BAKTAGenome Explorer: Limosilactobacillus panis (GCA_001435935.1)
Select a Genome:
|
BAKTA Annotations for GCA_001435935.1
|
Search & Sort all 3967 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | AZGM01000001.1 | GCA001435935_00621 | CDS | open | 774-2261 | _na 495_aa | yjeM | glutamate/gamma-aminobutyrate family transporter YjeM |
| 2 | AZGM01000001.1 | GCA001435935_00622 | CDS | open | 2336-3580 | _na 414_aa | glutamate-5-semialdehyde dehydrogenase | |
| 3 | AZGM01000001.1 | GCA001435935_00623 | CDS | open | 3593-4381 | _na 262_aa | Glutamate 5-kinase | |
| 4 | AZGM01000001.1 | GCA001435935_00624 | CDS | open | 4643-6043 | _na 466_aa | Na+ H+ antiporter | |
| 5 | AZGM01000001.1 | GCA001435935_00625 | CDS | open | 6517-6630 | _na 37_aa | Toxin-antitoxin system%2C antitoxin component%2C ribbon-helix-helix domain protein | |
| 6 | AZGM01000001.1 | GCA001435935_00626 | CDS | open | 6736-7596 | _na 286_aa | glcU | Glucose uptake protein GlcU |
| 7 | AZGM01000001.1 | GCA001435935_00627 | CDS | open | 7761-7889 | _na 42_aa | hypothetical protein | |
| 8 | AZGM01000001.1 | GCA001435935_00628 | CDS | open | 8210-9295 | _na 361_aa | Malate L-lactate dehydrogenase | |
| 9 | AZGM01000001.1 | GCA001435935_00629 | CDS | open | 9394-10434 | _na 346_aa | GroES-like protein | |
| 10 | AZGM01000001.1 | GCA001435935_00630 | CDS | open | 10926-11483 | _na 185_aa | efp | elongation factor P |
| 11 | AZGM01000001.1 | GCA001435935_00631 | CDS | open | 11598-12641 | _na 347_aa | Lipoprotein | |
| 12 | AZGM01000001.1 | GCA001435935_00632 | CDS | open | 12719-14230 | _na 503_aa | Amino acid ABC superfamily ATP binding cassette transporter%2C membrane protein | |
| 13 | AZGM01000001.1 | GCA001435935_00621 | gene | open | 774-2261 | yjeM | ||
| 14 | AZGM01000001.1 | GCA001435935_00622 | gene | open | 2336-3580 | |||
| 15 | AZGM01000001.1 | GCA001435935_00623 | gene | open | 3593-4381 | |||
| 16 | AZGM01000001.1 | GCA001435935_00624 | gene | open | 4643-6043 | |||
| 17 | AZGM01000001.1 | GCA001435935_00625 | gene | open | 6517-6630 | |||
| 18 | AZGM01000001.1 | GCA001435935_00626 | gene | open | 6736-7596 | glcU | ||
| 19 | AZGM01000001.1 | GCA001435935_00627 | gene | open | 7761-7889 | |||
| 20 | AZGM01000001.1 | GCA001435935_00628 | gene | open | 8210-9295 | |||
| 21 | AZGM01000001.1 | GCA001435935_00629 | gene | open | 9394-10434 | |||
| 22 | AZGM01000001.1 | GCA001435935_00630 | gene | open | 10926-11483 | efp | ||
| 23 | AZGM01000001.1 | GCA001435935_00631 | gene | open | 11598-12641 | |||
| 24 | AZGM01000001.1 | GCA001435935_00632 | gene | open | 12719-14230 | |||
| 25 | AZGM01000003.1 | GCA001435935_01427 | CDS | open | 179-1030 | _na 283_aa | pyridoxal kinase | |
| 26 | AZGM01000003.1 | GCA001435935_01428 | CDS | open | 1008-1511 | _na 167_aa | ECF transporter S component | |
| 27 | AZGM01000003.1 | GCA001435935_01429 | CDS | open | 1524-2243 | _na 239_aa | phoP | Alkaline phosphatase synthesis transcriptional regulatory protein PhoP |
| 28 | AZGM01000003.1 | GCA001435935_01430 | CDS | open | 2227-3720 | _na 497_aa | histidine kinase | |
| 29 | AZGM01000003.1 | GCA001435935_01431 | CDS | open | 3876-4766 | _na 296_aa | Glucose uptake protein glcu | |
| 30 | AZGM01000003.1 | GCA001435935_01432 | CDS | open | 4855-5469 | _na 204_aa | Transferase hexapeptide repeat containing protein | |
| 31 | AZGM01000003.1 | GCA001435935_01433 | CDS | open | 5610-6968 | _na 452_aa | glucose-6-phosphate isomerase | |
| 32 | AZGM01000003.1 | GCA001435935_01434 | CDS | open | 7271-8449 | _na 392_aa | ROK family protein | |
| 33 | AZGM01000003.1 | GCA001435935_01435 | CDS | open | 8522-9691 | _na 389_aa | Rok family protein | |
| 34 | AZGM01000003.1 | GCA001435935_01436 | CDS | open | 9772-12060 | _na 762_aa | yicI | alpha-xylosidase |
| 35 | AZGM01000003.1 | GCA001435935_01437 | CDS | open | 12342-13730 | _na 462_aa | Transporter%2C major facilitator family protein | |
| 36 | AZGM01000003.1 | GCA001435935_01438 | CDS | open | 13822-14292 | _na 156_aa | Rok family protein | |
| 37 | AZGM01000003.1 | GCA001435935_01439 | CDS | open | 14231-14722 | _na 163_aa | ROK family protein | |
| 38 | AZGM01000003.1 | GCA001435935_01440 | CDS | open | 14736-16211 | _na 491_aa | Aryl-phospho-beta-d-glucosidase bglh | |
| 39 | AZGM01000003.1 | GCA001435935_01441 | CDS | open | 16213-17688 | _na 491_aa | Aryl-phospho-beta-d-glucosidase bglh | |
| 40 | AZGM01000003.1 | GCA001435935_01442 | CDS | open | 17917-19284 | _na 455_aa | D-xylose-proton symporter | |
| 41 | AZGM01000003.1 | GCA001435935_01443 | CDS | open | 19577-20488 | _na 303_aa | Transcriptional regulator%2C arac family | |
| 42 | AZGM01000003.1 | GCA001435935_01444 | CDS | open | 20685-22151 | _na 488_aa | Glycoside/pentoside/hexuronide transporter | |
| 43 | AZGM01000003.1 | GCA001435935_01445 | CDS | open | 22183-24225 | _na 680_aa | Glycoside hydrolase 120 insertion domain-containing protein | |
| 44 | AZGM01000003.1 | GCA001435935_01427 | gene | open | 179-1030 | |||
| 45 | AZGM01000003.1 | GCA001435935_01428 | gene | open | 1008-1511 | |||
| 46 | AZGM01000003.1 | GCA001435935_01429 | gene | open | 1524-2243 | phoP | ||
| 47 | AZGM01000003.1 | GCA001435935_01430 | gene | open | 2227-3720 | |||
| 48 | AZGM01000003.1 | GCA001435935_01431 | gene | open | 3876-4766 | |||
| 49 | AZGM01000003.1 | GCA001435935_01432 | gene | open | 4855-5469 | |||
| 50 | AZGM01000003.1 | GCA001435935_01433 | gene | open | 5610-6968 | |||
| 51 | AZGM01000003.1 | GCA001435935_01434 | gene | open | 7271-8449 | |||
| 52 | AZGM01000003.1 | GCA001435935_01435 | gene | open | 8522-9691 | |||
| 53 | AZGM01000003.1 | GCA001435935_01436 | gene | open | 9772-12060 | yicI | ||
| 54 | AZGM01000003.1 | GCA001435935_01437 | gene | open | 12342-13730 | |||
| 55 | AZGM01000003.1 | GCA001435935_01438 | gene | open | 13822-14292 | |||
| 56 | AZGM01000003.1 | GCA001435935_01439 | gene | open | 14231-14722 | |||
| 57 | AZGM01000003.1 | GCA001435935_01440 | gene | open | 14736-16211 | |||
| 58 | AZGM01000003.1 | GCA001435935_01441 | gene | open | 16213-17688 | |||
| 59 | AZGM01000003.1 | GCA001435935_01442 | gene | open | 17917-19284 | |||
| 60 | AZGM01000003.1 | GCA001435935_01443 | gene | open | 19577-20488 | |||
| 61 | AZGM01000003.1 | GCA001435935_01444 | gene | open | 20685-22151 | |||
| 62 | AZGM01000003.1 | GCA001435935_01445 | gene | open | 22183-24225 | |||
| 63 | AZGM01000004.1 | repeat_region | open | 23978-24415 | CRISPR array with 7 repeats of length 30%2C consensus sequence ATTTACATTCCACTTCTATTAGATAAATAC and spacer length 36 | |||
| 64 | AZGM01000004.1 | GCA001435935_01524 | CDS | open | 77-1003 | _na 308_aa | Glycosyltransferase | |
| 65 | AZGM01000004.1 | GCA001435935_01525 | CDS | open | 1050-2015 | _na 321_aa | Glycosyl transferase family 2 | |
| 66 | AZGM01000004.1 | GCA001435935_01526 | CDS | open | 2043-2924 | _na 293_aa | Glycosyltransferase | |
| 67 | AZGM01000004.1 | GCA001435935_01527 | CDS | open | 2944-3714 | _na 256_aa | Family 2 glycosyl transferase | |
| 68 | AZGM01000004.1 | GCA001435935_01528 | CDS | open | 3756-4523 | _na 255_aa | Family 2 glycosyl transferase | |
| 69 | AZGM01000004.1 | GCA001435935_01529 | CDS | open | 4549-5160 | _na 203_aa | cpsC | Capsular polysaccharide biosynthesis protein CpsC |
| 70 | AZGM01000004.1 | GCA001435935_01530 | CDS | open | 5157-6347 | _na 396_aa | Polymerase | |
| 71 | AZGM01000004.1 | GCA001435935_01531 | CDS | open | 6385-7314 | _na 309_aa | Glycosyltransferase%2C group 2 family protein | |
| 72 | AZGM01000004.1 | GCA001435935_01532 | CDS | open | 7335-8096 | _na 253_aa | DUF4422 domain-containing protein | |
| 73 | AZGM01000004.1 | GCA001435935_01533 | CDS | open | 8118-8762 | _na 214_aa | Undecaprenyl-phosphate galactose phosphotransferase | |
| 74 | AZGM01000004.1 | GCA001435935_01534 | CDS | open | 8822-9622 | _na 266_aa | recX | recombination regulator RecX |
| 75 | AZGM01000004.1 | GCA001435935_01535 | CDS | open | 9722-9937 | _na 71_aa | DUF1659 domain-containing protein | |
| 76 | AZGM01000004.1 | GCA001435935_01536 | CDS | open | 9962-10207 | _na 81_aa | DUF2922 domain-containing protein | |
| 77 | AZGM01000004.1 | GCA001435935_01537 | CDS | open | 10279-11172 | _na 297_aa | yihY | YihY family protein |
| 78 | AZGM01000004.1 | GCA001435935_01538 | CDS | open | 11290-12795 | _na 501_aa | yjeM | glutamate/gamma-aminobutyrate family transporter YjeM |
| 79 | AZGM01000004.1 | GCA001435935_01539 | CDS | open | 13200-14054 | _na 284_aa | map | type I methionyl aminopeptidase |
| 80 | AZGM01000004.1 | GCA001435935_01540 | CDS | open | 14167-14625 | _na 152_aa | flavodoxin | |
| 81 | AZGM01000004.1 | GCA001435935_01541 | CDS | open | 14618-15055 | _na 145_aa | GtrA-like protein | |
| 82 | AZGM01000004.1 | GCA001435935_01542 | CDS | open | 15113-16246 | _na 377_aa | wecB | non-hydrolyzing UDP-N-acetylglucosamine 2-epimerase |
| 83 | AZGM01000004.1 | GCA001435935_01544 | CDS | open | 16480-17784 | _na 434_aa | DEAD DEAH box family ATP-dependent RNA helicase | |
| 84 | AZGM01000004.1 | GCA001435935_01545 | CDS | open | 17796-18815 | _na 339_aa | Oxidoreductase%2C nad-binding domain protein | |
| 85 | AZGM01000004.1 | GCA001435935_01546 | CDS | open | 18981-19343 | _na 120_aa | DUF4828 domain-containing protein | |
| 86 | AZGM01000004.1 | GCA001435935_01547 | CDS | open | 19385-19960 | _na 191_aa | Cytokinin riboside 5'-monophosphate phosphoribohydrolase | |
| 87 | AZGM01000004.1 | GCA001435935_01548 | CDS | open | 19950-20891 | _na 313_aa | L-2-hydroxyisocaproate dehydrogenase | |
| 88 | AZGM01000004.1 | GCA001435935_01549 | CDS | open | 20965-22500 | _na 511_aa | Glutamate--cysteine ligase | |
| 89 | AZGM01000004.1 | GCA001435935_01550 | CDS | open | 22639-23127 | _na 162_aa | ybaK | YbaK prolyl-tRNA synthetase domain protein |
| 90 | AZGM01000004.1 | GCA001435935_01551 | CDS | open | 23194-23622 | _na 142_aa | Transposase | |
| 91 | AZGM01000004.1 | GCA001435935_01552 | CDS | open | 23576-23887 | _na 103_aa | 6-O-methylguanine DNA methyltransferase%2C DNA binding domain protein | |
| 92 | AZGM01000004.1 | GCA001435935_01524 | gene | open | 77-1003 | |||
| 93 | AZGM01000004.1 | GCA001435935_01525 | gene | open | 1050-2015 | |||
| 94 | AZGM01000004.1 | GCA001435935_01526 | gene | open | 2043-2924 | |||
| 95 | AZGM01000004.1 | GCA001435935_01527 | gene | open | 2944-3714 | |||
| 96 | AZGM01000004.1 | GCA001435935_01528 | gene | open | 3756-4523 | |||
| 97 | AZGM01000004.1 | GCA001435935_01529 | gene | open | 4549-5160 | cpsC | ||
| 98 | AZGM01000004.1 | GCA001435935_01530 | gene | open | 5157-6347 | |||
| 99 | AZGM01000004.1 | GCA001435935_01531 | gene | open | 6385-7314 | |||
| 100 | AZGM01000004.1 | GCA001435935_01532 | gene | open | 7335-8096 | |||
| 101 | AZGM01000004.1 | GCA001435935_01533 | gene | open | 8118-8762 | |||
| 102 | AZGM01000004.1 | GCA001435935_01534 | gene | open | 8822-9622 | recX | ||
| 103 | AZGM01000004.1 | GCA001435935_01535 | gene | open | 9722-9937 | |||
| 104 | AZGM01000004.1 | GCA001435935_01536 | gene | open | 9962-10207 | |||
| 105 | AZGM01000004.1 | GCA001435935_01537 | gene | open | 10279-11172 | yihY | ||
| 106 | AZGM01000004.1 | GCA001435935_01538 | gene | open | 11290-12795 | yjeM | ||
| 107 | AZGM01000004.1 | GCA001435935_01539 | gene | open | 13200-14054 | map | ||
| 108 | AZGM01000004.1 | GCA001435935_01540 | gene | open | 14167-14625 | |||
| 109 | AZGM01000004.1 | GCA001435935_01541 | gene | open | 14618-15055 | |||
| 110 | AZGM01000004.1 | GCA001435935_01542 | gene | open | 15113-16246 | wecB | ||
| 111 | AZGM01000004.1 | GCA001435935_01544 | gene | open | 16480-17784 | |||
| 112 | AZGM01000004.1 | GCA001435935_01545 | gene | open | 17796-18815 | |||
| 113 | AZGM01000004.1 | GCA001435935_01546 | gene | open | 18981-19343 | |||
| 114 | AZGM01000004.1 | GCA001435935_01547 | gene | open | 19385-19960 | |||
| 115 | AZGM01000004.1 | GCA001435935_01548 | gene | open | 19950-20891 | |||
| 116 | AZGM01000004.1 | GCA001435935_01549 | gene | open | 20965-22500 | |||
| 117 | AZGM01000004.1 | GCA001435935_01550 | gene | open | 22639-23127 | ybaK | ||
| 118 | AZGM01000004.1 | GCA001435935_01551 | gene | open | 23194-23622 | |||
| 119 | AZGM01000004.1 | GCA001435935_01552 | gene | open | 23576-23887 | |||
| 120 | AZGM01000004.1 | GCA001435935_01543 | gene | open | 16351-16423 | trnR | ||
| 121 | AZGM01000004.1 | GCA001435935_01543 | tRNA | open | 16351-16423 | trnR | tRNA-Arg(cct) | |
| 122 | AZGM01000006.1 | GCA001435935_01739 | CDS | open | 991-1557 | _na 188_aa | Bacterial mobilisation domain-containing protein | |
| 123 | AZGM01000006.1 | GCA001435935_01740 | CDS | open | 2454-3386 | _na 310_aa | hypothetical protein | |
| 124 | AZGM01000006.1 | GCA001435935_01741 | CDS | open | 3376-3639 | _na 87_aa | histidine kinase | |
| 125 | AZGM01000006.1 | GCA001435935_01742 | CDS | open | 4601-4804 | _na 67_aa | HTH cro/C1-type domain-containing protein | |
| 126 | AZGM01000006.1 | GCA001435935_01743 | CDS | open | 4966-8253 | _na 1095_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 127 | AZGM01000006.1 | GCA001435935_01744 | CDS | open | 8283-11456 | _na 1057_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 128 | AZGM01000006.1 | GCA001435935_01745 | CDS | open | 11487-11804 | _na 105_aa | hypothetical protein | |
| 129 | AZGM01000006.1 | GCA001435935_01746 | CDS | open | 11884-12489 | _na 201_aa | hypothetical protein | |
| 130 | AZGM01000006.1 | GCA001435935_01747 | CDS | open | 12646-13023 | _na 125_aa | hypothetical protein | |
| 131 | AZGM01000006.1 | GCA001435935_01748 | CDS | open | 13671-14105 | _na 144_aa | hypothetical protein | |
| 132 | AZGM01000006.1 | GCA001435935_01749 | CDS | open | 14678-17554 | _na 958_aa | DNA-directed DNA polymerase | |
| 133 | AZGM01000006.1 | GCA001435935_01750 | CDS | open | 17568-17939 | _na 123_aa | hypothetical protein | |
| 134 | AZGM01000006.1 | GCA001435935_01751 | CDS | open | 17958-18311 | _na 117_aa | hypothetical protein | |
| 135 | AZGM01000006.1 | GCA001435935_01752 | CDS | open | 18330-18425 | _na 31_aa | hypothetical protein | |
| 136 | AZGM01000006.1 | GCA001435935_01753 | CDS | open | 18493-18909 | _na 138_aa | hypothetical protein | |
| 137 | AZGM01000006.1 | GCA001435935_01754 | CDS | open | 18923-19492 | _na 189_aa | hypothetical protein | |
| 138 | AZGM01000006.1 | GCA001435935_01755 | CDS | open | 19512-19697 | _na 61_aa | Helix-turn-helix domain-containing protein | |
| 139 | AZGM01000006.1 | GCA001435935_01756 | CDS | open | 19761-20993 | _na 410_aa | Integrase | |
| 140 | AZGM01000006.1 | GCA001435935_01739 | gene | open | 991-1557 | |||
| 141 | AZGM01000006.1 | GCA001435935_01740 | gene | open | 2454-3386 | |||
| 142 | AZGM01000006.1 | GCA001435935_01741 | gene | open | 3376-3639 | |||
| 143 | AZGM01000006.1 | GCA001435935_01742 | gene | open | 4601-4804 | |||
| 144 | AZGM01000006.1 | GCA001435935_01743 | gene | open | 4966-8253 | |||
| 145 | AZGM01000006.1 | GCA001435935_01744 | gene | open | 8283-11456 | |||
| 146 | AZGM01000006.1 | GCA001435935_01745 | gene | open | 11487-11804 | |||
| 147 | AZGM01000006.1 | GCA001435935_01746 | gene | open | 11884-12489 | |||
| 148 | AZGM01000006.1 | GCA001435935_01747 | gene | open | 12646-13023 | |||
| 149 | AZGM01000006.1 | GCA001435935_01748 | gene | open | 13671-14105 | |||
| 150 | AZGM01000006.1 | GCA001435935_01749 | gene | open | 14678-17554 | |||
| 151 | AZGM01000006.1 | GCA001435935_01750 | gene | open | 17568-17939 | |||
| 152 | AZGM01000006.1 | GCA001435935_01751 | gene | open | 17958-18311 | |||
| 153 | AZGM01000006.1 | GCA001435935_01752 | gene | open | 18330-18425 | |||
| 154 | AZGM01000006.1 | GCA001435935_01753 | gene | open | 18493-18909 | |||
| 155 | AZGM01000006.1 | GCA001435935_01754 | gene | open | 18923-19492 | |||
| 156 | AZGM01000006.1 | GCA001435935_01755 | gene | open | 19512-19697 | |||
| 157 | AZGM01000006.1 | GCA001435935_01756 | gene | open | 19761-20993 | |||
| 158 | AZGM01000006.1 | GCA001435935_01738 | gene | open | 166-238 | trnT | ||
| 159 | AZGM01000006.1 | GCA001435935_01738 | tRNA | open | 166-238 | trnT | tRNA-Thr(agt) | |
| 160 | AZGM01000008.1 | GCA001435935_01869 | gene | open | 95-1618 | rrl | ||
| 161 | AZGM01000008.1 | GCA001435935_01869 | rRNA | open | 95-1618 | rrl | 23S ribosomal RNA | |
| 162 | AZGM01000011.1 | GCA001435935_00253 | CDS | open | 595-2079 | _na 494_aa | Potassium transport system protein kup2 | |
| 163 | AZGM01000011.1 | GCA001435935_00253 | gene | open | 595-2079 | |||
| 164 | AZGM01000012.1 | GCA001435935_00344 | CDS | open | 146-493 | _na 115_aa | hypothetical protein | |
| 165 | AZGM01000012.1 | GCA001435935_00345 | CDS | open | 1190-3103 | _na 637_aa | P-type Cu(+) transporter | |
| 166 | AZGM01000012.1 | GCA001435935_00346 | CDS | open | 3103-3474 | _na 123_aa | cupredoxin domain-containing protein | |
| 167 | AZGM01000012.1 | GCA001435935_00347 | CDS | open | 3633-4847 | _na 404_aa | Choice-of-anchor A domain-containing protein | |
| 168 | AZGM01000012.1 | GCA001435935_00348 | CDS | open | 4805-5431 | _na 208_aa | KxYKxGKxW signal peptide domain-containing protein | |
| 169 | AZGM01000012.1 | GCA001435935_00344 | gene | open | 146-493 | |||
| 170 | AZGM01000012.1 | GCA001435935_00345 | gene | open | 1190-3103 | |||
| 171 | AZGM01000012.1 | GCA001435935_00346 | gene | open | 3103-3474 | |||
| 172 | AZGM01000012.1 | GCA001435935_00347 | gene | open | 3633-4847 | |||
| 173 | AZGM01000012.1 | GCA001435935_00348 | gene | open | 4805-5431 | |||
| 174 | AZGM01000013.1 | GCA001435935_00383 | CDS | open | 141-992 | _na 283_aa | azlC | Azaleucine resistance protein AzlC |
| 175 | AZGM01000013.1 | GCA001435935_00384 | CDS | open | 1004-1384 | _na 126_aa | Branched-chain amino acid transport protein (AzlD) | |
| 176 | AZGM01000013.1 | GCA001435935_00385 | CDS | open | 1635-2870 | _na 411_aa | Transporter%2C major facilitator family protein | |
| 177 | AZGM01000013.1 | GCA001435935_00386 | CDS | open | 3241-4167 | _na 308_aa | dihydroorotate dehydrogenase | |
| 178 | AZGM01000013.1 | GCA001435935_00387 | CDS | open | 4164-4889 | _na 241_aa | pyrF | orotidine-5'-phosphate decarboxylase |
| 179 | AZGM01000013.1 | GCA001435935_00388 | CDS | open | 4891-5526 | _na 211_aa | Orotate phosphoribosyltransferase | |
| 180 | AZGM01000013.1 | GCA001435935_00389 | CDS | open | 5583-6248 | _na 221_aa | NADPH-flavin oxidoreductase | |
| 181 | AZGM01000013.1 | GCA001435935_00390 | CDS | open | 6410-7354 | _na 314_aa | L-2-hydroxyisocaproate dehydrogenase | |
| 182 | AZGM01000013.1 | GCA001435935_00391 | CDS | open | 7433-8611 | _na 392_aa | Cyclopropane-fatty-acyl-phospholipid synthase | |
| 183 | AZGM01000013.1 | GCA001435935_00392 | CDS | open | 8747-9778 | _na 343_aa | Membrane protein | |
| 184 | AZGM01000013.1 | GCA001435935_00393 | CDS | open | 10071-11750 | _na 559_aa | alsS | acetolactate synthase AlsS |
| 185 | AZGM01000013.1 | GCA001435935_00394 | CDS | open | 11750-12484 | _na 244_aa | budA | acetolactate decarboxylase |
| 186 | AZGM01000013.1 | GCA001435935_00395 | CDS | open | 12783-14444 | _na 553_aa | formate--tetrahydrofolate ligase | |
| 187 | AZGM01000013.1 | GCA001435935_00396 | CDS | open | 14606-15091 | _na 161_aa | N5-carboxyaminoimidazole ribonucleotide mutase | |
| 188 | AZGM01000013.1 | GCA001435935_00397 | CDS | open | 15075-16208 | _na 377_aa | purK | 5-(carboxyamino)imidazole ribonucleotide synthase |
| 189 | AZGM01000013.1 | GCA001435935_00398 | CDS | open | 16275-17570 | _na 431_aa | purB | adenylosuccinate lyase |
| 190 | AZGM01000013.1 | GCA001435935_00399 | CDS | open | 17757-17936 | _na 59_aa | hypothetical protein | |
| 191 | AZGM01000013.1 | GCA001435935_00400 | CDS | open | 17933-18448 | _na 171_aa | Acetyltransferase%2C GNAT family | |
| 192 | AZGM01000013.1 | GCA001435935_00401 | CDS | open | 18541-19821 | _na 426_aa | Homoserine dehydrogenase | |
| 193 | AZGM01000013.1 | GCA001435935_00402 | CDS | open | 19837-21120 | _na 427_aa | O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase | |
| 194 | AZGM01000013.1 | GCA001435935_00403 | CDS | open | 21137-21877 | _na 246_aa | Homoserine O-acetyltransferase | |
| 195 | AZGM01000013.1 | GCA001435935_00404 | CDS | open | 22551-23270 | _na 239_aa | purC | phosphoribosylaminoimidazolesuccinocarboxamide synthase |
| 196 | AZGM01000013.1 | GCA001435935_00405 | CDS | open | 23270-23518 | _na 82_aa | purS | phosphoribosylformylglycinamidine synthase subunit PurS |
| 197 | AZGM01000013.1 | GCA001435935_00406 | CDS | open | 23518-24198 | _na 226_aa | purQ | phosphoribosylformylglycinamidine synthase subunit PurQ |
| 198 | AZGM01000013.1 | GCA001435935_00407 | CDS | open | 24202-26430 | _na 742_aa | purL | phosphoribosylformylglycinamidine synthase subunit PurL |
| 199 | AZGM01000013.1 | GCA001435935_00408 | CDS | open | 26406-27872 | _na 488_aa | purF | amidophosphoribosyltransferase |
| 200 | AZGM01000013.1 | GCA001435935_00409 | CDS | open | 27869-28906 | _na 345_aa | Phosphoribosylformylglycinamidine cyclo-ligase | |
| 201 | AZGM01000013.1 | GCA001435935_00410 | CDS | open | 28917-29495 | _na 192_aa | purN | phosphoribosylglycinamide formyltransferase |
| 202 | AZGM01000013.1 | GCA001435935_00411 | CDS | open | 29501-31039 | _na 512_aa | purH | bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase |
| 203 | AZGM01000013.1 | GCA001435935_00412 | CDS | open | 31057-32313 | _na 418_aa | Phosphoribosylamine--glycine ligase | |
| 204 | AZGM01000013.1 | GCA001435935_00413 | CDS | open | 32419-33105 | _na 228_aa | gpmA | 2%2C3-diphosphoglycerate-dependent phosphoglycerate mutase |
| 205 | AZGM01000013.1 | GCA001435935_00414 | CDS | open | 33411-34454 | _na 347_aa | Integral membrane protein | |
| 206 | AZGM01000013.1 | GCA001435935_00415 | CDS | open | 34732-37554 | _na 940_aa | Phosphatidylglycerol--membrane-oligosaccharide glycerophosphotransferase | |
| 207 | AZGM01000013.1 | GCA001435935_00416 | CDS | open | 37852-39102 | _na 416_aa | tyrS | tyrosine--tRNA ligase |
| 208 | AZGM01000013.1 | GCA001435935_00383 | gene | open | 141-992 | azlC | ||
| 209 | AZGM01000013.1 | GCA001435935_00384 | gene | open | 1004-1384 | |||
| 210 | AZGM01000013.1 | GCA001435935_00385 | gene | open | 1635-2870 | |||
| 211 | AZGM01000013.1 | GCA001435935_00386 | gene | open | 3241-4167 | |||
| 212 | AZGM01000013.1 | GCA001435935_00387 | gene | open | 4164-4889 | pyrF | ||
| 213 | AZGM01000013.1 | GCA001435935_00388 | gene | open | 4891-5526 | |||
| 214 | AZGM01000013.1 | GCA001435935_00389 | gene | open | 5583-6248 | |||
| 215 | AZGM01000013.1 | GCA001435935_00390 | gene | open | 6410-7354 | |||
| 216 | AZGM01000013.1 | GCA001435935_00391 | gene | open | 7433-8611 | |||
| 217 | AZGM01000013.1 | GCA001435935_00392 | gene | open | 8747-9778 | |||
| 218 | AZGM01000013.1 | GCA001435935_00393 | gene | open | 10071-11750 | alsS | ||
| 219 | AZGM01000013.1 | GCA001435935_00394 | gene | open | 11750-12484 | budA | ||
| 220 | AZGM01000013.1 | GCA001435935_00395 | gene | open | 12783-14444 | |||
| 221 | AZGM01000013.1 | GCA001435935_00396 | gene | open | 14606-15091 | |||
| 222 | AZGM01000013.1 | GCA001435935_00397 | gene | open | 15075-16208 | purK | ||
| 223 | AZGM01000013.1 | GCA001435935_00398 | gene | open | 16275-17570 | purB | ||
| 224 | AZGM01000013.1 | GCA001435935_00399 | gene | open | 17757-17936 | |||
| 225 | AZGM01000013.1 | GCA001435935_00400 | gene | open | 17933-18448 | |||
| 226 | AZGM01000013.1 | GCA001435935_00401 | gene | open | 18541-19821 | |||
| 227 | AZGM01000013.1 | GCA001435935_00402 | gene | open | 19837-21120 | |||
| 228 | AZGM01000013.1 | GCA001435935_00403 | gene | open | 21137-21877 | |||
| 229 | AZGM01000013.1 | GCA001435935_00404 | gene | open | 22551-23270 | purC | ||
| 230 | AZGM01000013.1 | GCA001435935_00405 | gene | open | 23270-23518 | purS | ||
| 231 | AZGM01000013.1 | GCA001435935_00406 | gene | open | 23518-24198 | purQ | ||
| 232 | AZGM01000013.1 | GCA001435935_00407 | gene | open | 24202-26430 | purL | ||
| 233 | AZGM01000013.1 | GCA001435935_00408 | gene | open | 26406-27872 | purF | ||
| 234 | AZGM01000013.1 | GCA001435935_00409 | gene | open | 27869-28906 | |||
| 235 | AZGM01000013.1 | GCA001435935_00410 | gene | open | 28917-29495 | purN | ||
| 236 | AZGM01000013.1 | GCA001435935_00411 | gene | open | 29501-31039 | purH | ||
| 237 | AZGM01000013.1 | GCA001435935_00412 | gene | open | 31057-32313 | |||
| 238 | AZGM01000013.1 | GCA001435935_00413 | gene | open | 32419-33105 | gpmA | ||
| 239 | AZGM01000013.1 | GCA001435935_00414 | gene | open | 33411-34454 | |||
| 240 | AZGM01000013.1 | GCA001435935_00415 | gene | open | 34732-37554 | |||
| 241 | AZGM01000013.1 | GCA001435935_00416 | gene | open | 37852-39102 | tyrS | ||
| 242 | AZGM01000014.1 | GCA001435935_00558 | CDS | open | 585-785 | _na 66_aa | CSD domain-containing protein | |
| 243 | AZGM01000014.1 | GCA001435935_00559 | CDS | open | 880-1860 | _na 326_aa | ISL3 family transposase | |
| 244 | AZGM01000014.1 | GCA001435935_00560 | CDS | open | 2312-3688 | _na 458_aa | rlmD | 23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD |
| 245 | AZGM01000014.1 | GCA001435935_00561 | CDS | open | 3942-5255 | _na 437_aa | Multidrug resistance protein b | |
| 246 | AZGM01000014.1 | GCA001435935_00562 | CDS | open | 5261-5683 | _na 140_aa | HTH marR-type domain-containing protein | |
| 247 | AZGM01000014.1 | GCA001435935_00558 | gene | open | 585-785 | |||
| 248 | AZGM01000014.1 | GCA001435935_00559 | gene | open | 880-1860 | |||
| 249 | AZGM01000014.1 | GCA001435935_00560 | gene | open | 2312-3688 | rlmD | ||
| 250 | AZGM01000014.1 | GCA001435935_00561 | gene | open | 3942-5255 | |||
| 251 | AZGM01000014.1 | GCA001435935_00562 | gene | open | 5261-5683 | |||
| 252 | AZGM01000015.1 | GCA001435935_00701 | CDS | open | 1061-2263 | _na 400_aa | nupC | Nucleoside transporter%2C NupC family |
| 253 | AZGM01000015.1 | GCA001435935_00702 | CDS | open | 2347-3255 | _na 302_aa | rihC | ribonucleoside hydrolase RihC |
| 254 | AZGM01000015.1 | GCA001435935_00703 | CDS | open | 3497-4222 | _na 241_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 255 | AZGM01000015.1 | GCA001435935_00704 | CDS | open | 4236-5189 | _na 317_aa | noc | nucleoid occlusion protein |
| 256 | AZGM01000015.1 | GCA001435935_00705 | CDS | open | 5202-5972 | _na 256_aa | Sporulation initiation inhibitor protein Soj | |
| 257 | AZGM01000015.1 | GCA001435935_00706 | CDS | open | 5959-6846 | _na 295_aa | Stage 0 sporulation protein J | |
| 258 | AZGM01000015.1 | GCA001435935_00707 | CDS | open | 6859-7062 | _na 67_aa | DUF951 domain-containing protein | |
| 259 | AZGM01000015.1 | GCA001435935_00708 | CDS | open | 7110-8207 | _na 365_aa | ychF | redox-regulated ATPase YchF |
| 260 | AZGM01000015.1 | GCA001435935_00709 | CDS | open | 8277-9026 | _na 249_aa | Integral membrane protein | |
| 261 | AZGM01000015.1 | GCA001435935_00710 | CDS | open | 9320-11476 | _na 718_aa | yicI | alpha-xylosidase |
| 262 | AZGM01000015.1 | GCA001435935_00711 | CDS | open | 11497-11955 | _na 152_aa | Glycoside pentoside hexuronide transporter | |
| 263 | AZGM01000015.1 | GCA001435935_00712 | CDS | open | 11955-12884 | _na 309_aa | Glycoside pentoside hexuronide transporter | |
| 264 | AZGM01000015.1 | GCA001435935_00713 | CDS | open | 13194-13871 | _na 225_aa | deoC | deoxyribose-phosphate aldolase |
| 265 | AZGM01000015.1 | GCA001435935_00714 | CDS | open | 13917-15110 | _na 397_aa | deoB | phosphopentomutase |
| 266 | AZGM01000015.1 | GCA001435935_00715 | CDS | open | 15140-16438 | _na 432_aa | pyrimidine-nucleoside phosphorylase | |
| 267 | AZGM01000015.1 | GCA001435935_00716 | CDS | open | 16455-17165 | _na 236_aa | deoD | purine-nucleoside phosphorylase |
| 268 | AZGM01000015.1 | GCA001435935_00717 | CDS | open | 17271-18221 | _na 316_aa | Deoxyribonucleoside regulator | |
| 269 | AZGM01000015.1 | GCA001435935_00718 | CDS | open | 18292-19434 | _na 380_aa | guaB | Inosine-5-monophosphate dehydrogenase |
| 270 | AZGM01000015.1 | GCA001435935_00719 | CDS | open | 19575-20582 | _na 335_aa | Transcriptional regulator lytr | |
| 271 | AZGM01000015.1 | GCA001435935_00720 | CDS | open | 20679-21368 | _na 229_aa | phoB | Phosphate regulon transcriptional regulatory protein PhoB |
| 272 | AZGM01000015.1 | GCA001435935_00721 | CDS | open | 21395-22525 | _na 376_aa | histidine kinase | |
| 273 | AZGM01000015.1 | GCA001435935_00701 | gene | open | 1061-2263 | nupC | ||
| 274 | AZGM01000015.1 | GCA001435935_00702 | gene | open | 2347-3255 | rihC | ||
| 275 | AZGM01000015.1 | GCA001435935_00703 | gene | open | 3497-4222 | rsmG | ||
| 276 | AZGM01000015.1 | GCA001435935_00704 | gene | open | 4236-5189 | noc | ||
| 277 | AZGM01000015.1 | GCA001435935_00705 | gene | open | 5202-5972 | |||
| 278 | AZGM01000015.1 | GCA001435935_00706 | gene | open | 5959-6846 | |||
| 279 | AZGM01000015.1 | GCA001435935_00707 | gene | open | 6859-7062 | |||
| 280 | AZGM01000015.1 | GCA001435935_00708 | gene | open | 7110-8207 | ychF | ||
| 281 | AZGM01000015.1 | GCA001435935_00709 | gene | open | 8277-9026 | |||
| 282 | AZGM01000015.1 | GCA001435935_00710 | gene | open | 9320-11476 | yicI | ||
| 283 | AZGM01000015.1 | GCA001435935_00711 | gene | open | 11497-11955 | |||
| 284 | AZGM01000015.1 | GCA001435935_00712 | gene | open | 11955-12884 | |||
| 285 | AZGM01000015.1 | GCA001435935_00713 | gene | open | 13194-13871 | deoC | ||
| 286 | AZGM01000015.1 | GCA001435935_00714 | gene | open | 13917-15110 | deoB | ||
| 287 | AZGM01000015.1 | GCA001435935_00715 | gene | open | 15140-16438 | |||
| 288 | AZGM01000015.1 | GCA001435935_00716 | gene | open | 16455-17165 | deoD | ||
| 289 | AZGM01000015.1 | GCA001435935_00717 | gene | open | 17271-18221 | |||
| 290 | AZGM01000015.1 | GCA001435935_00718 | gene | open | 18292-19434 | guaB | ||
| 291 | AZGM01000015.1 | GCA001435935_00719 | gene | open | 19575-20582 | |||
| 292 | AZGM01000015.1 | GCA001435935_00720 | gene | open | 20679-21368 | phoB | ||
| 293 | AZGM01000015.1 | GCA001435935_00721 | gene | open | 21395-22525 | |||
| 294 | AZGM01000016.1 | regulatory_region | open | 63324-63392 | Ribosomal protein L21 leader | |||
| 295 | AZGM01000016.1 | GCA001435935_00724 | CDS | open | 69-332 | _na 87_aa | Antitoxin | |
| 296 | AZGM01000016.1 | GCA001435935_00725 | CDS | open | 381-809 | _na 142_aa | Transcriptional regulator%2C hxlr family | |
| 297 | AZGM01000016.1 | GCA001435935_00726 | CDS | open | 867-1589 | _na 240_aa | hypothetical protein | |
| 298 | AZGM01000016.1 | GCA001435935_00727 | CDS | open | 1806-2369 | _na 187_aa | RNA polymerase sigma factor%2C sigma-70 family | |
| 299 | AZGM01000016.1 | GCA001435935_00728 | CDS | open | 2366-2611 | _na 81_aa | hypothetical protein | |
| 300 | AZGM01000016.1 | GCA001435935_00729 | CDS | open | 2679-3656 | _na 325_aa | Linear amide c-n hydrolase%2C choloylglycine hydrolase family protein | |
| 301 | AZGM01000016.1 | GCA001435935_00730 | CDS | open | 3768-4082 | _na 104_aa | NADH:flavin oxidoreductase/NADH oxidase N-terminal domain-containing protein | |
| 302 | AZGM01000016.1 | GCA001435935_00731 | CDS | open | 4119-4451 | _na 110_aa | NADH-dependent oxidoreductase | |
| 303 | AZGM01000016.1 | GCA001435935_00732 | CDS | open | 4542-5009 | _na 155_aa | hypothetical protein | |
| 304 | AZGM01000016.1 | GCA001435935_00733 | CDS | open | 5091-5603 | _na 170_aa | hypothetical protein | |
| 305 | AZGM01000016.1 | GCA001435935_00734 | CDS | open | 5624-7108 | _na 494_aa | glpK | glycerol kinase GlpK |
| 306 | AZGM01000016.1 | GCA001435935_00735 | CDS | open | 7192-7380 | _na 62_aa | 2-hydroxymuconate tautomerase | |
| 307 | AZGM01000016.1 | GCA001435935_00736 | CDS | open | 7454-9283 | _na 609_aa | Trka c-terminal domain protein | |
| 308 | AZGM01000016.1 | GCA001435935_00737 | CDS | open | 9439-10845 | _na 468_aa | C69 family dipeptidase | |
| 309 | AZGM01000016.1 | GCA001435935_00738 | CDS | open | 10978-12438 | _na 486_aa | Glycosyltransferase | |
| 310 | AZGM01000016.1 | GCA001435935_00739 | CDS | open | 12439-13992 | _na 517_aa | Glycosyl transferase group 1 | |
| 311 | AZGM01000016.1 | GCA001435935_00740 | CDS | open | 14211-15866 | _na 551_aa | Thioredoxin-disulfide reductase | |
| 312 | AZGM01000016.1 | GCA001435935_00741 | CDS | open | 15888-16451 | _na 187_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 313 | AZGM01000016.1 | GCA001435935_00742 | CDS | open | 16657-16926 | _na 89_aa | rpsN | 30S ribosomal protein S14 |
| 314 | AZGM01000016.1 | GCA001435935_00743 | CDS | open | 17052-17906 | _na 284_aa | Ser Thr phosphatase family protein | |
| 315 | AZGM01000016.1 | GCA001435935_00744 | CDS | open | 18034-19398 | _na 454_aa | Transporter%2C major facilitator family protein | |
| 316 | AZGM01000016.1 | GCA001435935_00745 | CDS | open | 19444-20661 | _na 405_aa | MFS family major facilitator transporter | |
| 317 | AZGM01000016.1 | GCA001435935_00746 | CDS | open | 20699-21370 | _na 223_aa | hypothetical protein | |
| 318 | AZGM01000016.1 | GCA001435935_00747 | CDS | open | 21756-22358 | _na 200_aa | Integral membrane protein | |
| 319 | AZGM01000016.1 | GCA001435935_00748 | CDS | open | 22608-22973 | _na 121_aa | rplS | 50S ribosomal protein L19 |
| 320 | AZGM01000016.1 | GCA001435935_00749 | CDS | open | 23088-24533 | _na 481_aa | Amino acid permease | |
| 321 | AZGM01000016.1 | GCA001435935_00750 | CDS | open | 24533-25291 | _na 252_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 322 | AZGM01000016.1 | GCA001435935_00751 | CDS | open | 25291-25797 | _na 168_aa | rimM | ribosome maturation factor RimM |
| 323 | AZGM01000016.1 | GCA001435935_00752 | CDS | open | 25880-26140 | _na 86_aa | khpA | RNA-binding protein KhpA |
| 324 | AZGM01000016.1 | GCA001435935_00753 | CDS | open | 26153-26428 | _na 91_aa | rpsP | 30S ribosomal protein S16 |
| 325 | AZGM01000016.1 | GCA001435935_00754 | CDS | open | 26515-27963 | _na 482_aa | ffh | signal recognition particle protein |
| 326 | AZGM01000016.1 | GCA001435935_00755 | CDS | open | 27967-28308 | _na 113_aa | ylxM | putative DNA-binding protein |
| 327 | AZGM01000016.1 | GCA001435935_00756 | CDS | open | 28321-29856 | _na 511_aa | ftsY | signal recognition particle-docking protein FtsY |
| 328 | AZGM01000016.1 | GCA001435935_00757 | CDS | open | 29859-33431 | _na 1190_aa | smc | chromosome segregation protein SMC |
| 329 | AZGM01000016.1 | GCA001435935_00758 | CDS | open | 33450-34148 | _na 232_aa | rnc | ribonuclease III |
| 330 | AZGM01000016.1 | GCA001435935_00759 | CDS | open | 34349-34609 | _na 86_aa | acpP | acyl carrier protein |
| 331 | AZGM01000016.1 | GCA001435935_00760 | CDS | open | 34646-35677 | _na 343_aa | plsX | phosphate acyltransferase PlsX |
| 332 | AZGM01000016.1 | GCA001435935_00761 | CDS | open | 35694-37730 | _na 678_aa | recG | ATP-dependent DNA helicase RecG |
| 333 | AZGM01000016.1 | GCA001435935_00762 | CDS | open | 37812-39521 | _na 569_aa | yloV | DAK2 domain fusion protein YloV |
| 334 | AZGM01000016.1 | GCA001435935_00763 | CDS | open | 39546-39911 | _na 121_aa | Asp23/Gls24 family envelope stress response protein | |
| 335 | AZGM01000016.1 | GCA001435935_00764 | CDS | open | 40082-40267 | _na 61_aa | rpmB | 50S ribosomal protein L28 |
| 336 | AZGM01000016.1 | GCA001435935_00765 | CDS | open | 40397-41053 | _na 218_aa | thiamine diphosphokinase | |
| 337 | AZGM01000016.1 | GCA001435935_00766 | CDS | open | 41309-41962 | _na 217_aa | rpe | ribulose-phosphate 3-epimerase |
| 338 | AZGM01000016.1 | GCA001435935_00767 | CDS | open | 41973-42845 | _na 290_aa | rsgA | ribosome small subunit-dependent GTPase A |
| 339 | AZGM01000016.1 | GCA001435935_00768 | CDS | open | 42860-44785 | _na 641_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 340 | AZGM01000016.1 | GCA001435935_00769 | CDS | open | 44788-45534 | _na 248_aa | Stp1/IreP family PP2C-type Ser/Thr phosphatase | |
| 341 | AZGM01000016.1 | GCA001435935_00770 | CDS | open | 45553-46899 | _na 448_aa | rsmB | 16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB |
| 342 | AZGM01000016.1 | GCA001435935_00771 | CDS | open | 46892-47845 | _na 317_aa | fmt | methionyl-tRNA formyltransferase |
| 343 | AZGM01000016.1 | GCA001435935_00772 | CDS | open | 47863-50292 | _na 809_aa | priA | primosomal protein N' |
| 344 | AZGM01000016.1 | GCA001435935_00773 | CDS | open | 50293-51501 | _na 402_aa | coaBC | bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC |
| 345 | AZGM01000016.1 | GCA001435935_00774 | CDS | open | 51625-51843 | _na 72_aa | rpoZ | DNA-directed RNA polymerase subunit omega |
| 346 | AZGM01000016.1 | GCA001435935_00775 | CDS | open | 51840-52460 | _na 206_aa | gmk | guanylate kinase |
| 347 | AZGM01000016.1 | GCA001435935_00776 | CDS | open | 52627-52968 | _na 113_aa | hypothetical protein | |
| 348 | AZGM01000016.1 | GCA001435935_00777 | CDS | open | 53063-54751 | _na 562_aa | recN | DNA repair protein RecN |
| 349 | AZGM01000016.1 | GCA001435935_00778 | CDS | open | 54755-55213 | _na 152_aa | Arginine repressor | |
| 350 | AZGM01000016.1 | GCA001435935_00779 | CDS | open | 55225-56049 | _na 274_aa | Putative ribosomal RNA large subunit methyltransferase J | |
| 351 | AZGM01000016.1 | GCA001435935_00780 | CDS | open | 56061-56936 | _na 291_aa | Polyprenyl synthetase | |
| 352 | AZGM01000016.1 | GCA001435935_00781 | CDS | open | 56954-57232 | _na 92_aa | exodeoxyribonuclease VII small subunit | |
| 353 | AZGM01000016.1 | GCA001435935_00782 | CDS | open | 57219-58571 | _na 450_aa | xseA | exodeoxyribonuclease VII large subunit |
| 354 | AZGM01000016.1 | GCA001435935_00783 | CDS | open | 58564-59421 | _na 285_aa | folD | Bifunctional protein FolD |
| 355 | AZGM01000016.1 | GCA001435935_00784 | CDS | open | 59509-59775 | _na 88_aa | nusB | transcription antitermination factor NusB |
| 356 | AZGM01000016.1 | GCA001435935_00785 | CDS | open | 59821-59919 | _na 32_aa | hypothetical protein | |
| 357 | AZGM01000016.1 | GCA001435935_00786 | CDS | open | 59916-60359 | _na 147_aa | Alkaline shock protein | |
| 358 | AZGM01000016.1 | GCA001435935_00787 | CDS | open | 60519-61202 | _na 227_aa | 2'-5' RNA ligase family protein | |
| 359 | AZGM01000016.1 | GCA001435935_00788 | CDS | open | 61202-62281 | _na 359_aa | Xaa-Pro dipeptidase | |
| 360 | AZGM01000016.1 | GCA001435935_00789 | CDS | open | 62356-62637 | _na 93_aa | rpmA | 50S ribosomal protein L27 |
| 361 | AZGM01000016.1 | GCA001435935_00790 | CDS | open | 62663-62986 | _na 107_aa | Ribosomal processing cysteine protease Prp | |
| 362 | AZGM01000016.1 | GCA001435935_00791 | CDS | open | 63002-63310 | _na 102_aa | rplU | 50S ribosomal protein L21 |
| 363 | AZGM01000016.1 | GCA001435935_00792 | CDS | open | 63532-64176 | _na 214_aa | HTH tetR-type domain-containing protein | |
| 364 | AZGM01000016.1 | GCA001435935_00724 | gene | open | 69-332 | |||
| 365 | AZGM01000016.1 | GCA001435935_00725 | gene | open | 381-809 | |||
| 366 | AZGM01000016.1 | GCA001435935_00726 | gene | open | 867-1589 | |||
| 367 | AZGM01000016.1 | GCA001435935_00727 | gene | open | 1806-2369 | |||
| 368 | AZGM01000016.1 | GCA001435935_00728 | gene | open | 2366-2611 | |||
| 369 | AZGM01000016.1 | GCA001435935_00729 | gene | open | 2679-3656 | |||
| 370 | AZGM01000016.1 | GCA001435935_00730 | gene | open | 3768-4082 | |||
| 371 | AZGM01000016.1 | GCA001435935_00731 | gene | open | 4119-4451 | |||
| 372 | AZGM01000016.1 | GCA001435935_00732 | gene | open | 4542-5009 | |||
| 373 | AZGM01000016.1 | GCA001435935_00733 | gene | open | 5091-5603 | |||
| 374 | AZGM01000016.1 | GCA001435935_00734 | gene | open | 5624-7108 | glpK | ||
| 375 | AZGM01000016.1 | GCA001435935_00735 | gene | open | 7192-7380 | |||
| 376 | AZGM01000016.1 | GCA001435935_00736 | gene | open | 7454-9283 | |||
| 377 | AZGM01000016.1 | GCA001435935_00737 | gene | open | 9439-10845 | |||
| 378 | AZGM01000016.1 | GCA001435935_00738 | gene | open | 10978-12438 | |||
| 379 | AZGM01000016.1 | GCA001435935_00739 | gene | open | 12439-13992 | |||
| 380 | AZGM01000016.1 | GCA001435935_00740 | gene | open | 14211-15866 | |||
| 381 | AZGM01000016.1 | GCA001435935_00741 | gene | open | 15888-16451 | ahpC | ||
| 382 | AZGM01000016.1 | GCA001435935_00742 | gene | open | 16657-16926 | rpsN | ||
| 383 | AZGM01000016.1 | GCA001435935_00743 | gene | open | 17052-17906 | |||
| 384 | AZGM01000016.1 | GCA001435935_00744 | gene | open | 18034-19398 | |||
| 385 | AZGM01000016.1 | GCA001435935_00745 | gene | open | 19444-20661 | |||
| 386 | AZGM01000016.1 | GCA001435935_00746 | gene | open | 20699-21370 | |||
| 387 | AZGM01000016.1 | GCA001435935_00747 | gene | open | 21756-22358 | |||
| 388 | AZGM01000016.1 | GCA001435935_00748 | gene | open | 22608-22973 | rplS | ||
| 389 | AZGM01000016.1 | GCA001435935_00749 | gene | open | 23088-24533 | |||
| 390 | AZGM01000016.1 | GCA001435935_00750 | gene | open | 24533-25291 | trmD | ||
| 391 | AZGM01000016.1 | GCA001435935_00751 | gene | open | 25291-25797 | rimM | ||
| 392 | AZGM01000016.1 | GCA001435935_00752 | gene | open | 25880-26140 | khpA | ||
| 393 | AZGM01000016.1 | GCA001435935_00753 | gene | open | 26153-26428 | rpsP | ||
| 394 | AZGM01000016.1 | GCA001435935_00754 | gene | open | 26515-27963 | ffh | ||
| 395 | AZGM01000016.1 | GCA001435935_00755 | gene | open | 27967-28308 | ylxM | ||
| 396 | AZGM01000016.1 | GCA001435935_00756 | gene | open | 28321-29856 | ftsY | ||
| 397 | AZGM01000016.1 | GCA001435935_00757 | gene | open | 29859-33431 | smc | ||
| 398 | AZGM01000016.1 | GCA001435935_00758 | gene | open | 33450-34148 | rnc | ||
| 399 | AZGM01000016.1 | GCA001435935_00759 | gene | open | 34349-34609 | acpP | ||
| 400 | AZGM01000016.1 | GCA001435935_00760 | gene | open | 34646-35677 | plsX | ||
| 401 | AZGM01000016.1 | GCA001435935_00761 | gene | open | 35694-37730 | recG | ||
| 402 | AZGM01000016.1 | GCA001435935_00762 | gene | open | 37812-39521 | yloV | ||
| 403 | AZGM01000016.1 | GCA001435935_00763 | gene | open | 39546-39911 | |||
| 404 | AZGM01000016.1 | GCA001435935_00764 | gene | open | 40082-40267 | rpmB | ||
| 405 | AZGM01000016.1 | GCA001435935_00765 | gene | open | 40397-41053 | |||
| 406 | AZGM01000016.1 | GCA001435935_00766 | gene | open | 41309-41962 | rpe | ||
| 407 | AZGM01000016.1 | GCA001435935_00767 | gene | open | 41973-42845 | rsgA | ||
| 408 | AZGM01000016.1 | GCA001435935_00768 | gene | open | 42860-44785 | pknB | ||
| 409 | AZGM01000016.1 | GCA001435935_00769 | gene | open | 44788-45534 | |||
| 410 | AZGM01000016.1 | GCA001435935_00770 | gene | open | 45553-46899 | rsmB | ||
| 411 | AZGM01000016.1 | GCA001435935_00771 | gene | open | 46892-47845 | fmt | ||
| 412 | AZGM01000016.1 | GCA001435935_00772 | gene | open | 47863-50292 | priA | ||
| 413 | AZGM01000016.1 | GCA001435935_00773 | gene | open | 50293-51501 | coaBC | ||
| 414 | AZGM01000016.1 | GCA001435935_00774 | gene | open | 51625-51843 | rpoZ | ||
| 415 | AZGM01000016.1 | GCA001435935_00775 | gene | open | 51840-52460 | gmk | ||
| 416 | AZGM01000016.1 | GCA001435935_00776 | gene | open | 52627-52968 | |||
| 417 | AZGM01000016.1 | GCA001435935_00777 | gene | open | 53063-54751 | recN | ||
| 418 | AZGM01000016.1 | GCA001435935_00778 | gene | open | 54755-55213 | |||
| 419 | AZGM01000016.1 | GCA001435935_00779 | gene | open | 55225-56049 | |||
| 420 | AZGM01000016.1 | GCA001435935_00780 | gene | open | 56061-56936 | |||
| 421 | AZGM01000016.1 | GCA001435935_00781 | gene | open | 56954-57232 | |||
| 422 | AZGM01000016.1 | GCA001435935_00782 | gene | open | 57219-58571 | xseA | ||
| 423 | AZGM01000016.1 | GCA001435935_00783 | gene | open | 58564-59421 | folD | ||
| 424 | AZGM01000016.1 | GCA001435935_00784 | gene | open | 59509-59775 | nusB | ||
| 425 | AZGM01000016.1 | GCA001435935_00785 | gene | open | 59821-59919 | |||
| 426 | AZGM01000016.1 | GCA001435935_00786 | gene | open | 59916-60359 | |||
| 427 | AZGM01000016.1 | GCA001435935_00787 | gene | open | 60519-61202 | |||
| 428 | AZGM01000016.1 | GCA001435935_00788 | gene | open | 61202-62281 | |||
| 429 | AZGM01000016.1 | GCA001435935_00789 | gene | open | 62356-62637 | rpmA | ||
| 430 | AZGM01000016.1 | GCA001435935_00790 | gene | open | 62663-62986 | |||
| 431 | AZGM01000016.1 | GCA001435935_00791 | gene | open | 63002-63310 | rplU | ||
| 432 | AZGM01000016.1 | GCA001435935_00792 | gene | open | 63532-64176 | |||
| 433 | AZGM01000019.1 | GCA001435935_01071 | gene | open | 7681-7743 | Bacillus-plasmid | ||
| 434 | AZGM01000019.1 | GCA001435935_01071 | ncRNA | open | 7681-7743 | Bacillus-plasmid RNA | ||
| 435 | AZGM01000019.1 | GCA001435935_01061 | CDS | open | 41-553 | _na 170_aa | Mrr N-terminal domain-containing protein | |
| 436 | AZGM01000019.1 | GCA001435935_01062 | CDS | open | 1255-1593 | _na 112_aa | hypothetical protein | |
| 437 | AZGM01000019.1 | GCA001435935_01063 | CDS | open | 1820-2122 | _na 100_aa | Metalloregulator ArsR/SmtB family transcription factor | |
| 438 | AZGM01000019.1 | GCA001435935_01064 | CDS | open | 2185-3219 | _na 344_aa | arsB | ACR3 family arsenite efflux transporter |
| 439 | AZGM01000019.1 | GCA001435935_01065 | CDS | open | 3829-3927 | _na 32_aa | hypothetical protein | |
| 440 | AZGM01000019.1 | GCA001435935_01066 | CDS | open | 4084-4671 | _na 195_aa | Recombinase | |
| 441 | AZGM01000019.1 | GCA001435935_01067 | CDS | open | 5033-5191 | _na 52_aa | hypothetical protein | |
| 442 | AZGM01000019.1 | GCA001435935_01068 | CDS | open | 5203-5586 | _na 127_aa | hypothetical protein | |
| 443 | AZGM01000019.1 | GCA001435935_01069 | CDS | open | 5707-6459 | _na 250_aa | lysM | LysM domain-containing protein |
| 444 | AZGM01000019.1 | GCA001435935_01070 | CDS | open | 6456-7532 | _na 358_aa | Replication initiation factor | |
| 445 | AZGM01000019.1 | GCA001435935_01072 | CDS | open | 7746-8072 | _na 108_aa | Single-stranded DNA-binding protein | |
| 446 | AZGM01000019.1 | GCA001435935_01073 | CDS | open | 8086-8922 | _na 278_aa | Site-specific recombinase%2C phage integrase family | |
| 447 | AZGM01000019.1 | GCA001435935_01074 | CDS | open | 9107-9349 | _na 80_aa | hypothetical protein | |
| 448 | AZGM01000019.1 | GCA001435935_01075 | CDS | open | 9410-9637 | _na 75_aa | DUF2922 domain-containing protein | |
| 449 | AZGM01000019.1 | GCA001435935_01076 | CDS | open | 9654-9941 | _na 95_aa | DUF2922 domain-containing protein | |
| 450 | AZGM01000019.1 | GCA001435935_01077 | CDS | open | 10064-10624 | _na 186_aa | Regulator of chromosome segregation-like C-terminal domain-containing protein | |
| 451 | AZGM01000019.1 | GCA001435935_01078 | CDS | open | 10804-11745 | _na 313_aa | Replication protein A1 | |
| 452 | AZGM01000019.1 | GCA001435935_01061 | gene | open | 41-553 | |||
| 453 | AZGM01000019.1 | GCA001435935_01062 | gene | open | 1255-1593 | |||
| 454 | AZGM01000019.1 | GCA001435935_01063 | gene | open | 1820-2122 | |||
| 455 | AZGM01000019.1 | GCA001435935_01064 | gene | open | 2185-3219 | arsB | ||
| 456 | AZGM01000019.1 | GCA001435935_01065 | gene | open | 3829-3927 | |||
| 457 | AZGM01000019.1 | GCA001435935_01066 | gene | open | 4084-4671 | |||
| 458 | AZGM01000019.1 | GCA001435935_01067 | gene | open | 5033-5191 | |||
| 459 | AZGM01000019.1 | GCA001435935_01068 | gene | open | 5203-5586 | |||
| 460 | AZGM01000019.1 | GCA001435935_01069 | gene | open | 5707-6459 | lysM | ||
| 461 | AZGM01000019.1 | GCA001435935_01070 | gene | open | 6456-7532 | |||
| 462 | AZGM01000019.1 | GCA001435935_01072 | gene | open | 7746-8072 | |||
| 463 | AZGM01000019.1 | GCA001435935_01073 | gene | open | 8086-8922 | |||
| 464 | AZGM01000019.1 | GCA001435935_01074 | gene | open | 9107-9349 | |||
| 465 | AZGM01000019.1 | GCA001435935_01075 | gene | open | 9410-9637 | |||
| 466 | AZGM01000019.1 | GCA001435935_01076 | gene | open | 9654-9941 | |||
| 467 | AZGM01000019.1 | GCA001435935_01077 | gene | open | 10064-10624 | |||
| 468 | AZGM01000019.1 | GCA001435935_01078 | gene | open | 10804-11745 | |||
| 469 | AZGM01000020.1 | regulatory_region | open | 25810-26049 | T-box leader | |||
| 470 | AZGM01000020.1 | GCA001435935_01177 | CDS | open | 216-821 | _na 201_aa | luxR | LuxR family DNA-binding response regulator |
| 471 | AZGM01000020.1 | GCA001435935_01178 | CDS | open | 840-1835 | _na 331_aa | nreB | Oxygen sensor histidine kinase NreB |
| 472 | AZGM01000020.1 | GCA001435935_01179 | CDS | open | 1859-2293 | _na 144_aa | NLP1-9 GAF domain-containing protein | |
| 473 | AZGM01000020.1 | GCA001435935_01180 | CDS | open | 2309-2593 | _na 94_aa | Phage protein | |
| 474 | AZGM01000020.1 | GCA001435935_01181 | CDS | open | 2596-3156 | _na 186_aa | mobA | Molybdopterin-guanine dinucleotide biosynthesis protein MobA |
| 475 | AZGM01000020.1 | GCA001435935_01182 | CDS | open | 3153-3641 | _na 162_aa | mobB | molybdopterin-guanine dinucleotide biosynthesis protein B |
| 476 | AZGM01000020.1 | GCA001435935_01183 | CDS | open | 3620-4840 | _na 406_aa | Molybdopterin molybdenumtransferase | |
| 477 | AZGM01000020.1 | GCA001435935_01184 | CDS | open | 4830-5327 | _na 165_aa | Molybdenum cofactor biosynthesis protein B | |
| 478 | AZGM01000020.1 | GCA001435935_01185 | CDS | open | 5299-6351 | _na 350_aa | thiF | ThiF family protein |
| 479 | AZGM01000020.1 | GCA001435935_01186 | CDS | open | 6499-10161 | _na 1220_aa | nitrate reductase subunit alpha | |
| 480 | AZGM01000020.1 | GCA001435935_01187 | CDS | open | 10151-11710 | _na 519_aa | narH | nitrate reductase subunit beta |
| 481 | AZGM01000020.1 | GCA001435935_01188 | CDS | open | 11688-12284 | _na 198_aa | narJ | nitrate reductase molybdenum cofactor assembly chaperone |
| 482 | AZGM01000020.1 | GCA001435935_01189 | CDS | open | 12274-12963 | _na 229_aa | narI | respiratory nitrate reductase subunit gamma |
| 483 | AZGM01000020.1 | GCA001435935_01190 | CDS | open | 13060-13953 | _na 297_aa | eamA | EamA domain-containing protein |
| 484 | AZGM01000020.1 | GCA001435935_01191 | CDS | open | 14138-16642 | _na 834_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 485 | AZGM01000020.1 | GCA001435935_01192 | CDS | open | 16929-18314 | _na 461_aa | Aromatic amino acid transporter | |
| 486 | AZGM01000020.1 | GCA001435935_01193 | CDS | open | 18445-19287 | _na 280_aa | DNA RNA non-specific endonuclease | |
| 487 | AZGM01000020.1 | GCA001435935_01194 | CDS | open | 19554-20930 | _na 458_aa | C69 family dipeptidase | |
| 488 | AZGM01000020.1 | GCA001435935_01195 | CDS | open | 21344-24787 | _na 1147_aa | pyruvate carboxylase | |
| 489 | AZGM01000020.1 | GCA001435935_01196 | CDS | open | 24811-25572 | _na 253_aa | BPL/LPL catalytic domain-containing protein | |
| 490 | AZGM01000020.1 | GCA001435935_01197 | CDS | open | 26260-27069 | _na 269_aa | 2-oxo-hept-3-ene-1%2C7-dioate hydratase | |
| 491 | AZGM01000020.1 | GCA001435935_01198 | CDS | open | 27116-28060 | _na 314_aa | L-2-hydroxyisocaproate dehydrogenase | |
| 492 | AZGM01000020.1 | GCA001435935_01199 | CDS | open | 28257-30545 | _na 762_aa | ATP-binding protein | |
| 493 | AZGM01000020.1 | GCA001435935_01200 | CDS | open | 30598-31464 | _na 288_aa | Lipoprotein | |
| 494 | AZGM01000020.1 | GCA001435935_01201 | CDS | open | 31469-31630 | _na 53_aa | copG | Ribbon-helix-helix protein CopG domain-containing protein |
| 495 | AZGM01000020.1 | GCA001435935_01202 | CDS | open | 31660-32136 | _na 158_aa | Nucleoside deoxyribosyltransferase | |
| 496 | AZGM01000020.1 | GCA001435935_01203 | CDS | open | 32332-33141 | _na 269_aa | Cysteine-rich domain-containing protein | |
| 497 | AZGM01000020.1 | GCA001435935_01204 | CDS | open | 33145-34659 | _na 504_aa | LutB/LldF family L-lactate oxidation iron-sulfur protein | |
| 498 | AZGM01000020.1 | GCA001435935_01205 | CDS | open | 34652-35386 | _na 244_aa | LUD domain-containing protein | |
| 499 | AZGM01000020.1 | GCA001435935_01206 | CDS | open | 35454-36164 | _na 236_aa | ubiE | bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1%2C4-benzoquinol methylase UbiE |
| 500 | AZGM01000020.1 | GCA001435935_01207 | CDS | open | 36155-36952 | _na 265_aa | HAD superfamily hydrolase |

