HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Neisseria weaveri (GCA_000224275.2)

Select a Genome:
BAKTA Annotations for GCA_000224275.2
Genome Selected: Neisseria weaveri
ContigsBases CDSrRNA tmRNAtRNA
40 2,125,582 1928 3 2 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 3983 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 3983 [8 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 AFWR01000001.1 repeat_region open 56-363 CRISPR array with 5 repeats of length 31%2C consensus sequence CAGCCGCCTTCGGGCGGCTGTGTGTTGAAAC and spacer length 35
2 AFWR01000001.1 GCA000224275_01888 CDS open 517-1353 _na     278_aa Putative N-6adenine-specific DNA methylase
3 AFWR01000001.1 GCA000224275_01889 CDS open 1675-2976 _na     433_aa Chromosome segregation protein SMC
4 AFWR01000001.1 GCA000224275_01890 CDS open 2979-3251 _na     90_aa hypothetical protein
5 AFWR01000001.1 GCA000224275_01891 CDS open 3253-3990 _na     245_aa Putative phage fiber-spike protein
6 AFWR01000001.1 GCA000224275_01892 CDS open 4003-5301 _na     432_aa Putative phage tail fiber protein
7 AFWR01000001.1 GCA000224275_01893 CDS open 5305-5868 _na     187_aa ymfQ Phage tail protein
8 AFWR01000001.1 GCA000224275_01894 CDS open 5865-6920 _na     351_aa Baseplate protein J-like domain-containing protein
9 AFWR01000001.1 GCA000224275_01895 CDS open 6946-7293 _na     115_aa gp46 Bacteriophage protein GP46
10 AFWR01000001.1 GCA000224275_01896 CDS open 7394-8062 _na     222_aa gp45 Baseplate assembly protein V
11 AFWR01000001.1 GCA000224275_01897 CDS open 8059-8817 _na     252_aa Phage tail protein
12 AFWR01000001.1 GCA000224275_01898 CDS open 8827-9204 _na     125_aa Mu-like prophage tail protein gpP
13 AFWR01000001.1 GCA000224275_01899 CDS open 9194-10525 _na     443_aa Phage virion protein
14 AFWR01000001.1 GCA000224275_01900 CDS open 10525-12621 _na     698_aa Phage-related minor tail protein
15 AFWR01000001.1 GCA000224275_01901 CDS open 12691-12912 _na     73_aa hypothetical protein
16 AFWR01000001.1 GCA000224275_01902 CDS open 12916-13071 _na     51_aa Phage associated protein
17 AFWR01000001.1 GCA000224275_01903 CDS open 13071-13496 _na     141_aa Phage associated protein
18 AFWR01000001.1 GCA000224275_01904 CDS open 13503-13880 _na     125_aa phage tail protein
19 AFWR01000001.1 GCA000224275_01905 CDS open 13945-15354 _na     469_aa gpL Phage sheath protein
20 AFWR01000001.1 GCA000224275_01906 CDS open 15357-15551 _na     64_aa DUF2635 domain-containing protein
21 AFWR01000001.1 GCA000224275_01907 CDS open 15548-16198 _na     216_aa Putative Gp37-like prophage protein
22 AFWR01000001.1 GCA000224275_01908 CDS open 16188-16610 _na     140_aa Phage protein
23 AFWR01000001.1 GCA000224275_01909 CDS open 16614-16994 _na     126_aa hypothetical protein
24 AFWR01000001.1 GCA000224275_01910 CDS open 17060-17809 _na     249_aa Putative GpT-like prophage major head subunit protein
25 AFWR01000001.1 GCA000224275_01911 CDS open 17778-17969 _na     63_aa Phage associated protein
26 AFWR01000001.1 GCA000224275_01912 CDS open 17972-19030 _na     352_aa Phage protease
27 AFWR01000001.1 GCA000224275_01913 CDS open 19241-19657 _na     138_aa phage virion morphogenesis protein
28 AFWR01000001.1 GCA000224275_01914 CDS open 19760-20044 _na     94_aa Putative phage head morphogenesis protein
29 AFWR01000001.1 GCA000224275_01915 CDS open 20432-21970 _na     512_aa Ornithine/acetylornithine aminotransferase
30 AFWR01000001.1 GCA000224275_01916 CDS open 22689-25208 _na     839_aa Pectate lyase superfamily protein
31 AFWR01000001.1 GCA000224275_01917 CDS open 25315-26670 _na     451_aa ATP-dependent RNA helicase
32 AFWR01000001.1 GCA000224275_01918 CDS open 27006-27953 _na     315_aa Putative methyltransferase
33 AFWR01000001.1 GCA000224275_01919 CDS open 27994-28212 _na     72_aa Lipoprotein
34 AFWR01000001.1 GCA000224275_01920 CDS open 28304-28891 _na     195_aa Glucan endo-1%2C3-beta-glucosidase
35 AFWR01000001.1 GCA000224275_01921 CDS open 28970-30232 _na     420_aa Gluconate permease
36 AFWR01000001.1 GCA000224275_01922 CDS open 30242-31381 _na     379_aa Glycerate kinase
37 AFWR01000001.1 GCA000224275_01923 CDS open 31403-31933 _na     176_aa Lipoprotein
38 AFWR01000001.1 GCA000224275_01924 CDS open 32076-32759 _na     227_aa NAD-dependent protein deacylase
39 AFWR01000001.1 GCA000224275_01925 CDS open 32961-33428 _na     155_aa HXXEE domain-containing protein
40 AFWR01000001.1 GCA000224275_01926 CDS open 33694-34881 _na     395_aa Acetylornithine aminotransferase
41 AFWR01000001.1 GCA000224275_01927 CDS open 35100-35381 _na     93_aa yhbY ribosome assembly RNA-binding protein YhbY
42 AFWR01000001.1 GCA000224275_01928 CDS open 35489-36109 _na     206_aa Ribosomal RNA large subunit methyltransferase E
43 AFWR01000001.1 GCA000224275_01929 CDS open 36165-38195 _na     676_aa ftsH ATP-dependent zinc metalloprotease FtsH
44 AFWR01000001.1 GCA000224275_01930 CDS open 38300-39151 _na     283_aa folP dihydropteroate synthase
45 AFWR01000001.1 GCA000224275_01931 CDS open 39322-40656 _na     444_aa glmM phosphoglucosamine mutase
46 AFWR01000001.1 GCA000224275_01932 CDS open 40745-41437 _na     230_aa DedA-family integral membrane protein
47 AFWR01000001.1 GCA000224275_01933 CDS open 41645-42613 _na     322_aa speB agmatinase
48 AFWR01000001.1 GCA000224275_01934 CDS open 42670-43656 _na     328_aa L-asparaginase
49 AFWR01000001.1 GCA000224275_01935 CDS open 43736-44350 _na     204_aa DUF4230 domain-containing protein
50 AFWR01000001.1 GCA000224275_01936 CDS open 44383-44877 _na     164_aa tpx thiol peroxidase
51 AFWR01000001.1 GCA000224275_01937 CDS open 45020-46039 _na     339_aa yejE Inner membrane ABC transporter permease protein yejE
52 AFWR01000001.1 GCA000224275_01938 CDS open 46282-46527 _na     81_aa Lipoprotein
53 AFWR01000001.1 GCA000224275_01939 CDS open 46561-46884 _na     107_aa Putative secreted protein
54 AFWR01000001.1 GCA000224275_01941 CDS open 47225-48190 _na     321_aa yrbG Inner membrane protein yrbG
55 AFWR01000001.1 GCA000224275_01942 CDS open 48488-49663 _na     391_aa metZ O-succinylhomoserine sulfhydrylase
56 AFWR01000001.1 GCA000224275_01943 CDS open 49722-49928 _na     68_aa DUF2788 domain-containing protein
57 AFWR01000001.1 GCA000224275_01944 CDS open 50041-51093 _na     350_aa yejB Inner membrane ABC transporter permease protein yejB
58 AFWR01000001.1 GCA000224275_01945 CDS open 51305-52549 _na     414_aa multifunctional CCA addition/repair protein
59 AFWR01000001.1 GCA000224275_01946 CDS open 53019-53642 _na     207_aa S-fimbrillin
60 AFWR01000001.1 GCA000224275_01947 CDS open 53720-54466 _na     248_aa focC Chaperone protein focC
61 AFWR01000001.1 GCA000224275_01948 CDS open 54553-57042 _na     829_aa Heat shock protein E
62 AFWR01000001.1 GCA000224275_01949 CDS open 57002-58057 _na     351_aa F17a-G fimbrial adhesin
63 AFWR01000001.1 GCA000224275_01950 CDS open 58235-59776 _na     513_aa cntF staphylopine uptake ABC transporter ATP-binding protein CntF
64 AFWR01000001.1 GCA000224275_01951 CDS open 59860-60189 _na     109_aa trxA thioredoxin TrxA
65 AFWR01000001.1 GCA000224275_01952 CDS open 60911-62233 _na     440_aa PIN-like domain-containing protein
66 AFWR01000001.1 GCA000224275_01953 CDS open 62247-65084 _na     945_aa uvrA excinuclease ABC subunit UvrA
67 AFWR01000001.1 GCA000224275_01954 CDS open 65151-66011 _na     286_aa RNA methyltransferase
68 AFWR01000001.1 GCA000224275_01955 CDS open 66086-66745 _na     219_aa yecA YecA family protein
69 AFWR01000001.1 GCA000224275_01956 CDS open 67116-68609 _na     497_aa putP sodium/proline symporter PutP
70 AFWR01000001.1 GCA000224275_01957 CDS open 68831-70027 _na     398_aa Acetate kinase
71 AFWR01000001.1 GCA000224275_01958 CDS open 70160-70681 _na     173_aa Lipoprotein
72 AFWR01000001.1 GCA000224275_01959 CDS open 70843-72093 _na     416_aa lipoprotein-releasing ABC transporter permease subunit
73 AFWR01000001.1 GCA000224275_01960 CDS open 72086-72766 _na     226_aa lolD lipoprotein-releasing ABC transporter ATP-binding protein LolD
74 AFWR01000001.1 GCA000224275_01961 CDS open 72853-73587 _na     244_aa Oxidoreductase
75 AFWR01000001.1 GCA000224275_01962 CDS open 73715-74335 _na     206_aa Putative Smr-like protein
76 AFWR01000001.1 GCA000224275_01963 CDS open 74735-77404 _na     889_aa aceE pyruvate dehydrogenase (acetyl-transferring)%2C homodimeric type
77 AFWR01000001.1 GCA000224275_01964 CDS open 77537-79195 _na     552_aa aceF dihydrolipoyllysine-residue acetyltransferase
78 AFWR01000001.1 GCA000224275_01965 CDS open 79291-81081 _na     596_aa lpdA dihydrolipoyl dehydrogenase
79 AFWR01000001.1 GCA000224275_01966 CDS open 81203-81862 _na     219_aa UPF0056 membrane protein
80 AFWR01000001.1 GCA000224275_01967 CDS open 81889-82995 _na     368_aa rodA rod shape-determining protein RodA
81 AFWR01000001.1 GCA000224275_01968 CDS open 82988-85051 _na     687_aa mrdA penicillin-binding protein 2
82 AFWR01000001.1 GCA000224275_01969 CDS open 85048-85551 _na     167_aa mreD rod shape-determining protein MreD
83 AFWR01000001.1 GCA000224275_01970 CDS open 85609-86442 _na     277_aa mreC rod shape-determining protein MreC
84 AFWR01000001.1 GCA000224275_01971 CDS open 86466-87506 _na     346_aa mreB Cell shape-determining protein MreB
85 AFWR01000001.1 GCA000224275_01972 CDS open 87749-88039 _na     96_aa gatC Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC
86 AFWR01000001.1 GCA000224275_01973 CDS open 88120-89574 _na     484_aa gatA Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA
87 AFWR01000001.1 GCA000224275_01974 CDS open 89610-90398 _na     262_aa Type II restriction endonuclease
88 AFWR01000001.1 GCA000224275_01975 CDS open 90415-90588 _na     57_aa Phage associated protein
89 AFWR01000001.1 GCA000224275_01976 CDS open 90575-91180 _na     201_aa putative protein conserved in bacteria
90 AFWR01000001.1 GCA000224275_01977 CDS open 91216-92643 _na     475_aa gatB Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB
91 AFWR01000001.1 GCA000224275_01978 CDS open 92718-93197 _na     159_aa lptE LPS-assembly lipoprotein LptE
92 AFWR01000001.1 GCA000224275_01979 CDS open 93197-94201 _na     334_aa holA DNA polymerase III subunit delta
93 AFWR01000001.1 GCA000224275_01980 CDS open 94291-94710 _na     139_aa Membrane protein
94 AFWR01000001.1 GCA000224275_01981 CDS open 94794-95420 _na     208_aa argO Arginine exporter protein ArgO
95 AFWR01000001.1 GCA000224275_01982 CDS open 95504-96799 _na     431_aa serS serine--tRNA ligase
96 AFWR01000001.1 GCA000224275_01983 CDS open 97280-97411 _na     43_aa hypothetical protein
97 AFWR01000001.1 GCA000224275_01984 CDS open 97457-97603 _na     48_aa hypothetical protein
98 AFWR01000001.1 GCA000224275_01985 CDS open 98134-99063 _na     309_aa Hemagglutinin/hemolysin-like protein
99 AFWR01000001.1 GCA000224275_01986 CDS open 99209-99622 _na     137_aa DUF596 domain-containing protein
100 AFWR01000001.1 GCA000224275_01888 gene open 517-1353
101 AFWR01000001.1 GCA000224275_01889 gene open 1675-2976
102 AFWR01000001.1 GCA000224275_01890 gene open 2979-3251
103 AFWR01000001.1 GCA000224275_01891 gene open 3253-3990
104 AFWR01000001.1 GCA000224275_01892 gene open 4003-5301
105 AFWR01000001.1 GCA000224275_01893 gene open 5305-5868 ymfQ
106 AFWR01000001.1 GCA000224275_01894 gene open 5865-6920
107 AFWR01000001.1 GCA000224275_01895 gene open 6946-7293 gp46
108 AFWR01000001.1 GCA000224275_01896 gene open 7394-8062 gp45
109 AFWR01000001.1 GCA000224275_01897 gene open 8059-8817
110 AFWR01000001.1 GCA000224275_01898 gene open 8827-9204
111 AFWR01000001.1 GCA000224275_01899 gene open 9194-10525
112 AFWR01000001.1 GCA000224275_01900 gene open 10525-12621
113 AFWR01000001.1 GCA000224275_01901 gene open 12691-12912
114 AFWR01000001.1 GCA000224275_01902 gene open 12916-13071
115 AFWR01000001.1 GCA000224275_01903 gene open 13071-13496
116 AFWR01000001.1 GCA000224275_01904 gene open 13503-13880
117 AFWR01000001.1 GCA000224275_01905 gene open 13945-15354 gpL
118 AFWR01000001.1 GCA000224275_01906 gene open 15357-15551
119 AFWR01000001.1 GCA000224275_01907 gene open 15548-16198
120 AFWR01000001.1 GCA000224275_01908 gene open 16188-16610
121 AFWR01000001.1 GCA000224275_01909 gene open 16614-16994
122 AFWR01000001.1 GCA000224275_01910 gene open 17060-17809
123 AFWR01000001.1 GCA000224275_01911 gene open 17778-17969
124 AFWR01000001.1 GCA000224275_01912 gene open 17972-19030
125 AFWR01000001.1 GCA000224275_01913 gene open 19241-19657
126 AFWR01000001.1 GCA000224275_01914 gene open 19760-20044
127 AFWR01000001.1 GCA000224275_01915 gene open 20432-21970
128 AFWR01000001.1 GCA000224275_01916 gene open 22689-25208
129 AFWR01000001.1 GCA000224275_01917 gene open 25315-26670
130 AFWR01000001.1 GCA000224275_01918 gene open 27006-27953
131 AFWR01000001.1 GCA000224275_01919 gene open 27994-28212
132 AFWR01000001.1 GCA000224275_01920 gene open 28304-28891
133 AFWR01000001.1 GCA000224275_01921 gene open 28970-30232
134 AFWR01000001.1 GCA000224275_01922 gene open 30242-31381
135 AFWR01000001.1 GCA000224275_01923 gene open 31403-31933
136 AFWR01000001.1 GCA000224275_01924 gene open 32076-32759
137 AFWR01000001.1 GCA000224275_01925 gene open 32961-33428
138 AFWR01000001.1 GCA000224275_01926 gene open 33694-34881
139 AFWR01000001.1 GCA000224275_01927 gene open 35100-35381 yhbY
140 AFWR01000001.1 GCA000224275_01928 gene open 35489-36109
141 AFWR01000001.1 GCA000224275_01929 gene open 36165-38195 ftsH
142 AFWR01000001.1 GCA000224275_01930 gene open 38300-39151 folP
143 AFWR01000001.1 GCA000224275_01931 gene open 39322-40656 glmM
144 AFWR01000001.1 GCA000224275_01932 gene open 40745-41437
145 AFWR01000001.1 GCA000224275_01933 gene open 41645-42613 speB
146 AFWR01000001.1 GCA000224275_01934 gene open 42670-43656
147 AFWR01000001.1 GCA000224275_01935 gene open 43736-44350
148 AFWR01000001.1 GCA000224275_01936 gene open 44383-44877 tpx
149 AFWR01000001.1 GCA000224275_01937 gene open 45020-46039 yejE
150 AFWR01000001.1 GCA000224275_01938 gene open 46282-46527
151 AFWR01000001.1 GCA000224275_01939 gene open 46561-46884
152 AFWR01000001.1 GCA000224275_01941 gene open 47225-48190 yrbG
153 AFWR01000001.1 GCA000224275_01942 gene open 48488-49663 metZ
154 AFWR01000001.1 GCA000224275_01943 gene open 49722-49928
155 AFWR01000001.1 GCA000224275_01944 gene open 50041-51093 yejB
156 AFWR01000001.1 GCA000224275_01945 gene open 51305-52549
157 AFWR01000001.1 GCA000224275_01946 gene open 53019-53642
158 AFWR01000001.1 GCA000224275_01947 gene open 53720-54466 focC
159 AFWR01000001.1 GCA000224275_01948 gene open 54553-57042
160 AFWR01000001.1 GCA000224275_01949 gene open 57002-58057
161 AFWR01000001.1 GCA000224275_01950 gene open 58235-59776 cntF
162 AFWR01000001.1 GCA000224275_01951 gene open 59860-60189 trxA
163 AFWR01000001.1 GCA000224275_01952 gene open 60911-62233
164 AFWR01000001.1 GCA000224275_01953 gene open 62247-65084 uvrA
165 AFWR01000001.1 GCA000224275_01954 gene open 65151-66011
166 AFWR01000001.1 GCA000224275_01955 gene open 66086-66745 yecA
167 AFWR01000001.1 GCA000224275_01956 gene open 67116-68609 putP
168 AFWR01000001.1 GCA000224275_01957 gene open 68831-70027
169 AFWR01000001.1 GCA000224275_01958 gene open 70160-70681
170 AFWR01000001.1 GCA000224275_01959 gene open 70843-72093
171 AFWR01000001.1 GCA000224275_01960 gene open 72086-72766 lolD
172 AFWR01000001.1 GCA000224275_01961 gene open 72853-73587
173 AFWR01000001.1 GCA000224275_01962 gene open 73715-74335
174 AFWR01000001.1 GCA000224275_01963 gene open 74735-77404 aceE
175 AFWR01000001.1 GCA000224275_01964 gene open 77537-79195 aceF
176 AFWR01000001.1 GCA000224275_01965 gene open 79291-81081 lpdA
177 AFWR01000001.1 GCA000224275_01966 gene open 81203-81862
178 AFWR01000001.1 GCA000224275_01967 gene open 81889-82995 rodA
179 AFWR01000001.1 GCA000224275_01968 gene open 82988-85051 mrdA
180 AFWR01000001.1 GCA000224275_01969 gene open 85048-85551 mreD
181 AFWR01000001.1 GCA000224275_01970 gene open 85609-86442 mreC
182 AFWR01000001.1 GCA000224275_01971 gene open 86466-87506 mreB
183 AFWR01000001.1 GCA000224275_01972 gene open 87749-88039 gatC
184 AFWR01000001.1 GCA000224275_01973 gene open 88120-89574 gatA
185 AFWR01000001.1 GCA000224275_01974 gene open 89610-90398
186 AFWR01000001.1 GCA000224275_01975 gene open 90415-90588
187 AFWR01000001.1 GCA000224275_01976 gene open 90575-91180
188 AFWR01000001.1 GCA000224275_01977 gene open 91216-92643 gatB
189 AFWR01000001.1 GCA000224275_01978 gene open 92718-93197 lptE
190 AFWR01000001.1 GCA000224275_01979 gene open 93197-94201 holA
191 AFWR01000001.1 GCA000224275_01980 gene open 94291-94710
192 AFWR01000001.1 GCA000224275_01981 gene open 94794-95420 argO
193 AFWR01000001.1 GCA000224275_01982 gene open 95504-96799 serS
194 AFWR01000001.1 GCA000224275_01983 gene open 97280-97411
195 AFWR01000001.1 GCA000224275_01984 gene open 97457-97603
196 AFWR01000001.1 GCA000224275_01985 gene open 98134-99063
197 AFWR01000001.1 GCA000224275_01986 gene open 99209-99622
198 AFWR01000001.1 GCA000224275_01940 gene open 47081-47171 trnS
199 AFWR01000001.1 GCA000224275_01940 tRNA open 47081-47171 trnS tRNA-Ser(gga)
200 AFWR01000002.1 GCA000224275_01887 CDS open 233-1177 _na     314_aa thrB homoserine kinase
201 AFWR01000002.1 GCA000224275_01887 gene open 233-1177 thrB
202 AFWR01000003.1 GCA000224275_01882 CDS open 164-565 _na     133_aa hypothetical protein
203 AFWR01000003.1 GCA000224275_01883 CDS open 562-1050 _na     162_aa hypothetical protein
204 AFWR01000003.1 GCA000224275_01884 CDS open 1561-1917 _na     118_aa hypothetical protein
205 AFWR01000003.1 GCA000224275_01885 CDS open 2450-2737 _na     95_aa Ribonuclease inhibitor barstar
206 AFWR01000003.1 GCA000224275_01886 CDS open 2743-3177 _na     144_aa ribonuclease domain-containing protein
207 AFWR01000003.1 GCA000224275_01882 gene open 164-565
208 AFWR01000003.1 GCA000224275_01883 gene open 562-1050
209 AFWR01000003.1 GCA000224275_01884 gene open 1561-1917
210 AFWR01000003.1 GCA000224275_01885 gene open 2450-2737
211 AFWR01000003.1 GCA000224275_01886 gene open 2743-3177
212 AFWR01000004.1 GCA000224275_01878 CDS open 119-769 _na     216_aa hypothetical protein
213 AFWR01000004.1 GCA000224275_01879 CDS open 769-1215 _na     148_aa hypothetical protein
214 AFWR01000004.1 GCA000224275_01880 CDS open 1662-2531 _na     289_aa Hemagglutinin/hemolysin-related protein PspA-related protein
215 AFWR01000004.1 GCA000224275_01881 CDS open 2554-3012 _na     152_aa hypothetical protein
216 AFWR01000004.1 GCA000224275_01878 gene open 119-769
217 AFWR01000004.1 GCA000224275_01879 gene open 769-1215
218 AFWR01000004.1 GCA000224275_01880 gene open 1662-2531
219 AFWR01000004.1 GCA000224275_01881 gene open 2554-3012
220 AFWR01000005.1 GCA000224275_01874 CDS open 88-495 _na     135_aa cadR Cd(II)/Pb(II)-responsive transcriptional regulator
221 AFWR01000005.1 GCA000224275_01875 CDS open 591-1487 _na     298_aa cation transporter
222 AFWR01000005.1 GCA000224275_01876 CDS open 1491-2003 _na     170_aa lspA signal peptidase II
223 AFWR01000005.1 GCA000224275_01877 CDS open 2025-3314 _na     429_aa tnp ISL3-like element ISPpu12 family transposase
224 AFWR01000005.1 GCA000224275_01874 gene open 88-495 cadR
225 AFWR01000005.1 GCA000224275_01875 gene open 591-1487
226 AFWR01000005.1 GCA000224275_01876 gene open 1491-2003 lspA
227 AFWR01000005.1 GCA000224275_01877 gene open 2025-3314 tnp
228 AFWR01000006.1 GCA000224275_01868 CDS open 486-938 _na     150_aa hypothetical protein
229 AFWR01000006.1 GCA000224275_01869 CDS open 935-1120 _na     61_aa hypothetical protein
230 AFWR01000006.1 GCA000224275_01870 CDS open 1217-1468 _na     83_aa hypothetical protein
231 AFWR01000006.1 GCA000224275_01871 CDS open 1478-2005 _na     175_aa hypothetical protein
232 AFWR01000006.1 GCA000224275_01872 CDS open 2150-2875 _na     241_aa hypothetical protein
233 AFWR01000006.1 GCA000224275_01873 CDS open 3320-3583 _na     87_aa hypothetical protein
234 AFWR01000006.1 GCA000224275_01868 gene open 486-938
235 AFWR01000006.1 GCA000224275_01869 gene open 935-1120
236 AFWR01000006.1 GCA000224275_01870 gene open 1217-1468
237 AFWR01000006.1 GCA000224275_01871 gene open 1478-2005
238 AFWR01000006.1 GCA000224275_01872 gene open 2150-2875
239 AFWR01000006.1 GCA000224275_01873 gene open 3320-3583
240 AFWR01000007.1 GCA000224275_01864 CDS open 80-970 _na     296_aa hypothetical protein
241 AFWR01000007.1 GCA000224275_01865 CDS open 967-1407 _na     146_aa Immunity protein 42
242 AFWR01000007.1 GCA000224275_01866 CDS open 1539-2192 _na     217_aa tnp IS1595 family transposase
243 AFWR01000007.1 GCA000224275_01867 CDS open 3536-3973 _na     145_aa hypothetical protein
244 AFWR01000007.1 GCA000224275_01864 gene open 80-970
245 AFWR01000007.1 GCA000224275_01865 gene open 967-1407
246 AFWR01000007.1 GCA000224275_01866 gene open 1539-2192 tnp
247 AFWR01000007.1 GCA000224275_01867 gene open 3536-3973
248 AFWR01000008.1 GCA000224275_01857 CDS open 152-754 _na     200_aa GTP cyclohydrolase-2
249 AFWR01000008.1 GCA000224275_01858 CDS open 747-1418 _na     223_aa GAF domain-containing protein
250 AFWR01000008.1 GCA000224275_01860 CDS open 2145-2906 _na     253_aa fabG 3-oxoacyl-ACP reductase FabG
251 AFWR01000008.1 GCA000224275_01861 CDS open 3080-4114 _na     344_aa Transferrin-binding protein B C-lobe/N-lobe beta barrel domain-containing protein
252 AFWR01000008.1 GCA000224275_01862 CDS open 4393-4599 _na     68_aa Ring dioxygenase subunit beta
253 AFWR01000008.1 GCA000224275_01863 CDS open 4596-4967 _na     123_aa vanZ VanZ family protein
254 AFWR01000008.1 GCA000224275_01857 gene open 152-754
255 AFWR01000008.1 GCA000224275_01858 gene open 747-1418
256 AFWR01000008.1 GCA000224275_01860 gene open 2145-2906 fabG
257 AFWR01000008.1 GCA000224275_01861 gene open 3080-4114
258 AFWR01000008.1 GCA000224275_01862 gene open 4393-4599
259 AFWR01000008.1 GCA000224275_01863 gene open 4596-4967 vanZ
260 AFWR01000008.1 GCA000224275_01859 gene open 1586-1670 trnL
261 AFWR01000008.1 GCA000224275_01859 tRNA open 1586-1670 trnL tRNA-Leu(tag)
262 AFWR01000009.1 GCA000224275_01852 gene open 290-1830 rrs
263 AFWR01000009.1 GCA000224275_01855 gene open 2507-5393 rrl
264 AFWR01000009.1 GCA000224275_01856 gene open 5522-5634 rrf
265 AFWR01000009.1 GCA000224275_01852 rRNA open 290-1830 rrs 16S ribosomal RNA
266 AFWR01000009.1 GCA000224275_01855 rRNA open 2507-5393 rrl 23S ribosomal RNA
267 AFWR01000009.1 GCA000224275_01856 rRNA open 5522-5634 rrf 5S ribosomal RNA
268 AFWR01000009.1 GCA000224275_01853 gene open 1911-1987 trnI
269 AFWR01000009.1 GCA000224275_01854 gene open 2018-2093 trnA
270 AFWR01000009.1 GCA000224275_01853 tRNA open 1911-1987 trnI tRNA-Ile(gat)
271 AFWR01000009.1 GCA000224275_01854 tRNA open 2018-2093 trnA tRNA-Ala(tgc)
272 AFWR01000010.1 GCA000224275_01842 CDS open 182-496 _na     104_aa secG preprotein translocase subunit SecG
273 AFWR01000010.1 GCA000224275_01843 CDS open 502-1257 _na     251_aa tpiA triose-phosphate isomerase
274 AFWR01000010.1 GCA000224275_01844 CDS open 1494-1982 _na     162_aa GAF-domain containing protein
275 AFWR01000010.1 GCA000224275_01845 CDS open 2083-2742 _na     219_aa Protein-L-isoaspartate O-methyltransferase
276 AFWR01000010.1 GCA000224275_01846 CDS open 2847-3170 _na     107_aa Putative thiosulfate sulfurtransferase
277 AFWR01000010.1 GCA000224275_01847 CDS open 3234-4055 _na     273_aa dapD 2%2C3%2C4%2C5-tetrahydropyridine-2%2C6-dicarboxylate N-succinyltransferase
278 AFWR01000010.1 GCA000224275_01848 CDS open 4207-4938 _na     243_aa aat leucyl/phenylalanyl-tRNA--protein transferase
279 AFWR01000010.1 GCA000224275_01849 CDS open 5011-5448 _na     145_aa fur ferric iron uptake transcriptional regulator
280 AFWR01000010.1 GCA000224275_01850 CDS open 5607-6002 _na     131_aa bamE Outer membrane protein assembly factor BamE
281 AFWR01000010.1 GCA000224275_01851 CDS open 5999-6811 _na     270_aa dapB 4-hydroxy-tetrahydrodipicolinate reductase
282 AFWR01000010.1 GCA000224275_01842 gene open 182-496 secG
283 AFWR01000010.1 GCA000224275_01843 gene open 502-1257 tpiA
284 AFWR01000010.1 GCA000224275_01844 gene open 1494-1982
285 AFWR01000010.1 GCA000224275_01845 gene open 2083-2742
286 AFWR01000010.1 GCA000224275_01846 gene open 2847-3170
287 AFWR01000010.1 GCA000224275_01847 gene open 3234-4055 dapD
288 AFWR01000010.1 GCA000224275_01848 gene open 4207-4938 aat
289 AFWR01000010.1 GCA000224275_01849 gene open 5011-5448 fur
290 AFWR01000010.1 GCA000224275_01850 gene open 5607-6002 bamE
291 AFWR01000010.1 GCA000224275_01851 gene open 5999-6811 dapB
292 AFWR01000010.1 GCA000224275_01841 gene open 89-174 trnL
293 AFWR01000010.1 GCA000224275_01841 tRNA open 89-174 trnL tRNA-Leu(gag)
294 AFWR01000011.1 GCA000224275_01832 CDS open 75-1286 _na     403_aa Putative prophage integrase
295 AFWR01000011.1 GCA000224275_01833 CDS open 1584-1796 _na     70_aa Putative prophage regulator protein
296 AFWR01000011.1 GCA000224275_01834 CDS open 1793-2263 _na     156_aa Host-nuclease inhibitor phage protein Gam
297 AFWR01000011.1 GCA000224275_01835 CDS open 2265-2588 _na     107_aa Putative bacteriophage transcriptional regulator
298 AFWR01000011.1 GCA000224275_01836 CDS open 2572-3306 _na     244_aa Phage associated protein
299 AFWR01000011.1 GCA000224275_01837 CDS open 3324-3965 _na     213_aa Phage associated protein
300 AFWR01000011.1 GCA000224275_01838 CDS open 4281-4556 _na     91_aa Phage associated protein
301 AFWR01000011.1 GCA000224275_01839 CDS open 4706-5788 _na     360_aa Bacteriophage T7 Gp4 DNA primase/helicase N-terminal domain-containing protein
302 AFWR01000011.1 GCA000224275_01840 CDS open 5809-7545 _na     578_aa Putative superfamily II helicase
303 AFWR01000011.1 GCA000224275_01832 gene open 75-1286
304 AFWR01000011.1 GCA000224275_01833 gene open 1584-1796
305 AFWR01000011.1 GCA000224275_01834 gene open 1793-2263
306 AFWR01000011.1 GCA000224275_01835 gene open 2265-2588
307 AFWR01000011.1 GCA000224275_01836 gene open 2572-3306
308 AFWR01000011.1 GCA000224275_01837 gene open 3324-3965
309 AFWR01000011.1 GCA000224275_01838 gene open 4281-4556
310 AFWR01000011.1 GCA000224275_01839 gene open 4706-5788
311 AFWR01000011.1 GCA000224275_01840 gene open 5809-7545
312 AFWR01000012.1 GCA000224275_01823 CDS open 115-804 _na     229_aa mtgA monofunctional biosynthetic peptidoglycan transglycosylase
313 AFWR01000012.1 GCA000224275_01824 CDS open 791-1621 _na     276_aa aroE shikimate dehydrogenase
314 AFWR01000012.1 GCA000224275_01825 CDS open 2044-3462 _na     472_aa glnA type I glutamate--ammonia ligase
315 AFWR01000012.1 GCA000224275_01827 CDS open 3739-4713 _na     324_aa ispB IspB protein
316 AFWR01000012.1 GCA000224275_01828 CDS open 4926-5234 _na     102_aa rplU 50S ribosomal protein L21
317 AFWR01000012.1 GCA000224275_01829 CDS open 5266-5538 _na     90_aa rpmA 50S ribosomal protein L27
318 AFWR01000012.1 GCA000224275_01830 CDS open 6154-7611 _na     485_aa Trk system potassium uptake protein
319 AFWR01000012.1 GCA000224275_01831 CDS open 7724-9550 _na     608_aa Transglycosylase
320 AFWR01000012.1 GCA000224275_01823 gene open 115-804 mtgA
321 AFWR01000012.1 GCA000224275_01824 gene open 791-1621 aroE
322 AFWR01000012.1 GCA000224275_01825 gene open 2044-3462 glnA
323 AFWR01000012.1 GCA000224275_01827 gene open 3739-4713 ispB
324 AFWR01000012.1 GCA000224275_01828 gene open 4926-5234 rplU
325 AFWR01000012.1 GCA000224275_01829 gene open 5266-5538 rpmA
326 AFWR01000012.1 GCA000224275_01830 gene open 6154-7611
327 AFWR01000012.1 GCA000224275_01831 gene open 7724-9550
328 AFWR01000012.1 GCA000224275_01826 gene open 3659-3733 trnR
329 AFWR01000012.1 GCA000224275_01826 tRNA open 3659-3733 trnR tRNA-Arg(cct)
330 AFWR01000013.1 GCA000224275_01813 CDS open 108-821 _na     237_aa trmB tRNA (guanosine(46)-N7)-methyltransferase TrmB
331 AFWR01000013.1 GCA000224275_01814 CDS open 1091-1993 _na     300_aa lysR LysR family transcriptional regulator
332 AFWR01000013.1 GCA000224275_01815 CDS open 2183-2746 _na     187_aa Periplasmic protein
333 AFWR01000013.1 GCA000224275_01816 CDS open 2944-4545 _na     533_aa Major facilitator superfamily (MFS) profile domain-containing protein
334 AFWR01000013.1 GCA000224275_01817 CDS open 4898-5797 _na     299_aa Quercetin 2%2C3-dioxygenase
335 AFWR01000013.1 GCA000224275_01818 CDS open 5958-7847 _na     629_aa ytcJ N-substituted formamide deformylase
336 AFWR01000013.1 GCA000224275_01819 CDS open 7851-8072 _na     73_aa putative protein conserved in bacteria
337 AFWR01000013.1 GCA000224275_01820 CDS open 8159-8842 _na     227_aa pncA Isochorismatase family protein
338 AFWR01000013.1 GCA000224275_01821 CDS open 8973-9581 _na     202_aa Oxidoreductase
339 AFWR01000013.1 GCA000224275_01822 CDS open 9673-10410 _na     245_aa Quercetin 2%2C3-dioxygenase
340 AFWR01000013.1 GCA000224275_01813 gene open 108-821 trmB
341 AFWR01000013.1 GCA000224275_01814 gene open 1091-1993 lysR
342 AFWR01000013.1 GCA000224275_01815 gene open 2183-2746
343 AFWR01000013.1 GCA000224275_01816 gene open 2944-4545
344 AFWR01000013.1 GCA000224275_01817 gene open 4898-5797
345 AFWR01000013.1 GCA000224275_01818 gene open 5958-7847 ytcJ
346 AFWR01000013.1 GCA000224275_01819 gene open 7851-8072
347 AFWR01000013.1 GCA000224275_01820 gene open 8159-8842 pncA
348 AFWR01000013.1 GCA000224275_01821 gene open 8973-9581
349 AFWR01000013.1 GCA000224275_01822 gene open 9673-10410
350 AFWR01000014.1 GCA000224275_01800 CDS open 272-1165 _na     297_aa DUF340 domain-containing protein
351 AFWR01000014.1 GCA000224275_01801 CDS open 1244-2014 _na     256_aa deoR DeoR family transcriptional regulator
352 AFWR01000014.1 GCA000224275_01802 CDS open 2080-2436 _na     118_aa Endoribonuclease L-PSP
353 AFWR01000014.1 GCA000224275_01803 CDS open 2614-3099 _na     161_aa ybaK Cys-tRNA(Pro) deacylase
354 AFWR01000014.1 GCA000224275_01804 CDS open 3182-4066 _na     294_aa Membrane protein
355 AFWR01000014.1 GCA000224275_01805 CDS open 4213-5367 _na     384_aa nnrS Integral membrane protein NnrS
356 AFWR01000014.1 GCA000224275_01806 CDS open 5424-5789 _na     121_aa putative conserved protein
357 AFWR01000014.1 GCA000224275_01807 CDS open 5929-6378 _na     149_aa Transcriptional regulator
358 AFWR01000014.1 GCA000224275_01808 CDS open 6463-7866 _na     467_aa Amino-acid transporter sodium/alanine symporter
359 AFWR01000014.1 GCA000224275_01809 CDS open 8187-8915 _na     242_aa tACO1 YebC/PmpR family DNA-binding transcriptional regulator
360 AFWR01000014.1 GCA000224275_01810 CDS open 9075-9923 _na     282_aa hpnD presqualene diphosphate synthase HpnD
361 AFWR01000014.1 GCA000224275_01811 CDS open 9920-11254 _na     444_aa hpnE hydroxysqualene dehydroxylase HpnE
362 AFWR01000014.1 GCA000224275_01812 CDS open 11241-11960 _na     239_aa SDR family oxidoreductase
363 AFWR01000014.1 GCA000224275_01800 gene open 272-1165
364 AFWR01000014.1 GCA000224275_01801 gene open 1244-2014 deoR
365 AFWR01000014.1 GCA000224275_01802 gene open 2080-2436
366 AFWR01000014.1 GCA000224275_01803 gene open 2614-3099 ybaK
367 AFWR01000014.1 GCA000224275_01804 gene open 3182-4066
368 AFWR01000014.1 GCA000224275_01805 gene open 4213-5367 nnrS
369 AFWR01000014.1 GCA000224275_01806 gene open 5424-5789
370 AFWR01000014.1 GCA000224275_01807 gene open 5929-6378
371 AFWR01000014.1 GCA000224275_01808 gene open 6463-7866
372 AFWR01000014.1 GCA000224275_01809 gene open 8187-8915 tACO1
373 AFWR01000014.1 GCA000224275_01810 gene open 9075-9923 hpnD
374 AFWR01000014.1 GCA000224275_01811 gene open 9920-11254 hpnE
375 AFWR01000014.1 GCA000224275_01812 gene open 11241-11960
376 AFWR01000015.1 GCA000224275_01787 CDS open 123-1340 _na     405_aa Inner membrane transport protein
377 AFWR01000015.1 GCA000224275_01788 CDS open 1663-2148 _na     161_aa putative protein conserved in bacteria
378 AFWR01000015.1 GCA000224275_01789 CDS open 2294-2698 _na     134_aa Diacylglycerol kinase
379 AFWR01000015.1 GCA000224275_01790 CDS open 2702-3088 _na     128_aa Diacylglycerol kinase
380 AFWR01000015.1 GCA000224275_01791 CDS open 3088-4047 _na     319_aa gshB glutathione synthase
381 AFWR01000015.1 GCA000224275_01792 CDS open 4349-5731 _na     460_aa Phosphoglucomutase
382 AFWR01000015.1 GCA000224275_01793 CDS open 5772-6545 _na     257_aa 3-dehydroquinate dehydratase
383 AFWR01000015.1 GCA000224275_01794 CDS open 6692-7231 _na     179_aa DUF2062 domain-containing protein
384 AFWR01000015.1 GCA000224275_01795 CDS open 7224-7784 _na     186_aa Type IV secretion protein Rhs
385 AFWR01000015.1 GCA000224275_01797 CDS open 8271-8585 _na     104_aa Lipoprotein
386 AFWR01000015.1 GCA000224275_01798 CDS open 8836-11460 _na     874_aa alaS alanine--tRNA ligase
387 AFWR01000015.1 GCA000224275_01799 CDS open 11746-12876 _na     376_aa Putrescine-binding periplasmic protein
388 AFWR01000015.1 GCA000224275_01787 gene open 123-1340
389 AFWR01000015.1 GCA000224275_01788 gene open 1663-2148
390 AFWR01000015.1 GCA000224275_01789 gene open 2294-2698
391 AFWR01000015.1 GCA000224275_01790 gene open 2702-3088
392 AFWR01000015.1 GCA000224275_01791 gene open 3088-4047 gshB
393 AFWR01000015.1 GCA000224275_01792 gene open 4349-5731
394 AFWR01000015.1 GCA000224275_01793 gene open 5772-6545
395 AFWR01000015.1 GCA000224275_01794 gene open 6692-7231
396 AFWR01000015.1 GCA000224275_01795 gene open 7224-7784
397 AFWR01000015.1 GCA000224275_01797 gene open 8271-8585
398 AFWR01000015.1 GCA000224275_01798 gene open 8836-11460 alaS
399 AFWR01000015.1 GCA000224275_01799 gene open 11746-12876
400 AFWR01000015.1 GCA000224275_01796 gene open 7870-7945 trnN
401 AFWR01000015.1 GCA000224275_01796 tRNA open 7870-7945 trnN tRNA-Asn(gtt)
402 AFWR01000016.1 GCA000224275_01779 CDS open 313-483 _na     56_aa hypothetical protein
403 AFWR01000016.1 GCA000224275_01780 CDS open 972-1190 _na     72_aa hypothetical protein
404 AFWR01000016.1 GCA000224275_01781 CDS open 1387-4281 _na     964_aa hrpA ATP-dependent RNA helicase HrpA
405 AFWR01000016.1 GCA000224275_01782 CDS open 4500-5795 _na     431_aa Archaeal ATPase
406 AFWR01000016.1 GCA000224275_01783 CDS open 5830-10782 _na     1650_aa DNA and RNA helicase
407 AFWR01000016.1 GCA000224275_01784 CDS open 10779-12170 _na     463_aa marR MarR family transcriptional regulator
408 AFWR01000016.1 GCA000224275_01785 CDS open 12263-13663 _na     466_aa hrpA ATP-dependent RNA helicase HrpA
409 AFWR01000016.1 GCA000224275_01779 gene open 313-483
410 AFWR01000016.1 GCA000224275_01780 gene open 972-1190
411 AFWR01000016.1 GCA000224275_01781 gene open 1387-4281 hrpA
412 AFWR01000016.1 GCA000224275_01782 gene open 4500-5795
413 AFWR01000016.1 GCA000224275_01783 gene open 5830-10782
414 AFWR01000016.1 GCA000224275_01784 gene open 10779-12170 marR
415 AFWR01000016.1 GCA000224275_01785 gene open 12263-13663 hrpA
416 AFWR01000016.1 GCA000224275_01786 gene open 13885-13961 trnfM
417 AFWR01000016.1 GCA000224275_01786 tRNA open 13885-13961 trnfM tRNA-fMet(cat)
418 AFWR01000017.1 GCA000224275_01770 CDS open 202-1893 _na     563_aa dld D-lactate dehydrogenase
419 AFWR01000017.1 GCA000224275_01771 CDS open 1970-3103 _na     377_aa Twitching motility protein
420 AFWR01000017.1 GCA000224275_01772 CDS open 3277-3996 _na     239_aa 5'-methylthioadenosine/adenosylhomocysteine nucleosidase
421 AFWR01000017.1 GCA000224275_01773 CDS open 4052-5809 _na     585_aa recD exodeoxyribonuclease V subunit alpha
422 AFWR01000017.1 GCA000224275_01774 CDS open 5949-6608 _na     219_aa ung uracil-DNA glycosylase
423 AFWR01000017.1 GCA000224275_01775 CDS open 6758-10378 _na     1206_aa recB exodeoxyribonuclease V subunit beta
424 AFWR01000017.1 GCA000224275_01776 CDS open 10729-12492 _na     587_aa hecB Hemolysin activation protein HecB
425 AFWR01000017.1 GCA000224275_01777 CDS open 14289-14501 _na     70_aa hypothetical protein
426 AFWR01000017.1 GCA000224275_01778 CDS open 14654-14962 _na     102_aa hypothetical protein
427 AFWR01000017.1 GCA000224275_01770 gene open 202-1893 dld
428 AFWR01000017.1 GCA000224275_01771 gene open 1970-3103
429 AFWR01000017.1 GCA000224275_01772 gene open 3277-3996
430 AFWR01000017.1 GCA000224275_01773 gene open 4052-5809 recD
431 AFWR01000017.1 GCA000224275_01774 gene open 5949-6608 ung
432 AFWR01000017.1 GCA000224275_01775 gene open 6758-10378 recB
433 AFWR01000017.1 GCA000224275_01776 gene open 10729-12492 hecB
434 AFWR01000017.1 GCA000224275_01777 gene open 14289-14501
435 AFWR01000017.1 GCA000224275_01778 gene open 14654-14962
436 AFWR01000018.1 GCA000224275_01750 CDS open 637-1563 _na     308_aa prmC peptide chain release factor N(5)-glutamine methyltransferase
437 AFWR01000018.1 GCA000224275_01751 CDS open 1601-3046 _na     481_aa mgtE magnesium transporter
438 AFWR01000018.1 GCA000224275_01752 CDS open 3269-7168 _na     1299_aa Periplasmic protein
439 AFWR01000018.1 GCA000224275_01753 CDS open 7174-8991 _na     605_aa tamA Translocation and assembly module subunit TamA
440 AFWR01000018.1 GCA000224275_01754 CDS open 9099-10322 _na     407_aa lysA diaminopimelate decarboxylase
441 AFWR01000018.1 GCA000224275_01755 CDS open 10322-10555 _na     77_aa lptM LPS translocon maturation chaperone LptM
442 AFWR01000018.1 GCA000224275_01756 CDS open 10557-10883 _na     108_aa cyaY iron donor protein CyaY
443 AFWR01000018.1 GCA000224275_01757 CDS open 10992-12056 _na     354_aa Diadenosine tetraphosphatase
444 AFWR01000018.1 GCA000224275_01758 CDS open 12094-12288 _na     64_aa thiS sulfur carrier protein ThiS
445 AFWR01000018.1 GCA000224275_01759 CDS open 12430-12876 _na     148_aa yciA acyl-CoA thioester hydrolase YciA
446 AFWR01000018.1 GCA000224275_01760 CDS open 12984-13778 _na     264_aa Thiazole synthase
447 AFWR01000018.1 GCA000224275_01761 CDS open 13873-14745 _na     290_aa putative conserved protein
448 AFWR01000018.1 GCA000224275_01762 CDS open 14841-15560 _na     239_aa minC septum site-determining protein MinC
449 AFWR01000018.1 GCA000224275_01763 CDS open 15603-16415 _na     270_aa minD septum site-determining protein MinD
450 AFWR01000018.1 GCA000224275_01764 CDS open 16419-16682 _na     87_aa minE cell division topological specificity factor MinE
451 AFWR01000018.1 GCA000224275_01765 CDS open 16686-17606 _na     306_aa lysR LysR family transcriptional regulator
452 AFWR01000018.1 GCA000224275_01766 CDS open 17784-18230 _na     148_aa Membrane protein
453 AFWR01000018.1 GCA000224275_01767 CDS open 18362-18565 _na     67_aa Lipoprotein
454 AFWR01000018.1 GCA000224275_01768 CDS open 18762-19601 _na     279_aa Lipoprotein
455 AFWR01000018.1 GCA000224275_01769 CDS open 19986-20474 _na     162_aa pilin
456 AFWR01000018.1 GCA000224275_01750 gene open 637-1563 prmC
457 AFWR01000018.1 GCA000224275_01751 gene open 1601-3046 mgtE
458 AFWR01000018.1 GCA000224275_01752 gene open 3269-7168
459 AFWR01000018.1 GCA000224275_01753 gene open 7174-8991 tamA
460 AFWR01000018.1 GCA000224275_01754 gene open 9099-10322 lysA
461 AFWR01000018.1 GCA000224275_01755 gene open 10322-10555 lptM
462 AFWR01000018.1 GCA000224275_01756 gene open 10557-10883 cyaY
463 AFWR01000018.1 GCA000224275_01757 gene open 10992-12056
464 AFWR01000018.1 GCA000224275_01758 gene open 12094-12288 thiS
465 AFWR01000018.1 GCA000224275_01759 gene open 12430-12876 yciA
466 AFWR01000018.1 GCA000224275_01760 gene open 12984-13778
467 AFWR01000018.1 GCA000224275_01761 gene open 13873-14745
468 AFWR01000018.1 GCA000224275_01762 gene open 14841-15560 minC
469 AFWR01000018.1 GCA000224275_01763 gene open 15603-16415 minD
470 AFWR01000018.1 GCA000224275_01764 gene open 16419-16682 minE
471 AFWR01000018.1 GCA000224275_01765 gene open 16686-17606 lysR
472 AFWR01000018.1 GCA000224275_01766 gene open 17784-18230
473 AFWR01000018.1 GCA000224275_01767 gene open 18362-18565
474 AFWR01000018.1 GCA000224275_01768 gene open 18762-19601
475 AFWR01000018.1 GCA000224275_01769 gene open 19986-20474
476 AFWR01000019.1 rep_origin open 8259-10691
477 AFWR01000019.1 GCA000224275_01731 CDS open 307-1788 _na     493_aa ATP-binding protein
478 AFWR01000019.1 GCA000224275_01732 CDS open 1915-4701 _na     928_aa polA DNA polymerase I
479 AFWR01000019.1 GCA000224275_01733 CDS open 4854-5051 _na     65_aa CsbD-like
480 AFWR01000019.1 GCA000224275_01734 CDS open 5553-5711 _na     52_aa UPF0391 membrane protein NCTC12742_01177
481 AFWR01000019.1 GCA000224275_01735 CDS open 5916-6647 _na     243_aa Cytokinin riboside 5'-monophosphate phosphoribohydrolase
482 AFWR01000019.1 GCA000224275_01736 CDS open 6762-7253 _na     163_aa Periplasmic protein
483 AFWR01000019.1 GCA000224275_01737 CDS open 7432-7974 _na     180_aa ahpD Alkylhydroperoxidase AhpD family core domain protein
484 AFWR01000019.1 GCA000224275_01738 CDS open 8259-10835 _na     858_aa mutS DNA mismatch repair protein MutS
485 AFWR01000019.1 GCA000224275_01739 CDS open 10987-12090 _na     367_aa prfB peptide chain release factor 2
486 AFWR01000019.1 GCA000224275_01740 CDS open 12170-14041 _na     623_aa Ribonuclease II-related protein
487 AFWR01000019.1 GCA000224275_01741 CDS open 14230-15033 _na     267_aa truC tRNA pseudouridine(65) synthase TruC
488 AFWR01000019.1 GCA000224275_01742 CDS open 15209-16456 _na     415_aa htpX Heat shock protein HtpX
489 AFWR01000019.1 GCA000224275_01743 CDS open 16588-17457 _na     289_aa rsgA ribosome small subunit-dependent GTPase A
490 AFWR01000019.1 GCA000224275_01744 CDS open 17676-18404 _na     242_aa lytR Sensory transduction protein lytR
491 AFWR01000019.1 GCA000224275_01745 CDS open 18542-19825 _na     427_aa hemL glutamate-1-semialdehyde 2%2C1-aminomutase
492 AFWR01000019.1 GCA000224275_01746 CDS open 20625-21098 _na     157_aa Putative adenylate cyclase
493 AFWR01000019.1 GCA000224275_01747 CDS open 21114-21536 _na     140_aa Protoporphyrinogen IX oxidase
494 AFWR01000019.1 GCA000224275_01748 CDS open 21673-22182 _na     169_aa Periplasmic thioredoxin
495 AFWR01000019.1 GCA000224275_01731 gene open 307-1788
496 AFWR01000019.1 GCA000224275_01732 gene open 1915-4701 polA
497 AFWR01000019.1 GCA000224275_01733 gene open 4854-5051
498 AFWR01000019.1 GCA000224275_01734 gene open 5553-5711
499 AFWR01000019.1 GCA000224275_01735 gene open 5916-6647
500 AFWR01000019.1 GCA000224275_01736 gene open 6762-7253