BAKTAGenome Explorer: Schaalia dentiphila (GCA_000154225.1)
Select a Genome:
|
BAKTA Annotations for GCA_000154225.1
|
Search & Sort all 4169 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | DS264585.1 | GCA000154225_02080 | gene | open | 734-2161 | rrs | ||
| 2 | DS264585.1 | GCA000154225_02080 | rRNA | open | 734-2161 | rrs | 16S ribosomal RNA | |
| 3 | DS264586.1 | GCA000154225_00087 | gene | open | 108635-109010 | ssrA | ||
| 4 | DS264586.1 | GCA000154225_00087 | tmRNA | open | 108635-109010 | ssrA | transfer-messenger RNA%2C SsrA | |
| 5 | DS264586.1 | rep_origin | open | 783397-783845 | ||||
| 6 | DS264586.1 | GCA000154225_00847 | gene | open | 983614-983709 | Bacteria_small_SRP | ||
| 7 | DS264586.1 | GCA000154225_01125 | gene | open | 1312165-1313705 | rrs | ||
| 8 | DS264586.1 | GCA000154225_01126 | gene | open | 1314030-1317154 | rrl | ||
| 9 | DS264586.1 | GCA000154225_01127 | gene | open | 1317280-1317397 | rrf | ||
| 10 | DS264586.1 | GCA000154225_01527 | gene | open | 1768266-1768383 | rrf | ||
| 11 | DS264586.1 | GCA000154225_01528 | gene | open | 1768506-1771630 | rrl | ||
| 12 | DS264586.1 | GCA000154225_01529 | gene | open | 1771952-1773492 | rrs | ||
| 13 | DS264586.1 | GCA000154225_01541 | gene | open | 1787197-1787560 | RNaseP_bact_a | ||
| 14 | DS264586.1 | GCA000154225_02079 | gene | open | 2390302-2390419 | rrf | ||
| 15 | DS264586.1 | GCA000154225_00847 | ncRNA | open | 983614-983709 | Bacterial small signal recognition particle RNA | ||
| 16 | DS264586.1 | GCA000154225_01541 | ncRNA | open | 1787197-1787560 | Bacterial RNase P class A | ||
| 17 | DS264586.1 | regulatory_region | open | 220004-220088 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 18 | DS264586.1 | regulatory_region | open | 400001-400141 | c-di-AMP riboswitch aptamer (ydaO/yuaA leader) | |||
| 19 | DS264586.1 | regulatory_region | open | 437998-438057 | msiK RNA | |||
| 20 | DS264586.1 | regulatory_region | open | 712666-712767 | TPP riboswitch aptamer (THI element) | |||
| 21 | DS264586.1 | regulatory_region | open | 1405657-1405786 | FMN riboswitch aptamer (RFN element) | |||
| 22 | DS264586.1 | regulatory_region | open | 1754822-1754929 | TPP riboswitch aptamer (THI element) | |||
| 23 | DS264586.1 | regulatory_region | open | 2358912-2358996 | ZMP/ZTP riboswitch aptamer (pfl RNA motif) | |||
| 24 | DS264586.1 | GCA000154225_01125 | rRNA | open | 1312165-1313705 | rrs | 16S ribosomal RNA | |
| 25 | DS264586.1 | GCA000154225_01126 | rRNA | open | 1314030-1317154 | rrl | 23S ribosomal RNA | |
| 26 | DS264586.1 | GCA000154225_01127 | rRNA | open | 1317280-1317397 | rrf | 5S ribosomal RNA | |
| 27 | DS264586.1 | GCA000154225_01527 | rRNA | open | 1768266-1768383 | rrf | 5S ribosomal RNA | |
| 28 | DS264586.1 | GCA000154225_01528 | rRNA | open | 1768506-1771630 | rrl | 23S ribosomal RNA | |
| 29 | DS264586.1 | GCA000154225_01529 | rRNA | open | 1771952-1773492 | rrs | 16S ribosomal RNA | |
| 30 | DS264586.1 | GCA000154225_02079 | rRNA | open | 2390302-2390419 | rrf | 5S ribosomal RNA | |
| 31 | DS264586.1 | repeat_region | open | 538368-541027 | CRISPR array with 44 repeats of length 26%2C consensus sequence CTCATCCCCGCTCACGCGGGGAAAAC and spacer length 35 | |||
| 32 | DS264586.1 | repeat_region | open | 541112-544140 | CRISPR array with 50 repeats of length 28%2C consensus sequence GGCTCATCCCCGCTCACGCGGGGAAAAC and spacer length 33 | |||
| 33 | DS264586.1 | repeat_region | open | 544958-545849 | CRISPR array with 15 repeats of length 28%2C consensus sequence GGCTCATCCCCGCTCACGCGGGGAAAAC and spacer length 33 | |||
| 34 | DS264586.1 | GCA000154225_00001 | CDS | open | 439-1866 | _na 475_aa | sfcA | NADP-dependent malate dehydrogenase (Oxaloacetate-decarboxylating) |
| 35 | DS264586.1 | GCA000154225_00002 | CDS | open | 2145-3641 | _na 498_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 36 | DS264586.1 | GCA000154225_00003 | CDS | open | 3641-5146 | _na 501_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 37 | DS264586.1 | GCA000154225_00004 | CDS | open | 5146-5442 | _na 98_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 38 | DS264586.1 | GCA000154225_00005 | CDS | open | 5461-6726 | _na 421_aa | Phospholipase D domain protein | |
| 39 | DS264586.1 | GCA000154225_00006 | CDS | open | 6739-9063 | _na 774_aa | ligA | NAD-dependent DNA ligase LigA |
| 40 | DS264586.1 | GCA000154225_00007 | CDS | open | 9674-12286 | _na 870_aa | ftsK | Cell division protein FtsK |
| 41 | DS264586.1 | GCA000154225_00008 | CDS | open | 12439-12690 | _na 83_aa | whiB | Transcriptional regulator WhiB |
| 42 | DS264586.1 | GCA000154225_00009 | CDS | open | 12798-14258 | _na 486_aa | histidine kinase | |
| 43 | DS264586.1 | GCA000154225_00010 | CDS | open | 14356-14838 | _na 160_aa | DUF2505 domain-containing protein | |
| 44 | DS264586.1 | GCA000154225_00011 | CDS | open | 14924-15349 | _na 141_aa | OsmC-like protein | |
| 45 | DS264586.1 | GCA000154225_00012 | CDS | open | 15351-16154 | _na 267_aa | thymidylate synthase | |
| 46 | DS264586.1 | GCA000154225_00013 | CDS | open | 16151-16684 | _na 177_aa | Dihydrofolate reductase | |
| 47 | DS264586.1 | GCA000154225_00014 | CDS | open | 16757-18091 | _na 444_aa | Major facilitator transporter | |
| 48 | DS264586.1 | GCA000154225_00015 | CDS | open | 18180-19589 | _na 469_aa | fumC | class II fumarate hydratase |
| 49 | DS264586.1 | GCA000154225_00016 | CDS | open | 19763-20575 | _na 270_aa | protein-ADP-ribose hydrolase | |
| 50 | DS264586.1 | GCA000154225_00017 | CDS | open | 20600-21427 | _na 275_aa | Deacetylase sirtuin-type domain-containing protein | |
| 51 | DS264586.1 | GCA000154225_00018 | CDS | open | 21445-22245 | _na 266_aa | putative membrane transporter protein | |
| 52 | DS264586.1 | GCA000154225_00019 | CDS | open | 22376-22927 | _na 183_aa | Flavodoxin-like protein | |
| 53 | DS264586.1 | GCA000154225_00020 | CDS | open | 23084-23617 | _na 177_aa | Protein CrcB-like protein | |
| 54 | DS264586.1 | GCA000154225_00021 | CDS | open | 23721-24044 | _na 107_aa | tfoX | TfoX N-terminal domain protein |
| 55 | DS264586.1 | GCA000154225_00022 | CDS | open | 24168-24395 | _na 75_aa | hypothetical protein | |
| 56 | DS264586.1 | GCA000154225_00023 | CDS | open | 24494-24859 | _na 121_aa | hypothetical protein | |
| 57 | DS264586.1 | GCA000154225_00024 | CDS | open | 24860-25768 | _na 302_aa | Divergent AAA domain protein | |
| 58 | DS264586.1 | GCA000154225_00025 | CDS | open | 25918-28971 | _na 1017_aa | Type I restriction enzyme endonuclease subunit | |
| 59 | DS264586.1 | GCA000154225_00026 | CDS | open | 29854-30144 | _na 96_aa | hypothetical protein | |
| 60 | DS264586.1 | GCA000154225_00027 | CDS | open | 30905-32815 | _na 636_aa | AAA family ATPase | |
| 61 | DS264586.1 | GCA000154225_00028 | CDS | open | 33113-33385 | _na 90_aa | ISL3 family transposase | |
| 62 | DS264586.1 | GCA000154225_00029 | CDS | open | 33414-33917 | _na 167_aa | Transposase | |
| 63 | DS264586.1 | GCA000154225_00030 | CDS | open | 33934-34638 | _na 234_aa | hypothetical protein | |
| 64 | DS264586.1 | GCA000154225_00031 | CDS | open | 35018-36169 | _na 383_aa | Type I restriction modification DNA specificity domain protein | |
| 65 | DS264586.1 | GCA000154225_00032 | CDS | open | 36166-37746 | _na 526_aa | type I restriction-modification system subunit M | |
| 66 | DS264586.1 | GCA000154225_00033 | CDS | open | 37900-38070 | _na 56_aa | hypothetical protein | |
| 67 | DS264586.1 | GCA000154225_00034 | CDS | open | 37992-38912 | _na 306_aa | PH domain-containing protein | |
| 68 | DS264586.1 | GCA000154225_00035 | CDS | open | 39076-39426 | _na 116_aa | DUF1499 domain-containing protein | |
| 69 | DS264586.1 | GCA000154225_00036 | CDS | open | 39718-40350 | _na 210_aa | DUF4232 domain-containing protein | |
| 70 | DS264586.1 | GCA000154225_00037 | CDS | open | 40466-41968 | _na 500_aa | lysP | Lysine-specific permease |
| 71 | DS264586.1 | GCA000154225_00038 | CDS | open | 42186-42878 | _na 230_aa | sapB | Methyltransferase |
| 72 | DS264586.1 | GCA000154225_00039 | CDS | open | 42951-44735 | _na 594_aa | Cytochrome c1 family protein | |
| 73 | DS264586.1 | GCA000154225_00041 | CDS | open | 45030-45536 | _na 168_aa | Tat pathway signal sequence domain protein | |
| 74 | DS264586.1 | GCA000154225_00042 | CDS | open | 45681-46448 | _na 255_aa | hypothetical protein | |
| 75 | DS264586.1 | GCA000154225_00043 | CDS | open | 46650-49802 | _na 1050_aa | UPF0182 protein HMPREF0058_2342 | |
| 76 | DS264586.1 | GCA000154225_00044 | CDS | open | 49859-50416 | _na 185_aa | DUF222 domain-containing protein | |
| 77 | DS264586.1 | GCA000154225_00045 | CDS | open | 50522-51769 | _na 415_aa | endopeptidase La | |
| 78 | DS264586.1 | GCA000154225_00046 | CDS | open | 51840-53306 | _na 488_aa | putative conserved protein | |
| 79 | DS264586.1 | GCA000154225_00047 | CDS | open | 53417-54295 | _na 292_aa | Bacteriocin biosynthesis cyclodehydratase domain protein | |
| 80 | DS264586.1 | GCA000154225_00048 | CDS | open | 54297-56321 | _na 674_aa | recQ | DNA 3'-5' helicase |
| 81 | DS264586.1 | GCA000154225_00049 | CDS | open | 56339-57274 | _na 311_aa | nudC | NAD(+) diphosphatase |
| 82 | DS264586.1 | GCA000154225_00050 | CDS | open | 57311-58078 | _na 255_aa | rph | ribonuclease PH |
| 83 | DS264586.1 | GCA000154225_00051 | CDS | open | 58075-58689 | _na 204_aa | rdgB | RdgB/HAM1 family non-canonical purine NTP pyrophosphatase |
| 84 | DS264586.1 | GCA000154225_00052 | CDS | open | 58765-58887 | _na 40_aa | hypothetical protein | |
| 85 | DS264586.1 | GCA000154225_00053 | CDS | open | 59140-59472 | _na 110_aa | Cyclic nucleotide-binding protein | |
| 86 | DS264586.1 | GCA000154225_00054 | CDS | open | 59559-60476 | _na 305_aa | Morphology and auto-aggregation control protein | |
| 87 | DS264586.1 | GCA000154225_00055 | CDS | open | 60522-61319 | _na 265_aa | Metallo-beta-lactamase domain-containing protein | |
| 88 | DS264586.1 | GCA000154225_00056 | CDS | open | 61316-62146 | _na 276_aa | murI | glutamate racemase |
| 89 | DS264586.1 | GCA000154225_00057 | CDS | open | 62163-62735 | _na 190_aa | DUF2017 domain-containing protein | |
| 90 | DS264586.1 | GCA000154225_00058 | CDS | open | 62740-63027 | _na 95_aa | clpS | ATP-dependent Clp protease adapter ClpS |
| 91 | DS264586.1 | GCA000154225_00059 | CDS | open | 63160-64452 | _na 430_aa | pncB | nicotinate phosphoribosyltransferase |
| 92 | DS264586.1 | GCA000154225_00060 | CDS | open | 64560-66302 | _na 580_aa | sSL2 | Helicase ATP-binding domain-containing protein |
| 93 | DS264586.1 | GCA000154225_00061 | CDS | open | 66299-66631 | _na 110_aa | DUF3039 domain-containing protein | |
| 94 | DS264586.1 | GCA000154225_00062 | CDS | open | 66766-67539 | _na 257_aa | nagB | glucosamine-6-phosphate deaminase |
| 95 | DS264586.1 | GCA000154225_00063 | CDS | open | 67615-68295 | _na 226_aa | cutC | PF03932 family protein CutC |
| 96 | DS264586.1 | GCA000154225_00064 | CDS | open | 68292-69224 | _na 310_aa | Glucokinase | |
| 97 | DS264586.1 | GCA000154225_00065 | CDS | open | 69221-70678 | _na 485_aa | mlrC | MlrC |
| 98 | DS264586.1 | GCA000154225_00066 | CDS | open | 70675-71823 | _na 382_aa | nagC | Making large colonies protein |
| 99 | DS264586.1 | GCA000154225_00067 | CDS | open | 72073-73884 | _na 603_aa | appA | Oligopeptide-binding protein AppA |
| 100 | DS264586.1 | GCA000154225_00068 | CDS | open | 73964-74923 | _na 319_aa | dppB | Dipeptide transport system permease protein dppB |
| 101 | DS264586.1 | GCA000154225_00069 | CDS | open | 74920-75819 | _na 299_aa | dppC | Oligopeptide ABC superfamily ATP binding cassette transporter%2C membrane protein |
| 102 | DS264586.1 | GCA000154225_00070 | CDS | open | 75830-77881 | _na 683_aa | oppF | murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF |
| 103 | DS264586.1 | GCA000154225_00071 | CDS | open | 78678-78959 | _na 93_aa | hupA | DNA-binding protein HB1 |
| 104 | DS264586.1 | GCA000154225_00072 | CDS | open | 79459-79599 | _na 46_aa | hypothetical protein | |
| 105 | DS264586.1 | GCA000154225_00073 | CDS | open | 79693-80706 | _na 337_aa | lacI | LacI family transcriptional regulator |
| 106 | DS264586.1 | GCA000154225_00074 | CDS | open | 80872-82812 | _na 646_aa | Xanthine permease | |
| 107 | DS264586.1 | GCA000154225_00075 | CDS | open | 83677-87630 | _na 1317_aa | Peptidase%2C S8/S53 family | |
| 108 | DS264586.1 | GCA000154225_00076 | CDS | open | 88075-90819 | _na 914_aa | Cell wall-binding repeat protein | |
| 109 | DS264586.1 | GCA000154225_00077 | CDS | open | 91293-97937 | _na 2214_aa | BIG2 domain-containing protein | |
| 110 | DS264586.1 | GCA000154225_00078 | CDS | open | 98243-98560 | _na 105_aa | ybjQ | UPF0145 protein NCTC9935_01222 |
| 111 | DS264586.1 | GCA000154225_00079 | CDS | open | 98722-98943 | _na 73_aa | Phage protein | |
| 112 | DS264586.1 | GCA000154225_00080 | CDS | open | 99316-100101 | _na 261_aa | AB hydrolase-1 domain-containing protein | |
| 113 | DS264586.1 | GCA000154225_00081 | CDS | open | 100085-100687 | _na 200_aa | Methyltransferase type 11 domain-containing protein | |
| 114 | DS264586.1 | GCA000154225_00082 | CDS | open | 100982-101341 | _na 119_aa | Iron ABC transporter | |
| 115 | DS264586.1 | GCA000154225_00083 | CDS | open | 101464-101643 | _na 59_aa | Transposase | |
| 116 | DS264586.1 | GCA000154225_00084 | CDS | open | 101861-103501 | _na 546_aa | Coenzyme A disulfide reductase | |
| 117 | DS264586.1 | GCA000154225_00085 | CDS | open | 103942-107166 | _na 1074_aa | GED domain-containing protein | |
| 118 | DS264586.1 | GCA000154225_00086 | CDS | open | 107163-107945 | _na 260_aa | hypothetical protein | |
| 119 | DS264586.1 | GCA000154225_00088 | CDS | open | 109111-111315 | _na 734_aa | ABC transporter | |
| 120 | DS264586.1 | GCA000154225_00089 | CDS | open | 111312-113951 | _na 879_aa | Phage infection protein | |
| 121 | DS264586.1 | GCA000154225_00090 | CDS | open | 114021-114548 | _na 175_aa | smpB | SsrA-binding protein SmpB |
| 122 | DS264586.1 | GCA000154225_00091 | CDS | open | 114635-115909 | _na 424_aa | Glycyl-glycine endopeptidase ALE-1 | |
| 123 | DS264586.1 | GCA000154225_00092 | CDS | open | 115915-116829 | _na 304_aa | ftsX | permease-like cell division protein FtsX |
| 124 | DS264586.1 | GCA000154225_00093 | CDS | open | 116835-117524 | _na 229_aa | ftsE | cell division ATP-binding protein FtsE |
| 125 | DS264586.1 | GCA000154225_00094 | CDS | open | 117717-118838 | _na 373_aa | prfB | peptide chain release factor 2 |
| 126 | DS264586.1 | GCA000154225_00095 | CDS | open | 118975-120336 | _na 453_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 127 | DS264586.1 | GCA000154225_00096 | CDS | open | 120409-120852 | _na 147_aa | Flp pilus-assembly TadG-like N-terminal domain-containing protein | |
| 128 | DS264586.1 | GCA000154225_00097 | CDS | open | 120845-121243 | _na 132_aa | TadE-like protein | |
| 129 | DS264586.1 | GCA000154225_00098 | CDS | open | 121240-121629 | _na 129_aa | TadE-like protein | |
| 130 | DS264586.1 | GCA000154225_00099 | CDS | open | 121601-121771 | _na 56_aa | Pilus assembly protein | |
| 131 | DS264586.1 | GCA000154225_00100 | CDS | open | 121787-122683 | _na 298_aa | Bacterial type II secretion system domain protein F | |
| 132 | DS264586.1 | GCA000154225_00101 | CDS | open | 122680-123546 | _na 288_aa | Type II secretion system protein F | |
| 133 | DS264586.1 | GCA000154225_00102 | CDS | open | 123543-124757 | _na 404_aa | Type II/IV secretion system protein | |
| 134 | DS264586.1 | GCA000154225_00103 | CDS | open | 124790-126082 | _na 430_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 135 | DS264586.1 | GCA000154225_00104 | CDS | open | 126191-126583 | _na 130_aa | PF10066 family protein | |
| 136 | DS264586.1 | GCA000154225_00105 | CDS | open | 126580-127335 | _na 251_aa | Glycosyltransferase%2C group 2 family protein | |
| 137 | DS264586.1 | GCA000154225_00106 | CDS | open | 127336-128208 | _na 290_aa | rfbA | glucose-1-phosphate thymidylyltransferase RfbA |
| 138 | DS264586.1 | GCA000154225_00107 | CDS | open | 128404-129831 | _na 475_aa | rfbC | dTDP-4-dehydrorhamnose reductase |
| 139 | DS264586.1 | GCA000154225_00108 | CDS | open | 129908-130582 | _na 224_aa | IS3 family transposase | |
| 140 | DS264586.1 | GCA000154225_00109 | CDS | open | 130768-131280 | _na 170_aa | Insertion element IS150 protein InsJ-like helix-turn-helix domain-containing protein | |
| 141 | DS264586.1 | GCA000154225_00110 | CDS | open | 131619-132110 | _na 163_aa | Phosphohydrolase | |
| 142 | DS264586.1 | GCA000154225_00111 | CDS | open | 132110-132997 | _na 295_aa | nudI | Nucleoside triphosphatase nudI |
| 143 | DS264586.1 | GCA000154225_00112 | CDS | open | 133000-134280 | _na 426_aa | CorA-like protein | |
| 144 | DS264586.1 | GCA000154225_00113 | CDS | open | 134499-136559 | _na 686_aa | N-acetylmuramoyl-L-alanine amidase | |
| 145 | DS264586.1 | GCA000154225_00114 | CDS | open | 136773-137954 | _na 393_aa | Glycosyltransferase subfamily 4-like N-terminal domain-containing protein | |
| 146 | DS264586.1 | GCA000154225_00115 | CDS | open | 137948-139252 | _na 434_aa | tuaD | UDP-glucose 6-dehydrogenase tuaD |
| 147 | DS264586.1 | GCA000154225_00116 | CDS | open | 139299-140441 | _na 380_aa | Glycosyltransferase | |
| 148 | DS264586.1 | GCA000154225_00117 | CDS | open | 140463-141743 | _na 426_aa | Polysaccharide biosynthesis protein | |
| 149 | DS264586.1 | GCA000154225_00118 | CDS | open | 141837-142940 | _na 367_aa | Glycosyltransferase%2C group 1 family protein | |
| 150 | DS264586.1 | GCA000154225_00119 | CDS | open | 142950-143960 | _na 336_aa | Inositol 2-dehydrogenase/D-chiro-inositol 3-dehydrogenase | |
| 151 | DS264586.1 | GCA000154225_00120 | CDS | open | 143935-145035 | _na 366_aa | UDP-4-amino-4-deoxy-L-arabinose--oxoglutarate aminotransferase | |
| 152 | DS264586.1 | GCA000154225_00121 | CDS | open | 145032-145697 | _na 221_aa | 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-acetyltransferase | |
| 153 | DS264586.1 | GCA000154225_00122 | CDS | open | 145812-146492 | _na 226_aa | Glycosyltransferase%2C group 2 family protein | |
| 154 | DS264586.1 | GCA000154225_00123 | CDS | open | 146489-146959 | _na 156_aa | PF10066 family protein | |
| 155 | DS264586.1 | GCA000154225_00124 | CDS | open | 146949-148259 | _na 436_aa | Transcriptional regulator | |
| 156 | DS264586.1 | GCA000154225_00125 | CDS | open | 148256-149638 | _na 460_aa | Cell envelope-related transcriptional attenuator domain-containing protein | |
| 157 | DS264586.1 | GCA000154225_00126 | CDS | open | 149740-150735 | _na 331_aa | galE | UDP-glucose 4-epimerase GalE |
| 158 | DS264586.1 | GCA000154225_00127 | CDS | open | 150799-151353 | _na 184_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 159 | DS264586.1 | GCA000154225_00128 | CDS | open | 151421-152575 | _na 384_aa | 5-(carboxyamino)imidazole ribonucleotide synthase | |
| 160 | DS264586.1 | GCA000154225_00129 | CDS | open | 152609-153937 | _na 442_aa | mprB | Signal transduction histidine-protein kinase/phosphatase MprB |
| 161 | DS264586.1 | GCA000154225_00130 | CDS | open | 153962-154639 | _na 225_aa | ompR | DNA-binding response regulator |
| 162 | DS264586.1 | GCA000154225_00131 | CDS | open | 154733-155767 | _na 344_aa | acyC | Guanylate cyclase domain-containing protein |
| 163 | DS264586.1 | GCA000154225_00132 | CDS | open | 155976-156701 | _na 241_aa | Nucleoside triphosphate pyrophosphatase | |
| 164 | DS264586.1 | GCA000154225_00133 | CDS | open | 156746-157702 | _na 318_aa | dapD | 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase |
| 165 | DS264586.1 | GCA000154225_00134 | CDS | open | 157674-158864 | _na 396_aa | dapC | succinyldiaminopimelate transaminase |
| 166 | DS264586.1 | GCA000154225_00135 | CDS | open | 158884-159225 | _na 113_aa | fdxA | ferredoxin |
| 167 | DS264586.1 | GCA000154225_00136 | CDS | open | 159278-159604 | _na 108_aa | 2-hydroxymuconic semialdehyde dehydrogenase | |
| 168 | DS264586.1 | GCA000154225_00137 | CDS | open | 159627-161546 | _na 639_aa | typA | translational GTPase TypA |
| 169 | DS264586.1 | GCA000154225_00138 | CDS | open | 161784-162638 | _na 284_aa | Putative glucose-6-phosphate 1-epimerase | |
| 170 | DS264586.1 | GCA000154225_00139 | CDS | open | 162686-163264 | _na 192_aa | 1-acyl-sn-glycerol-3-phosphate acyltransferase | |
| 171 | DS264586.1 | GCA000154225_00140 | CDS | open | 163261-164151 | _na 296_aa | Tat pathway signal sequence domain protein | |
| 172 | DS264586.1 | GCA000154225_00141 | CDS | open | 164214-165707 | _na 497_aa | glutamine synthetase | |
| 173 | DS264586.1 | GCA000154225_00142 | CDS | open | 165891-166415 | _na 174_aa | hypothetical protein | |
| 174 | DS264586.1 | GCA000154225_00143 | CDS | open | 166415-166948 | _na 177_aa | Glycoside hydrolase family 20 catalytic domain-containing protein | |
| 175 | DS264586.1 | GCA000154225_00144 | CDS | open | 167046-167501 | _na 151_aa | HTH merR-type domain-containing protein | |
| 176 | DS264586.1 | GCA000154225_00145 | CDS | open | 167649-168275 | _na 208_aa | N-acetyltransferase domain-containing protein | |
| 177 | DS264586.1 | GCA000154225_00146 | CDS | open | 168518-171046 | _na 842_aa | LPXTG-motif cell wall anchor domain protein | |
| 178 | DS264586.1 | GCA000154225_00147 | CDS | open | 171065-172153 | _na 362_aa | ecsC | EcsC family protein |
| 179 | DS264586.1 | GCA000154225_00148 | CDS | open | 172219-173277 | _na 352_aa | ecsC | EcsC family protein |
| 180 | DS264586.1 | GCA000154225_00149 | CDS | open | 173417-174235 | _na 272_aa | Histidine kinase | |
| 181 | DS264586.1 | GCA000154225_00150 | CDS | open | 174326-175819 | _na 497_aa | alpha-amylase | |
| 182 | DS264586.1 | GCA000154225_00151 | CDS | open | 175942-176820 | _na 292_aa | ugpE | ABC transporter%2C permease protein |
| 183 | DS264586.1 | GCA000154225_00152 | CDS | open | 176817-177758 | _na 313_aa | ugpA | ABC transporter%2C permease protein |
| 184 | DS264586.1 | GCA000154225_00153 | CDS | open | 177758-179065 | _na 435_aa | ABC transporter%2C solute-binding protein | |
| 185 | DS264586.1 | GCA000154225_00154 | CDS | open | 179136-180281 | _na 381_aa | ROK family protein | |
| 186 | DS264586.1 | GCA000154225_00155 | CDS | open | 180345-181586 | _na 413_aa | beta-N-acetylhexosaminidase | |
| 187 | DS264586.1 | GCA000154225_00156 | CDS | open | 181648-182640 | _na 330_aa | ecsC | EcsC protein family protein |
| 188 | DS264586.1 | GCA000154225_00157 | CDS | open | 182784-183656 | _na 290_aa | Putative membrane protein | |
| 189 | DS264586.1 | GCA000154225_00158 | CDS | open | 183677-184627 | _na 316_aa | PKD domain-containing protein | |
| 190 | DS264586.1 | GCA000154225_00159 | CDS | open | 184617-185414 | _na 265_aa | DUF6318 domain-containing protein | |
| 191 | DS264586.1 | GCA000154225_00160 | CDS | open | 185619-186662 | _na 347_aa | mcrC | 5-methylcytosine-specific restriction endonuclease system specificity protein McrC |
| 192 | DS264586.1 | GCA000154225_00161 | CDS | open | 186659-188050 | _na 463_aa | ATPase family associated with various cellular activities (AAA) | |
| 193 | DS264586.1 | GCA000154225_00162 | CDS | open | 188217-188480 | _na 87_aa | higA | HigA family addiction module antitoxin |
| 194 | DS264586.1 | GCA000154225_00163 | CDS | open | 189480-192455 | _na 991_aa | DUF5979 domain-containing protein | |
| 195 | DS264586.1 | GCA000154225_00164 | CDS | open | 193745-194827 | _na 360_aa | ychF | redox-regulated ATPase YchF |
| 196 | DS264586.1 | GCA000154225_00165 | CDS | open | 194865-195932 | _na 355_aa | ispH | 4-hydroxy-3-methylbut-2-enyl diphosphate reductase |
| 197 | DS264586.1 | GCA000154225_00166 | CDS | open | 196206-197390 | _na 394_aa | xseA | exodeoxyribonuclease VII large subunit |
| 198 | DS264586.1 | GCA000154225_00167 | CDS | open | 197443-197673 | _na 76_aa | exodeoxyribonuclease VII small subunit | |
| 199 | DS264586.1 | GCA000154225_00168 | CDS | open | 197717-198652 | _na 311_aa | pfkB | Kinase%2C PfkB family |
| 200 | DS264586.1 | GCA000154225_00169 | CDS | open | 198735-199496 | _na 253_aa | uppS | isoprenyl transferase |
| 201 | DS264586.1 | GCA000154225_00170 | CDS | open | 199683-200366 | _na 227_aa | Hemolysin | |
| 202 | DS264586.1 | GCA000154225_00171 | CDS | open | 200482-200961 | _na 159_aa | greA | transcription elongation factor GreA |
| 203 | DS264586.1 | GCA000154225_00172 | CDS | open | 201071-202555 | _na 494_aa | ATP synthase F0%2C A subunit | |
| 204 | DS264586.1 | GCA000154225_00173 | CDS | open | 202655-203281 | _na 208_aa | msrA | Peptide methionine sulfoxide reductase MsrA |
| 205 | DS264586.1 | GCA000154225_00174 | CDS | open | 203349-203747 | _na 132_aa | fkpA | Peptidyl-prolyl cis-trans isomerase |
| 206 | DS264586.1 | GCA000154225_00175 | CDS | open | 203781-204761 | _na 326_aa | Bax1 inhibitor-like family protein | |
| 207 | DS264586.1 | GCA000154225_00177 | CDS | open | 205043-206011 | _na 322_aa | Guanosine-5'-triphosphate%2C3'-diphosphate pyrophosphatase | |
| 208 | DS264586.1 | GCA000154225_00178 | CDS | open | 206073-206582 | _na 169_aa | Septum formation initiator family protein | |
| 209 | DS264586.1 | GCA000154225_00179 | CDS | open | 206579-207340 | _na 253_aa | Septum formation initiator | |
| 210 | DS264586.1 | GCA000154225_00180 | CDS | open | 207447-208724 | _na 425_aa | eno | phosphopyruvate hydratase |
| 211 | DS264586.1 | GCA000154225_00181 | CDS | open | 208907-209503 | _na 198_aa | Lipoprotein | |
| 212 | DS264586.1 | GCA000154225_00182 | CDS | open | 209558-213142 | _na 1194_aa | mfd | transcription-repair coupling factor |
| 213 | DS264586.1 | GCA000154225_00183 | CDS | open | 213196-213798 | _na 200_aa | pth | aminoacyl-tRNA hydrolase |
| 214 | DS264586.1 | GCA000154225_00184 | CDS | open | 213788-214651 | _na 287_aa | tesA | SGNH/GDSL hydrolase family protein |
| 215 | DS264586.1 | GCA000154225_00185 | CDS | open | 214753-216000 | _na 415_aa | galK | galactokinase |
| 216 | DS264586.1 | GCA000154225_00186 | CDS | open | 216133-216681 | _na 182_aa | 2'%2C5' RNA ligase family | |
| 217 | DS264586.1 | GCA000154225_00187 | CDS | open | 216813-217640 | _na 275_aa | exodeoxyribonuclease III | |
| 218 | DS264586.1 | GCA000154225_00188 | CDS | open | 217770-218678 | _na 302_aa | bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase | |
| 219 | DS264586.1 | GCA000154225_00189 | CDS | open | 218681-219964 | _na 427_aa | Serine hydroxymethyltransferase | |
| 220 | DS264586.1 | GCA000154225_00190 | CDS | open | 220397-221092 | _na 231_aa | wcaJ | Bacterial sugar transferase |
| 221 | DS264586.1 | GCA000154225_00191 | CDS | open | 221995-222783 | _na 262_aa | Glycosyltransferase%2C WecB/TagA/CpsF family | |
| 222 | DS264586.1 | GCA000154225_00192 | CDS | open | 222789-226259 | _na 1156_aa | Tat pathway signal sequence domain protein | |
| 223 | DS264586.1 | GCA000154225_00193 | CDS | open | 226485-229937 | _na 1150_aa | Fibrinogen C-terminal domain-containing protein | |
| 224 | DS264586.1 | GCA000154225_00194 | CDS | open | 230054-231541 | _na 495_aa | Polysaccharide biosynthesis protein | |
| 225 | DS264586.1 | GCA000154225_00195 | CDS | open | 231601-232254 | _na 217_aa | ARC6 IMS domain-containing protein | |
| 226 | DS264586.1 | GCA000154225_00196 | CDS | open | 232175-233692 | _na 505_aa | O-antigen polymerase | |
| 227 | DS264586.1 | GCA000154225_00197 | CDS | open | 233689-235032 | _na 447_aa | Glycosyltransferase%2C group 2 family protein | |
| 228 | DS264586.1 | GCA000154225_00198 | CDS | open | 235029-236321 | _na 430_aa | Capsular polysaccharide biosynthesis protein | |
| 229 | DS264586.1 | GCA000154225_00199 | CDS | open | 236318-237226 | _na 302_aa | Glycosyltransferase%2C group 2 family protein | |
| 230 | DS264586.1 | GCA000154225_00200 | CDS | open | 237219-238025 | _na 268_aa | CDP-alcohol phosphatidyltransferase | |
| 231 | DS264586.1 | GCA000154225_00201 | CDS | open | 238022-238519 | _na 165_aa | Glycerol-3-phosphate cytidyltransferase | |
| 232 | DS264586.1 | GCA000154225_00202 | CDS | open | 238790-239710 | _na 306_aa | purU | formyltetrahydrofolate deformylase |
| 233 | DS264586.1 | GCA000154225_00203 | CDS | open | 240165-240671 | _na 168_aa | Acetyltransferase%2C GNAT family | |
| 234 | DS264586.1 | GCA000154225_00204 | CDS | open | 241708-242697 | _na 329_aa | mdh | malate dehydrogenase |
| 235 | DS264586.1 | GCA000154225_00205 | CDS | open | 242900-243931 | _na 343_aa | Cation diffusion facilitator family transporter | |
| 236 | DS264586.1 | GCA000154225_00206 | CDS | open | 244035-244331 | _na 98_aa | Ferredoxin-like protein | |
| 237 | DS264586.1 | GCA000154225_00207 | CDS | open | 244358-244795 | _na 145_aa | fixC | Protein FixC |
| 238 | DS264586.1 | GCA000154225_00208 | CDS | open | 244777-244995 | _na 72_aa | Major facilitator superfamily (MFS) profile domain-containing protein | |
| 239 | DS264586.1 | GCA000154225_00209 | CDS | open | 245740-246972 | _na 410_aa | Amine oxidase (Flavin-containing) | |
| 240 | DS264586.1 | GCA000154225_00210 | CDS | open | 247183-248058 | _na 291_aa | merR | MerR family transcriptional regulator |
| 241 | DS264586.1 | GCA000154225_00211 | CDS | open | 248051-248965 | _na 304_aa | rbbA | ABC superfamily ATP binding cassette transporter%2C ABC protein |
| 242 | DS264586.1 | GCA000154225_00212 | CDS | open | 248962-250563 | _na 533_aa | Tat pathway signal sequence domain protein | |
| 243 | DS264586.1 | GCA000154225_00213 | CDS | open | 250591-251409 | _na 272_aa | yhfC | YhfC family intramembrane metalloprotease |
| 244 | DS264586.1 | GCA000154225_00214 | CDS | open | 251572-252978 | _na 468_aa | Endonuclease/exonuclease/phosphatase | |
| 245 | DS264586.1 | GCA000154225_00215 | CDS | open | 253248-253553 | _na 101_aa | abrB | Transcriptional regulator%2C AbrB family |
| 246 | DS264586.1 | GCA000154225_00216 | CDS | open | 253584-254507 | _na 307_aa | drrA | Daunorubicin/doxorubicin resistance ATP-binding protein DrrA |
| 247 | DS264586.1 | GCA000154225_00217 | CDS | open | 254511-255260 | _na 249_aa | ABC-2 type transporter | |
| 248 | DS264586.1 | GCA000154225_00218 | CDS | open | 255265-255813 | _na 182_aa | Tat pathway signal sequence domain protein | |
| 249 | DS264586.1 | GCA000154225_00219 | CDS | open | 255867-257546 | _na 559_aa | pgi | glucose-6-phosphate isomerase |
| 250 | DS264586.1 | GCA000154225_00220 | CDS | open | 257699-259954 | _na 751_aa | pfkA | 6-phosphofructokinase |
| 251 | DS264586.1 | GCA000154225_00221 | CDS | open | 260127-261458 | _na 443_aa | Na(+)/serine-threonine symporter | |
| 252 | DS264586.1 | GCA000154225_00222 | CDS | open | 261627-261917 | _na 96_aa | DUF3017 domain-containing protein | |
| 253 | DS264586.1 | GCA000154225_00223 | CDS | open | 262093-263571 | _na 492_aa | pta | phosphate acetyltransferase |
| 254 | DS264586.1 | GCA000154225_00224 | CDS | open | 263670-264869 | _na 399_aa | Acetate kinase | |
| 255 | DS264586.1 | GCA000154225_00225 | CDS | open | 264958-265713 | _na 251_aa | NAD-dependent protein deacylase | |
| 256 | DS264586.1 | GCA000154225_00226 | CDS | open | 265738-266643 | _na 301_aa | NAD(+)/NADH kinase | |
| 257 | DS264586.1 | GCA000154225_00227 | CDS | open | 266646-267656 | _na 336_aa | Band 7 domain-containing protein | |
| 258 | DS264586.1 | GCA000154225_00228 | CDS | open | 267761-268516 | _na 251_aa | Bifunctional NMN adenylyltransferase/Nudix hydrolase | |
| 259 | DS264586.1 | GCA000154225_00229 | CDS | open | 268537-270618 | _na 693_aa | NAD(+) synthase | |
| 260 | DS264586.1 | GCA000154225_00230 | CDS | open | 270866-271879 | _na 337_aa | yclQ | putative ABC transporter solute-binding protein yclQ |
| 261 | DS264586.1 | GCA000154225_00231 | CDS | open | 271937-272959 | _na 340_aa | Iron chelate uptake ABC transporter%2C FeCT family%2C permease protein | |
| 262 | DS264586.1 | GCA000154225_00232 | CDS | open | 272956-274041 | _na 361_aa | feuC | Iron-uptake system permease protein FeuC |
| 263 | DS264586.1 | GCA000154225_00233 | CDS | open | 274038-274793 | _na 251_aa | ceuD | putative siderophore transport system ATP-binding protein YusV |
| 264 | DS264586.1 | GCA000154225_00234 | CDS | open | 274943-275299 | _na 118_aa | Permease | |
| 265 | DS264586.1 | GCA000154225_00235 | CDS | open | 275346-276989 | _na 547_aa | site-specific DNA-methyltransferase (adenine-specific) | |
| 266 | DS264586.1 | GCA000154225_00236 | CDS | open | 277000-277749 | _na 249_aa | xhoI | Restriction endonuclease XhoI |
| 267 | DS264586.1 | GCA000154225_00237 | CDS | open | 277890-278261 | _na 123_aa | qdoI | Cupin domain protein |
| 268 | DS264586.1 | GCA000154225_00238 | CDS | open | 278258-279079 | _na 273_aa | Methyltransferase domain protein | |
| 269 | DS264586.1 | GCA000154225_00239 | CDS | open | 279160-280833 | _na 557_aa | putative phosphomannomutase | |
| 270 | DS264586.1 | GCA000154225_00240 | CDS | open | 280838-281491 | _na 217_aa | deoC | deoxyribose-phosphate aldolase |
| 271 | DS264586.1 | GCA000154225_00241 | CDS | open | 281512-282219 | _na 235_aa | deoD | purine-nucleoside phosphorylase |
| 272 | DS264586.1 | GCA000154225_00242 | CDS | open | 282332-283315 | _na 327_aa | Putative sugar-binding domain protein | |
| 273 | DS264586.1 | GCA000154225_00243 | CDS | open | 283352-284638 | _na 428_aa | deoA | thymidine phosphorylase |
| 274 | DS264586.1 | GCA000154225_00244 | CDS | open | 284625-285080 | _na 151_aa | cytidine deaminase | |
| 275 | DS264586.1 | GCA000154225_00245 | CDS | open | 285089-286369 | _na 426_aa | ABC transporter permease | |
| 276 | DS264586.1 | GCA000154225_00246 | CDS | open | 286356-287495 | _na 379_aa | Branched-chain amino acid ABC transporter%2C permease protein | |
| 277 | DS264586.1 | GCA000154225_00247 | CDS | open | 287492-289057 | _na 521_aa | nupO | Ribose ABC superfamily ATP binding cassette transporter%2C ABC protein |
| 278 | DS264586.1 | GCA000154225_00248 | CDS | open | 289150-290244 | _na 364_aa | ABC transporter substrate-binding protein PnrA-like domain-containing protein | |
| 279 | DS264586.1 | GCA000154225_00249 | CDS | open | 290399-292678 | _na 759_aa | 5'-nucleotidase%2C C-terminal domain protein | |
| 280 | DS264586.1 | GCA000154225_00250 | CDS | open | 292747-295152 | _na 801_aa | LPXTG-motif cell wall anchor domain protein | |
| 281 | DS264586.1 | GCA000154225_00251 | CDS | open | 295367-296491 | _na 374_aa | guaB | GuaB3 family IMP dehydrogenase-related protein |
| 282 | DS264586.1 | GCA000154225_00252 | CDS | open | 296572-297324 | _na 250_aa | DNA polymerase III subunit epsilon | |
| 283 | DS264586.1 | GCA000154225_00253 | CDS | open | 298017-298706 | _na 229_aa | talA | Transaldolase |
| 284 | DS264586.1 | GCA000154225_00254 | CDS | open | 298812-300335 | _na 507_aa | guaB | IMP dehydrogenase |
| 285 | DS264586.1 | GCA000154225_00255 | CDS | open | 300436-301710 | _na 424_aa | N-acylglucosamine 2-epimerase | |
| 286 | DS264586.1 | GCA000154225_00256 | CDS | open | 301828-302748 | _na 306_aa | merR | Transcriptional regulator%2C MerR family |
| 287 | DS264586.1 | GCA000154225_00257 | CDS | open | 303041-303337 | _na 98_aa | whiB | Transcriptional regulator WhiB |
| 288 | DS264586.1 | GCA000154225_00258 | CDS | open | 303428-304240 | _na 270_aa | DsbA-like protein | |
| 289 | DS264586.1 | GCA000154225_00259 | CDS | open | 304350-304646 | _na 98_aa | groES | co-chaperone GroES |
| 290 | DS264586.1 | GCA000154225_00260 | CDS | open | 304785-306119 | _na 444_aa | THUMP-like domain-containing protein | |
| 291 | DS264586.1 | GCA000154225_00261 | CDS | open | 306185-307354 | _na 389_aa | ybdK | glutamate--cysteine ligase |
| 292 | DS264586.1 | GCA000154225_00262 | CDS | open | 307501-310164 | _na 887_aa | Phosphatidylglycerol lysyltransferase C-terminal domain-containing protein | |
| 293 | DS264586.1 | GCA000154225_00263 | CDS | open | 310161-311735 | _na 524_aa | Esterase | |
| 294 | DS264586.1 | GCA000154225_00264 | CDS | open | 311751-312806 | _na 351_aa | tsaD | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD |
| 295 | DS264586.1 | GCA000154225_00265 | CDS | open | 312886-313122 | _na 78_aa | Amino acid transporter | |
| 296 | DS264586.1 | GCA000154225_00266 | CDS | open | 313327-314070 | _na 247_aa | sdhB | succinate dehydrogenase |
| 297 | DS264586.1 | GCA000154225_00267 | CDS | open | 314067-316046 | _na 659_aa | Succinate dehydrogenase / fumarate reductase flavoprotein subunit | |
| 298 | DS264586.1 | GCA000154225_00268 | CDS | open | 316063-316869 | _na 268_aa | Succinate dehydrogenase cytochrome B subunit%2C b558 family | |
| 299 | DS264586.1 | GCA000154225_00269 | CDS | open | 317008-317457 | _na 149_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 300 | DS264586.1 | GCA000154225_00270 | CDS | open | 317454-318149 | _na 231_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 301 | DS264586.1 | GCA000154225_00271 | CDS | open | 318159-318731 | _na 190_aa | tsaE | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE |
| 302 | DS264586.1 | GCA000154225_00272 | CDS | open | 318728-319996 | _na 422_aa | alr | alanine racemase |
| 303 | DS264586.1 | GCA000154225_00273 | CDS | open | 320068-321849 | _na 593_aa | ADP-dependent (S)-NAD(P)H-hydrate dehydratase | |
| 304 | DS264586.1 | GCA000154225_00274 | CDS | open | 321994-323916 | _na 640_aa | glmS | glutamine--fructose-6-phosphate transaminase (isomerizing) |
| 305 | DS264586.1 | GCA000154225_00275 | CDS | open | 323997-325037 | _na 346_aa | coaA | type I pantothenate kinase |
| 306 | DS264586.1 | GCA000154225_00276 | CDS | open | 325106-328816 | _na 1236_aa | Autolysin | |
| 307 | DS264586.1 | GCA000154225_00277 | CDS | open | 328976-329908 | _na 310_aa | ugpE | ABC transmembrane type-1 domain-containing protein |
| 308 | DS264586.1 | GCA000154225_00278 | CDS | open | 329905-330816 | _na 303_aa | ugpA | ABC transporter%2C permease protein |
| 309 | DS264586.1 | GCA000154225_00279 | CDS | open | 330923-332335 | _na 470_aa | ugpB | ABC transporter%2C solute-binding protein |
| 310 | DS264586.1 | GCA000154225_00280 | CDS | open | 332470-335325 | _na 951_aa | Beta-galactosidase | |
| 311 | DS264586.1 | GCA000154225_00281 | CDS | open | 335437-336522 | _na 361_aa | HTH lacI-type domain-containing protein | |
| 312 | DS264586.1 | GCA000154225_00282 | CDS | open | 336634-337536 | _na 300_aa | UDP-N-acetylglucosamine diphosphorylase | |
| 313 | DS264586.1 | GCA000154225_00283 | CDS | open | 337542-339017 | _na 491_aa | Sialic acid permease | |
| 314 | DS264586.1 | GCA000154225_00284 | CDS | open | 339281-341518 | _na 745_aa | exo-alpha-sialidase | |
| 315 | DS264586.1 | GCA000154225_00285 | CDS | open | 341660-343012 | _na 450_aa | glmM | phosphoglucosamine mutase |
| 316 | DS264586.1 | GCA000154225_00286 | CDS | open | 343194-343685 | _na 163_aa | rpsI | 30S ribosomal protein S9 |
| 317 | DS264586.1 | GCA000154225_00287 | CDS | open | 343724-344167 | _na 147_aa | rplM | 50S ribosomal protein L13 |
| 318 | DS264586.1 | GCA000154225_00288 | CDS | open | 344371-345279 | _na 302_aa | tRNA pseudouridine synthase A | |
| 319 | DS264586.1 | GCA000154225_00289 | CDS | open | 345276-346025 | _na 249_aa | nagC | ROK protein |
| 320 | DS264586.1 | GCA000154225_00290 | CDS | open | 346111-346680 | _na 189_aa | rplQ | 50S ribosomal protein L17 |
| 321 | DS264586.1 | GCA000154225_00291 | CDS | open | 346724-347719 | _na 331_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 322 | DS264586.1 | GCA000154225_00292 | CDS | open | 347844-348254 | _na 136_aa | rpsK | 30S ribosomal protein S11 |
| 323 | DS264586.1 | GCA000154225_00293 | CDS | open | 348316-348690 | _na 124_aa | rpsM | 30S ribosomal protein S13 |
| 324 | DS264586.1 | GCA000154225_00294 | CDS | open | 348839-348952 | _na 37_aa | rpmJ | 50S ribosomal protein L36 |
| 325 | DS264586.1 | GCA000154225_00295 | CDS | open | 348993-349214 | _na 73_aa | infA | translation initiation factor IF-1 |
| 326 | DS264586.1 | GCA000154225_00296 | CDS | open | 349672-350538 | _na 288_aa | map | type I methionyl aminopeptidase |
| 327 | DS264586.1 | GCA000154225_00297 | CDS | open | 350584-351162 | _na 192_aa | adk | adenylate kinase |
| 328 | DS264586.1 | GCA000154225_00298 | CDS | open | 351159-352451 | _na 430_aa | secY | preprotein translocase subunit SecY |
| 329 | DS264586.1 | GCA000154225_00299 | CDS | open | 352709-353173 | _na 154_aa | rplO | 50S ribosomal protein L15 |
| 330 | DS264586.1 | GCA000154225_00300 | CDS | open | 353176-353361 | _na 61_aa | rpmD | 50S ribosomal protein L30 |
| 331 | DS264586.1 | GCA000154225_00301 | CDS | open | 353361-354050 | _na 229_aa | rpsE | 30S ribosomal protein S5 |
| 332 | DS264586.1 | GCA000154225_00302 | CDS | open | 354079-354450 | _na 123_aa | rplR | 50S ribosomal protein L18 |
| 333 | DS264586.1 | GCA000154225_00303 | CDS | open | 354450-354992 | _na 180_aa | rplF | 50S ribosomal protein L6 |
| 334 | DS264586.1 | GCA000154225_00304 | CDS | open | 355008-355406 | _na 132_aa | rpsH | 30S ribosomal protein S8 |
| 335 | DS264586.1 | GCA000154225_00305 | CDS | open | 355469-355654 | _na 61_aa | rpsN | type Z 30S ribosomal protein S14 |
| 336 | DS264586.1 | GCA000154225_00306 | CDS | open | 355658-356203 | _na 181_aa | rplE | 50S ribosomal protein L5 |
| 337 | DS264586.1 | GCA000154225_00307 | CDS | open | 356206-356637 | _na 143_aa | rplX | 50S ribosomal protein L24 |
| 338 | DS264586.1 | GCA000154225_00308 | CDS | open | 356641-357009 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 339 | DS264586.1 | GCA000154225_00309 | CDS | open | 357098-357364 | _na 88_aa | rpsQ | 30S ribosomal protein S17 |
| 340 | DS264586.1 | GCA000154225_00310 | CDS | open | 357370-357603 | _na 77_aa | rpmC | 50S ribosomal protein L29 |
| 341 | DS264586.1 | GCA000154225_00311 | CDS | open | 357603-358022 | _na 139_aa | rplP | 50S ribosomal protein L16 |
| 342 | DS264586.1 | GCA000154225_00312 | CDS | open | 358028-358837 | _na 269_aa | rpsC | 30S ribosomal protein S3 |
| 343 | DS264586.1 | GCA000154225_00313 | CDS | open | 358839-359210 | _na 123_aa | rplV | 50S ribosomal protein L22 |
| 344 | DS264586.1 | GCA000154225_00314 | CDS | open | 359240-359521 | _na 93_aa | rpsS | 30S ribosomal protein S19 |
| 345 | DS264586.1 | GCA000154225_00315 | CDS | open | 359538-360374 | _na 278_aa | rplB | 50S ribosomal protein L2 |
| 346 | DS264586.1 | GCA000154225_00316 | CDS | open | 360397-360702 | _na 101_aa | rplW | 50S ribosomal protein L23 |
| 347 | DS264586.1 | GCA000154225_00317 | CDS | open | 360699-361343 | _na 214_aa | rplD | 50S ribosomal protein L4 |
| 348 | DS264586.1 | GCA000154225_00318 | CDS | open | 361346-362011 | _na 221_aa | rplC | 50S ribosomal protein L3 |
| 349 | DS264586.1 | GCA000154225_00319 | CDS | open | 362023-362331 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 350 | DS264586.1 | GCA000154225_00320 | CDS | open | 362940-364127 | _na 395_aa | tuf | elongation factor Tu |
| 351 | DS264586.1 | GCA000154225_00321 | CDS | open | 364274-366397 | _na 707_aa | fusA | elongation factor G |
| 352 | DS264586.1 | GCA000154225_00322 | CDS | open | 366478-366948 | _na 156_aa | rpsG | 30S ribosomal protein S7 |
| 353 | DS264586.1 | GCA000154225_00323 | CDS | open | 366948-367322 | _na 124_aa | rpsL | 30S ribosomal protein S12 |
| 354 | DS264586.1 | GCA000154225_00324 | CDS | open | 367828-370779 | _na 983_aa | Glycosyl hydrolase family 3 protein | |
| 355 | DS264586.1 | GCA000154225_00325 | CDS | open | 371587-372636 | _na 349_aa | DUF559 domain-containing protein | |
| 356 | DS264586.1 | GCA000154225_00326 | CDS | open | 373146-377048 | _na 1300_aa | rpoC | DNA-directed RNA polymerase subunit beta' |
| 357 | DS264586.1 | GCA000154225_00327 | CDS | open | 377064-380540 | _na 1158_aa | rpoB | DNA-directed RNA polymerase subunit beta |
| 358 | DS264586.1 | GCA000154225_00329 | CDS | open | 381010-382752 | _na 580_aa | pyruvate dehydrogenase | |
| 359 | DS264586.1 | GCA000154225_00330 | CDS | open | 382825-383421 | _na 198_aa | Tat pathway signal sequence domain protein | |
| 360 | DS264586.1 | GCA000154225_00331 | CDS | open | 383576-384472 | _na 298_aa | Fructosamine kinase | |
| 361 | DS264586.1 | GCA000154225_00332 | CDS | open | 384629-385291 | _na 220_aa | hypothetical protein | |
| 362 | DS264586.1 | GCA000154225_00334 | CDS | open | 387085-387834 | _na 249_aa | Tat pathway signal sequence domain protein | |
| 363 | DS264586.1 | GCA000154225_00335 | CDS | open | 388209-388907 | _na 232_aa | [ribosomal protein uS5]-alanine N-acetyltransferase | |
| 364 | DS264586.1 | GCA000154225_00336 | CDS | open | 388904-390130 | _na 408_aa | glp | gephyrin-like molybdotransferase Glp |
| 365 | DS264586.1 | GCA000154225_00337 | CDS | open | 390136-391035 | _na 299_aa | galU | UTP--glucose-1-phosphate uridylyltransferase |
| 366 | DS264586.1 | GCA000154225_00338 | CDS | open | 391100-391744 | _na 214_aa | 5-formyltetrahydrofolate cyclo-ligase | |
| 367 | DS264586.1 | GCA000154225_00339 | CDS | open | 392033-392446 | _na 137_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 368 | DS264586.1 | GCA000154225_00340 | CDS | open | 392575-392796 | _na 73_aa | Toxin | |
| 369 | DS264586.1 | GCA000154225_00341 | CDS | open | 392789-396997 | _na 1402_aa | Restriction endonuclease type II-like domain-containing protein | |
| 370 | DS264586.1 | GCA000154225_00342 | CDS | open | 397023-397940 | _na 305_aa | eamA | EamA domain-containing protein |
| 371 | DS264586.1 | GCA000154225_00344 | CDS | open | 398183-399115 | _na 310_aa | uspA | UspA domain-containing protein |
| 372 | DS264586.1 | GCA000154225_00345 | CDS | open | 399249-399998 | _na 249_aa | Glycoside hydrolase | |
| 373 | DS264586.1 | GCA000154225_00346 | CDS | open | 400378-401055 | _na 225_aa | ideR | Iron-dependent repressor IdeR |
| 374 | DS264586.1 | GCA000154225_00347 | CDS | open | 401229-402356 | _na 375_aa | serC | phosphoserine transaminase |
| 375 | DS264586.1 | GCA000154225_00348 | CDS | open | 402372-403661 | _na 429_aa | Transporter%2C major facilitator family protein | |
| 376 | DS264586.1 | GCA000154225_00349 | CDS | open | 403807-405258 | _na 483_aa | pbuG | Guanine/hypoxanthine permease pbuG |
| 377 | DS264586.1 | GCA000154225_00350 | CDS | open | 405380-406234 | _na 284_aa | DUF3027 domain-containing protein | |
| 378 | DS264586.1 | GCA000154225_00351 | CDS | open | 406227-406604 | _na 125_aa | cspC | Cold shock-like protein |
| 379 | DS264586.1 | GCA000154225_00352 | CDS | open | 406853-408898 | _na 681_aa | TPM domain-containing protein | |
| 380 | DS264586.1 | GCA000154225_00353 | CDS | open | 409007-409732 | _na 241_aa | PspA/IM30 family protein | |
| 381 | DS264586.1 | GCA000154225_00354 | CDS | open | 409840-410412 | _na 190_aa | NYN domain-containing protein | |
| 382 | DS264586.1 | GCA000154225_00355 | CDS | open | 410534-412054 | _na 506_aa | glpK | glycerol kinase GlpK |
| 383 | DS264586.1 | GCA000154225_00356 | CDS | open | 412207-412992 | _na 261_aa | Channel protein%2C MIP family | |
| 384 | DS264586.1 | GCA000154225_00357 | CDS | open | 413307-414248 | _na 313_aa | deoR | Deoxyribonucleoside regulator |
| 385 | DS264586.1 | GCA000154225_00358 | CDS | open | 414332-415951 | _na 539_aa | lysS | lysine--tRNA ligase |
| 386 | DS264586.1 | GCA000154225_00359 | CDS | open | 416008-416895 | _na 295_aa | ydjH | putative sugar kinase ydjH |
| 387 | DS264586.1 | GCA000154225_00360 | CDS | open | 416972-418345 | _na 457_aa | 6-phospho-beta-glucosidase | |
| 388 | DS264586.1 | GCA000154225_00361 | CDS | open | 418441-419136 | _na 231_aa | lmbE | LmbE family protein |
| 389 | DS264586.1 | GCA000154225_00362 | CDS | open | 419205-420527 | _na 440_aa | Sugar ABC superfamily ATP binding cassette transporter%2C binding protein | |
| 390 | DS264586.1 | GCA000154225_00363 | CDS | open | 420558-421403 | _na 281_aa | ycjP | Inner membrane ABC transporter permease protein ycjP |
| 391 | DS264586.1 | GCA000154225_00364 | CDS | open | 421390-422268 | _na 292_aa | ugpA | sn-glycerol-3-phosphate transport system permease protein ugpA |
| 392 | DS264586.1 | GCA000154225_00365 | CDS | open | 422451-422885 | _na 144_aa | panD | aspartate 1-decarboxylase |
| 393 | DS264586.1 | GCA000154225_00366 | CDS | open | 422882-423835 | _na 317_aa | panC | pantoate--beta-alanine ligase |
| 394 | DS264586.1 | GCA000154225_00367 | CDS | open | 423968-424876 | _na 302_aa | DUF2520 domain-containing protein | |
| 395 | DS264586.1 | GCA000154225_00368 | CDS | open | 424881-426440 | _na 519_aa | YdbS-like PH domain-containing protein | |
| 396 | DS264586.1 | GCA000154225_00369 | CDS | open | 426437-426937 | _na 166_aa | YdbS-like PH domain-containing protein | |
| 397 | DS264586.1 | GCA000154225_00370 | CDS | open | 427067-427789 | _na 240_aa | ompR | putative transcriptional regulatory protein TcrX |
| 398 | DS264586.1 | GCA000154225_00371 | CDS | open | 427791-429257 | _na 488_aa | histidine kinase | |
| 399 | DS264586.1 | GCA000154225_00372 | CDS | open | 429433-430395 | _na 320_aa | Hydrolase | |
| 400 | DS264586.1 | GCA000154225_00373 | CDS | open | 430615-430908 | _na 97_aa | ESAT-6-like protein | |
| 401 | DS264586.1 | GCA000154225_00374 | CDS | open | 431042-432670 | _na 542_aa | groL | chaperonin GroEL |
| 402 | DS264586.1 | GCA000154225_00375 | CDS | open | 433138-433716 | _na 192_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 403 | DS264586.1 | GCA000154225_00376 | CDS | open | 433803-434513 | _na 236_aa | uracil-DNA glycosylase | |
| 404 | DS264586.1 | GCA000154225_00378 | CDS | open | 434873-435805 | _na 310_aa | Thioredoxin-like fold domain-containing protein | |
| 405 | DS264586.1 | GCA000154225_00379 | CDS | open | 435866-437797 | _na 643_aa | afsK | Serine/threonine-protein kinase AfsK |
| 406 | DS264586.1 | GCA000154225_00380 | CDS | open | 438059-439189 | _na 376_aa | malK | Sugar ABC superfamily ATP binding cassette transporter%2C ABC protein |
| 407 | DS264586.1 | GCA000154225_00381 | CDS | open | 439345-440616 | _na 423_aa | DUF4032 domain-containing protein | |
| 408 | DS264586.1 | GCA000154225_00382 | CDS | open | 440655-441398 | _na 247_aa | Glycerophosphodiester phosphodiesterase family protein | |
| 409 | DS264586.1 | GCA000154225_00383 | CDS | open | 441543-442748 | _na 401_aa | hypothetical protein | |
| 410 | DS264586.1 | GCA000154225_00384 | CDS | open | 443762-444787 | _na 341_aa | fbaA | class II fructose-bisphosphate aldolase |
| 411 | DS264586.1 | GCA000154225_00385 | CDS | open | 445281-446567 | _na 428_aa | hypothetical protein | |
| 412 | DS264586.1 | GCA000154225_00386 | CDS | open | 446783-447478 | _na 231_aa | trmH | RNA methyltransferase%2C TrmH family |
| 413 | DS264586.1 | GCA000154225_00387 | CDS | open | 447513-448334 | _na 273_aa | nagD | UMP phosphatase |
| 414 | DS264586.1 | GCA000154225_00388 | CDS | open | 448361-448930 | _na 189_aa | Orotate phosphoribosyltransferase | |
| 415 | DS264586.1 | GCA000154225_00389 | CDS | open | 449008-449796 | _na 262_aa | Ketoacyl reductase | |
| 416 | DS264586.1 | GCA000154225_00390 | CDS | open | 449878-452886 | _na 1002_aa | ABC transporter-associated repeat protein | |
| 417 | DS264586.1 | GCA000154225_00391 | CDS | open | 452987-453802 | _na 271_aa | exodeoxyribonuclease III | |
| 418 | DS264586.1 | GCA000154225_00392 | CDS | open | 453881-454684 | _na 267_aa | Serine hydrolase | |
| 419 | DS264586.1 | GCA000154225_00393 | CDS | open | 454681-455469 | _na 262_aa | acrR | Transcriptional regulator%2C TetR family |
| 420 | DS264586.1 | GCA000154225_00394 | CDS | open | 455545-458157 | _na 870_aa | clpB | ATP-dependent chaperone ClpB |
| 421 | DS264586.1 | GCA000154225_00395 | CDS | open | 458278-458940 | _na 220_aa | Bacterial sensory transduction regulator | |
| 422 | DS264586.1 | GCA000154225_00396 | CDS | open | 459300-460712 | _na 470_aa | DUF418 domain-containing protein | |
| 423 | DS264586.1 | GCA000154225_00397 | CDS | open | 460801-461508 | _na 235_aa | Histidine kinase | |
| 424 | DS264586.1 | GCA000154225_00398 | CDS | open | 461711-462367 | _na 218_aa | PF12158 family protein | |
| 425 | DS264586.1 | GCA000154225_00399 | CDS | open | 462498-463238 | _na 246_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 426 | DS264586.1 | GCA000154225_00400 | CDS | open | 463235-464545 | _na 436_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 427 | DS264586.1 | GCA000154225_00401 | CDS | open | 465111-465665 | _na 184_aa | hspR | heat shock protein transcriptional repressor HspR |
| 428 | DS264586.1 | GCA000154225_00402 | CDS | open | 465669-466715 | _na 348_aa | dnaJ | DnaJ domain protein |
| 429 | DS264586.1 | GCA000154225_00403 | CDS | open | 466755-467411 | _na 218_aa | grpE | Protein GrpE |
| 430 | DS264586.1 | GCA000154225_00404 | CDS | open | 467408-469243 | _na 611_aa | dnaK | molecular chaperone DnaK |
| 431 | DS264586.1 | GCA000154225_00405 | CDS | open | 469557-472697 | _na 1046_aa | DUF5979 domain-containing protein | |
| 432 | DS264586.1 | GCA000154225_00406 | CDS | open | 473047-475419 | _na 790_aa | Alpha-L-fucosidase | |
| 433 | DS264586.1 | GCA000154225_00407 | CDS | open | 475499-476656 | _na 385_aa | rumB | Putative 23S rRNA (Uracil-5-)-methyltransferase RumB |
| 434 | DS264586.1 | GCA000154225_00408 | CDS | open | 476724-477179 | _na 151_aa | Acetyltransferase%2C GNAT family | |
| 435 | DS264586.1 | GCA000154225_00409 | CDS | open | 477830-478111 | _na 93_aa | Transposase | |
| 436 | DS264586.1 | GCA000154225_00410 | CDS | open | 478273-478956 | _na 227_aa | IS3 family transposase | |
| 437 | DS264586.1 | GCA000154225_00411 | CDS | open | 479333-479965 | _na 210_aa | hypothetical protein | |
| 438 | DS264586.1 | GCA000154225_00412 | CDS | open | 480038-480877 | _na 279_aa | 2%2C5-diketo-D-gluconic acid reductase B | |
| 439 | DS264586.1 | GCA000154225_00413 | CDS | open | 480916-482229 | _na 437_aa | M18 family aminopeptidase | |
| 440 | DS264586.1 | GCA000154225_00414 | CDS | open | 482388-482819 | _na 143_aa | Peroxiredoxin%2C Ohr subfamily | |
| 441 | DS264586.1 | GCA000154225_00415 | CDS | open | 482930-483451 | _na 173_aa | Hydrolase%2C NUDIX family | |
| 442 | DS264586.1 | GCA000154225_00416 | CDS | open | 483470-485092 | _na 540_aa | ybjL | TrkA protein |
| 443 | DS264586.1 | GCA000154225_00417 | CDS | open | 485155-485643 | _na 162_aa | DUF2510 domain-containing protein | |
| 444 | DS264586.1 | GCA000154225_00418 | CDS | open | 485640-486350 | _na 236_aa | 3-demethylubiquinone-9 3-methyltransferase | |
| 445 | DS264586.1 | GCA000154225_00419 | CDS | open | 486396-486959 | _na 187_aa | DUF2510 domain-containing protein | |
| 446 | DS264586.1 | GCA000154225_00420 | CDS | open | 486956-487648 | _na 230_aa | hypothetical protein | |
| 447 | DS264586.1 | GCA000154225_00421 | CDS | open | 487733-488053 | _na 106_aa | Small transmembrane and glycosylated protein | |
| 448 | DS264586.1 | GCA000154225_00422 | CDS | open | 488050-488763 | _na 237_aa | Tat pathway signal sequence domain protein | |
| 449 | DS264586.1 | GCA000154225_00423 | CDS | open | 488892-489314 | _na 140_aa | S4 domain protein | |
| 450 | DS264586.1 | GCA000154225_00424 | CDS | open | 489324-492047 | _na 907_aa | Putative ATP synthase F0%2C A subunit | |
| 451 | DS264586.1 | GCA000154225_00425 | CDS | open | 492047-492784 | _na 245_aa | lolD | ABC superfamily ATP binding cassette transporter%2C ABC protein |
| 452 | DS264586.1 | GCA000154225_00426 | CDS | open | 492781-493389 | _na 202_aa | padR | Transcriptional regulator%2C PadR family |
| 453 | DS264586.1 | GCA000154225_00427 | CDS | open | 493781-494182 | _na 133_aa | DUF3806 domain-containing protein | |
| 454 | DS264586.1 | GCA000154225_00428 | CDS | open | 494250-495128 | _na 292_aa | putative oxidoreductase MSMEG_2408 | |
| 455 | DS264586.1 | GCA000154225_00429 | CDS | open | 495148-496467 | _na 439_aa | galT | DUF4921 domain-containing protein |
| 456 | DS264586.1 | GCA000154225_00430 | CDS | open | 496494-497786 | _na 430_aa | ABC transporter%2C solute-binding protein | |
| 457 | DS264586.1 | GCA000154225_00431 | CDS | open | 497927-498205 | _na 92_aa | DUF4235 domain-containing protein | |
| 458 | DS264586.1 | GCA000154225_00432 | CDS | open | 498236-498568 | _na 110_aa | Bacterial SCP orthologue domain-containing protein | |
| 459 | DS264586.1 | GCA000154225_00433 | CDS | open | 498704-499612 | _na 302_aa | Cytochrome C oxidase subunit IV | |
| 460 | DS264586.1 | GCA000154225_00434 | CDS | open | 499853-500620 | _na 255_aa | Phosphatidylcholine synthase | |
| 461 | DS264586.1 | GCA000154225_00435 | CDS | open | 502438-504795 | _na 785_aa | purL | phosphoribosylformylglycinamidine synthase subunit PurL |
| 462 | DS264586.1 | GCA000154225_00436 | CDS | open | 504865-505572 | _na 235_aa | purQ | phosphoribosylformylglycinamidine synthase subunit PurQ |
| 463 | DS264586.1 | GCA000154225_00437 | CDS | open | 505569-505850 | _na 93_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 464 | DS264586.1 | GCA000154225_00438 | CDS | open | 505915-506916 | _na 333_aa | phosphoribosylaminoimidazolesuccinocarboxamide synthase | |
| 465 | DS264586.1 | GCA000154225_00439 | CDS | open | 506936-508270 | _na 444_aa | Phosphoribosylamine--glycine ligase | |
| 466 | DS264586.1 | GCA000154225_00440 | CDS | open | 508363-509388 | _na 341_aa | Tetratricopeptide repeat protein | |
| 467 | DS264586.1 | GCA000154225_00441 | CDS | open | 509378-510412 | _na 344_aa | VWFA domain-containing protein | |
| 468 | DS264586.1 | GCA000154225_00442 | CDS | open | 510414-511430 | _na 338_aa | VWFA domain-containing protein | |
| 469 | DS264586.1 | GCA000154225_00443 | CDS | open | 511427-511939 | _na 170_aa | DUF4381 domain-containing protein | |
| 470 | DS264586.1 | GCA000154225_00444 | CDS | open | 512194-513048 | _na 284_aa | Sortase (Surface protein transpeptidase) | |
| 471 | DS264586.1 | GCA000154225_00445 | CDS | open | 513189-516071 | _na 960_aa | LPXTG-motif cell wall anchor domain protein | |
| 472 | DS264586.1 | GCA000154225_00446 | CDS | open | 516229-517830 | _na 533_aa | Type 2 fimbrial subunit | |
| 473 | DS264586.1 | GCA000154225_00447 | CDS | open | 518045-518938 | _na 297_aa | DUF58 domain-containing protein | |
| 474 | DS264586.1 | GCA000154225_00448 | CDS | open | 518979-519968 | _na 329_aa | mMP0363 | AAA family ATPase |
| 475 | DS264586.1 | GCA000154225_00449 | CDS | open | 520174-522009 | _na 611_aa | pepCK | phosphoenolpyruvate carboxykinase (GTP) |
| 476 | DS264586.1 | GCA000154225_00450 | CDS | open | 522348-523013 | _na 221_aa | ykaA | TIGR00153 family protein |
| 477 | DS264586.1 | GCA000154225_00451 | CDS | open | 523017-524081 | _na 354_aa | Phosphate transporter | |
| 478 | DS264586.1 | GCA000154225_00452 | CDS | open | 524081-524518 | _na 145_aa | Septum formation-related domain-containing protein | |
| 479 | DS264586.1 | GCA000154225_00453 | CDS | open | 524701-525951 | _na 416_aa | Hydrolase%2C NUDIX family | |
| 480 | DS264586.1 | GCA000154225_00454 | CDS | open | 526086-526715 | _na 209_aa | Histone acetyltransferase | |
| 481 | DS264586.1 | GCA000154225_00456 | CDS | open | 526888-529011 | _na 707_aa | ADP-ribosylglycohydrolase | |
| 482 | DS264586.1 | GCA000154225_00457 | CDS | open | 529151-530395 | _na 414_aa | Drug resistance transporter%2C Bcr/CflA subfamily | |
| 483 | DS264586.1 | GCA000154225_00458 | CDS | open | 530766-531626 | _na 286_aa | eamA | EamA family transporter |
| 484 | DS264586.1 | GCA000154225_00459 | CDS | open | 531623-532027 | _na 134_aa | msrB | Peptide methionine sulfoxide reductase MsrB |
| 485 | DS264586.1 | GCA000154225_00460 | CDS | open | 532109-533125 | _na 338_aa | Tat pathway signal sequence domain protein | |
| 486 | DS264586.1 | GCA000154225_00461 | CDS | open | 533240-536497 | _na 1085_aa | mscS | Transporter%2C small conductance mechanosensitive ion channel MscS family protein |
| 487 | DS264586.1 | GCA000154225_00465 | CDS | open | 537177-537755 | _na 192_aa | Excalibur domain protein | |
| 488 | DS264586.1 | GCA000154225_00466 | CDS | open | 537891-538187 | _na 98_aa | hypothetical protein | |
| 489 | DS264586.1 | GCA000154225_00467 | CDS | open | 546259-547221 | _na 320_aa | cas1e | type I-E CRISPR-associated endonuclease Cas1e |
| 490 | DS264586.1 | GCA000154225_00468 | CDS | open | 547218-547967 | _na 249_aa | cas6e | type I-E CRISPR-associated protein Cas6/Cse3/CasE |
| 491 | DS264586.1 | GCA000154225_00469 | CDS | open | 547967-548695 | _na 242_aa | cas5e | type I-E CRISPR-associated protein Cas5/CasD |
| 492 | DS264586.1 | GCA000154225_00470 | CDS | open | 548692-549816 | _na 374_aa | cas7e | type I-E CRISPR-associated protein Cas7/Cse4/CasC |
| 493 | DS264586.1 | GCA000154225_00471 | CDS | open | 549862-550512 | _na 216_aa | casB | type I-E CRISPR-associated protein Cse2/CasB |
| 494 | DS264586.1 | GCA000154225_00472 | CDS | open | 550509-552179 | _na 556_aa | casA | type I-E CRISPR-associated protein Cse1/CasA |
| 495 | DS264586.1 | GCA000154225_00473 | CDS | open | 552176-555169 | _na 997_aa | CRISPR-associated helicase Cas3 | |
| 496 | DS264586.1 | GCA000154225_00474 | CDS | open | 555576-557258 | _na 560_aa | ABC transporter domain-containing protein | |
| 497 | DS264586.1 | GCA000154225_00475 | CDS | open | 557351-557797 | _na 148_aa | Phage holin family protein | |
| 498 | DS264586.1 | GCA000154225_00476 | CDS | open | 557794-558222 | _na 142_aa | DUF3618 domain-containing protein | |
| 499 | DS264586.1 | GCA000154225_00477 | CDS | open | 558457-558735 | _na 92_aa | DUF3073 domain-containing protein | |
| 500 | DS264586.1 | GCA000154225_00478 | CDS | open | 558979-560139 | _na 386_aa | Phosphoribosylformylglycinamidine cyclo-ligase |

