase |
| 3637 | CAUJPH010000033.1 | GCA963394865_01809 | gene | open | 130-489 | |||
| 3638 | CAUJPH010000033.1 | GCA963394865_01810 | gene | open | 1279-1596 | |||
| 3639 | CAUJPH010000033.1 | GCA963394865_01811 | gene | open | 1593-2975 | mafB | ||
| 3640 | CAUJPH010000033.1 | GCA963394865_01812 | gene | open | 3015-3977 | mafA | ||
| 3641 | CAUJPH010000033.1 | GCA963394865_01813 | gene | open | 4504-5223 | pyrH | ||
| 3642 | CAUJPH010000033.1 | GCA963394865_01814 | gene | open | 5442-6296 | tsf | ||
| 3643 | CAUJPH010000033.1 | GCA963394865_01815 | gene | open | 6418-7146 | rpsB | ||
| 3644 | CAUJPH010000033.1 | GCA963394865_01816 | gene | open | 7319-7552 | |||
| 3645 | CAUJPH010000033.1 | GCA963394865_01817 | gene | open | 7630-8211 | |||
| 3646 | CAUJPH010000033.1 | GCA963394865_01818 | gene | open | 8272-8862 | rimL | ||
| 3647 | CAUJPH010000033.1 | GCA963394865_01819 | gene | open | 9247-10713 | mqo | ||
| 3648 | CAUJPH010000033.1 | GCA963394865_01820 | gene | open | 10901-11275 | |||
| 3649 | CAUJPH010000033.1 | GCA963394865_01821 | gene | open | 11512-11811 | |||
| 3650 | CAUJPH010000033.1 | GCA963394865_01822 | gene | open | 11965-12744 | map | ||
| 3651 | CAUJPH010000034.1 | GCA963394865_01823 | CDS | open | 427-663 | _na 78_aa | opcA | Outer membrane protein OpcA |
| 3652 | CAUJPH010000034.1 | GCA963394865_01824 | CDS | open | 1360-2415 | _na 351_aa | aroG | 3-deoxy-7-phosphoheptulonate synthase AroG |
| 3653 | CAUJPH010000034.1 | GCA963394865_01825 | CDS | open | 2483-2971 | _na 162_aa | folA | Dihydrofolate reductase |
| 3654 | CAUJPH010000034.1 | GCA963394865_01826 | CDS | open | 3001-3477 | _na 158_aa | cYTH | Adenylate cyclase |
| 3655 | CAUJPH010000034.1 | GCA963394865_01827 | CDS | open | 3489-3914 | _na 141_aa | hemJ | Protoporphyrinogen IX oxidase |
| 3656 | CAUJPH010000034.1 | GCA963394865_01828 | CDS | open | 4031-4276 | _na 81_aa | Phage associated protein | |
| 3657 | CAUJPH010000034.1 | GCA963394865_01829 | CDS | open | 4547-5011 | _na 154_aa | hypothetical protein | |
| 3658 | CAUJPH010000034.1 | GCA963394865_01830 | CDS | open | 5077-7191 | _na 704_aa | Virulence associated protein | |
| 3659 | CAUJPH010000034.1 | GCA963394865_01831 | CDS | open | 7460-8893 | _na 477_aa | Surface lipoprotein assembly modifier 1 | |
| 3660 | CAUJPH010000034.1 | GCA963394865_01832 | CDS | open | 9067-10395 | _na 442_aa | miaB | tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB |
| 3661 | CAUJPH010000034.1 | GCA963394865_01833 | CDS | open | 10599-11012 | _na 137_aa | Secreted protein | |
| 3662 | CAUJPH010000034.1 | GCA963394865_01834 | CDS | open | 11076-12359 | _na 427_aa | hemL | glutamate-1-semialdehyde 2%2C1-aminomutase |
| 3663 | CAUJPH010000034.1 | GCA963394865_01823 | gene | open | 427-663 | opcA | ||
| 3664 | CAUJPH010000034.1 | GCA963394865_01824 | gene | open | 1360-2415 | aroG | ||
| 3665 | CAUJPH010000034.1 | GCA963394865_01825 | gene | open | 2483-2971 | folA | ||
| 3666 | CAUJPH010000034.1 | GCA963394865_01826 | gene | open | 3001-3477 | cYTH | ||
| 3667 | CAUJPH010000034.1 | GCA963394865_01827 | gene | open | 3489-3914 | hemJ | ||
| 3668 | CAUJPH010000034.1 | GCA963394865_01828 | gene | open | 4031-4276 | |||
| 3669 | CAUJPH010000034.1 | GCA963394865_01829 | gene | open | 4547-5011 | |||
| 3670 | CAUJPH010000034.1 | GCA963394865_01830 | gene | open | 5077-7191 | |||
| 3671 | CAUJPH010000034.1 | GCA963394865_01831 | gene | open | 7460-8893 | |||
| 3672 | CAUJPH010000034.1 | GCA963394865_01832 | gene | open | 9067-10395 | miaB | ||
| 3673 | CAUJPH010000034.1 | GCA963394865_01833 | gene | open | 10599-11012 | |||
| 3674 | CAUJPH010000034.1 | GCA963394865_01834 | gene | open | 11076-12359 | hemL | ||
| 3675 | CAUJPH010000035.1 | GCA963394865_01835 | CDS | open | 357-1541 | _na 394_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 3676 | CAUJPH010000035.1 | GCA963394865_01836 | CDS | open | 1854-2309 | _na 151_aa | DUF4440 domain-containing protein | |
| 3677 | CAUJPH010000035.1 | GCA963394865_01837 | CDS | open | 2377-4533 | _na 718_aa | spoT | Guanosine-3'%2C5'-bis(Diphosphate)3'-pyrophophohydrolase |
| 3678 | CAUJPH010000035.1 | GCA963394865_01838 | CDS | open | 4626-4832 | _na 68_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 3679 | CAUJPH010000035.1 | GCA963394865_01839 | CDS | open | 4891-5508 | _na 205_aa | gmk | guanylate kinase |
| 3680 | CAUJPH010000035.1 | GCA963394865_01840 | CDS | open | 5669-6235 | _na 188_aa | apt | adenine phosphoribosyltransferase |
| 3681 | CAUJPH010000035.1 | GCA963394865_01841 | CDS | open | 6282-7070 | _na 262_aa | cof | Hydrolase |
| 3682 | CAUJPH010000035.1 | GCA963394865_01842 | CDS | open | 7262-8617 | _na 451_aa | yegQ | tRNA 5-hydroxyuridine modification protein YegQ |
| 3683 | CAUJPH010000035.1 | GCA963394865_01843 | CDS | open | 8714-9226 | _na 170_aa | Excinuclease ATPase subunit | |
| 3684 | CAUJPH010000035.1 | GCA963394865_01844 | CDS | open | 9415-10380 | _na 321_aa | Ex13L | |
| 3685 | CAUJPH010000035.1 | GCA963394865_01835 | gene | open | 357-1541 | coaBC | ||
| 3686 | CAUJPH010000035.1 | GCA963394865_01836 | gene | open | 1854-2309 | |||
| 3687 | CAUJPH010000035.1 | GCA963394865_01837 | gene | open | 2377-4533 | spoT | ||
| 3688 | CAUJPH010000035.1 | GCA963394865_01838 | gene | open | 4626-4832 | rpoZ | ||
| 3689 | CAUJPH010000035.1 | GCA963394865_01839 | gene | open | 4891-5508 | gmk | ||
| 3690 | CAUJPH010000035.1 | GCA963394865_01840 | gene | open | 5669-6235 | apt | ||
| 3691 | CAUJPH010000035.1 | GCA963394865_01841 | gene | open | 6282-7070 | cof | ||
| 3692 | CAUJPH010000035.1 | GCA963394865_01842 | gene | open | 7262-8617 | yegQ | ||
| 3693 | CAUJPH010000035.1 | GCA963394865_01843 | gene | open | 8714-9226 | |||
| 3694 | CAUJPH010000035.1 | GCA963394865_01844 | gene | open | 9415-10380 | |||
| 3695 | CAUJPH010000036.1 | GCA963394865_01845 | CDS | open | 182-415 | _na 77_aa | Thioredoxin | |
| 3696 | CAUJPH010000036.1 | GCA963394865_01846 | CDS | open | 787-1650 | _na 287_aa | rfbD | dTDP-4-dehydrorhamnose reductase |
| 3697 | CAUJPH010000036.1 | GCA963394865_01847 | CDS | open | 1851-2714 | _na 287_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 3698 | CAUJPH010000036.1 | GCA963394865_01848 | CDS | open | 2952-5072 | _na 706_aa | pnp | polyribonucleotide nucleotidyltransferase |
| 3699 | CAUJPH010000036.1 | GCA963394865_01849 | CDS | open | 5146-5814 | _na 222_aa | dsbD | Urease accessory protein UreH-like transmembrane domain-containing protein |
| 3700 | CAUJPH010000036.1 | GCA963394865_01850 | CDS | open | 5811-6125 | _na 104_aa | Putative lipoprotein | |
| 3701 | CAUJPH010000036.1 | GCA963394865_01851 | CDS | open | 6189-7112 | _na 307_aa | dapF | diaminopimelate epimerase |
| 3702 | CAUJPH010000036.1 | GCA963394865_01852 | CDS | open | 7109-7714 | _na 201_aa | Integral membrane protein | |
| 3703 | CAUJPH010000036.1 | GCA963394865_01853 | CDS | open | 7911-8843 | _na 310_aa | cysK | cysteine synthase A |
| 3704 | CAUJPH010000036.1 | GCA963394865_01854 | CDS | open | 9335-10213 | _na 292_aa | rhaT | EamA domain-containing protein |
| 3705 | CAUJPH010000036.1 | GCA963394865_01845 | gene | open | 182-415 | |||
| 3706 | CAUJPH010000036.1 | GCA963394865_01846 | gene | open | 787-1650 | rfbD | ||
| 3707 | CAUJPH010000036.1 | GCA963394865_01847 | gene | open | 1851-2714 | purC | ||
| 3708 | CAUJPH010000036.1 | GCA963394865_01848 | gene | open | 2952-5072 | pnp | ||
| 3709 | CAUJPH010000036.1 | GCA963394865_01849 | gene | open | 5146-5814 | dsbD | ||
| 3710 | CAUJPH010000036.1 | GCA963394865_01850 | gene | open | 5811-6125 | |||
| 3711 | CAUJPH010000036.1 | GCA963394865_01851 | gene | open | 6189-7112 | dapF | ||
| 3712 | CAUJPH010000036.1 | GCA963394865_01852 | gene | open | 7109-7714 | |||
| 3713 | CAUJPH010000036.1 | GCA963394865_01853 | gene | open | 7911-8843 | cysK | ||
| 3714 | CAUJPH010000036.1 | GCA963394865_01854 | gene | open | 9335-10213 | rhaT | ||
| 3715 | CAUJPH010000037.1 | GCA963394865_01855 | CDS | open | 139-1551 | _na 470_aa | trkA | Trk system potassium transporter TrkA |
| 3716 | CAUJPH010000037.1 | GCA963394865_01856 | CDS | open | 1649-3172 | _na 507_aa | ttdA | Fumarate hydratase class I |
| 3717 | CAUJPH010000037.1 | GCA963394865_01857 | CDS | open | 3981-4619 | _na 212_aa | forC | 2Fe-2S iron-sulfur cluster binding domain protein |
| 3718 | CAUJPH010000037.1 | GCA963394865_01858 | CDS | open | 4619-6247 | _na 542_aa | nadB | FAD-dependent oxidoreductase 2 FAD binding domain-containing protein |
| 3719 | CAUJPH010000037.1 | GCA963394865_01859 | CDS | open | 6244-7497 | _na 417_aa | nuoF | NADH dehydrogenase |
| 3720 | CAUJPH010000037.1 | GCA963394865_01860 | CDS | open | 8014-9465 | _na 483_aa | citT | Integral membrane transport protein |
| 3721 | CAUJPH010000037.1 | GCA963394865_01855 | gene | open | 139-1551 | trkA | ||
| 3722 | CAUJPH010000037.1 | GCA963394865_01856 | gene | open | 1649-3172 | ttdA | ||
| 3723 | CAUJPH010000037.1 | GCA963394865_01857 | gene | open | 3981-4619 | forC | ||
| 3724 | CAUJPH010000037.1 | GCA963394865_01858 | gene | open | 4619-6247 | nadB | ||
| 3725 | CAUJPH010000037.1 | GCA963394865_01859 | gene | open | 6244-7497 | nuoF | ||
| 3726 | CAUJPH010000037.1 | GCA963394865_01860 | gene | open | 8014-9465 | citT | ||
| 3727 | CAUJPH010000038.1 | GCA963394865_01861 | CDS | open | 67-2448 | _na 793_aa | phage tail tape measure protein | |
| 3728 | CAUJPH010000038.1 | GCA963394865_01862 | CDS | open | 2489-3385 | _na 298_aa | phage tail protein | |
| 3729 | CAUJPH010000038.1 | GCA963394865_01863 | CDS | open | 3386-3610 | _na 74_aa | tail protein X | |
| 3730 | CAUJPH010000038.1 | GCA963394865_01864 | CDS | open | 3607-4761 | _na 384_aa | phage late control D family protein | |
| 3731 | CAUJPH010000038.1 | GCA963394865_01865 | CDS | open | 4736-5323 | _na 195_aa | phage baseplate assembly protein V | |
| 3732 | CAUJPH010000038.1 | GCA963394865_01866 | CDS | open | 5440-5811 | _na 123_aa | GPW/gp25 family protein | |
| 3733 | CAUJPH010000038.1 | GCA963394865_01867 | CDS | open | 5808-6413 | _na 201_aa | DUF4376 domain-containing protein | |
| 3734 | CAUJPH010000038.1 | GCA963394865_01868 | CDS | open | 6424-6900 | _na 158_aa | Enoyl-CoA hydratase | |
| 3735 | CAUJPH010000038.1 | GCA963394865_01869 | CDS | open | 7107-7301 | _na 64_aa | Com family DNA-binding transcriptional regulator | |
| 3736 | CAUJPH010000038.1 | GCA963394865_01870 | CDS | open | 7264-8115 | _na 283_aa | DNA cytosine methyltransferase | |
| 3737 | CAUJPH010000038.1 | GCA963394865_01871 | CDS | open | 8276-8608 | _na 110_aa | hypothetical protein | |
| 3738 | CAUJPH010000038.1 | GCA963394865_01861 | gene | open | 67-2448 | |||
| 3739 | CAUJPH010000038.1 | GCA963394865_01862 | gene | open | 2489-3385 | |||
| 3740 | CAUJPH010000038.1 | GCA963394865_01863 | gene | open | 3386-3610 | |||
| 3741 | CAUJPH010000038.1 | GCA963394865_01864 | gene | open | 3607-4761 | |||
| 3742 | CAUJPH010000038.1 | GCA963394865_01865 | gene | open | 4736-5323 | |||
| 3743 | CAUJPH010000038.1 | GCA963394865_01866 | gene | open | 5440-5811 | |||
| 3744 | CAUJPH010000038.1 | GCA963394865_01867 | gene | open | 5808-6413 | |||
| 3745 | CAUJPH010000038.1 | GCA963394865_01868 | gene | open | 6424-6900 | |||
| 3746 | CAUJPH010000038.1 | GCA963394865_01869 | gene | open | 7107-7301 | |||
| 3747 | CAUJPH010000038.1 | GCA963394865_01870 | gene | open | 7264-8115 | |||
| 3748 | CAUJPH010000038.1 | GCA963394865_01871 | gene | open | 8276-8608 | |||
| 3749 | CAUJPH010000039.1 | GCA963394865_01873 | gene | open | 829-916 | NmsRb | ||
| 3750 | CAUJPH010000039.1 | GCA963394865_01874 | gene | open | 1029-1119 | NmsRb | ||
| 3751 | CAUJPH010000039.1 | GCA963394865_01873 | ncRNA | open | 829-916 | Neisseria metabolic switch regulator b (RcoF1/NgncR163) | ||
| 3752 | CAUJPH010000039.1 | GCA963394865_01874 | ncRNA | open | 1029-1119 | Neisseria metabolic switch regulator b (RcoF1/NgncR163) | ||
| 3753 | CAUJPH010000039.1 | GCA963394865_01872 | CDS | open | 89-550 | _na 153_aa | hypothetical protein | |
| 3754 | CAUJPH010000039.1 | GCA963394865_01875 | CDS | open | 1200-1664 | _na 154_aa | lrp | Leucine-responsive regulatory protein |
| 3755 | CAUJPH010000039.1 | GCA963394865_01876 | CDS | open | 1885-2943 | _na 352_aa | alr | alanine racemase |
| 3756 | CAUJPH010000039.1 | GCA963394865_01877 | CDS | open | 3007-4362 | _na 451_aa | UPF0210 protein NMA1908 | |
| 3757 | CAUJPH010000039.1 | GCA963394865_01878 | CDS | open | 4377-4649 | _na 90_aa | aCT | ACT domain-containing protein |
| 3758 | CAUJPH010000039.1 | GCA963394865_01879 | CDS | open | 4775-5512 | _na 245_aa | ywqK | Periplasmic protein |
| 3759 | CAUJPH010000039.1 | GCA963394865_01880 | CDS | open | 5793-6704 | _na 303_aa | prmB | 50S ribosomal protein L3 N(5)-glutamine methyltransferase |
| 3760 | CAUJPH010000039.1 | GCA963394865_01881 | CDS | open | 6837-7112 | _na 91_aa | Large polyvalent protein-associated domain 3 | |
| 3761 | CAUJPH010000039.1 | GCA963394865_01882 | CDS | open | 7404-7715 | _na 103_aa | hypothetical protein | |
| 3762 | CAUJPH010000039.1 | GCA963394865_01872 | gene | open | 89-550 | |||
| 3763 | CAUJPH010000039.1 | GCA963394865_01875 | gene | open | 1200-1664 | lrp | ||
| 3764 | CAUJPH010000039.1 | GCA963394865_01876 | gene | open | 1885-2943 | alr | ||
| 3765 | CAUJPH010000039.1 | GCA963394865_01877 | gene | open | 3007-4362 | |||
| 3766 | CAUJPH010000039.1 | GCA963394865_01878 | gene | open | 4377-4649 | aCT | ||
| 3767 | CAUJPH010000039.1 | GCA963394865_01879 | gene | open | 4775-5512 | ywqK | ||
| 3768 | CAUJPH010000039.1 | GCA963394865_01880 | gene | open | 5793-6704 | prmB | ||
| 3769 | CAUJPH010000039.1 | GCA963394865_01881 | gene | open | 6837-7112 | |||
| 3770 | CAUJPH010000039.1 | GCA963394865_01882 | gene | open | 7404-7715 | |||
| 3771 | CAUJPH010000040.1 | GCA963394865_01888 | gene | open | 5568-5747 | 6S | ||
| 3772 | CAUJPH010000040.1 | GCA963394865_01888 | ncRNA | open | 5568-5747 | 6S / SsrS RNA | ||
| 3773 | CAUJPH010000040.1 | GCA963394865_01883 | CDS | open | 112-882 | _na 256_aa | thiF | ThiF family protein |
| 3774 | CAUJPH010000040.1 | GCA963394865_01884 | CDS | open | 1049-3751 | _na 900_aa | ppc | phosphoenolpyruvate carboxylase |
| 3775 | CAUJPH010000040.1 | GCA963394865_01885 | CDS | open | 3874-4863 | _na 329_aa | gpsA | Glycerol-3-phosphate dehydrogenase [NAD(P)+] |
| 3776 | CAUJPH010000040.1 | GCA963394865_01886 | CDS | open | 4918-5247 | _na 109_aa | BZIP transcription factor | |
| 3777 | CAUJPH010000040.1 | GCA963394865_01887 | CDS | open | 5258-5563 | _na 101_aa | zapA | Cell division protein ZapA |
| 3778 | CAUJPH010000040.1 | GCA963394865_01889 | CDS | open | 5925-6356 | _na 143_aa | rplM | 50S ribosomal protein L13 |
| 3779 | CAUJPH010000040.1 | GCA963394865_01890 | CDS | open | 6366-6758 | _na 130_aa | rpsI | 30S ribosomal protein S9 |
| 3780 | CAUJPH010000040.1 | GCA963394865_01883 | gene | open | 112-882 | thiF | ||
| 3781 | CAUJPH010000040.1 | GCA963394865_01884 | gene | open | 1049-3751 | ppc | ||
| 3782 | CAUJPH010000040.1 | GCA963394865_01885 | gene | open | 3874-4863 | gpsA | ||
| 3783 | CAUJPH010000040.1 | GCA963394865_01886 | gene | open | 4918-5247 | |||
| 3784 | CAUJPH010000040.1 | GCA963394865_01887 | gene | open | 5258-5563 | zapA | ||
| 3785 | CAUJPH010000040.1 | GCA963394865_01889 | gene | open | 5925-6356 | rplM | ||
| 3786 | CAUJPH010000040.1 | GCA963394865_01890 | gene | open | 6366-6758 | rpsI | ||
| 3787 | CAUJPH010000041.1 | repeat_region | open | 1432-2265 | CRISPR array with 13 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCTAGAGGCGGCTGA and spacer length 34 | |||
| 3788 | CAUJPH010000041.1 | GCA963394865_01891 | CDS | open | 328-837 | _na 169_aa | Integrase core domain protein | |
| 3789 | CAUJPH010000041.1 | GCA963394865_01892 | CDS | open | 838-1134 | _na 98_aa | Integrase core domain | |
| 3790 | CAUJPH010000041.1 | GCA963394865_01893 | CDS | open | 1205-1357 | _na 50_aa | hypothetical protein | |
| 3791 | CAUJPH010000041.1 | GCA963394865_01894 | CDS | open | 2445-2786 | _na 113_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 3792 | CAUJPH010000041.1 | GCA963394865_01895 | CDS | open | 2793-3806 | _na 337_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 3793 | CAUJPH010000041.1 | GCA963394865_01896 | CDS | open | 4361-4963 | _na 200_aa | hypothetical protein | |
| 3794 | CAUJPH010000041.1 | GCA963394865_01897 | CDS | open | 4980-5258 | _na 92_aa | hypothetical protein | |
| 3795 | CAUJPH010000041.1 | GCA963394865_01898 | CDS | open | 5517-6452 | _na 311_aa | era | GTPase Era |
| 3796 | CAUJPH010000041.1 | GCA963394865_01891 | gene | open | 328-837 | |||
| 3797 | CAUJPH010000041.1 | GCA963394865_01892 | gene | open | 838-1134 | |||
| 3798 | CAUJPH010000041.1 | GCA963394865_01893 | gene | open | 1205-1357 | |||
| 3799 | CAUJPH010000041.1 | GCA963394865_01894 | gene | open | 2445-2786 | cas2 | ||
| 3800 | CAUJPH010000041.1 | GCA963394865_01895 | gene | open | 2793-3806 | cas1c | ||
| 3801 | CAUJPH010000041.1 | GCA963394865_01896 | gene | open | 4361-4963 | |||
| 3802 | CAUJPH010000041.1 | GCA963394865_01897 | gene | open | 4980-5258 | |||
| 3803 | CAUJPH010000041.1 | GCA963394865_01898 | gene | open | 5517-6452 | era | ||
| 3804 | CAUJPH010000042.1 | GCA963394865_01899 | CDS | open | 256-1737 | _na 493_aa | hypothetical protein | |
| 3805 | CAUJPH010000042.1 | GCA963394865_01900 | CDS | open | 1895-3301 | _na 468_aa | Outer membrane protein transport protein%2C Ompp1/FadL/TodX family | |
| 3806 | CAUJPH010000042.1 | GCA963394865_01901 | CDS | open | 3383-3487 | _na 34_aa | hypothetical protein | |
| 3807 | CAUJPH010000042.1 | GCA963394865_01902 | CDS | open | 3505-4977 | _na 490_aa | pyk | pyruvate kinase |
| 3808 | CAUJPH010000042.1 | GCA963394865_01903 | CDS | open | 5352-5870 | _na 172_aa | Integral membrane protein | |
| 3809 | CAUJPH010000042.1 | GCA963394865_01904 | CDS | open | 5919-6044 | _na 41_aa | Putative lipoprotein | |
| 3810 | CAUJPH010000042.1 | GCA963394865_01899 | gene | open | 256-1737 | |||
| 3811 | CAUJPH010000042.1 | GCA963394865_01900 | gene | open | 1895-3301 | |||
| 3812 | CAUJPH010000042.1 | GCA963394865_01901 | gene | open | 3383-3487 | |||
| 3813 | CAUJPH010000042.1 | GCA963394865_01902 | gene | open | 3505-4977 | pyk | ||
| 3814 | CAUJPH010000042.1 | GCA963394865_01903 | gene | open | 5352-5870 | |||
| 3815 | CAUJPH010000042.1 | GCA963394865_01904 | gene | open | 5919-6044 | |||
| 3816 | CAUJPH010000043.1 | GCA963394865_01905 | gene | open | 138-1678 | rrs | ||
| 3817 | CAUJPH010000043.1 | GCA963394865_01908 | gene | open | 2282-5173 | rrl | ||
| 3818 | CAUJPH010000043.1 | GCA963394865_01909 | gene | open | 5270-5383 | rrf | ||
| 3819 | CAUJPH010000043.1 | GCA963394865_01905 | rRNA | open | 138-1678 | rrs | 16S ribosomal RNA | |
| 3820 | CAUJPH010000043.1 | GCA963394865_01908 | rRNA | open | 2282-5173 | rrl | 23S ribosomal RNA | |
| 3821 | CAUJPH010000043.1 | GCA963394865_01909 | rRNA | open | 5270-5383 | rrf | 5S ribosomal RNA | |
| 3822 | CAUJPH010000043.1 | GCA963394865_01906 | gene | open | 1779-1855 | trnI | ||
| 3823 | CAUJPH010000043.1 | GCA963394865_01907 | gene | open | 1861-1936 | trnA | ||
| 3824 | CAUJPH010000043.1 | GCA963394865_01906 | tRNA | open | 1779-1855 | trnI | tRNA-Ile(gat) | |
| 3825 | CAUJPH010000043.1 | GCA963394865_01907 | tRNA | open | 1861-1936 | trnA | tRNA-Ala(tgc) | |
| 3826 | CAUJPH010000044.1 | GCA963394865_01910 | CDS | open | 405-1211 | _na 268_aa | ypjD | Glutamate synthase [NADPH] small chain |
| 3827 | CAUJPH010000044.1 | GCA963394865_01911 | CDS | open | 1431-2801 | _na 456_aa | ffh | signal recognition particle protein |
| 3828 | CAUJPH010000044.1 | GCA963394865_01912 | CDS | open | 3059-3514 | _na 151_aa | Four-helix bundle copper-binding protein | |
| 3829 | CAUJPH010000044.1 | GCA963394865_01913 | CDS | open | 3569-4174 | _na 201_aa | fMR2 | Nitroreductase domain-containing protein |
| 3830 | CAUJPH010000044.1 | GCA963394865_01910 | gene | open | 405-1211 | ypjD | ||
| 3831 | CAUJPH010000044.1 | GCA963394865_01911 | gene | open | 1431-2801 | ffh | ||
| 3832 | CAUJPH010000044.1 | GCA963394865_01912 | gene | open | 3059-3514 | |||
| 3833 | CAUJPH010000044.1 | GCA963394865_01913 | gene | open | 3569-4174 | fMR2 | ||
| 3834 | CAUJPH010000045.1 | GCA963394865_01914 | CDS | open | 792-1382 | _na 196_aa | hypothetical protein | |
| 3835 | CAUJPH010000045.1 | GCA963394865_01915 | CDS | open | 1379-2017 | _na 212_aa | queE | 7-carboxy-7-deazaguanine synthase |
| 3836 | CAUJPH010000045.1 | GCA963394865_01914 | gene | open | 792-1382 | |||
| 3837 | CAUJPH010000045.1 | GCA963394865_01915 | gene | open | 1379-2017 | queE | ||
| 3838 | CAUJPH010000046.1 | GCA963394865_01916 | CDS | open | 110-535 | _na 141_aa | nusB | transcription antitermination factor NusB |
| 3839 | CAUJPH010000046.1 | GCA963394865_01917 | CDS | open | 614-1090 | _na 158_aa | ribH | 6%2C7-dimethyl-8-ribityllumazine synthase |
| 3840 | CAUJPH010000046.1 | GCA963394865_01918 | CDS | open | 1138-1461 | _na 107_aa | DUF2185 domain-containing protein | |
| 3841 | CAUJPH010000046.1 | GCA963394865_01916 | gene | open | 110-535 | nusB | ||
| 3842 | CAUJPH010000046.1 | GCA963394865_01917 | gene | open | 614-1090 | ribH | ||
| 3843 | CAUJPH010000046.1 | GCA963394865_01918 | gene | open | 1138-1461 | |||
| 3844 | CAUJPH010000047.1 | GCA963394865_01919 | CDS | open | 162-785 | _na 207_aa | hypothetical protein | |
| 3845 | CAUJPH010000047.1 | GCA963394865_01920 | CDS | open | 764-1048 | _na 94_aa | hypothetical protein | |
| 3846 | CAUJPH010000047.1 | GCA963394865_01919 | gene | open | 162-785 | |||
| 3847 | CAUJPH010000047.1 | GCA963394865_01920 | gene | open | 764-1048 | |||
| 3848 | CAUJPH010000048.1 | GCA963394865_01921 | CDS | open | 53-703 | _na 216_aa | tnp | IS1595 family transposase |
| 3849 | CAUJPH010000048.1 | GCA963394865_01921 | gene | open | 53-703 | tnp | ||
| 3850 | CAUJPH010000049.1 | GCA963394865_01922 | CDS | open | 52-342 | _na 96_aa | hypothetical protein | |
| 3851 | CAUJPH010000049.1 | GCA963394865_01922 | gene | open | 52-342 | |||
| 3852 | CAUJPH010000053.1 | GCA963394865_01923 | CDS | open | 66-365 | _na 99_aa | comE1 | ComE1 |
| 3853 | CAUJPH010000053.1 | GCA963394865_01923 | gene | open | 66-365 | comE1 | ||
| 3854 | CAUJPH010000054.1 | GCA963394865_01924 | CDS | open | 145-333 | _na 62_aa | Transposase | |
| 3855 | CAUJPH010000054.1 | GCA963394865_01924 | gene | open | 145-333 | |||
| 3856 | CAUJPH010000055.1 | GCA963394865_01925 | CDS | open | 8-235 | _na 75_aa | Transposase | |
| 3857 | CAUJPH010000055.1 | GCA963394865_01925 | gene | open | 8-235 | |||
| 3858 | CAUJPH010000058.1 | GCA963394865_01926 | CDS | open | 47-283 | _na 78_aa | Transposase IS4-like domain-containing protein | |
| 3859 | CAUJPH010000058.1 | GCA963394865_01926 | gene | open | 47-283 |

