HOMD Banner
Taxonomy: V4.3   |  16S rRNA RefSeq: V16.03   |  Genomic RefSeq: V11.03   |  Viruses: V1.2

BAKTAGenome Explorer: Peptidiphaga gingivicola (GCA_001652275.1)

Select a Genome:
BAKTA Annotations for GCA_001652275.1
Genome Selected: Peptidiphaga gingivicola
ContigsBases CDSrRNA tmRNAtRNA
3 2524828 2059 9 1 47
[Table]   [AA Fasta]      [Browser]   [Text]   [Excel]  
Search & Sort all 4244 Records
Search These Records: Clear
Sort Column:   Molecule   PID   NA   AA   Gene  Gene Product  Reverse
Annotation Table [page:1]    |    Number of Records Found: 4244 [9 Pages]    |    Previous Page <==> Next Page    |    Jump to Page: [ 1  2  3  4  5  6  7  8  9  ]
Notes:   1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
Region Protein-ID Type Genome
Viewer		 Range
(bp)		 Show Sequences
(length) NA / AA		 BAKTA
Gene		 BAKTA
GeneProduct
1 LVZK01000001.1 GCA001652275_01273 gene open 1519373-1519741 ssrA
2 LVZK01000001.1 GCA001652275_01273 tmRNA open 1519373-1519741 ssrA transfer-messenger RNA%2C SsrA
3 LVZK01000001.1 GCA001652275_00730 gene open 882441-882537 Bacteria_small_SRP
4 LVZK01000001.1 GCA001652275_01597 gene open 1893614-1893734 rrf
5 LVZK01000001.1 GCA001652275_01598 gene open 1893847-1896944 rrl
6 LVZK01000001.1 GCA001652275_01599 gene open 1897110-1898647 rrs
7 LVZK01000001.1 GCA001652275_00730 ncRNA open 882441-882537 Bacterial small signal recognition particle RNA
8 LVZK01000001.1 regulatory_region open 700910-701011 TPP riboswitch aptamer (THI element)
9 LVZK01000001.1 regulatory_region open 894392-894449 msiK RNA
10 LVZK01000001.1 regulatory_region open 1408832-1408910 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
11 LVZK01000001.1 regulatory_region open 1731484-1731602 FMN riboswitch aptamer (RFN element)
12 LVZK01000001.1 GCA001652275_01597 rRNA open 1893614-1893734 rrf 5S ribosomal RNA
13 LVZK01000001.1 GCA001652275_01598 rRNA open 1893847-1896944 rrl 23S ribosomal RNA
14 LVZK01000001.1 GCA001652275_01599 rRNA open 1897110-1898647 rrs 16S ribosomal RNA
15 LVZK01000001.1 repeat_region open 799472-800617 CRISPR array with 16 repeats of length 37%2C consensus sequence GTCTCAATGCACCTTCTGGTGCTCAGTGCTTTCCGAC and spacer length 36
16 LVZK01000001.1 repeat_region open 823327-824907 CRISPR array with 22 repeats of length 37%2C consensus sequence GTCGGAAAGCACCAAGCACCAGAAGGTGCATTGAGAC and spacer length 36
17 LVZK01000001.1 repeat_region open 826834-827102 CRISPR array with 4 repeats of length 38%2C consensus sequence GTCGGAAAGCACTGAGCACCAGAAGGTGCATTGAGACA and spacer length 35
18 LVZK01000001.1 GCA001652275_00001 CDS open 22-795 _na     257_aa hypothetical protein
19 LVZK01000001.1 GCA001652275_00002 CDS open 792-2558 _na     588_aa Calcium-binding protein
20 LVZK01000001.1 GCA001652275_00003 CDS open 2555-2857 _na     100_aa hypothetical protein
21 LVZK01000001.1 GCA001652275_00004 CDS open 3375-4325 _na     316_aa Geranylgeranyl pyrophosphate synthase
22 LVZK01000001.1 GCA001652275_00005 CDS open 4373-5953 _na     526_aa nuoN NADH-quinone oxidoreductase subunit NuoN
23 LVZK01000001.1 GCA001652275_00006 CDS open 5950-7449 _na     499_aa NADH-quinone oxidoreductase subunit M
24 LVZK01000001.1 GCA001652275_00007 CDS open 7465-9378 _na     637_aa nuoL NADH-quinone oxidoreductase subunit L
25 LVZK01000001.1 GCA001652275_00008 CDS open 9401-9700 _na     99_aa nuoK NADH-quinone oxidoreductase subunit NuoK
26 LVZK01000001.1 GCA001652275_00009 CDS open 9697-10662 _na     321_aa NADH-quinone oxidoreductase subunit J
27 LVZK01000001.1 GCA001652275_00010 CDS open 10662-11417 _na     251_aa nuoI NADH-quinone oxidoreductase subunit NuoI
28 LVZK01000001.1 GCA001652275_00011 CDS open 11414-12916 _na     500_aa nuoH NADH-quinone oxidoreductase subunit NuoH
29 LVZK01000001.1 GCA001652275_00012 CDS open 12913-15489 _na     858_aa NADH-quinone oxidoreductase subunit G
30 LVZK01000001.1 GCA001652275_00013 CDS open 15486-16814 _na     442_aa nuoF NADH-quinone oxidoreductase subunit NuoF
31 LVZK01000001.1 GCA001652275_00014 CDS open 16811-17482 _na     223_aa nuoE NADH-quinone oxidoreductase subunit NuoE
32 LVZK01000001.1 GCA001652275_00015 CDS open 17479-18828 _na     449_aa NADH-quinone oxidoreductase subunit D
33 LVZK01000001.1 GCA001652275_00016 CDS open 18828-19532 _na     234_aa NADH-quinone oxidoreductase subunit C
34 LVZK01000001.1 GCA001652275_00017 CDS open 19567-20166 _na     199_aa NADH-quinone oxidoreductase subunit B
35 LVZK01000001.1 GCA001652275_00018 CDS open 20178-20537 _na     119_aa NADH-quinone oxidoreductase subunit A
36 LVZK01000001.1 GCA001652275_00019 CDS open 20602-21867 _na     421_aa Drug:proton antiporter
37 LVZK01000001.1 GCA001652275_00020 CDS open 22044-22745 _na     233_aa demethylmenaquinone methyltransferase
38 LVZK01000001.1 GCA001652275_00021 CDS open 23056-24078 _na     340_aa 1%2C4-dihydroxy-2-naphthoyl-CoA synthase
39 LVZK01000001.1 GCA001652275_00022 CDS open 24090-25385 _na     431_aa AMP-dependent synthetase/ligase domain-containing protein
40 LVZK01000001.1 GCA001652275_00023 CDS open 25545-26351 _na     268_aa 1%2C4-dihydroxy-2-naphthoate polyprenyltransferase
41 LVZK01000001.1 GCA001652275_00024 CDS open 26369-26917 _na     182_aa Cardiolipin synthase N-terminal domain-containing protein
42 LVZK01000001.1 GCA001652275_00025 CDS open 27261-28151 _na     296_aa DNA glycosylase AlkZ-like family protein
43 LVZK01000001.1 GCA001652275_00026 CDS open 28361-29890 _na     509_aa Serine hydrolase
44 LVZK01000001.1 GCA001652275_00027 CDS open 30458-31894 _na     478_aa Serine hydrolase
45 LVZK01000001.1 GCA001652275_00028 CDS open 32087-32761 _na     224_aa Fructose-2%2C6-bisphosphatase
46 LVZK01000001.1 GCA001652275_00029 CDS open 32841-33488 _na     215_aa marR MarR family winged helix-turn-helix transcriptional regulator
47 LVZK01000001.1 GCA001652275_00030 CDS open 33722-33934 _na     70_aa Excisionase
48 LVZK01000001.1 GCA001652275_00031 CDS open 34228-35628 _na     466_aa Potassium transporter Trk
49 LVZK01000001.1 GCA001652275_00032 CDS open 35642-36304 _na     220_aa Potassium transporter
50 LVZK01000001.1 GCA001652275_00033 CDS open 36322-37698 _na     458_aa radA DNA repair protein RadA
51 LVZK01000001.1 GCA001652275_00034 CDS open 37786-39372 _na     528_aa hypothetical protein
52 LVZK01000001.1 GCA001652275_00035 CDS open 39421-40299 _na     292_aa Adenine DNA glycosylase
53 LVZK01000001.1 GCA001652275_00036 CDS open 40535-41461 _na     308_aa Transcriptional regulator
54 LVZK01000001.1 GCA001652275_00037 CDS open 41785-43533 _na     582_aa Glycerol-3-phosphate dehydrogenase
55 LVZK01000001.1 GCA001652275_00038 CDS open 43603-45129 _na     508_aa glpK glycerol kinase GlpK
56 LVZK01000001.1 GCA001652275_00039 CDS open 45524-45955 _na     143_aa Superoxide dismutase
57 LVZK01000001.1 GCA001652275_00040 CDS open 45970-46842 _na     290_aa ABC transporter
58 LVZK01000001.1 GCA001652275_00041 CDS open 46856-47617 _na     253_aa ABC transporter permease
59 LVZK01000001.1 GCA001652275_00042 CDS open 47614-48240 _na     208_aa ABC transporter permease
60 LVZK01000001.1 GCA001652275_00043 CDS open 48313-49095 _na     260_aa ABC transporter permease
61 LVZK01000001.1 GCA001652275_00044 CDS open 49105-49659 _na     184_aa RNA polymerase subunit sigma-24
62 LVZK01000001.1 GCA001652275_00045 CDS open 49915-50526 _na     203_aa Flavoprotein domain-containing protein
63 LVZK01000001.1 GCA001652275_00046 CDS open 50610-52046 _na     478_aa Lanthionine synthetase
64 LVZK01000001.1 GCA001652275_00047 CDS open 52033-55482 _na     1149_aa Lantibiotic dehydratase
65 LVZK01000001.1 GCA001652275_00048 CDS open 55970-56230 _na     86_aa hypothetical protein
66 LVZK01000001.1 GCA001652275_00049 CDS open 56748-58406 _na     552_aa L-lactate permease
67 LVZK01000001.1 GCA001652275_00050 CDS open 58481-59269 _na     262_aa Fe-S oxidoreductase
68 LVZK01000001.1 GCA001652275_00051 CDS open 59266-60819 _na     517_aa LutB/LldF family L-lactate oxidation iron-sulfur protein
69 LVZK01000001.1 GCA001652275_00052 CDS open 60816-61469 _na     217_aa Lactate utilization protein B/C
70 LVZK01000001.1 GCA001652275_00053 CDS open 61444-62286 _na     280_aa Gluconolactonase
71 LVZK01000001.1 GCA001652275_00054 CDS open 62628-64262 _na     544_aa Putative amidase domain-containing protein
72 LVZK01000001.1 GCA001652275_00055 CDS open 64821-65138 _na     105_aa PE domain-containing protein
73 LVZK01000001.1 GCA001652275_00056 CDS open 65141-65830 _na     229_aa Lipoprotein
74 LVZK01000001.1 GCA001652275_00057 CDS open 65833-67653 _na     606_aa DUF1023 domain-containing protein
75 LVZK01000001.1 GCA001652275_00058 CDS open 68227-70578 _na     783_aa ABC3 transporter permease C-terminal domain-containing protein
76 LVZK01000001.1 GCA001652275_00059 CDS open 70581-71411 _na     276_aa ABC transporter ATP-binding protein
77 LVZK01000001.1 GCA001652275_00060 CDS open 71591-72847 _na     418_aa histidine kinase
78 LVZK01000001.1 GCA001652275_00061 CDS open 72963-73751 _na     262_aa DNA-binding response regulator
79 LVZK01000001.1 GCA001652275_00062 CDS open 73872-74678 _na     268_aa HTH tetR-type domain-containing protein
80 LVZK01000001.1 GCA001652275_00063 CDS open 74789-76951 _na     720_aa MFS transporter
81 LVZK01000001.1 GCA001652275_00064 CDS open 76991-77620 _na     209_aa rskA Anti-sigma K factor RskA C-terminal domain-containing protein
82 LVZK01000001.1 GCA001652275_00065 CDS open 77617-78225 _na     202_aa RNA polymerase subunit sigma-70
83 LVZK01000001.1 GCA001652275_00066 CDS open 78289-79971 _na     560_aa Thiol:disulfide interchange protein
84 LVZK01000001.1 GCA001652275_00067 CDS open 80136-80531 _na     131_aa Pentapeptide MXKDX repeat protein
85 LVZK01000001.1 GCA001652275_00068 CDS open 80720-82261 _na     513_aa lysS lysine--tRNA ligase
86 LVZK01000001.1 GCA001652275_00069 CDS open 82549-83295 _na     248_aa espG ESX secretion-associated protein EspG
87 LVZK01000001.1 GCA001652275_00070 CDS open 83295-83720 _na     141_aa hypothetical protein
88 LVZK01000001.1 GCA001652275_00071 CDS open 84010-84303 _na     97_aa hypothetical protein
89 LVZK01000001.1 GCA001652275_00072 CDS open 84743-84928 _na     61_aa hypothetical protein
90 LVZK01000001.1 GCA001652275_00073 CDS open 85249-85500 _na     83_aa hypothetical protein
91 LVZK01000001.1 GCA001652275_00074 CDS open 85693-86142 _na     149_aa hypothetical protein
92 LVZK01000001.1 GCA001652275_00075 CDS open 86139-86852 _na     237_aa espG ESX secretion-associated protein EspG
93 LVZK01000001.1 GCA001652275_00076 CDS open 86934-87374 _na     146_aa panD aspartate 1-decarboxylase
94 LVZK01000001.1 GCA001652275_00077 CDS open 87367-88212 _na     281_aa panC pantoate--beta-alanine ligase
95 LVZK01000001.1 GCA001652275_00078 CDS open 88553-89752 _na     399_aa Putative amidase domain-containing protein
96 LVZK01000001.1 GCA001652275_00079 CDS open 90093-91082 _na     329_aa DUF2520 domain-containing protein
97 LVZK01000001.1 GCA001652275_00080 CDS open 91277-92869 _na     530_aa YdbS-like PH domain-containing protein
98 LVZK01000001.1 GCA001652275_00081 CDS open 92866-93381 _na     171_aa YdbS-like PH domain-containing protein
99 LVZK01000001.1 GCA001652275_00082 CDS open 93453-93542 _na     29_aa hypothetical protein
100 LVZK01000001.1 GCA001652275_00083 CDS open 93674-94180 _na     168_aa DUF3180 domain-containing protein
101 LVZK01000001.1 GCA001652275_00084 CDS open 94238-95065 _na     275_aa folK 2-amino-4-hydroxy-6-hydroxymethyldihydropteridine diphosphokinase
102 LVZK01000001.1 GCA001652275_00085 CDS open 95062-95895 _na     277_aa folP dihydropteroate synthase
103 LVZK01000001.1 GCA001652275_00086 CDS open 95907-96575 _na     222_aa folE GTP cyclohydrolase I FolE
104 LVZK01000001.1 GCA001652275_00087 CDS open 96568-99624 _na     1018_aa hypothetical protein
105 LVZK01000001.1 GCA001652275_00088 CDS open 99626-100180 _na     184_aa hpt hypoxanthine phosphoribosyltransferase
106 LVZK01000001.1 GCA001652275_00089 CDS open 100167-101222 _na     351_aa tilS tRNA lysidine(34) synthetase TilS
107 LVZK01000001.1 GCA001652275_00090 CDS open 101222-102202 _na     326_aa Coenzyme F420 biosynthesis-associated protein
108 LVZK01000001.1 GCA001652275_00091 CDS open 102214-103557 _na     447_aa dacB D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase
109 LVZK01000001.1 GCA001652275_00092 CDS open 103630-104133 _na     167_aa ppa Inorganic pyrophosphatase
110 LVZK01000001.1 GCA001652275_00093 CDS open 104209-105402 _na     397_aa MFS transporter
111 LVZK01000001.1 GCA001652275_00094 CDS open 105419-106075 _na     218_aa Transcriptional regulator
112 LVZK01000001.1 GCA001652275_00095 CDS open 106145-106753 _na     202_aa hypothetical protein
113 LVZK01000001.1 GCA001652275_00096 CDS open 106717-108504 _na     595_aa NlpC/P60 domain-containing protein
114 LVZK01000001.1 GCA001652275_00097 CDS open 109100-110386 _na     428_aa O-acetylhomoserine aminocarboxypropyltransferase
115 LVZK01000001.1 GCA001652275_00098 CDS open 110395-111816 _na     473_aa homoserine O-acetyltransferase
116 LVZK01000001.1 GCA001652275_00099 CDS open 112153-113529 _na     458_aa Alpha/beta hydrolase
117 LVZK01000001.1 GCA001652275_00100 CDS open 114136-115302 _na     388_aa Chromosome condensation regulator RCC1
118 LVZK01000001.1 GCA001652275_00101 CDS open 115593-116711 _na     372_aa hypothetical protein
119 LVZK01000001.1 GCA001652275_00102 CDS open 116713-119214 _na     833_aa LXG domain-containing protein
120 LVZK01000001.1 GCA001652275_00103 CDS open 119211-119552 _na     113_aa hypothetical protein
121 LVZK01000001.1 GCA001652275_00104 CDS open 119812-120429 _na     205_aa DUF4853 domain-containing protein
122 LVZK01000001.1 GCA001652275_00105 CDS open 120426-122135 _na     569_aa DUF1023 domain-containing protein
123 LVZK01000001.1 GCA001652275_00106 CDS open 122135-122488 _na     117_aa Chemotaxis protein
124 LVZK01000001.1 GCA001652275_00107 CDS open 122683-123336 _na     217_aa hypothetical protein
125 LVZK01000001.1 GCA001652275_00108 CDS open 123595-125028 _na     477_aa RAMA domain-containing protein
126 LVZK01000001.1 GCA001652275_00109 CDS open 125075-128131 _na     1018_aa Oxidoreductase
127 LVZK01000001.1 GCA001652275_00110 CDS open 128263-128682 _na     139_aa Paired domain-containing protein
128 LVZK01000001.1 GCA001652275_00111 CDS open 128679-130796 _na     705_aa feoB ferrous iron transport protein B
129 LVZK01000001.1 GCA001652275_00112 CDS open 130793-131017 _na     74_aa feoA FeoA family protein
130 LVZK01000001.1 GCA001652275_00113 CDS open 131407-134127 _na     906_aa ppdK pyruvate%2C phosphate dikinase
131 LVZK01000001.1 GCA001652275_00114 CDS open 134424-134822 _na     132_aa MAPEG family protein
132 LVZK01000001.1 GCA001652275_00115 CDS open 134819-135775 _na     318_aa DNA-binding protein
133 LVZK01000001.1 GCA001652275_00116 CDS open 136465-136908 _na     147_aa DUF2992 domain-containing protein
134 LVZK01000001.1 GCA001652275_00117 CDS open 137069-138553 _na     494_aa Xaa-Pro dipeptidase
135 LVZK01000001.1 GCA001652275_00118 CDS open 139379-140137 _na     252_aa Heavy-metal chelation domain-containing protein
136 LVZK01000001.1 GCA001652275_00119 CDS open 140147-141625 _na     492_aa NB-ARC domain-containing protein
137 LVZK01000001.1 GCA001652275_00120 CDS open 141647-141778 _na     43_aa hypothetical protein
138 LVZK01000001.1 GCA001652275_00121 CDS open 142137-142265 _na     42_aa hypothetical protein
139 LVZK01000001.1 GCA001652275_00122 CDS open 143338-145251 _na     637_aa Tetratricopeptide repeat protein
140 LVZK01000001.1 GCA001652275_00123 CDS open 145338-147104 _na     588_aa formate--tetrahydrofolate ligase
141 LVZK01000001.1 GCA001652275_00124 CDS open 147445-147738 _na     97_aa hypothetical protein
142 LVZK01000001.1 GCA001652275_00125 CDS open 147913-148113 _na     66_aa hypothetical protein
143 LVZK01000001.1 GCA001652275_00126 CDS open 148110-148367 _na     85_aa hypothetical protein
144 LVZK01000001.1 GCA001652275_00127 CDS open 148364-148957 _na     197_aa hypothetical protein
145 LVZK01000001.1 GCA001652275_00128 CDS open 149074-149673 _na     199_aa hypothetical protein
146 LVZK01000001.1 GCA001652275_00129 CDS open 149727-150320 _na     197_aa hypothetical protein
147 LVZK01000001.1 GCA001652275_00130 CDS open 150734-151777 _na     347_aa Glycerol-3-phosphate dehydrogenase
148 LVZK01000001.1 GCA001652275_00131 CDS open 151786-153345 _na     519_aa Carbohydrate kinase%2C FGGY family protein
149 LVZK01000001.1 GCA001652275_00132 CDS open 153368-154909 _na     513_aa Xylulose kinase
150 LVZK01000001.1 GCA001652275_00133 CDS open 155183-156244 _na     353_aa Glycerol-3-phosphate dehydrogenase
151 LVZK01000001.1 GCA001652275_00134 CDS open 156291-156992 _na     233_aa L-ribulose-5-phosphate 4-epimerase
152 LVZK01000001.1 GCA001652275_00135 CDS open 156989-158671 _na     560_aa ribulokinase
153 LVZK01000001.1 GCA001652275_00136 CDS open 158761-160128 _na     455_aa 3-dehydroquinate synthase
154 LVZK01000001.1 GCA001652275_00137 CDS open 160268-161866 _na     532_aa FGGY-family pentulose kinase
155 LVZK01000001.1 GCA001652275_00138 CDS open 161905-162753 _na     282_aa HAD hydrolase%2C family IIA
156 LVZK01000001.1 GCA001652275_00139 CDS open 162922-163956 _na     344_aa Permease
157 LVZK01000001.1 GCA001652275_00140 CDS open 164077-164544 _na     155_aa ribose-5-phosphate isomerase
158 LVZK01000001.1 GCA001652275_00141 CDS open 165372-166199 _na     275_aa Alkaline phosphatase
159 LVZK01000001.1 GCA001652275_00142 CDS open 166611-167300 _na     229_aa Cyclase
160 LVZK01000001.1 GCA001652275_00143 CDS open 167933-170518 _na     861_aa Negative regulator of genetic competence ClpC/MecB
161 LVZK01000001.1 GCA001652275_00144 CDS open 170700-171146 _na     148_aa dtd D-aminoacyl-tRNA deacylase
162 LVZK01000001.1 GCA001652275_00145 CDS open 171378-171806 _na     142_aa hypothetical protein
163 LVZK01000001.1 GCA001652275_00146 CDS open 171803-173419 _na     538_aa Aminomethyltransferase folate-binding domain-containing protein
164 LVZK01000001.1 GCA001652275_00147 CDS open 173419-173991 _na     190_aa THAP4-like heme-binding beta-barrel domain-containing protein
165 LVZK01000001.1 GCA001652275_00148 CDS open 174001-175002 _na     333_aa hypothetical protein
166 LVZK01000001.1 GCA001652275_00149 CDS open 175671-176291 _na     206_aa Pit accessory protein
167 LVZK01000001.1 GCA001652275_00150 CDS open 176295-177308 _na     337_aa Inorganic phosphate transporter
168 LVZK01000001.1 GCA001652275_00151 CDS open 177732-178454 _na     240_aa Lipoprotein
169 LVZK01000001.1 GCA001652275_00152 CDS open 179150-179899 _na     249_aa Lipoprotein
170 LVZK01000001.1 GCA001652275_00153 CDS open 179987-181759 _na     590_aa DUF5667 domain-containing protein
171 LVZK01000001.1 GCA001652275_00154 CDS open 181759-182217 _na     152_aa hypothetical protein
172 LVZK01000001.1 GCA001652275_00155 CDS open 183166-183777 _na     203_aa DUF222 domain-containing protein
173 LVZK01000001.1 GCA001652275_00156 CDS open 184553-185614 _na     353_aa Sulfur transporter
174 LVZK01000001.1 GCA001652275_00157 CDS open 185743-186072 _na     109_aa tusA sulfurtransferase TusA family protein
175 LVZK01000001.1 GCA001652275_00159 CDS open 186447-186788 _na     113_aa S-adenosylmethionine decarboxylase
176 LVZK01000001.1 GCA001652275_00160 CDS open 186788-187645 _na     285_aa DUF4178 domain-containing protein
177 LVZK01000001.1 GCA001652275_00161 CDS open 187735-187998 _na     87_aa Sodium:proline symporter
178 LVZK01000001.1 GCA001652275_00162 CDS open 187998-189524 _na     508_aa polyamine aminopropyltransferase
179 LVZK01000001.1 GCA001652275_00163 CDS open 189750-190709 _na     319_aa rbsK ribokinase
180 LVZK01000001.1 GCA001652275_00164 CDS open 190963-191421 _na     152_aa DNA starvation/stationary phase protection protein
181 LVZK01000001.1 GCA001652275_00165 CDS open 191671-193566 _na     631_aa Alpha-amylase
182 LVZK01000001.1 GCA001652275_00166 CDS open 193568-194116 _na     182_aa uspA Universal stress protein UspA
183 LVZK01000001.1 GCA001652275_00167 CDS open 194113-195498 _na     461_aa Sugar transporter
184 LVZK01000001.1 GCA001652275_00168 CDS open 195510-195980 _na     156_aa Activator of Hsp90 ATPase-like ue 1/2-like C-terminal domain-containing protein
185 LVZK01000001.1 GCA001652275_00169 CDS open 196378-197163 _na     261_aa Endonuclease/exonuclease/phosphatase domain-containing protein
186 LVZK01000001.1 GCA001652275_00170 CDS open 197169-197609 _na     146_aa msrB Peptide methionine sulfoxide reductase MsrB
187 LVZK01000001.1 GCA001652275_00171 CDS open 197829-199721 _na     630_aa mscS Mechanosensitive ion channel MscS domain-containing protein
188 LVZK01000001.1 GCA001652275_00175 CDS open 200849-201943 _na     364_aa Addiction module protein
189 LVZK01000001.1 GCA001652275_00176 CDS open 202057-202464 _na     135_aa VOC domain-containing protein
190 LVZK01000001.1 GCA001652275_00177 CDS open 202630-205194 _na     854_aa phosphoenolpyruvate--protein phosphotransferase
191 LVZK01000001.1 GCA001652275_00178 CDS open 205205-207016 _na     603_aa PTS sugar transporter subunit IIABC
192 LVZK01000001.1 GCA001652275_00179 CDS open 208145-208474 _na     109_aa Transcriptional regulator
193 LVZK01000001.1 GCA001652275_00180 CDS open 208474-209283 _na     269_aa DUF1707 domain-containing protein
194 LVZK01000001.1 GCA001652275_00181 CDS open 209576-210748 _na     390_aa phosphodiester glycosidase family protein
195 LVZK01000001.1 GCA001652275_00182 CDS open 210745-211827 _na     360_aa Dolichyl-phosphate beta-D-mannosyltransferase
196 LVZK01000001.1 GCA001652275_00183 CDS open 211800-212294 _na     164_aa tpx thiol peroxidase
197 LVZK01000001.1 GCA001652275_00184 CDS open 212389-213114 _na     241_aa Phage holin family protein
198 LVZK01000001.1 GCA001652275_00185 CDS open 213111-213425 _na     104_aa DUF3618 domain-containing protein
199 LVZK01000001.1 GCA001652275_00186 CDS open 213554-213757 _na     67_aa DUF3073 domain-containing protein
200 LVZK01000001.1 GCA001652275_00187 CDS open 213897-215051 _na     384_aa Phosphoribosylformylglycinamidine cyclo-ligase
201 LVZK01000001.1 GCA001652275_00188 CDS open 215071-216603 _na     510_aa purF amidophosphoribosyltransferase
202 LVZK01000001.1 GCA001652275_00189 CDS open 216759-218363 _na     534_aa RNB domain-containing ribonuclease
203 LVZK01000001.1 GCA001652275_00190 CDS open 218395-218778 _na     127_aa Bacterial SCP orthologue domain-containing protein
204 LVZK01000001.1 GCA001652275_00191 CDS open 219101-220081 _na     326_aa 1-phosphofructokinase
205 LVZK01000001.1 GCA001652275_00192 CDS open 220416-222698 _na     760_aa PTS lactose transporter subunit IIC
206 LVZK01000001.1 GCA001652275_00193 CDS open 222772-224109 _na     445_aa gdhA NADP-specific glutamate dehydrogenase
207 LVZK01000001.1 GCA001652275_00194 CDS open 224448-225323 _na     291_aa ABC transporter
208 LVZK01000001.1 GCA001652275_00195 CDS open 225320-226273 _na     317_aa Multidrug ABC transporter ATP-binding protein
209 LVZK01000001.1 GCA001652275_00196 CDS open 226630-227487 _na     285_aa ABC transporter ATP-binding protein
210 LVZK01000001.1 GCA001652275_00197 CDS open 227484-229868 _na     794_aa ABC3 transporter permease C-terminal domain-containing protein
211 LVZK01000001.1 GCA001652275_00198 CDS open 229868-231157 _na     429_aa MFS transporter
212 LVZK01000001.1 GCA001652275_00199 CDS open 231154-231822 _na     222_aa tetR TetR family transcriptional regulator
213 LVZK01000001.1 GCA001652275_00200 CDS open 231978-232892 _na     304_aa HTH tetR-type domain-containing protein
214 LVZK01000001.1 GCA001652275_00201 CDS open 233015-233563 _na     182_aa tetR TetR family transcriptional regulator
215 LVZK01000001.1 GCA001652275_00202 CDS open 233620-234534 _na     304_aa HTH deoR-type domain-containing protein
216 LVZK01000001.1 GCA001652275_00203 CDS open 234810-236420 _na     536_aa Carbohydrate kinase
217 LVZK01000001.1 GCA001652275_00204 CDS open 236417-237631 _na     404_aa Hydroxyacid dehydrogenase
218 LVZK01000001.1 GCA001652275_00205 CDS open 237638-238285 _na     215_aa Fuculose phosphate aldolase
219 LVZK01000001.1 GCA001652275_00206 CDS open 238504-239841 _na     445_aa Alpha-amylase
220 LVZK01000001.1 GCA001652275_00207 CDS open 239960-240499 _na     179_aa N-acetyltransferase domain-containing protein
221 LVZK01000001.1 GCA001652275_00208 CDS open 240628-240873 _na     81_aa hypothetical protein
222 LVZK01000001.1 GCA001652275_00209 CDS open 240893-241255 _na     120_aa hypothetical protein
223 LVZK01000001.1 GCA001652275_00210 CDS open 241364-241837 _na     157_aa hypothetical protein
224 LVZK01000001.1 GCA001652275_00211 CDS open 241953-244445 _na     830_aa purL phosphoribosylformylglycinamidine synthase subunit PurL
225 LVZK01000001.1 GCA001652275_00212 CDS open 244535-245227 _na     230_aa purQ phosphoribosylformylglycinamidine synthase subunit PurQ
226 LVZK01000001.1 GCA001652275_00213 CDS open 245224-245481 _na     85_aa purS Phosphoribosylformylglycinamidine synthase subunit PurS
227 LVZK01000001.1 GCA001652275_00214 CDS open 245616-246599 _na     327_aa phosphoribosylaminoimidazolesuccinocarboxamide synthase
228 LVZK01000001.1 GCA001652275_00215 CDS open 246888-248294 _na     468_aa Phosphoribosylamine--glycine ligase
229 LVZK01000001.1 GCA001652275_00216 CDS open 248780-251155 _na     791_aa SD-repeat containing protein B domain-containing protein
230 LVZK01000001.1 GCA001652275_00217 CDS open 251475-253340 _na     621_aa phosphoenolpyruvate carboxykinase (GTP)
231 LVZK01000001.1 GCA001652275_00218 CDS open 253849-254814 _na     321_aa Lipoprotein
232 LVZK01000001.1 GCA001652275_00219 CDS open 255248-256633 _na     461_aa hypothetical protein
233 LVZK01000001.1 GCA001652275_00220 CDS open 256762-258042 _na     426_aa adenylosuccinate synthase
234 LVZK01000001.1 GCA001652275_00221 CDS open 258304-260670 _na     788_aa Alpha-1%2C4 glucan phosphorylase
235 LVZK01000001.1 GCA001652275_00222 CDS open 260972-262315 _na     447_aa ABC transporter substrate-binding protein
236 LVZK01000001.1 GCA001652275_00223 CDS open 262580-263428 _na     282_aa ABC transporter permease
237 LVZK01000001.1 GCA001652275_00224 CDS open 263425-264360 _na     311_aa Sugar ABC transporter permease
238 LVZK01000001.1 GCA001652275_00225 CDS open 264374-265009 _na     211_aa DUF624 domain-containing protein
239 LVZK01000001.1 GCA001652275_00226 CDS open 265519-266547 _na     342_aa fbaA class II fructose-bisphosphate aldolase
240 LVZK01000001.1 GCA001652275_00227 CDS open 266734-267426 _na     230_aa RNA methyltransferase
241 LVZK01000001.1 GCA001652275_00228 CDS open 267572-268144 _na     190_aa Orotate phosphoribosyltransferase
242 LVZK01000001.1 GCA001652275_00229 CDS open 268261-269661 _na     466_aa hypothetical protein
243 LVZK01000001.1 GCA001652275_00230 CDS open 269995-270660 _na     221_aa lemA LemA family protein
244 LVZK01000001.1 GCA001652275_00231 CDS open 271141-271911 _na     256_aa Short-chain dehydrogenase
245 LVZK01000001.1 GCA001652275_00232 CDS open 272082-273698 _na     538_aa site-specific DNA-methyltransferase (adenine-specific)
246 LVZK01000001.1 GCA001652275_00233 CDS open 273695-274615 _na     306_aa Restriction endonuclease
247 LVZK01000001.1 GCA001652275_00234 CDS open 274635-275426 _na     263_aa exodeoxyribonuclease III
248 LVZK01000001.1 GCA001652275_00235 CDS open 275843-277294 _na     483_aa Amidase domain-containing protein
249 LVZK01000001.1 GCA001652275_00236 CDS open 277329-277919 _na     196_aa Scramblase
250 LVZK01000001.1 GCA001652275_00237 CDS open 278182-278766 _na     194_aa Scramblase
251 LVZK01000001.1 GCA001652275_00238 CDS open 279049-279366 _na     105_aa mRNA interferase
252 LVZK01000001.1 GCA001652275_00239 CDS open 279398-279613 _na     71_aa Toxin-antitoxin system protein
253 LVZK01000001.1 GCA001652275_00240 CDS open 280354-281586 _na     410_aa Cinnamoyl-CoA:phenyllactate CoA-transferase
254 LVZK01000001.1 GCA001652275_00241 CDS open 281616-282410 _na     264_aa 2-hydroxyglutaryl-CoA dehydratase
255 LVZK01000001.1 GCA001652275_00242 CDS open 282422-283753 _na     443_aa 2-hydroxyglutaryl-CoA dehydratase
256 LVZK01000001.1 GCA001652275_00243 CDS open 283756-284886 _na     376_aa Benzoyl-CoA reductase
257 LVZK01000001.1 GCA001652275_00244 CDS open 285202-286167 _na     321_aa Alcohol dehydrogenase
258 LVZK01000001.1 GCA001652275_00245 CDS open 286865-288115 _na     416_aa Major facilitator superfamily (MFS) profile domain-containing protein
259 LVZK01000001.1 GCA001652275_00246 CDS open 288144-288707 _na     187_aa hypothetical protein
260 LVZK01000001.1 GCA001652275_00247 CDS open 288712-289857 _na     381_aa Acyl-CoA dehydrogenase
261 LVZK01000001.1 GCA001652275_00248 CDS open 290153-291781 _na     542_aa Acyl CoA:acetate/3-ketoacid CoA transferase
262 LVZK01000001.1 GCA001652275_00249 CDS open 291778-293400 _na     540_aa Long-chain fatty acid--CoA ligase
263 LVZK01000001.1 GCA001652275_00250 CDS open 293632-294012 _na     126_aa hypothetical protein
264 LVZK01000001.1 GCA001652275_00251 CDS open 294019-295359 _na     446_aa Calpain catalytic domain-containing protein
265 LVZK01000001.1 GCA001652275_00252 CDS open 295356-295826 _na     156_aa hypothetical protein
266 LVZK01000001.1 GCA001652275_00253 CDS open 295914-296351 _na     145_aa ATPase AAA-type core domain-containing protein
267 LVZK01000001.1 GCA001652275_00254 CDS open 296390-297358 _na     322_aa HTH tetR-type domain-containing protein
268 LVZK01000001.1 GCA001652275_00255 CDS open 297366-298163 _na     265_aa HAD family hydrolase
269 LVZK01000001.1 GCA001652275_00256 CDS open 298338-298721 _na     127_aa Sigma-70-like protein
270 LVZK01000001.1 GCA001652275_00257 CDS open 299160-300011 _na     283_aa Penicillin-binding protein
271 LVZK01000001.1 GCA001652275_00258 CDS open 300351-301031 _na     226_aa DUF4853 domain-containing protein
272 LVZK01000001.1 GCA001652275_00259 CDS open 301039-301575 _na     178_aa DUF4853 domain-containing protein
273 LVZK01000001.1 GCA001652275_00260 CDS open 301694-303385 _na     563_aa DUF1023 domain-containing protein
274 LVZK01000001.1 GCA001652275_00261 CDS open 303385-303696 _na     103_aa Antitoxin protein
275 LVZK01000001.1 GCA001652275_00262 CDS open 304152-306485 _na     777_aa cellulase family glycosylhydrolase
276 LVZK01000001.1 GCA001652275_00263 CDS open 306476-307603 _na     375_aa Glutamine--fructose-6-phosphate aminotransferase [isomerizing]
277 LVZK01000001.1 GCA001652275_00264 CDS open 307606-308664 _na     352_aa ABC transmembrane type-1 domain-containing protein
278 LVZK01000001.1 GCA001652275_00265 CDS open 308661-309632 _na     323_aa msmF Transmembrane permease MsmF
279 LVZK01000001.1 GCA001652275_00266 CDS open 309765-311054 _na     429_aa ABC transporter substrate-binding protein
280 LVZK01000001.1 GCA001652275_00267 CDS open 311182-312048 _na     288_aa HTH gntR-type domain-containing protein
281 LVZK01000001.1 GCA001652275_00268 CDS open 312099-313373 _na     424_aa ROK family protein
282 LVZK01000001.1 GCA001652275_00269 CDS open 313440-314159 _na     239_aa hypothetical protein
283 LVZK01000001.1 GCA001652275_00270 CDS open 314529-315548 _na     339_aa hypothetical protein
284 LVZK01000001.1 GCA001652275_00271 CDS open 315505-316896 _na     463_aa NB-ARC domain-containing protein
285 LVZK01000001.1 GCA001652275_00272 CDS open 316896-317198 _na     100_aa Tetratricopeptide repeat protein
286 LVZK01000001.1 GCA001652275_00273 CDS open 317466-320114 _na     882_aa clpB ATP-dependent chaperone ClpB
287 LVZK01000001.1 GCA001652275_00274 CDS open 320358-321209 _na     283_aa hypothetical protein
288 LVZK01000001.1 GCA001652275_00275 CDS open 321351-321491 _na     46_aa hypothetical protein
289 LVZK01000001.1 GCA001652275_00276 CDS open 321645-322712 _na     355_aa DNA-(apurinic or apyrimidinic site) lyase
290 LVZK01000001.1 GCA001652275_00277 CDS open 322817-326830 _na     1337_aa eccC Type VII secretion protein EccC
291 LVZK01000001.1 GCA001652275_00278 CDS open 327125-328483 _na     452_aa eccD Type VII secretion integral membrane protein EccD
292 LVZK01000001.1 GCA001652275_00279 CDS open 328517-329872 _na     451_aa eccD type VII secretion integral membrane protein EccD
293 LVZK01000001.1 GCA001652275_00280 CDS open 329874-331241 _na     455_aa eccB Type VII secretion protein EccB
294 LVZK01000001.1 GCA001652275_00281 CDS open 331268-332668 _na     466_aa Peptidase S8/S53 domain-containing protein
295 LVZK01000001.1 GCA001652275_00282 CDS open 332702-333658 _na     318_aa hypothetical protein
296 LVZK01000001.1 GCA001652275_00283 CDS open 333947-335581 _na     544_aa hypothetical protein
297 LVZK01000001.1 GCA001652275_00284 CDS open 335864-337378 _na     504_aa hypothetical protein
298 LVZK01000001.1 GCA001652275_00285 CDS open 337385-338062 _na     225_aa hypothetical protein
299 LVZK01000001.1 GCA001652275_00286 CDS open 338826-338999 _na     57_aa Rv0909 family putative TA system antitoxin
300 LVZK01000001.1 GCA001652275_00287 CDS open 339010-340059 _na     349_aa gluQRS tRNA glutamyl-Q(34) synthetase GluQRS
301 LVZK01000001.1 GCA001652275_00288 CDS open 340142-342835 _na     897_aa Nuclease
302 LVZK01000001.1 GCA001652275_00289 CDS open 343294-344589 _na     431_aa 23S rRNA (Uracil(747)-C(5))-methyltransferase
303 LVZK01000001.1 GCA001652275_00290 CDS open 344893-345408 _na     171_aa hspR heat shock protein transcriptional repressor HspR
304 LVZK01000001.1 GCA001652275_00291 CDS open 345411-346394 _na     327_aa dnaJ Molecular chaperone DnaJ
305 LVZK01000001.1 GCA001652275_00292 CDS open 346431-347111 _na     226_aa grpE Protein GrpE
306 LVZK01000001.1 GCA001652275_00293 CDS open 347108-348976 _na     622_aa dnaK molecular chaperone DnaK
307 LVZK01000001.1 GCA001652275_00294 CDS open 349422-350081 _na     219_aa Lipoprotein
308 LVZK01000001.1 GCA001652275_00295 CDS open 350078-350674 _na     198_aa hypothetical protein
309 LVZK01000001.1 GCA001652275_00296 CDS open 350783-351703 _na     306_aa Lipoprotein
310 LVZK01000001.1 GCA001652275_00297 CDS open 351978-352847 _na     289_aa Lipoprotein
311 LVZK01000001.1 GCA001652275_00298 CDS open 352844-353779 _na     311_aa DUF1684 domain-containing protein
312 LVZK01000001.1 GCA001652275_00300 CDS open 354444-355127 _na     227_aa hypothetical protein
313 LVZK01000001.1 GCA001652275_00301 CDS open 355001-355855 _na     284_aa Manganese ABC transporter permease
314 LVZK01000001.1 GCA001652275_00302 CDS open 355848-356696 _na     282_aa metal ABC transporter ATP-binding protein
315 LVZK01000001.1 GCA001652275_00303 CDS open 356693-357634 _na     313_aa Iron-binding protein
316 LVZK01000001.1 GCA001652275_00304 CDS open 357776-358558 _na     260_aa SD-repeat containing protein B domain-containing protein
317 LVZK01000001.1 GCA001652275_00305 CDS open 358555-359310 _na     251_aa hypothetical protein
318 LVZK01000001.1 GCA001652275_00306 CDS open 359669-360280 _na     203_aa Haloacid dehalogenase
319 LVZK01000001.1 GCA001652275_00307 CDS open 360342-361058 _na     238_aa HTH tetR-type domain-containing protein
320 LVZK01000001.1 GCA001652275_00308 CDS open 361324-362517 _na     397_aa hypothetical protein
321 LVZK01000001.1 GCA001652275_00309 CDS open 362504-363589 _na     361_aa hypothetical protein
322 LVZK01000001.1 GCA001652275_00310 CDS open 363917-365380 _na     487_aa Sodium:alanine symporter
323 LVZK01000001.1 GCA001652275_00311 CDS open 365854-366663 _na     269_aa FHA domain-containing protein
324 LVZK01000001.1 GCA001652275_00312 CDS open 366773-368353 _na     526_aa non-specific serine/threonine protein kinase
325 LVZK01000001.1 GCA001652275_00313 CDS open 368353-370365 _na     670_aa FHA domain-containing protein
326 LVZK01000001.1 GCA001652275_00314 CDS open 370368-371177 _na     269_aa PPM-type phosphatase domain-containing protein
327 LVZK01000001.1 GCA001652275_00315 CDS open 371174-372670 _na     498_aa FHA domain-containing protein
328 LVZK01000001.1 GCA001652275_00316 CDS open 372663-375122 _na     819_aa Transglutaminase-like domain-containing protein
329 LVZK01000001.1 GCA001652275_00317 CDS open 375122-376423 _na     433_aa DUF58 domain-containing protein
330 LVZK01000001.1 GCA001652275_00318 CDS open 376425-377405 _na     326_aa ATPase
331 LVZK01000001.1 GCA001652275_00319 CDS open 377436-383411 _na     1991_aa Fibronectin type-III domain-containing protein
332 LVZK01000001.1 GCA001652275_00320 CDS open 384001-385422 _na     473_aa sseB SseB protein N-terminal domain-containing protein
333 LVZK01000001.1 GCA001652275_00321 CDS open 385452-386699 _na     415_aa tgt tRNA guanosine(34) transglycosylase Tgt
334 LVZK01000001.1 GCA001652275_00322 CDS open 386696-387433 _na     245_aa queuosine precursor transporter
335 LVZK01000001.1 GCA001652275_00323 CDS open 387625-389241 _na     538_aa HNH nuclease domain-containing protein
336 LVZK01000001.1 GCA001652275_00324 CDS open 389695-390612 _na     305_aa DUF4261 domain-containing protein
337 LVZK01000001.1 GCA001652275_00325 CDS open 391202-391753 _na     183_aa Gluconokinase
338 LVZK01000001.1 GCA001652275_00326 CDS open 391885-392568 _na     227_aa Adenylate cyclase
339 LVZK01000001.1 GCA001652275_00327 CDS open 392773-393957 _na     394_aa MFS transporter permease
340 LVZK01000001.1 GCA001652275_00328 CDS open 394303-394671 _na     122_aa Transcriptional regulator
341 LVZK01000001.1 GCA001652275_00329 CDS open 394909-396162 _na     417_aa ilvA threonine ammonia-lyase IlvA
342 LVZK01000001.1 GCA001652275_00330 CDS open 396532-397137 _na     201_aa Acyltransferase
343 LVZK01000001.1 GCA001652275_00331 CDS open 397540-398289 _na     249_aa HTH tetR-type domain-containing protein
344 LVZK01000001.1 GCA001652275_00332 CDS open 398467-399057 _na     196_aa NAD(P)H dehydrogenase
345 LVZK01000001.1 GCA001652275_00333 CDS open 399061-400047 _na     328_aa Alkane 1-monooxygenase
346 LVZK01000001.1 GCA001652275_00334 CDS open 400100-401020 _na     306_aa tatC twin-arginine translocase subunit TatC
347 LVZK01000001.1 GCA001652275_00335 CDS open 401098-401352 _na     84_aa tatA Sec-independent protein translocase protein TatA
348 LVZK01000001.1 GCA001652275_00336 CDS open 401349-402035 _na     228_aa tatB Sec-independent protein translocase protein TatB
349 LVZK01000001.1 GCA001652275_00337 CDS open 402381-402524 _na     47_aa hypothetical protein
350 LVZK01000001.1 GCA001652275_00338 CDS open 402778-403488 _na     236_aa hypothetical protein
351 LVZK01000001.1 GCA001652275_00339 CDS open 403578-405314 _na     578_aa hypothetical protein
352 LVZK01000001.1 GCA001652275_00340 CDS open 405579-406397 _na     272_aa Lipoprotein
353 LVZK01000001.1 GCA001652275_00341 CDS open 406767-407447 _na     226_aa Lipoprotein
354 LVZK01000001.1 GCA001652275_00342 CDS open 407720-408583 _na     287_aa Lipoprotein
355 LVZK01000001.1 GCA001652275_00343 CDS open 408662-409051 _na     129_aa hypothetical protein
356 LVZK01000001.1 GCA001652275_00344 CDS open 409279-409827 _na     182_aa Transmembrane protein
357 LVZK01000001.1 GCA001652275_00345 CDS open 409820-411250 _na     476_aa hypothetical protein
358 LVZK01000001.1 GCA001652275_00346 CDS open 411825-414044 _na     739_aa Rhodanese domain-containing protein
359 LVZK01000001.1 GCA001652275_00347 CDS open 414348-415301 _na     317_aa Molybdopterin converting factor
360 LVZK01000001.1 GCA001652275_00348 CDS open 415333-415512 _na     59_aa hypothetical protein
361 LVZK01000001.1 GCA001652275_00349 CDS open 415509-415760 _na     83_aa Molybdopterin synthase sulfur carrier subunit
362 LVZK01000001.1 GCA001652275_00350 CDS open 415762-416937 _na     391_aa moaA GTP 3'%2C8-cyclase MoaA
363 LVZK01000001.1 GCA001652275_00351 CDS open 417441-419246 _na     601_aa Htaa domain-containing protein
364 LVZK01000001.1 GCA001652275_00352 CDS open 419539-420336 _na     265_aa Excalibur calcium-binding domain-containing protein
365 LVZK01000001.1 GCA001652275_00353 CDS open 420611-421522 _na     303_aa dprA DNA processing protein DprA
366 LVZK01000001.1 GCA001652275_00354 CDS open 422028-422294 _na     88_aa hypothetical protein
367 LVZK01000001.1 GCA001652275_00355 CDS open 423149-424591 _na     480_aa Alpha/beta hydrolase
368 LVZK01000001.1 GCA001652275_00356 CDS open 425104-426540 _na     478_aa Malate dehydrogenase
369 LVZK01000001.1 GCA001652275_00357 CDS open 426762-427772 _na     336_aa fepB Fe2+-enterobactin ABC transporter substrate-binding protein
370 LVZK01000001.1 GCA001652275_00358 CDS open 427765-428904 _na     379_aa ABC transporter permease
371 LVZK01000001.1 GCA001652275_00359 CDS open 428901-430064 _na     387_aa ABC transporter permease
372 LVZK01000001.1 GCA001652275_00360 CDS open 430151-430972 _na     273_aa Iron-dicitrate transporter ATP-binding subunit
373 LVZK01000001.1 GCA001652275_00361 CDS open 431175-432185 _na     336_aa siderophore-interacting protein
374 LVZK01000001.1 GCA001652275_00362 CDS open 432396-434027 _na     543_aa DUF1023 domain-containing protein
375 LVZK01000001.1 GCA001652275_00363 CDS open 434113-434883 _na     256_aa Lipoprotein
376 LVZK01000001.1 GCA001652275_00364 CDS open 434965-435285 _na     106_aa hypothetical protein
377 LVZK01000001.1 GCA001652275_00365 CDS open 435515-436360 _na     281_aa Oxidoreductase
378 LVZK01000001.1 GCA001652275_00366 CDS open 436487-436849 _na     120_aa hypothetical protein
379 LVZK01000001.1 GCA001652275_00367 CDS open 436979-438319 _na     446_aa Calpain catalytic domain-containing protein
380 LVZK01000001.1 GCA001652275_00368 CDS open 438532-438855 _na     107_aa hypothetical protein
381 LVZK01000001.1 GCA001652275_00369 CDS open 438981-439775 _na     264_aa PN/PL/PM kinase
382 LVZK01000001.1 GCA001652275_00370 CDS open 439957-441315 _na     452_aa dnaB replicative DNA helicase
383 LVZK01000001.1 GCA001652275_00371 CDS open 441752-443101 _na     449_aa MATE family efflux transporter
384 LVZK01000001.1 GCA001652275_00372 CDS open 443232-444119 _na     295_aa Oxidoreductase
385 LVZK01000001.1 GCA001652275_00373 CDS open 444245-445744 _na     499_aa Hydroxyacid dehydrogenase
386 LVZK01000001.1 GCA001652275_00374 CDS open 446329-447420 _na     363_aa Peptidase
387 LVZK01000001.1 GCA001652275_00375 CDS open 447430-448020 _na     196_aa hypothetical protein
388 LVZK01000001.1 GCA001652275_00376 CDS open 448629-450920 _na     763_aa ABC3 transporter permease C-terminal domain-containing protein
389 LVZK01000001.1 GCA001652275_00377 CDS open 450910-451638 _na     242_aa ABC transporter ATP-binding protein
390 LVZK01000001.1 GCA001652275_00378 CDS open 451635-452159 _na     174_aa padR PadR family transcriptional regulator
391 LVZK01000001.1 GCA001652275_00379 CDS open 452504-452878 _na     124_aa ABC transporter domain-containing protein
392 LVZK01000001.1 GCA001652275_00380 CDS open 452917-454578 _na     553_aa GmrSD restriction endonucleases N-terminal domain-containing protein
393 LVZK01000001.1 GCA001652275_00381 CDS open 454575-455792 _na     405_aa hipA Toxin HipA
394 LVZK01000001.1 GCA001652275_00382 CDS open 455914-456375 _na     153_aa rplI 50S ribosomal protein L9
395 LVZK01000001.1 GCA001652275_00383 CDS open 456390-456626 _na     78_aa rpsR 30S ribosomal protein S18
396 LVZK01000001.1 GCA001652275_00384 CDS open 456702-457232 _na     176_aa Single-stranded DNA-binding protein
397 LVZK01000001.1 GCA001652275_00385 CDS open 457256-457543 _na     95_aa rpsF 30S ribosomal protein S6
398 LVZK01000001.1 GCA001652275_00386 CDS open 457719-460112 _na     797_aa peptidoglycan glycosyltransferase
399 LVZK01000001.1 GCA001652275_00387 CDS open 460197-461618 _na     473_aa AI-2E family transporter
400 LVZK01000001.1 GCA001652275_00388 CDS open 461711-463138 _na     475_aa MFS transporter
401 LVZK01000001.1 GCA001652275_00389 CDS open 463135-464697 _na     520_aa CCA tRNA nucleotidyltransferase
402 LVZK01000001.1 GCA001652275_00390 CDS open 464701-465303 _na     200_aa NUDIX hydrolase
403 LVZK01000001.1 GCA001652275_00391 CDS open 465296-467746 _na     816_aa DUF6049 domain-containing protein
404 LVZK01000001.1 GCA001652275_00392 CDS open 467867-470416 _na     849_aa F5/8 type C domain-containing protein
405 LVZK01000001.1 GCA001652275_00393 CDS open 470518-471453 _na     311_aa trxB thioredoxin-disulfide reductase
406 LVZK01000001.1 GCA001652275_00394 CDS open 471523-473328 _na     601_aa site-specific DNA-methyltransferase (adenine-specific)
407 LVZK01000001.1 GCA001652275_00395 CDS open 473318-474028 _na     236_aa hypothetical protein
408 LVZK01000001.1 GCA001652275_00396 CDS open 474122-475465 _na     447_aa gntR GntR family transcriptional regulator
409 LVZK01000001.1 GCA001652275_00397 CDS open 475722-476684 _na     320_aa D-alanine--D-alanine ligase
410 LVZK01000001.1 GCA001652275_00398 CDS open 476941-479361 _na     806_aa ParB/RepB/Spo0J family partition protein
411 LVZK01000001.1 GCA001652275_00399 CDS open 479371-480324 _na     317_aa Chromosome partitioning protein
412 LVZK01000001.1 GCA001652275_00400 CDS open 481503-481874 _na     123_aa hypothetical protein
413 LVZK01000001.1 GCA001652275_00401 CDS open 488446-488559 _na     37_aa hypothetical protein
414 LVZK01000001.1 GCA001652275_00402 CDS open 488656-488877 _na     73_aa hypothetical protein
415 LVZK01000001.1 GCA001652275_00403 CDS open 489039-489764 _na     241_aa Single-stranded DNA-binding protein
416 LVZK01000001.1 GCA001652275_00404 CDS open 489991-491139 _na     382_aa yidC membrane protein insertase YidC
417 LVZK01000001.1 GCA001652275_00405 CDS open 492587-494362 _na     591_aa dnaA chromosomal replication initiator protein DnaA
418 LVZK01000001.1 GCA001652275_00406 CDS open 494837-495970 _na     377_aa dnaN DNA polymerase III subunit beta
419 LVZK01000001.1 GCA001652275_00407 CDS open 496001-497341 _na     446_aa recF DNA replication/repair protein RecF
420 LVZK01000001.1 GCA001652275_00408 CDS open 497334-497951 _na     205_aa Protein in RecF-GyrB intergenic region
421 LVZK01000001.1 GCA001652275_00409 CDS open 498137-500200 _na     687_aa gyrB DNA topoisomerase (ATP-hydrolyzing) subunit B
422 LVZK01000001.1 GCA001652275_00410 CDS open 500213-502801 _na     862_aa gyrA DNA gyrase subunit A
423 LVZK01000001.1 GCA001652275_00411 CDS open 502805-503320 _na     171_aa DUF3566 domain-containing protein
424 LVZK01000001.1 GCA001652275_00413 CDS open 503595-503714 _na     39_aa hypothetical protein
425 LVZK01000001.1 GCA001652275_00415 CDS open 504153-504599 _na     148_aa Acetyltransferase
426 LVZK01000001.1 GCA001652275_00416 CDS open 505188-508853 _na     1221_aa hypothetical protein
427 LVZK01000001.1 GCA001652275_00417 CDS open 509137-509865 _na     242_aa Methyltransferase type 11 domain-containing protein
428 LVZK01000001.1 GCA001652275_00418 CDS open 510201-510926 _na     241_aa M50 family peptidase
429 LVZK01000001.1 GCA001652275_00419 CDS open 511010-512518 _na     502_aa Multidrug transporter
430 LVZK01000001.1 GCA001652275_00420 CDS open 514168-514461 _na     97_aa hypothetical protein
431 LVZK01000001.1 GCA001652275_00421 CDS open 514533-515384 _na     283_aa ABC-2 type transporter transmembrane domain-containing protein
432 LVZK01000001.1 GCA001652275_00422 CDS open 515381-516313 _na     310_aa ABC transporter ATP-binding protein
433 LVZK01000001.1 GCA001652275_00423 CDS open 516599-517909 _na     436_aa Coproporphyrin III ferrochelatase
434 LVZK01000001.1 GCA001652275_00424 CDS open 518105-518842 _na     245_aa hemQ hydrogen peroxide-dependent heme synthase
435 LVZK01000001.1 GCA001652275_00425 CDS open 518977-519990 _na     337_aa Alcohol dehydrogenase
436 LVZK01000001.1 GCA001652275_00426 CDS open 520165-520719 _na     184_aa DUF5324 domain-containing protein
437 LVZK01000001.1 GCA001652275_00427 CDS open 520915-521424 _na     169_aa Peptidyl-prolyl cis-trans isomerase
438 LVZK01000001.1 GCA001652275_00428 CDS open 521441-522253 _na     270_aa Peptidase S54 rhomboid domain-containing protein
439 LVZK01000001.1 GCA001652275_00429 CDS open 522368-523060 _na     230_aa crgA Cell division protein CrgA
440 LVZK01000001.1 GCA001652275_00430 CDS open 523440-524333 _na     297_aa Class E sortase
441 LVZK01000001.1 GCA001652275_00431 CDS open 524347-524502 _na     51_aa hypothetical protein
442 LVZK01000001.1 GCA001652275_00432 CDS open 524502-525137 _na     211_aa Anthranilate synthase component II
443 LVZK01000001.1 GCA001652275_00433 CDS open 525420-527321 _na     633_aa pknB Stk1 family PASTA domain-containing Ser/Thr kinase
444 LVZK01000001.1 GCA001652275_00434 CDS open 527368-528831 _na     487_aa Penicillin-binding protein
445 LVZK01000001.1 GCA001652275_00435 CDS open 528828-530255 _na     475_aa Cell division protein
446 LVZK01000001.1 GCA001652275_00436 CDS open 530252-531643 _na     463_aa Serine/threonine protein phosphatase
447 LVZK01000001.1 GCA001652275_00437 CDS open 531643-532164 _na     173_aa FHA domain-containing protein
448 LVZK01000001.1 GCA001652275_00438 CDS open 532161-532856 _na     231_aa FHA domain-containing protein
449 LVZK01000001.1 GCA001652275_00440 CDS open 534953-535090 _na     45_aa hypothetical protein
450 LVZK01000001.1 GCA001652275_00441 CDS open 535303-537123 _na     606_aa Asparagine synthetase domain-containing protein
451 LVZK01000001.1 GCA001652275_00442 CDS open 537113-537406 _na     97_aa pqqD lasso peptide biosynthesis PqqD family chaperone
452 LVZK01000001.1 GCA001652275_00443 CDS open 538443-538583 _na     46_aa hypothetical protein
453 LVZK01000001.1 GCA001652275_00444 CDS open 539445-539576 _na     43_aa hypothetical protein
454 LVZK01000001.1 GCA001652275_00445 CDS open 539826-539945 _na     39_aa hypothetical protein
455 LVZK01000001.1 GCA001652275_00446 CDS open 540344-542101 _na     585_aa Asparagine synthetase domain-containing protein
456 LVZK01000001.1 GCA001652275_00447 CDS open 542091-542378 _na     95_aa pqqD lasso peptide biosynthesis PqqD family chaperone
457 LVZK01000001.1 GCA001652275_00448 CDS open 542375-544651 _na     758_aa ABC transporter
458 LVZK01000001.1 GCA001652275_00449 CDS open 544691-545419 _na     242_aa ABC transporter
459 LVZK01000001.1 GCA001652275_00450 CDS open 545416-546204 _na     262_aa ABC transporter permease
460 LVZK01000001.1 GCA001652275_00451 CDS open 546207-546893 _na     228_aa ABC transporter permease
461 LVZK01000001.1 GCA001652275_00452 CDS open 547124-547939 _na     271_aa hypothetical protein
462 LVZK01000001.1 GCA001652275_00453 CDS open 548125-548373 _na     82_aa hypothetical protein
463 LVZK01000001.1 GCA001652275_00454 CDS open 548533-550503 _na     656_aa ABC transporter permease
464 LVZK01000001.1 GCA001652275_00455 CDS open 550500-552467 _na     655_aa Multidrug ABC transporter ATP-binding protein
465 LVZK01000001.1 GCA001652275_00456 CDS open 552608-553606 _na     332_aa Thioredoxin-like fold domain-containing protein
466 LVZK01000001.1 GCA001652275_00457 CDS open 553609-554517 _na     302_aa Appr-1-p processing protein
467 LVZK01000001.1 GCA001652275_00458 CDS open 554658-555536 _na     292_aa ribonuclease H
468 LVZK01000001.1 GCA001652275_00459 CDS open 555632-556582 _na     316_aa DSBA-like thioredoxin domain-containing protein
469 LVZK01000001.1 GCA001652275_00460 CDS open 556675-557442 _na     255_aa ABC transporter permease
470 LVZK01000001.1 GCA001652275_00461 CDS open 557439-558776 _na     445_aa ABC transporter domain-containing protein
471 LVZK01000001.1 GCA001652275_00462 CDS open 558769-559611 _na     280_aa hypothetical protein
472 LVZK01000001.1 GCA001652275_00463 CDS open 559598-559939 _na     113_aa padR Transcription regulator PadR N-terminal domain-containing protein
473 LVZK01000001.1 GCA001652275_00464 CDS open 560195-562444 _na     749_aa Protease
474 LVZK01000001.1 GCA001652275_00465 CDS open 562680-564059 _na     459_aa mtnN 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase
475 LVZK01000001.1 GCA001652275_00466 CDS open 564056-564529 _na     157_aa S-ribosylhomocysteine lyase
476 LVZK01000001.1 GCA001652275_00467 CDS open 565016-565438 _na     140_aa Transcriptional repressor
477 LVZK01000001.1 GCA001652275_00468 CDS open 565661-567139 _na     492_aa L-serine ammonia-lyase
478 LVZK01000001.1 GCA001652275_00469 CDS open 567120-568259 _na     379_aa Cystathionine gamma-synthase
479 LVZK01000001.1 GCA001652275_00470 CDS open 568256-569680 _na     474_aa cysteine-S-conjugate beta-lyase
480 LVZK01000001.1 GCA001652275_00471 CDS open 570767-571234 _na     155_aa hypothetical protein
481 LVZK01000001.1 GCA001652275_00472 CDS open 571940-572521 _na     193_aa Permease
482 LVZK01000001.1 GCA001652275_00473 CDS open 572521-573384 _na     287_aa VTC domain-containing protein
483 LVZK01000001.1 GCA001652275_00474 CDS open 573392-574903 _na     503_aa Carbohydrate-binding domain-containing protein
484 LVZK01000001.1 GCA001652275_00475 CDS open 575285-575869 _na     194_aa Permease
485 LVZK01000001.1 GCA001652275_00476 CDS open 575869-576729 _na     286_aa VTC domain-containing protein
486 LVZK01000001.1 GCA001652275_00477 CDS open 576726-578291 _na     521_aa Carbohydrate-binding domain-containing protein
487 LVZK01000001.1 GCA001652275_00478 CDS open 578323-578427 _na     34_aa hypothetical protein
488 LVZK01000001.1 GCA001652275_00479 CDS open 579110-579364 _na     84_aa nrdH Glutaredoxin-like protein NrdH
489 LVZK01000001.1 GCA001652275_00480 CDS open 579441-579845 _na     134_aa nrdI class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI
490 LVZK01000001.1 GCA001652275_00481 CDS open 579827-581980 _na     717_aa nrdE class 1b ribonucleoside-diphosphate reductase subunit alpha
491 LVZK01000001.1 GCA001652275_00482 CDS open 582859-583356 _na     165_aa hypothetical protein
492 LVZK01000001.1 GCA001652275_00483 CDS open 583428-584603 _na     391_aa ABC transporter ATP-binding protein
493 LVZK01000001.1 GCA001652275_00484 CDS open 584600-585265 _na     221_aa ABC transporter permease
494 LVZK01000001.1 GCA001652275_00485 CDS open 585262-585942 _na     226_aa ABC transporter permease
495 LVZK01000001.1 GCA001652275_00486 CDS open 585945-587057 _na     370_aa Glycine/betaine ABC transporter
496 LVZK01000001.1 GCA001652275_00487 CDS open 587263-587601 _na     112_aa hypothetical protein
497 LVZK01000001.1 GCA001652275_00488 CDS open 587598-587897 _na     99_aa WXG100 family type VII secretion target
498 LVZK01000001.1 GCA001652275_00489 CDS open 587910-588260 _na     116_aa PE domain-containing protein
499 LVZK01000001.1 GCA001652275_00490 CDS open 588250-589926 _na     558_aa ADP-ribosyltransferase exoenzyme
500 LVZK01000001.1 GCA001652275_00491 CDS open 589988-590479 _na     163_aa hypothetical protein