BAKTAGenome Explorer: Gardnerella leopoldii (GCA_002861145.1)
Select a Genome:
|
BAKTA Annotations for GCA_002861145.1
|
Search & Sort all 2378 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | PKHB01000001.1 | GCA002861145_00972 | gene | open | 1205968-1206362 | ssrA | ||
| 2 | PKHB01000001.1 | GCA002861145_00972 | tmRNA | open | 1205968-1206362 | ssrA | transfer-messenger RNA%2C SsrA | |
| 3 | PKHB01000001.1 | rep_origin | open | 79011-79439 | ||||
| 4 | PKHB01000001.1 | GCA002861145_00652 | gene | open | 791726-792099 | RNaseP_bact_a | ||
| 5 | PKHB01000001.1 | GCA002861145_00656 | gene | open | 796095-796325 | sRNA_1300 | ||
| 6 | PKHB01000001.1 | GCA002861145_00652 | ncRNA | open | 791726-792099 | Bacterial RNase P class A | ||
| 7 | PKHB01000001.1 | GCA002861145_00656 | ncRNA | open | 796095-796325 | Enterococcus sRNA 1300 | ||
| 8 | PKHB01000001.1 | regulatory_region | open | 107361-107419 | msiK RNA | |||
| 9 | PKHB01000001.1 | regulatory_region | open | 389952-390112 | M-box riboswitch aptamer (ykoK leader) | |||
| 10 | PKHB01000001.1 | regulatory_region | open | 756949-757073 | TPP riboswitch aptamer (THI element) | |||
| 11 | PKHB01000001.1 | regulatory_region | open | 881183-881272 | TPP riboswitch aptamer (THI element) | |||
| 12 | PKHB01000001.1 | regulatory_region | open | 940445-940591 | FMN riboswitch aptamer (RFN element) | |||
| 13 | PKHB01000001.1 | regulatory_region | open | 1011062-1011167 | TPP riboswitch aptamer (THI element) | |||
| 14 | PKHB01000001.1 | regulatory_region | open | 1097566-1097751 | Lysine riboswitch aptamer | |||
| 15 | PKHB01000001.1 | regulatory_region | open | 1297817-1297928 | TPP riboswitch aptamer (THI element) | |||
| 16 | PKHB01000001.1 | repeat_region | open | 769461-769910 | CRISPR array with 7 repeats of length 36%2C consensus sequence CAAGTATATCAAGAGGGGTAAGAGCTAATTCTCAAC and spacer length 28 | |||
| 17 | PKHB01000001.1 | repeat_region | open | 878942-880161 | CRISPR array with 20 repeats of length 28%2C consensus sequence GTCTTTCCCGCATACGCGGGGGTGATCC and spacer length 33 | |||
| 18 | PKHB01000001.1 | GCA002861145_00001 | CDS | open | 484-1254 | _na 256_aa | sIR2 | Transcriptional regulator%2C Sir2 family |
| 19 | PKHB01000001.1 | GCA002861145_00002 | CDS | open | 1280-3199 | _na 639_aa | Alpha amylase%2C catalytic domain protein | |
| 20 | PKHB01000001.1 | GCA002861145_00003 | CDS | open | 3414-4382 | _na 322_aa | panE | 2-dehydropantoate 2-reductase |
| 21 | PKHB01000001.1 | GCA002861145_00004 | CDS | open | 4625-5686 | _na 353_aa | Ribokinase | |
| 22 | PKHB01000001.1 | GCA002861145_00005 | CDS | open | 5718-6113 | _na 131_aa | rbsD | D-ribose pyranase |
| 23 | PKHB01000001.1 | GCA002861145_00006 | CDS | open | 6407-7345 | _na 312_aa | rbsB | Putative D-ribose-binding periplasmic protein |
| 24 | PKHB01000001.1 | GCA002861145_00007 | CDS | open | 7609-8610 | _na 333_aa | araH | Branched-chain amino acid ABC transporter%2C permease protein |
| 25 | PKHB01000001.1 | GCA002861145_00008 | CDS | open | 8782-10275 | _na 497_aa | ccmA | heme ABC exporter ATP-binding protein CcmA |
| 26 | PKHB01000001.1 | GCA002861145_00009 | CDS | open | 10492-11502 | _na 336_aa | lacI | Transcriptional regulator%2C LacI family |
| 27 | PKHB01000001.1 | GCA002861145_00010 | CDS | open | 11893-12354 | _na 153_aa | tRNA-specific adenosine deaminase | |
| 28 | PKHB01000001.1 | GCA002861145_00011 | CDS | open | 12429-13199 | _na 256_aa | Esterase | |
| 29 | PKHB01000001.1 | GCA002861145_00013 | CDS | open | 13534-14859 | _na 441_aa | tgt | tRNA guanosine(34) transglycosylase Tgt |
| 30 | PKHB01000001.1 | GCA002861145_00014 | CDS | open | 15045-16811 | _na 588_aa | Serine protease | |
| 31 | PKHB01000001.1 | GCA002861145_00015 | CDS | open | 16951-18714 | _na 587_aa | ABC transporter permease | |
| 32 | PKHB01000001.1 | GCA002861145_00016 | CDS | open | 18711-19709 | _na 332_aa | rlmB | 23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB |
| 33 | PKHB01000001.1 | GCA002861145_00017 | CDS | open | 19938-22928 | _na 996_aa | Putative potassium/sodium efflux P-type ATPase%2C fungal-type | |
| 34 | PKHB01000001.1 | GCA002861145_00018 | CDS | open | 23228-23809 | _na 193_aa | dcd | dCTP deaminase |
| 35 | PKHB01000001.1 | GCA002861145_00019 | CDS | open | 24380-25573 | _na 397_aa | trpB | tryptophan synthase subunit beta |
| 36 | PKHB01000001.1 | GCA002861145_00020 | CDS | open | 25723-26625 | _na 300_aa | putative hydrogen peroxide-inducible genes activator | |
| 37 | PKHB01000001.1 | GCA002861145_00021 | CDS | open | 26667-28340 | _na 557_aa | ahpF | alkyl hydroperoxide reductase subunit F |
| 38 | PKHB01000001.1 | GCA002861145_00022 | CDS | open | 28467-29030 | _na 187_aa | ahpC | alkyl hydroperoxide reductase subunit C |
| 39 | PKHB01000001.1 | GCA002861145_00023 | CDS | open | 29383-30561 | _na 392_aa | Triacylglycerol lipase | |
| 40 | PKHB01000001.1 | GCA002861145_00024 | CDS | open | 30906-33950 | _na 1014_aa | Peptidase | |
| 41 | PKHB01000001.1 | GCA002861145_00026 | CDS | open | 34222-35100 | _na 292_aa | Peptidase M48 | |
| 42 | PKHB01000001.1 | GCA002861145_00027 | CDS | open | 35206-36684 | _na 492_aa | ferredoxin--NADP(+) reductase | |
| 43 | PKHB01000001.1 | GCA002861145_00028 | CDS | open | 36995-39307 | _na 770_aa | Heavy metal translocating P-type ATPase | |
| 44 | PKHB01000001.1 | GCA002861145_00031 | CDS | open | 39939-40418 | _na 159_aa | dps | DNA-binding ferritin-like protein for protection from oxidative damage |
| 45 | PKHB01000001.1 | GCA002861145_00032 | CDS | open | 40476-41771 | _na 431_aa | HlyC/CorC family transporter | |
| 46 | PKHB01000001.1 | GCA002861145_00033 | CDS | open | 41848-42618 | _na 256_aa | TIGR03943 family putative permease subunit | |
| 47 | PKHB01000001.1 | GCA002861145_00034 | CDS | open | 42615-43709 | _na 364_aa | Permease | |
| 48 | PKHB01000001.1 | GCA002861145_00035 | CDS | open | 43765-44424 | _na 219_aa | Carbonic anhydrase | |
| 49 | PKHB01000001.1 | GCA002861145_00036 | CDS | open | 44652-47408 | _na 918_aa | ppc | Phosphoenolpyruvate carboxylase |
| 50 | PKHB01000001.1 | GCA002861145_00037 | CDS | open | 47615-49336 | _na 573_aa | Threonine/serine exporter-like N-terminal domain-containing protein | |
| 51 | PKHB01000001.1 | GCA002861145_00038 | CDS | open | 49435-50526 | _na 363_aa | trpS | tryptophan--tRNA ligase |
| 52 | PKHB01000001.1 | GCA002861145_00039 | CDS | open | 50672-51052 | _na 126_aa | DUF3073 domain-containing protein | |
| 53 | PKHB01000001.1 | GCA002861145_00040 | CDS | open | 51171-51587 | _na 138_aa | Bacterial SCP orthologue domain-containing protein | |
| 54 | PKHB01000001.1 | GCA002861145_00041 | CDS | open | 51825-54314 | _na 829_aa | glgP | Alpha-1%2C4 glucan phosphorylase |
| 55 | PKHB01000001.1 | GCA002861145_00042 | CDS | open | 54515-54724 | _na 69_aa | Secreted protein | |
| 56 | PKHB01000001.1 | GCA002861145_00043 | CDS | open | 54991-55590 | _na 199_aa | Rhomboid family intramembrane serine protease | |
| 57 | PKHB01000001.1 | GCA002861145_00044 | CDS | open | 55847-57163 | _na 438_aa | SAM-dependent methyltransferase | |
| 58 | PKHB01000001.1 | GCA002861145_00045 | CDS | open | 57220-57612 | _na 130_aa | crgA | cell division protein CrgA |
| 59 | PKHB01000001.1 | GCA002861145_00046 | CDS | open | 57690-58445 | _na 251_aa | DUF881 domain-containing protein | |
| 60 | PKHB01000001.1 | GCA002861145_00047 | CDS | open | 58491-59597 | _na 368_aa | Class E sortase | |
| 61 | PKHB01000001.1 | GCA002861145_00048 | CDS | open | 59999-62002 | _na 667_aa | pknB | Stk1 family PASTA domain-containing Ser/Thr kinase |
| 62 | PKHB01000001.1 | GCA002861145_00049 | CDS | open | 61999-62961 | _na 320_aa | non-specific serine/threonine protein kinase | |
| 63 | PKHB01000001.1 | GCA002861145_00050 | CDS | open | 62958-64424 | _na 488_aa | Penicillin-binding protein 2 | |
| 64 | PKHB01000001.1 | GCA002861145_00051 | CDS | open | 64417-65898 | _na 493_aa | FtsW/RodA/SpoVE family cell cycle protein | |
| 65 | PKHB01000001.1 | GCA002861145_00052 | CDS | open | 65895-67559 | _na 554_aa | Phosphoprotein phosphatase | |
| 66 | PKHB01000001.1 | GCA002861145_00053 | CDS | open | 67563-68099 | _na 178_aa | FHA domain-containing protein | |
| 67 | PKHB01000001.1 | GCA002861145_00054 | CDS | open | 68133-68834 | _na 233_aa | FHA domain-containing protein | |
| 68 | PKHB01000001.1 | GCA002861145_00055 | CDS | open | 68990-69727 | _na 245_aa | PAP2 family protein | |
| 69 | PKHB01000001.1 | GCA002861145_00056 | CDS | open | 69751-70161 | _na 136_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 70 | PKHB01000001.1 | GCA002861145_00057 | CDS | open | 70247-70912 | _na 221_aa | DUF3566 domain-containing protein | |
| 71 | PKHB01000001.1 | GCA002861145_00058 | CDS | open | 71062-73692 | _na 876_aa | gyrA | DNA gyrase subunit A |
| 72 | PKHB01000001.1 | GCA002861145_00059 | CDS | open | 73762-75852 | _na 696_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 73 | PKHB01000001.1 | GCA002861145_00060 | CDS | open | 76019-76486 | _na 155_aa | RNA-binding protein | |
| 74 | PKHB01000001.1 | GCA002861145_00061 | CDS | open | 76486-77787 | _na 433_aa | recF | DNA replication/repair protein RecF |
| 75 | PKHB01000001.1 | GCA002861145_00062 | CDS | open | 77886-79010 | _na 374_aa | dnaN | DNA polymerase III subunit beta |
| 76 | PKHB01000001.1 | GCA002861145_00063 | CDS | open | 79440-81053 | _na 537_aa | dnaA | chromosomal replication initiator protein DnaA |
| 77 | PKHB01000001.1 | GCA002861145_00064 | CDS | open | 81443-81577 | _na 44_aa | rpmH | 50S ribosomal protein L34 |
| 78 | PKHB01000001.1 | GCA002861145_00065 | CDS | open | 81689-82096 | _na 135_aa | rnpA | ribonuclease P protein component |
| 79 | PKHB01000001.1 | GCA002861145_00066 | CDS | open | 82135-82455 | _na 106_aa | yidD | membrane protein insertion efficiency factor YidD |
| 80 | PKHB01000001.1 | GCA002861145_00067 | CDS | open | 82455-83468 | _na 337_aa | yidC | Membrane protein insertase YidC |
| 81 | PKHB01000001.1 | GCA002861145_00068 | CDS | open | 83605-84159 | _na 184_aa | R3H domain-containing protein | |
| 82 | PKHB01000001.1 | GCA002861145_00069 | CDS | open | 84298-85008 | _na 236_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 83 | PKHB01000001.1 | GCA002861145_00070 | CDS | open | 85766-86737 | _na 323_aa | Sporulation initiation inhibitor protein Soj family protein | |
| 84 | PKHB01000001.1 | GCA002861145_00071 | CDS | open | 86737-88095 | _na 452_aa | parB | Chromosome partitioning protein ParB |
| 85 | PKHB01000001.1 | GCA002861145_00072 | CDS | open | 88479-89300 | _na 273_aa | Triacylglycerol lipase | |
| 86 | PKHB01000001.1 | GCA002861145_00073 | CDS | open | 89451-90392 | _na 313_aa | trxB | thioredoxin-disulfide reductase |
| 87 | PKHB01000001.1 | GCA002861145_00074 | CDS | open | 90428-92647 | _na 739_aa | Kinase | |
| 88 | PKHB01000001.1 | GCA002861145_00075 | CDS | open | 92814-94610 | _na 598_aa | murJ | Lipid II flippase MurJ |
| 89 | PKHB01000001.1 | GCA002861145_00076 | CDS | open | 94607-97000 | _na 797_aa | DUF6049 domain-containing protein | |
| 90 | PKHB01000001.1 | GCA002861145_00077 | CDS | open | 96981-97787 | _na 268_aa | NUDIX hydrolase | |
| 91 | PKHB01000001.1 | GCA002861145_00078 | CDS | open | 97845-99272 | _na 475_aa | CCA tRNA nucleotidyltransferase | |
| 92 | PKHB01000001.1 | GCA002861145_00079 | CDS | open | 99331-99957 | _na 208_aa | LytR/CpsA/Psr regulator C-terminal domain-containing protein | |
| 93 | PKHB01000001.1 | GCA002861145_00080 | CDS | open | 100087-100968 | _na 293_aa | rsmA | 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))-dimethyltransferase RsmA |
| 94 | PKHB01000001.1 | GCA002861145_00081 | CDS | open | 101039-102499 | _na 486_aa | G5 domain-containing protein | |
| 95 | PKHB01000001.1 | GCA002861145_00083 | CDS | open | 103205-105028 | _na 607_aa | non-specific serine/threonine protein kinase | |
| 96 | PKHB01000001.1 | GCA002861145_00084 | CDS | open | 105161-106123 | _na 320_aa | dsbA | Disulfide bond formation protein DsbA |
| 97 | PKHB01000001.1 | GCA002861145_00085 | CDS | open | 106219-107178 | _na 319_aa | dsbA | Disulfide bond formation protein DsbA |
| 98 | PKHB01000001.1 | GCA002861145_00086 | CDS | open | 107419-108546 | _na 375_aa | malK | ABC transporter ATP-binding component |
| 99 | PKHB01000001.1 | GCA002861145_00087 | CDS | open | 108795-110210 | _na 471_aa | DUF4032 domain-containing protein | |
| 100 | PKHB01000001.1 | GCA002861145_00089 | CDS | open | 110511-110771 | _na 86_aa | NrdH-redoxin | |
| 101 | PKHB01000001.1 | GCA002861145_00090 | CDS | open | 110929-112140 | _na 403_aa | ftsY | signal recognition particle-docking protein FtsY |
| 102 | PKHB01000001.1 | GCA002861145_00091 | CDS | open | 112303-114084 | _na 593_aa | Ammonia transporter | |
| 103 | PKHB01000001.1 | GCA002861145_00092 | CDS | open | 114502-115863 | _na 453_aa | MATE family efflux transporter | |
| 104 | PKHB01000001.1 | GCA002861145_00093 | CDS | open | 115928-117388 | _na 486_aa | dnaB | replicative DNA helicase |
| 105 | PKHB01000001.1 | GCA002861145_00094 | CDS | open | 117404-118822 | _na 472_aa | murT | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit MurT |
| 106 | PKHB01000001.1 | GCA002861145_00095 | CDS | open | 118828-119625 | _na 265_aa | gatD | Lipid II isoglutaminyl synthase (glutamine-hydrolyzing) subunit GatD |
| 107 | PKHB01000001.1 | GCA002861145_00096 | CDS | open | 119754-120392 | _na 212_aa | upp | uracil phosphoribosyltransferase |
| 108 | PKHB01000001.1 | GCA002861145_00097 | CDS | open | 120684-121337 | _na 217_aa | Thymidine phosphorylase | |
| 109 | PKHB01000001.1 | GCA002861145_00098 | CDS | open | 121384-122544 | _na 386_aa | NUDIX hydrolase | |
| 110 | PKHB01000001.1 | GCA002861145_00099 | CDS | open | 122834-125071 | _na 745_aa | ppk | RNA degradosome polyphosphate kinase |
| 111 | PKHB01000001.1 | GCA002861145_00100 | CDS | open | 125681-126466 | _na 261_aa | glpF | MIP family channel protein |
| 112 | PKHB01000001.1 | GCA002861145_00101 | CDS | open | 126639-127688 | _na 349_aa | glnS | Putative glutamyl-queuosine tRNA(Asp) synthetase |
| 113 | PKHB01000001.1 | GCA002861145_00102 | CDS | open | 127731-128522 | _na 263_aa | Pyridoxal phosphate homeostasis protein | |
| 114 | PKHB01000001.1 | GCA002861145_00103 | CDS | open | 128561-129376 | _na 271_aa | ycgM | 2-hydroxyhepta-2%2C4-diene-1%2C7-dioate isomerase |
| 115 | PKHB01000001.1 | GCA002861145_00104 | CDS | open | 129692-132286 | _na 864_aa | clpB | ATP-dependent chaperone ClpB |
| 116 | PKHB01000001.1 | GCA002861145_00105 | CDS | open | 132431-133771 | _na 446_aa | rmuC | 30S ribosomal protein S9 |
| 117 | PKHB01000001.1 | GCA002861145_00106 | CDS | open | 133830-134759 | _na 309_aa | hypothetical protein | |
| 118 | PKHB01000001.1 | GCA002861145_00107 | CDS | open | 134817-135623 | _na 268_aa | spoU | tRNA/rRNA methyltransferase SpoU type domain-containing protein |
| 119 | PKHB01000001.1 | GCA002861145_00108 | CDS | open | 135771-136763 | _na 330_aa | Multidrug ABC transporter ATP-binding protein | |
| 120 | PKHB01000001.1 | GCA002861145_00109 | CDS | open | 136760-137734 | _na 324_aa | ABC transporter permease | |
| 121 | PKHB01000001.1 | GCA002861145_00110 | CDS | open | 137803-137934 | _na 43_aa | hypothetical protein | |
| 122 | PKHB01000001.1 | GCA002861145_00111 | CDS | open | 137931-140009 | _na 692_aa | Multidrug ABC transporter ATP-binding protein | |
| 123 | PKHB01000001.1 | GCA002861145_00112 | CDS | open | 140148-141698 | _na 516_aa | vly | cholesterol-dependent cytolysin vaginolysin |
| 124 | PKHB01000001.1 | GCA002861145_00113 | CDS | open | 142199-142495 | _na 98_aa | gatC | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC |
| 125 | PKHB01000001.1 | GCA002861145_00114 | CDS | open | 142499-144040 | _na 513_aa | gatA | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA |
| 126 | PKHB01000001.1 | GCA002861145_00115 | CDS | open | 144074-145573 | _na 499_aa | gatB | Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB |
| 127 | PKHB01000001.1 | GCA002861145_00116 | CDS | open | 145830-146738 | _na 302_aa | GNAT family N-acetyltransferase | |
| 128 | PKHB01000001.1 | GCA002861145_00117 | CDS | open | 146738-147052 | _na 104_aa | DUF2469 domain-containing protein | |
| 129 | PKHB01000001.1 | GCA002861145_00118 | CDS | open | 147144-148763 | _na 539_aa | Amine oxidase domain-containing protein | |
| 130 | PKHB01000001.1 | GCA002861145_00119 | CDS | open | 149103-151073 | _na 656_aa | rho | transcription termination factor Rho |
| 131 | PKHB01000001.1 | GCA002861145_00120 | CDS | open | 151164-152369 | _na 401_aa | Aminotransferase | |
| 132 | PKHB01000001.1 | GCA002861145_00121 | CDS | open | 152652-153113 | _na 153_aa | asnC | Transcriptional regulator%2C AsnC family |
| 133 | PKHB01000001.1 | GCA002861145_00122 | CDS | open | 153119-153460 | _na 113_aa | chorismate mutase | |
| 134 | PKHB01000001.1 | GCA002861145_00123 | CDS | open | 153608-154663 | _na 351_aa | fbaA | class II fructose-bisphosphate aldolase |
| 135 | PKHB01000001.1 | GCA002861145_00124 | CDS | open | 154780-156081 | _na 433_aa | purA | adenylosuccinate synthase |
| 136 | PKHB01000001.1 | GCA002861145_00125 | CDS | open | 156177-156680 | _na 167_aa | fluC | Fluoride-specific ion channel FluC |
| 137 | PKHB01000001.1 | GCA002861145_00126 | CDS | open | 156680-157090 | _na 136_aa | fluC | Fluoride-specific ion channel FluC |
| 138 | PKHB01000001.1 | GCA002861145_00127 | CDS | open | 157130-158497 | _na 455_aa | ClC family H(+)/Cl(-) exchange transporter | |
| 139 | PKHB01000001.1 | GCA002861145_00128 | CDS | open | 158621-159811 | _na 396_aa | ATPase | |
| 140 | PKHB01000001.1 | GCA002861145_00129 | CDS | open | 159798-160874 | _na 358_aa | Pilus assembly protein | |
| 141 | PKHB01000001.1 | GCA002861145_00130 | CDS | open | 160904-161479 | _na 191_aa | tadB | Pilus assembly protein TadB |
| 142 | PKHB01000001.1 | GCA002861145_00131 | CDS | open | 161483-162130 | _na 215_aa | Pilus assembly protein | |
| 143 | PKHB01000001.1 | GCA002861145_00132 | CDS | open | 162266-162544 | _na 92_aa | DUF4244 domain-containing protein | |
| 144 | PKHB01000001.1 | GCA002861145_00133 | CDS | open | 162577-162954 | _na 125_aa | tadG | Pilus assembly protein TadG |
| 145 | PKHB01000001.1 | GCA002861145_00134 | CDS | open | 162951-163355 | _na 134_aa | tadE | Pilus assembly protein TadE |
| 146 | PKHB01000001.1 | GCA002861145_00135 | CDS | open | 163461-165851 | _na 796_aa | dnaX | DNA polymerase III subunit gamma/tau |
| 147 | PKHB01000001.1 | GCA002861145_00136 | CDS | open | 165858-166466 | _na 202_aa | recR | recombination mediator RecR |
| 148 | PKHB01000001.1 | GCA002861145_00137 | CDS | open | 166596-167360 | _na 254_aa | metL1 | aspartate kinase |
| 149 | PKHB01000001.1 | GCA002861145_00138 | CDS | open | 167424-167993 | _na 189_aa | aspartate kinase | |
| 150 | PKHB01000001.1 | GCA002861145_00139 | CDS | open | 168086-169153 | _na 355_aa | aspartate-semialdehyde dehydrogenase | |
| 151 | PKHB01000001.1 | GCA002861145_00140 | CDS | open | 169206-169826 | _na 206_aa | DUF5701 domain-containing protein | |
| 152 | PKHB01000001.1 | GCA002861145_00141 | CDS | open | 169936-170637 | _na 233_aa | Macrolide ABC transporter ATP-binding protein | |
| 153 | PKHB01000001.1 | GCA002861145_00142 | CDS | open | 170651-173404 | _na 917_aa | ABC transporter permease | |
| 154 | PKHB01000001.1 | GCA002861145_00143 | CDS | open | 173492-175063 | _na 523_aa | Amino acid transporter | |
| 155 | PKHB01000001.1 | GCA002861145_00144 | CDS | open | 175100-175807 | _na 235_aa | nucS | endonuclease NucS |
| 156 | PKHB01000001.1 | GCA002861145_00145 | CDS | open | 175905-176891 | _na 328_aa | peptidylprolyl isomerase | |
| 157 | PKHB01000001.1 | GCA002861145_00146 | CDS | open | 176971-178767 | _na 598_aa | hypothetical protein | |
| 158 | PKHB01000001.1 | GCA002861145_00147 | CDS | open | 178769-179824 | _na 351_aa | Lipoprotein | |
| 159 | PKHB01000001.1 | GCA002861145_00148 | CDS | open | 179866-180891 | _na 341_aa | ybbN | Co-chaperone YbbN |
| 160 | PKHB01000001.1 | GCA002861145_00150 | CDS | open | 181220-182251 | _na 343_aa | metA | homoserine O-succinyltransferase |
| 161 | PKHB01000001.1 | GCA002861145_00151 | CDS | open | 182451-183305 | _na 284_aa | atpB | F0F1 ATP synthase subunit A |
| 162 | PKHB01000001.1 | GCA002861145_00152 | CDS | open | 183406-183639 | _na 77_aa | atpE | ATP synthase F0 subunit C |
| 163 | PKHB01000001.1 | GCA002861145_00153 | CDS | open | 183700-184242 | _na 180_aa | atpF | F0F1 ATP synthase subunit B |
| 164 | PKHB01000001.1 | GCA002861145_00154 | CDS | open | 184341-184922 | _na 193_aa | atpH | ATP synthase F1 subunit delta |
| 165 | PKHB01000001.1 | GCA002861145_00155 | CDS | open | 184939-186600 | _na 553_aa | atpA | F0F1 ATP synthase subunit alpha |
| 166 | PKHB01000001.1 | GCA002861145_00156 | CDS | open | 186604-187608 | _na 334_aa | atpG | F0F1 ATP synthase subunit gamma |
| 167 | PKHB01000001.1 | GCA002861145_00157 | CDS | open | 187615-189102 | _na 495_aa | atpD | F0F1 ATP synthase subunit beta |
| 168 | PKHB01000001.1 | GCA002861145_00158 | CDS | open | 189099-189419 | _na 106_aa | atpC | F0F1 ATP synthase subunit epsilon |
| 169 | PKHB01000001.1 | GCA002861145_00159 | CDS | open | 190313-190498 | _na 61_aa | vbhA | Antitoxin VbhA domain-containing protein |
| 170 | PKHB01000001.1 | GCA002861145_00160 | CDS | open | 190519-191238 | _na 239_aa | protein adenylyltransferase | |
| 171 | PKHB01000001.1 | GCA002861145_00161 | CDS | open | 191911-192942 | _na 343_aa | FAD:protein FMN transferase | |
| 172 | PKHB01000001.1 | GCA002861145_00162 | CDS | open | 193199-194917 | _na 572_aa | Iron permease | |
| 173 | PKHB01000001.1 | GCA002861145_00163 | CDS | open | 195012-195656 | _na 214_aa | Amino acid ABC transporter substrate-binding protein | |
| 174 | PKHB01000001.1 | GCA002861145_00164 | CDS | open | 195729-197000 | _na 423_aa | Membrane iron-sulfur containing protein FtrD-like domain-containing protein | |
| 175 | PKHB01000001.1 | GCA002861145_00165 | CDS | open | 197013-198347 | _na 444_aa | ABC transporter permease | |
| 176 | PKHB01000001.1 | GCA002861145_00166 | CDS | open | 198337-199656 | _na 439_aa | ABC3 transporter permease C-terminal domain-containing protein | |
| 177 | PKHB01000001.1 | GCA002861145_00167 | CDS | open | 199707-200552 | _na 281_aa | lolD | ABC transporter%2C ATP-binding protein |
| 178 | PKHB01000001.1 | GCA002861145_00168 | CDS | open | 200598-201197 | _na 199_aa | FMN-binding domain-containing protein | |
| 179 | PKHB01000001.1 | GCA002861145_00169 | CDS | open | 201254-201865 | _na 203_aa | hypothetical protein | |
| 180 | PKHB01000001.1 | GCA002861145_00170 | CDS | open | 202059-202799 | _na 246_aa | citB | Transcriptional regulator%2C LuxR family |
| 181 | PKHB01000001.1 | GCA002861145_00171 | CDS | open | 202793-204010 | _na 405_aa | comP | Histidine kinase |
| 182 | PKHB01000001.1 | GCA002861145_00172 | CDS | open | 204092-204265 | _na 57_aa | Hypoyhetical protein | |
| 183 | PKHB01000001.1 | GCA002861145_00173 | CDS | open | 204262-204555 | _na 97_aa | DUF2089 domain-containing protein | |
| 184 | PKHB01000001.1 | GCA002861145_00174 | CDS | open | 205004-206176 | _na 390_aa | comP | exodeoxyribonuclease V |
| 185 | PKHB01000001.1 | GCA002861145_00175 | CDS | open | 206211-206864 | _na 217_aa | citB | Transcriptional regulator%2C LuxR family |
| 186 | PKHB01000001.1 | GCA002861145_00176 | CDS | open | 206899-207360 | _na 153_aa | YokE-like PH domain-containing protein | |
| 187 | PKHB01000001.1 | GCA002861145_00177 | CDS | open | 207931-208143 | _na 70_aa | ABC transporter permease | |
| 188 | PKHB01000001.1 | GCA002861145_00178 | CDS | open | 208334-208594 | _na 86_aa | hypothetical protein | |
| 189 | PKHB01000001.1 | GCA002861145_00179 | CDS | open | 208772-209365 | _na 197_aa | Sortase | |
| 190 | PKHB01000001.1 | GCA002861145_00180 | CDS | open | 209719-210813 | _na 364_aa | nrdF | class 1b ribonucleoside-diphosphate reductase subunit beta |
| 191 | PKHB01000001.1 | GCA002861145_00181 | CDS | open | 210911-213136 | _na 741_aa | nrdE | class 1b ribonucleoside-diphosphate reductase subunit alpha |
| 192 | PKHB01000001.1 | GCA002861145_00182 | CDS | open | 213212-213712 | _na 166_aa | nrdI | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI |
| 193 | PKHB01000001.1 | GCA002861145_00183 | CDS | open | 213716-213976 | _na 86_aa | nrdH | Glutaredoxin-like protein NrdH |
| 194 | PKHB01000001.1 | GCA002861145_00184 | CDS | open | 214404-215858 | _na 484_aa | gndA | NADP-dependent phosphogluconate dehydrogenase |
| 195 | PKHB01000001.1 | GCA002861145_00185 | CDS | open | 215959-216783 | _na 274_aa | 6-phosphogluconolactonase | |
| 196 | PKHB01000001.1 | GCA002861145_00186 | CDS | open | 216838-217779 | _na 313_aa | opcA | OpcA protein |
| 197 | PKHB01000001.1 | GCA002861145_00187 | CDS | open | 217776-219356 | _na 526_aa | zwf | glucose-6-phosphate dehydrogenase |
| 198 | PKHB01000001.1 | GCA002861145_00188 | CDS | open | 219460-221928 | _na 822_aa | Acyltransferase | |
| 199 | PKHB01000001.1 | GCA002861145_00189 | CDS | open | 222190-222684 | _na 164_aa | ppa | Inorganic pyrophosphatase |
| 200 | PKHB01000001.1 | GCA002861145_00190 | CDS | open | 222836-223627 | _na 263_aa | Beta-carotene 15%2C15'-monooxygenase | |
| 201 | PKHB01000001.1 | GCA002861145_00191 | CDS | open | 223869-224660 | _na 263_aa | Transcriptional regulator | |
| 202 | PKHB01000001.1 | GCA002861145_00192 | CDS | open | 224660-225334 | _na 224_aa | nth | endonuclease III |
| 203 | PKHB01000001.1 | GCA002861145_00193 | CDS | open | 225378-226952 | _na 524_aa | Peptide ABC transporter substrate-binding protein | |
| 204 | PKHB01000001.1 | GCA002861145_00194 | CDS | open | 227001-229766 | _na 921_aa | valS | valine--tRNA ligase |
| 205 | PKHB01000001.1 | GCA002861145_00195 | CDS | open | 229897-231693 | _na 598_aa | argS | arginine--tRNA ligase |
| 206 | PKHB01000001.1 | GCA002861145_00196 | CDS | open | 231950-233452 | _na 500_aa | brnQ | branched-chain amino acid transport system II carrier protein |
| 207 | PKHB01000001.1 | GCA002861145_00197 | CDS | open | 233827-235107 | _na 426_aa | ABC transporter%2C solute-binding protein | |
| 208 | PKHB01000001.1 | GCA002861145_00198 | CDS | open | 235110-236075 | _na 321_aa | ABC transporter%2C permease protein | |
| 209 | PKHB01000001.1 | GCA002861145_00199 | CDS | open | 236059-236901 | _na 280_aa | ABC transporter%2C permease protein | |
| 210 | PKHB01000001.1 | GCA002861145_00200 | CDS | open | 236957-238351 | _na 464_aa | Alpha amylase%2C catalytic domain protein | |
| 211 | PKHB01000001.1 | GCA002861145_00201 | CDS | open | 238348-239412 | _na 354_aa | lacI | Transcriptional regulator%2C LacI family |
| 212 | PKHB01000001.1 | GCA002861145_00202 | CDS | open | 239440-239787 | _na 115_aa | L-dopachrome isomerase | |
| 213 | PKHB01000001.1 | GCA002861145_00203 | CDS | open | 239863-240378 | _na 171_aa | Sugar translocase | |
| 214 | PKHB01000001.1 | GCA002861145_00204 | CDS | open | 240413-241117 | _na 234_aa | Phosphoglycerate mutase family protein | |
| 215 | PKHB01000001.1 | GCA002861145_00205 | CDS | open | 241146-242102 | _na 318_aa | Hydrolase | |
| 216 | PKHB01000001.1 | GCA002861145_00206 | CDS | open | 242159-243721 | _na 520_aa | gltX | glutamate--tRNA ligase |
| 217 | PKHB01000001.1 | GCA002861145_00209 | CDS | open | 244646-245938 | _na 430_aa | Serine/threonine protein phosphatase | |
| 218 | PKHB01000001.1 | GCA002861145_00210 | CDS | open | 246030-247391 | _na 453_aa | murA | UDP-N-acetylglucosamine 1-carboxyvinyltransferase |
| 219 | PKHB01000001.1 | GCA002861145_00211 | CDS | open | 247582-249495 | _na 637_aa | non-specific serine/threonine protein kinase | |
| 220 | PKHB01000001.1 | GCA002861145_00212 | CDS | open | 249523-251865 | _na 780_aa | Ig-like domain-containing protein | |
| 221 | PKHB01000001.1 | GCA002861145_00214 | CDS | open | 252149-252835 | _na 228_aa | VTT domain-containing protein | |
| 222 | PKHB01000001.1 | GCA002861145_00215 | CDS | open | 253063-253806 | _na 247_aa | Teichoic acid transporter | |
| 223 | PKHB01000001.1 | GCA002861145_00216 | CDS | open | 253937-254206 | _na 89_aa | rpsO | 30S ribosomal protein S15 |
| 224 | PKHB01000001.1 | GCA002861145_00217 | CDS | open | 254571-257333 | _na 920_aa | polyribonucleotide nucleotidyltransferase | |
| 225 | PKHB01000001.1 | GCA002861145_00218 | CDS | open | 257581-258444 | _na 287_aa | pdxI | Oxidoreductase%2C aldo/keto reductase family protein |
| 226 | PKHB01000001.1 | GCA002861145_00219 | CDS | open | 258459-259424 | _na 321_aa | Copper oxidase | |
| 227 | PKHB01000001.1 | GCA002861145_00220 | CDS | open | 259601-261034 | _na 477_aa | Cell division initiation protein | |
| 228 | PKHB01000001.1 | GCA002861145_00221 | CDS | open | 261146-262480 | _na 444_aa | pepC | Aminopeptidase |
| 229 | PKHB01000001.1 | GCA002861145_00222 | CDS | open | 262745-263926 | _na 393_aa | 3-deoxy-7-phosphoheptulonate synthase | |
| 230 | PKHB01000001.1 | GCA002861145_00223 | CDS | open | 264040-264537 | _na 165_aa | Permease | |
| 231 | PKHB01000001.1 | GCA002861145_00224 | CDS | open | 264530-265240 | _na 236_aa | mtnN | 5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase |
| 232 | PKHB01000001.1 | GCA002861145_00225 | CDS | open | 265447-266673 | _na 408_aa | pstS | phosphate ABC transporter substrate-binding protein PstS |
| 233 | PKHB01000001.1 | GCA002861145_00226 | CDS | open | 266723-267727 | _na 334_aa | pstC | phosphate ABC transporter permease subunit PstC |
| 234 | PKHB01000001.1 | GCA002861145_00227 | CDS | open | 267728-268780 | _na 350_aa | pstA | phosphate ABC transporter permease PstA |
| 235 | PKHB01000001.1 | GCA002861145_00228 | CDS | open | 268849-269628 | _na 259_aa | pstB | phosphate ABC transporter ATP-binding protein PstB |
| 236 | PKHB01000001.1 | GCA002861145_00229 | CDS | open | 269882-271285 | _na 467_aa | Xanthine/uracil/vitamin C permease | |
| 237 | PKHB01000001.1 | GCA002861145_00230 | CDS | open | 271677-272198 | _na 173_aa | rplJ | 50S ribosomal protein L10 |
| 238 | PKHB01000001.1 | GCA002861145_00231 | CDS | open | 272296-272676 | _na 126_aa | rplL | 50S ribosomal protein L7/L12 |
| 239 | PKHB01000001.1 | GCA002861145_00232 | CDS | open | 273420-274190 | _na 256_aa | Peptidase | |
| 240 | PKHB01000001.1 | GCA002861145_00233 | CDS | open | 274667-275557 | _na 296_aa | CAAX protease | |
| 241 | PKHB01000001.1 | GCA002861145_00234 | CDS | open | 276088-277296 | _na 402_aa | Peptidase | |
| 242 | PKHB01000001.1 | GCA002861145_00235 | CDS | open | 277736-279061 | _na 441_aa | FHA domain-containing protein | |
| 243 | PKHB01000001.1 | GCA002861145_00236 | CDS | open | 279079-282837 | _na 1252_aa | Helicase | |
| 244 | PKHB01000001.1 | GCA002861145_00237 | CDS | open | 282834-283037 | _na 67_aa | DNA and RNA helicase-like protein | |
| 245 | PKHB01000001.1 | GCA002861145_00238 | CDS | open | 283159-283938 | _na 259_aa | SAF domain-containing protein | |
| 246 | PKHB01000001.1 | GCA002861145_00239 | CDS | open | 284447-285619 | _na 390_aa | Membrane associated protein | |
| 247 | PKHB01000001.1 | GCA002861145_00240 | CDS | open | 285775-286086 | _na 103_aa | groES | co-chaperone GroES |
| 248 | PKHB01000001.1 | GCA002861145_00241 | CDS | open | 286385-287482 | _na 365_aa | hisC | histidinol-phosphate transaminase |
| 249 | PKHB01000001.1 | GCA002861145_00245 | CDS | open | 288181-289446 | _na 421_aa | UDP-N-acetylmuramate dehydrogenase | |
| 250 | PKHB01000001.1 | GCA002861145_00246 | CDS | open | 289737-291368 | _na 543_aa | potE | Amino acid permease |
| 251 | PKHB01000001.1 | GCA002861145_00247 | CDS | open | 291491-291823 | _na 110_aa | fdxA | ferredoxin |
| 252 | PKHB01000001.1 | GCA002861145_00248 | CDS | open | 291859-293169 | _na 436_aa | dinB | DNA polymerase IV |
| 253 | PKHB01000001.1 | GCA002861145_00249 | CDS | open | 293279-294211 | _na 310_aa | Putative membrane protein | |
| 254 | PKHB01000001.1 | GCA002861145_00251 | CDS | open | 294705-297695 | _na 996_aa | Peptidase | |
| 255 | PKHB01000001.1 | GCA002861145_00252 | CDS | open | 297878-298171 | _na 97_aa | Transcriptional regulator | |
| 256 | PKHB01000001.1 | GCA002861145_00253 | CDS | open | 298187-298855 | _na 222_aa | yigZ | YigZ family protein |
| 257 | PKHB01000001.1 | GCA002861145_00254 | CDS | open | 298866-299492 | _na 208_aa | abrB | AbrB family transcriptional regulator |
| 258 | PKHB01000001.1 | GCA002861145_00255 | CDS | open | 299501-301675 | _na 724_aa | malQ | 4-alpha-glucanotransferase |
| 259 | PKHB01000001.1 | GCA002861145_00256 | CDS | open | 301920-302369 | _na 149_aa | rplM | 50S ribosomal protein L13 |
| 260 | PKHB01000001.1 | GCA002861145_00257 | CDS | open | 302387-302875 | _na 162_aa | rpsI | 30S ribosomal protein S9 |
| 261 | PKHB01000001.1 | GCA002861145_00258 | CDS | open | 303243-305948 | _na 901_aa | adhE | bifunctional acetaldehyde-CoA/alcohol dehydrogenase |
| 262 | PKHB01000001.1 | GCA002861145_00259 | CDS | open | 306271-306579 | _na 102_aa | rpsJ | 30S ribosomal protein S10 |
| 263 | PKHB01000001.1 | GCA002861145_00260 | CDS | open | 306596-307246 | _na 216_aa | rplC | 50S ribosomal protein L3 |
| 264 | PKHB01000001.1 | GCA002861145_00261 | CDS | open | 307252-307917 | _na 221_aa | rplD | 50S ribosomal protein L4 |
| 265 | PKHB01000001.1 | GCA002861145_00262 | CDS | open | 307923-308219 | _na 98_aa | rplW | 50S ribosomal protein L23 |
| 266 | PKHB01000001.1 | GCA002861145_00263 | CDS | open | 308254-309084 | _na 276_aa | rplB | 50S ribosomal protein L2 |
| 267 | PKHB01000001.1 | GCA002861145_00264 | CDS | open | 309100-309378 | _na 92_aa | rpsS | 30S ribosomal protein S19 |
| 268 | PKHB01000001.1 | GCA002861145_00265 | CDS | open | 309395-309754 | _na 119_aa | rplV | 50S ribosomal protein L22 |
| 269 | PKHB01000001.1 | GCA002861145_00266 | CDS | open | 309757-310575 | _na 272_aa | rpsC | 30S ribosomal protein S3 |
| 270 | PKHB01000001.1 | GCA002861145_00267 | CDS | open | 310580-310999 | _na 139_aa | rplP | 50S ribosomal protein L16 |
| 271 | PKHB01000001.1 | GCA002861145_00268 | CDS | open | 310999-311250 | _na 83_aa | rpmC | 50S ribosomal protein L29 |
| 272 | PKHB01000001.1 | GCA002861145_00269 | CDS | open | 311253-311519 | _na 88_aa | rpsQ | 30S ribosomal protein S17 |
| 273 | PKHB01000001.1 | GCA002861145_00270 | CDS | open | 311611-311979 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 274 | PKHB01000001.1 | GCA002861145_00271 | CDS | open | 311981-312316 | _na 111_aa | rplX | 50S ribosomal protein L24 |
| 275 | PKHB01000001.1 | GCA002861145_00272 | CDS | open | 312313-312885 | _na 190_aa | rplE | 50S ribosomal protein L5 |
| 276 | PKHB01000001.1 | GCA002861145_00273 | CDS | open | 312887-313072 | _na 61_aa | rpsZ | type Z 30S ribosomal protein S14 |
| 277 | PKHB01000001.1 | GCA002861145_00274 | CDS | open | 313159-313557 | _na 132_aa | rpsH | 30S ribosomal protein S8 |
| 278 | PKHB01000001.1 | GCA002861145_00275 | CDS | open | 313574-314113 | _na 179_aa | rplF | 50S ribosomal protein L6 |
| 279 | PKHB01000001.1 | GCA002861145_00276 | CDS | open | 314115-314486 | _na 123_aa | rplR | 50S ribosomal protein L18 |
| 280 | PKHB01000001.1 | GCA002861145_00277 | CDS | open | 314483-315211 | _na 242_aa | rpsE | 30S ribosomal protein S5 |
| 281 | PKHB01000001.1 | GCA002861145_00278 | CDS | open | 315211-315393 | _na 60_aa | rpmD | 50S ribosomal protein L30 |
| 282 | PKHB01000001.1 | GCA002861145_00279 | CDS | open | 315396-315851 | _na 151_aa | rplO | 50S ribosomal protein L15 |
| 283 | PKHB01000001.1 | GCA002861145_00280 | CDS | open | 316113-317390 | _na 425_aa | secY | preprotein translocase subunit SecY |
| 284 | PKHB01000001.1 | GCA002861145_00281 | CDS | open | 317419-317979 | _na 186_aa | adk | adenylate kinase |
| 285 | PKHB01000001.1 | GCA002861145_00282 | CDS | open | 318122-318340 | _na 72_aa | infA | translation initiation factor IF-1 |
| 286 | PKHB01000001.1 | GCA002861145_00283 | CDS | open | 318619-318996 | _na 125_aa | rpsM | 30S ribosomal protein S13 |
| 287 | PKHB01000001.1 | GCA002861145_00284 | CDS | open | 319080-319478 | _na 132_aa | rpsK | 30S ribosomal protein S11 |
| 288 | PKHB01000001.1 | GCA002861145_00285 | CDS | open | 319558-320553 | _na 331_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 289 | PKHB01000001.1 | GCA002861145_00286 | CDS | open | 320631-321065 | _na 144_aa | rplQ | 50S ribosomal protein L17 |
| 290 | PKHB01000001.1 | GCA002861145_00287 | CDS | open | 321195-322433 | _na 412_aa | Triacylglycerol lipase | |
| 291 | PKHB01000001.1 | GCA002861145_00288 | CDS | open | 322462-323367 | _na 301_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 292 | PKHB01000001.1 | GCA002861145_00290 | CDS | open | 323816-324817 | _na 333_aa | Lipoprotein | |
| 293 | PKHB01000001.1 | GCA002861145_00291 | CDS | open | 324990-326072 | _na 360_aa | nusA | Transcription termination/antitermination protein NusA |
| 294 | PKHB01000001.1 | GCA002861145_00292 | CDS | open | 326392-329247 | _na 951_aa | infB | translation initiation factor IF-2 |
| 295 | PKHB01000001.1 | GCA002861145_00293 | CDS | open | 329250-329792 | _na 180_aa | rbfA | 30S ribosome-binding factor RbfA |
| 296 | PKHB01000001.1 | GCA002861145_00294 | CDS | open | 329841-330944 | _na 367_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 297 | PKHB01000001.1 | GCA002861145_00295 | CDS | open | 331006-332250 | _na 414_aa | Riboflavin kinase | |
| 298 | PKHB01000001.1 | GCA002861145_00296 | CDS | open | 332310-333797 | _na 495_aa | radA | DNA repair protein RadA |
| 299 | PKHB01000001.1 | GCA002861145_00297 | CDS | open | 333929-334561 | _na 210_aa | DUF4245 domain-containing protein | |
| 300 | PKHB01000001.1 | GCA002861145_00299 | CDS | open | 334892-335590 | _na 232_aa | rpiA | ribose-5-phosphate isomerase RpiA |
| 301 | PKHB01000001.1 | GCA002861145_00300 | CDS | open | 335941-336999 | _na 352_aa | ribonuclease H | |
| 302 | PKHB01000001.1 | GCA002861145_00301 | CDS | open | 337082-338755 | _na 557_aa | pgm | phosphoglucomutase (alpha-D-glucose-1%2C6-bisphosphate-dependent) |
| 303 | PKHB01000001.1 | GCA002861145_00302 | CDS | open | 338786-339877 | _na 363_aa | DAGKc domain-containing protein | |
| 304 | PKHB01000001.1 | GCA002861145_00303 | CDS | open | 340269-342086 | _na 605_aa | L%2CD-TPase catalytic domain-containing protein | |
| 305 | PKHB01000001.1 | GCA002861145_00304 | CDS | open | 342083-343567 | _na 494_aa | Phosphatidate phosphatase APP1 catalytic domain-containing protein | |
| 306 | PKHB01000001.1 | GCA002861145_00305 | CDS | open | 343681-346161 | _na 826_aa | S9 family peptidase | |
| 307 | PKHB01000001.1 | GCA002861145_00306 | CDS | open | 346448-347158 | _na 236_aa | Cyclic nucleotide-binding domain protein | |
| 308 | PKHB01000001.1 | GCA002861145_00307 | CDS | open | 347217-349538 | _na 773_aa | peptidoglycan glycosyltransferase | |
| 309 | PKHB01000001.1 | GCA002861145_00308 | CDS | open | 349680-350834 | _na 384_aa | quinone-dependent dihydroorotate dehydrogenase | |
| 310 | PKHB01000001.1 | GCA002861145_00309 | CDS | open | 350984-351919 | _na 311_aa | glpR | Transcriptional regulator%2C DeoR family |
| 311 | PKHB01000001.1 | GCA002861145_00310 | CDS | open | 352431-353675 | _na 414_aa | Gram-positive cocci surface proteins LPxTG domain-containing protein | |
| 312 | PKHB01000001.1 | GCA002861145_00311 | CDS | open | 354156-355532 | _na 458_aa | AMP-dependent synthetase | |
| 313 | PKHB01000001.1 | GCA002861145_00312 | CDS | open | 355929-356225 | _na 98_aa | rpsF | 30S ribosomal protein S6 |
| 314 | PKHB01000001.1 | GCA002861145_00313 | CDS | open | 356380-356961 | _na 193_aa | Single-stranded DNA-binding protein | |
| 315 | PKHB01000001.1 | GCA002861145_00314 | CDS | open | 357101-357349 | _na 82_aa | rpsR | 30S ribosomal protein S18 |
| 316 | PKHB01000001.1 | GCA002861145_00315 | CDS | open | 357366-357812 | _na 148_aa | rplI | 50S ribosomal protein L9 |
| 317 | PKHB01000001.1 | GCA002861145_00316 | CDS | open | 358314-359477 | _na 387_aa | mvk | mevalonate kinase |
| 318 | PKHB01000001.1 | GCA002861145_00317 | CDS | open | 359613-360710 | _na 365_aa | mvaD | diphosphomevalonate decarboxylase |
| 319 | PKHB01000001.1 | GCA002861145_00318 | CDS | open | 360720-363083 | _na 787_aa | fni | type 2 isopentenyl-diphosphate Delta-isomerase |
| 320 | PKHB01000001.1 | GCA002861145_00319 | CDS | open | 363211-363405 | _na 64_aa | rpmB | 50S ribosomal protein L28 |
| 321 | PKHB01000001.1 | GCA002861145_00320 | CDS | open | 363545-365947 | _na 800_aa | recG | putative DNA 3'-5' helicase RecG |
| 322 | PKHB01000001.1 | GCA002861145_00321 | CDS | open | 366237-367385 | _na 382_aa | HTH domain protein | |
| 323 | PKHB01000001.1 | GCA002861145_00322 | CDS | open | 367458-368396 | _na 312_aa | Nucleoside hydrolase | |
| 324 | PKHB01000001.1 | GCA002861145_00323 | CDS | open | 368457-369890 | _na 477_aa | MFS transporter | |
| 325 | PKHB01000001.1 | GCA002861145_00324 | CDS | open | 370000-370584 | _na 194_aa | rsmD | 16S rRNA (guanine(966)-N(2))-methyltransferase RsmD |
| 326 | PKHB01000001.1 | GCA002861145_00325 | CDS | open | 370739-371626 | _na 295_aa | trmD | tRNA (guanosine(37)-N1)-methyltransferase TrmD |
| 327 | PKHB01000001.1 | GCA002861145_00326 | CDS | open | 371664-372299 | _na 211_aa | rimM | ribosome maturation factor RimM |
| 328 | PKHB01000001.1 | GCA002861145_00327 | CDS | open | 372265-372498 | _na 77_aa | ylqC | RNA-binding protein |
| 329 | PKHB01000001.1 | GCA002861145_00328 | CDS | open | 372501-372962 | _na 153_aa | rpsP | 30S ribosomal protein S16 |
| 330 | PKHB01000001.1 | GCA002861145_00329 | CDS | open | 373079-374227 | _na 382_aa | Endonuclease/exonuclease/phosphatase family protein | |
| 331 | PKHB01000001.1 | GCA002861145_00330 | CDS | open | 374224-375894 | _na 556_aa | ffh | signal recognition particle protein |
| 332 | PKHB01000001.1 | GCA002861145_00331 | CDS | open | 375970-377607 | _na 545_aa | cysS | cysteine--tRNA ligase |
| 333 | PKHB01000001.1 | GCA002861145_00332 | CDS | open | 377801-379138 | _na 445_aa | nicotinate phosphoribosyltransferase | |
| 334 | PKHB01000001.1 | GCA002861145_00333 | CDS | open | 379361-379690 | _na 109_aa | DUF3039 domain-containing protein | |
| 335 | PKHB01000001.1 | GCA002861145_00334 | CDS | open | 379818-380366 | _na 182_aa | coaD | pantetheine-phosphate adenylyltransferase |
| 336 | PKHB01000001.1 | GCA002861145_00335 | CDS | open | 380382-381419 | _na 345_aa | Cell division protein | |
| 337 | PKHB01000001.1 | GCA002861145_00336 | CDS | open | 381422-382051 | _na 209_aa | DNA-binding protein | |
| 338 | PKHB01000001.1 | GCA002861145_00337 | CDS | open | 382280-382474 | _na 64_aa | rpmF | 50S ribosomal protein L32 |
| 339 | PKHB01000001.1 | GCA002861145_00338 | CDS | open | 383030-383851 | _na 273_aa | rnc | ribonuclease III |
| 340 | PKHB01000001.1 | GCA002861145_00339 | CDS | open | 383979-386075 | _na 698_aa | abc-f | ribosomal protection-like ABC-F family protein |
| 341 | PKHB01000001.1 | GCA002861145_00340 | CDS | open | 386142-386903 | _na 253_aa | rph | ribonuclease PH |
| 342 | PKHB01000001.1 | GCA002861145_00341 | CDS | open | 386926-387612 | _na 228_aa | dITP/XTP pyrophosphatase | |
| 343 | PKHB01000001.1 | GCA002861145_00344 | CDS | open | 388086-389780 | _na 564_aa | pgi | glucose-6-phosphate isomerase |
| 344 | PKHB01000001.1 | GCA002861145_00345 | CDS | open | 390217-390363 | _na 48_aa | hypothetical protein | |
| 345 | PKHB01000001.1 | GCA002861145_00346 | CDS | open | 390624-392372 | _na 582_aa | Binding-protein-dependent transport systems inner membrane component | |
| 346 | PKHB01000001.1 | GCA002861145_00347 | CDS | open | 392432-393967 | _na 511_aa | ABC transporter ATP-binding protein | |
| 347 | PKHB01000001.1 | GCA002861145_00348 | CDS | open | 394214-394579 | _na 121_aa | rplS | 50S ribosomal protein L19 |
| 348 | PKHB01000001.1 | GCA002861145_00349 | CDS | open | 394608-395396 | _na 262_aa | lepB | signal peptidase I |
| 349 | PKHB01000001.1 | GCA002861145_00350 | CDS | open | 395462-396229 | _na 255_aa | ribonuclease HII | |
| 350 | PKHB01000001.1 | GCA002861145_00351 | CDS | open | 396242-397345 | _na 367_aa | lacI | LacI family transcriptional regulator |
| 351 | PKHB01000001.1 | GCA002861145_00352 | CDS | open | 397603-400167 | _na 854_aa | ABC transporter | |
| 352 | PKHB01000001.1 | GCA002861145_00353 | CDS | open | 400219-400929 | _na 236_aa | HNH endonuclease | |
| 353 | PKHB01000001.1 | GCA002861145_00354 | CDS | open | 400986-402581 | _na 531_aa | MFS transporter | |
| 354 | PKHB01000001.1 | GCA002861145_00355 | CDS | open | 402745-403731 | _na 328_aa | G5 domain-containing protein | |
| 355 | PKHB01000001.1 | GCA002861145_00356 | CDS | open | 403880-404221 | _na 113_aa | trxA | thioredoxin |
| 356 | PKHB01000001.1 | GCA002861145_00357 | CDS | open | 404329-405615 | _na 428_aa | serS | serine--tRNA ligase |
| 357 | PKHB01000001.1 | GCA002861145_00359 | CDS | open | 406309-407580 | _na 423_aa | hydroxymethylglutaryl-CoA synthase | |
| 358 | PKHB01000001.1 | GCA002861145_00360 | CDS | open | 407626-409008 | _na 460_aa | hydroxymethylglutaryl-CoA reductase%2C degradative | |
| 359 | PKHB01000001.1 | GCA002861145_00361 | CDS | open | 409096-410373 | _na 425_aa | acetyl-CoA C-acetyltransferase | |
| 360 | PKHB01000001.1 | GCA002861145_00362 | CDS | open | 411456-412037 | _na 193_aa | xanthine phosphoribosyltransferase | |
| 361 | PKHB01000001.1 | GCA002861145_00363 | CDS | open | 412226-415162 | _na 978_aa | pcrA | DNA helicase PcrA |
| 362 | PKHB01000001.1 | GCA002861145_00364 | CDS | open | 415305-415718 | _na 137_aa | DUF4418 domain-containing protein | |
| 363 | PKHB01000001.1 | GCA002861145_00365 | CDS | open | 415757-416968 | _na 403_aa | ABC transporter permease | |
| 364 | PKHB01000001.1 | GCA002861145_00366 | CDS | open | 416971-417753 | _na 260_aa | Macrolide ABC transporter substrate-binding protein | |
| 365 | PKHB01000001.1 | GCA002861145_00367 | CDS | open | 418190-418816 | _na 208_aa | rpsD | 30S ribosomal protein S4 |
| 366 | PKHB01000001.1 | GCA002861145_00368 | CDS | open | 419009-419683 | _na 224_aa | Phosphoglycerate mutase | |
| 367 | PKHB01000001.1 | GCA002861145_00369 | CDS | open | 419831-420277 | _na 148_aa | DUF948 domain-containing protein | |
| 368 | PKHB01000001.1 | GCA002861145_00370 | CDS | open | 420277-420522 | _na 81_aa | Secreted protein | |
| 369 | PKHB01000001.1 | GCA002861145_00371 | CDS | open | 420734-423418 | _na 894_aa | alaS | alanine--tRNA ligase |
| 370 | PKHB01000001.1 | GCA002861145_00372 | CDS | open | 423472-423936 | _na 154_aa | ruvX | Holliday junction resolvase RuvX |
| 371 | PKHB01000001.1 | GCA002861145_00373 | CDS | open | 423982-425163 | _na 393_aa | Endolytic murein transglycosylase | |
| 372 | PKHB01000001.1 | GCA002861145_00374 | CDS | open | 426138-427325 | _na 395_aa | aroC | chorismate synthase |
| 373 | PKHB01000001.1 | GCA002861145_00375 | CDS | open | 427322-429004 | _na 560_aa | bifunctional shikimate kinase/3-dehydroquinate synthase | |
| 374 | PKHB01000001.1 | GCA002861145_00376 | CDS | open | 429024-429479 | _na 151_aa | 3-dehydroquinate dehydratase | |
| 375 | PKHB01000001.1 | GCA002861145_00377 | CDS | open | 429542-431224 | _na 560_aa | CTP synthase | |
| 376 | PKHB01000001.1 | GCA002861145_00378 | CDS | open | 431575-433230 | _na 551_aa | sufB | Fe-S cluster assembly protein SufB |
| 377 | PKHB01000001.1 | GCA002861145_00379 | CDS | open | 433230-434477 | _na 415_aa | sufD | Fe-S cluster assembly protein SufD |
| 378 | PKHB01000001.1 | GCA002861145_00380 | CDS | open | 434487-435263 | _na 258_aa | sufC | Fe-S cluster assembly ATPase SufC |
| 379 | PKHB01000001.1 | GCA002861145_00381 | CDS | open | 435331-436701 | _na 456_aa | Cysteine desulfurase | |
| 380 | PKHB01000001.1 | GCA002861145_00382 | CDS | open | 436789-437472 | _na 227_aa | sufU | Fe-S cluster assembly sulfur transfer protein SufU |
| 381 | PKHB01000001.1 | GCA002861145_00383 | CDS | open | 437505-437978 | _na 157_aa | Metal-sulfur cluster biosynthetic enzyme | |
| 382 | PKHB01000001.1 | GCA002861145_00384 | CDS | open | 438050-438694 | _na 214_aa | Alpha/beta hydrolase | |
| 383 | PKHB01000001.1 | GCA002861145_00385 | CDS | open | 438917-439564 | _na 215_aa | DUF4125 domain-containing protein | |
| 384 | PKHB01000001.1 | GCA002861145_00386 | CDS | open | 439564-441555 | _na 663_aa | DUF4037 domain-containing protein | |
| 385 | PKHB01000001.1 | GCA002861145_00387 | CDS | open | 441958-443046 | _na 362_aa | tyrosine-type recombinase/integrase | |
| 386 | PKHB01000001.1 | GCA002861145_00388 | CDS | open | 443058-443789 | _na 243_aa | helix-turn-helix domain-containing protein | |
| 387 | PKHB01000001.1 | GCA002861145_00389 | CDS | open | 443980-444192 | _na 70_aa | helix-turn-helix domain-containing protein | |
| 388 | PKHB01000001.1 | GCA002861145_00390 | CDS | open | 444189-444758 | _na 189_aa | hypothetical protein | |
| 389 | PKHB01000001.1 | GCA002861145_00391 | CDS | open | 444761-446266 | _na 501_aa | AAA family ATPase | |
| 390 | PKHB01000001.1 | GCA002861145_00392 | CDS | open | 446283-446711 | _na 142_aa | hypothetical protein | |
| 391 | PKHB01000001.1 | GCA002861145_00393 | CDS | open | 446743-447477 | _na 244_aa | hypothetical protein | |
| 392 | PKHB01000001.1 | GCA002861145_00394 | CDS | open | 447623-448462 | _na 279_aa | phage major capsid protein | |
| 393 | PKHB01000001.1 | GCA002861145_00395 | CDS | open | 448671-449063 | _na 130_aa | hypothetical protein | |
| 394 | PKHB01000001.1 | GCA002861145_00397 | CDS | open | 449829-451526 | _na 565_aa | lysS | lysine--tRNA ligase |
| 395 | PKHB01000001.1 | GCA002861145_00398 | CDS | open | 451597-452337 | _na 246_aa | phosphoglyceromutase | |
| 396 | PKHB01000001.1 | GCA002861145_00399 | CDS | open | 452509-453189 | _na 226_aa | phoU | phosphate signaling complex protein PhoU |
| 397 | PKHB01000001.1 | GCA002861145_00400 | CDS | open | 453431-454735 | _na 434_aa | senX3 | Sensor-like histidine kinase SenX3 |
| 398 | PKHB01000001.1 | GCA002861145_00401 | CDS | open | 454818-455084 | _na 88_aa | DUF2530 domain-containing protein | |
| 399 | PKHB01000001.1 | GCA002861145_00402 | CDS | open | 455270-456415 | _na 381_aa | CHAP domain-containing protein | |
| 400 | PKHB01000001.1 | GCA002861145_00403 | CDS | open | 456551-457273 | _na 240_aa | NlpC/P60 domain-containing protein | |
| 401 | PKHB01000001.1 | GCA002861145_00404 | CDS | open | 457430-458455 | _na 341_aa | uspA | Universal stress family protein |
| 402 | PKHB01000001.1 | GCA002861145_00405 | CDS | open | 458730-460022 | _na 430_aa | Glycosyl transferase | |
| 403 | PKHB01000001.1 | GCA002861145_00406 | CDS | open | 460145-460564 | _na 139_aa | osmC | OsmC family protein |
| 404 | PKHB01000001.1 | GCA002861145_00407 | CDS | open | 460716-461588 | _na 290_aa | thyA | thymidylate synthase |
| 405 | PKHB01000001.1 | GCA002861145_00408 | CDS | open | 461666-462313 | _na 215_aa | dihydrofolate reductase | |
| 406 | PKHB01000001.1 | GCA002861145_00409 | CDS | open | 462360-462908 | _na 182_aa | protein-tyrosine-phosphatase | |
| 407 | PKHB01000001.1 | GCA002861145_00410 | CDS | open | 463203-464570 | _na 455_aa | Peptidase M20 dimerisation domain-containing protein | |
| 408 | PKHB01000001.1 | GCA002861145_00411 | CDS | open | 464729-465367 | _na 212_aa | DUF3043 domain-containing protein | |
| 409 | PKHB01000001.1 | GCA002861145_00412 | CDS | open | 465461-466294 | _na 277_aa | DUF4191 domain-containing protein | |
| 410 | PKHB01000001.1 | GCA002861145_00413 | CDS | open | 466515-467048 | _na 177_aa | hypothetical protein | |
| 411 | PKHB01000001.1 | GCA002861145_00414 | CDS | open | 467079-467687 | _na 202_aa | ABC transporter permease | |
| 412 | PKHB01000001.1 | GCA002861145_00415 | CDS | open | 467742-470546 | _na 934_aa | ABC transporter ATP-binding protein | |
| 413 | PKHB01000001.1 | GCA002861145_00417 | CDS | open | 471095-471370 | _na 91_aa | Txe/YoeB family addiction module toxin | |
| 414 | PKHB01000001.1 | GCA002861145_00418 | CDS | open | 471376-471651 | _na 91_aa | Addiction module antitoxin%2C RelB/DinJ family protein | |
| 415 | PKHB01000001.1 | GCA002861145_00419 | CDS | open | 472322-473254 | _na 310_aa | ORF6N domain-containing protein | |
| 416 | PKHB01000001.1 | GCA002861145_00420 | CDS | open | 474340-480474 | _na 2044_aa | Long Rib domain-containing protein | |
| 417 | PKHB01000001.1 | GCA002861145_00421 | CDS | open | 480771-482402 | _na 543_aa | SpaH/EbpB family LPXTG-anchored major pilin | |
| 418 | PKHB01000001.1 | GCA002861145_00422 | CDS | open | 482612-483772 | _na 386_aa | Class C sortase | |
| 419 | PKHB01000001.1 | GCA002861145_00423 | CDS | open | 484781-490918 | _na 2045_aa | Histidine kinase | |
| 420 | PKHB01000001.1 | GCA002861145_00424 | CDS | open | 491360-492118 | _na 252_aa | Abi-like protein | |
| 421 | PKHB01000001.1 | GCA002861145_00425 | CDS | open | 492823-498516 | _na 1897_aa | Subtilisin-like serine protease | |
| 422 | PKHB01000001.1 | GCA002861145_00426 | CDS | open | 498888-501839 | _na 983_aa | Cell surface protein | |
| 423 | PKHB01000001.1 | GCA002861145_00427 | CDS | open | 501836-503551 | _na 571_aa | SpaH/EbpB family LPXTG-anchored major pilin | |
| 424 | PKHB01000001.1 | GCA002861145_00428 | CDS | open | 503645-504742 | _na 365_aa | Class C sortase | |
| 425 | PKHB01000001.1 | GCA002861145_00430 | CDS | open | 505709-507121 | _na 470_aa | xseA | exodeoxyribonuclease VII large subunit |
| 426 | PKHB01000001.1 | GCA002861145_00431 | CDS | open | 507167-507499 | _na 110_aa | exodeoxyribonuclease VII small subunit | |
| 427 | PKHB01000001.1 | GCA002861145_00433 | CDS | open | 507808-507957 | _na 49_aa | Toxin-antitoxin system%2C antitoxin component%2C Xre domain protein | |
| 428 | PKHB01000001.1 | GCA002861145_00434 | CDS | open | 508308-511754 | _na 1148_aa | ileS | mupirocin-resistant isoleucine--tRNA ligase |
| 429 | PKHB01000001.1 | GCA002861145_00435 | CDS | open | 511890-512660 | _na 256_aa | murI | glutamate racemase |
| 430 | PKHB01000001.1 | GCA002861145_00436 | CDS | open | 512714-513364 | _na 216_aa | Vitamin K epoxide reductase domain-containing protein | |
| 431 | PKHB01000001.1 | GCA002861145_00437 | CDS | open | 513432-514397 | _na 321_aa | Phosphatase | |
| 432 | PKHB01000001.1 | GCA002861145_00438 | CDS | open | 514507-514725 | _na 72_aa | DUF3107 domain-containing protein | |
| 433 | PKHB01000001.1 | GCA002861145_00439 | CDS | open | 514789-516543 | _na 584_aa | Aminoglycoside phosphotransferase domain-containing protein | |
| 434 | PKHB01000001.1 | GCA002861145_00440 | CDS | open | 516675-518234 | _na 519_aa | DNA 3'-5' helicase | |
| 435 | PKHB01000001.1 | GCA002861145_00441 | CDS | open | 518443-520248 | _na 601_aa | Hydrolase | |
| 436 | PKHB01000001.1 | GCA002861145_00442 | CDS | open | 520509-521396 | _na 295_aa | endopeptidase La | |
| 437 | PKHB01000001.1 | GCA002861145_00444 | CDS | open | 521647-523164 | _na 505_aa | Cell division protein DivIVA | |
| 438 | PKHB01000001.1 | GCA002861145_00445 | CDS | open | 523196-523942 | _na 248_aa | recO | DNA repair protein RecO |
| 439 | PKHB01000001.1 | GCA002861145_00446 | CDS | open | 523945-524739 | _na 264_aa | uppS | isoprenyl transferase |
| 440 | PKHB01000001.1 | GCA002861145_00447 | CDS | open | 524757-525989 | _na 410_aa | abgB | Peptidase M20 dimerisation domain-containing protein |
| 441 | PKHB01000001.1 | GCA002861145_00448 | CDS | open | 526064-526429 | _na 121_aa | Thiamine-binding protein domain-containing protein | |
| 442 | PKHB01000001.1 | GCA002861145_00449 | CDS | open | 526621-528141 | _na 506_aa | gRS1 | glycine--tRNA ligase |
| 443 | PKHB01000001.1 | GCA002861145_00450 | CDS | open | 528211-529365 | _na 384_aa | dusB | tRNA dihydrouridine synthase DusB |
| 444 | PKHB01000001.1 | GCA002861145_00451 | CDS | open | 529568-530779 | _na 403_aa | ftsZ | cell division protein FtsZ |
| 445 | PKHB01000001.1 | GCA002861145_00452 | CDS | open | 530804-531262 | _na 152_aa | sepF | Cell division protein SepF |
| 446 | PKHB01000001.1 | GCA002861145_00453 | CDS | open | 531422-532240 | _na 272_aa | trmB | tRNA (guanosine(46)-N7)-methyltransferase TrmB |
| 447 | PKHB01000001.1 | GCA002861145_00455 | CDS | open | 532595-533389 | _na 264_aa | ABC transporter | |
| 448 | PKHB01000001.1 | GCA002861145_00457 | CDS | open | 533831-534733 | _na 300_aa | pfkB | Kinase%2C PfkB family |
| 449 | PKHB01000001.1 | GCA002861145_00458 | CDS | open | 535017-536612 | _na 531_aa | Xaa-Pro aminopeptidase | |
| 450 | PKHB01000001.1 | GCA002861145_00459 | CDS | open | 536891-538348 | _na 485_aa | folC | tetrahydrofolate synthase |
| 451 | PKHB01000001.1 | GCA002861145_00460 | CDS | open | 538367-539095 | _na 242_aa | Amino acid racemase | |
| 452 | PKHB01000001.1 | GCA002861145_00461 | CDS | open | 539131-540372 | _na 413_aa | ATP-grasp domain-containing protein | |
| 453 | PKHB01000001.1 | GCA002861145_00462 | CDS | open | 540496-542286 | _na 596_aa | UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2%2C6-diaminopimelate ligase | |
| 454 | PKHB01000001.1 | GCA002861145_00463 | CDS | open | 542318-543097 | _na 259_aa | DNA polymerase III subunit epsilon | |
| 455 | PKHB01000001.1 | GCA002861145_00464 | CDS | open | 543247-543924 | _na 225_aa | RNA polymerase subunit sigma | |
| 456 | PKHB01000001.1 | GCA002861145_00465 | CDS | open | 544205-544705 | _na 166_aa | ybaK | Cys-tRNA(Pro) deacylase |
| 457 | PKHB01000001.1 | GCA002861145_00466 | CDS | open | 544882-545937 | _na 351_aa | gap | type I glyceraldehyde-3-phosphate dehydrogenase |
| 458 | PKHB01000001.1 | GCA002861145_00467 | CDS | open | 546310-547185 | _na 291_aa | thiamine diphosphokinase | |
| 459 | PKHB01000001.1 | GCA002861145_00468 | CDS | open | 547407-549293 | _na 628_aa | asnB | asparagine synthase (glutamine-hydrolyzing) |
| 460 | PKHB01000001.1 | GCA002861145_00469 | CDS | open | 549551-550285 | _na 244_aa | infC | translation initiation factor IF-3 |
| 461 | PKHB01000001.1 | GCA002861145_00470 | CDS | open | 550266-550460 | _na 64_aa | rpmI | 50S ribosomal protein L35 |
| 462 | PKHB01000001.1 | GCA002861145_00471 | CDS | open | 550528-550911 | _na 127_aa | rplT | 50S ribosomal protein L20 |
| 463 | PKHB01000001.1 | GCA002861145_00472 | CDS | open | 551006-551965 | _na 319_aa | xerD | site-specific tyrosine recombinase XerD |
| 464 | PKHB01000001.1 | GCA002861145_00473 | CDS | open | 552014-552853 | _na 279_aa | parA | AAA domain-containing protein |
| 465 | PKHB01000001.1 | GCA002861145_00474 | CDS | open | 553045-554970 | _na 641_aa | typA | translational GTPase TypA |
| 466 | PKHB01000001.1 | GCA002861145_00475 | CDS | open | 555013-555420 | _na 135_aa | Alcohol dehydrogenase | |
| 467 | PKHB01000001.1 | GCA002861145_00476 | CDS | open | 555557-556555 | _na 332_aa | prephenate dehydratase | |
| 468 | PKHB01000001.1 | GCA002861145_00477 | CDS | open | 556549-557634 | _na 361_aa | Prephenate dehydrogenase | |
| 469 | PKHB01000001.1 | GCA002861145_00478 | CDS | open | 557956-558249 | _na 97_aa | DUF6725 domain-containing protein | |
| 470 | PKHB01000001.1 | GCA002861145_00479 | CDS | open | 558335-559303 | _na 322_aa | xerC | Tyrosine recombinase XerC |
| 471 | PKHB01000001.1 | GCA002861145_00480 | CDS | open | 559689-561317 | _na 542_aa | ABC transporter substrate-binding protein | |
| 472 | PKHB01000001.1 | GCA002861145_00481 | CDS | open | 561519-562445 | _na 308_aa | dppB | Putative oligopeptide transport system permease protein OppB |
| 473 | PKHB01000001.1 | GCA002861145_00482 | CDS | open | 562458-563450 | _na 330_aa | dppC | Putative oligopeptide ABC transporter%2C permease protein OppC |
| 474 | PKHB01000001.1 | GCA002861145_00483 | CDS | open | 563475-565499 | _na 674_aa | nikD | nickel import ATP-binding protein NikD |
| 475 | PKHB01000001.1 | GCA002861145_00484 | CDS | open | 565679-566545 | _na 288_aa | exodeoxyribonuclease III | |
| 476 | PKHB01000001.1 | GCA002861145_00485 | CDS | open | 566725-567489 | _na 254_aa | DUF3710 domain-containing protein | |
| 477 | PKHB01000001.1 | GCA002861145_00486 | CDS | open | 567514-568335 | _na 273_aa | Zinc ABC transporter permease | |
| 478 | PKHB01000001.1 | GCA002861145_00487 | CDS | open | 568373-569788 | _na 471_aa | trmA | TRAM domain-containing protein |
| 479 | PKHB01000001.1 | GCA002861145_00488 | CDS | open | 570063-570656 | _na 197_aa | DUF4097 domain-containing protein | |
| 480 | PKHB01000001.1 | GCA002861145_00489 | CDS | open | 570748-571032 | _na 94_aa | hypothetical protein | |
| 481 | PKHB01000001.1 | GCA002861145_00490 | CDS | open | 571140-572618 | _na 492_aa | lsa | Lsa family ABC-F type ribosomal protection protein |
| 482 | PKHB01000001.1 | GCA002861145_00491 | CDS | open | 573154-573333 | _na 59_aa | Sodium:proton antiporter | |
| 483 | PKHB01000001.1 | GCA002861145_00492 | CDS | open | 573944-574555 | _na 203_aa | cadD | Cadmium resistance protein CadD |
| 484 | PKHB01000001.1 | GCA002861145_00493 | CDS | open | 574961-575446 | _na 161_aa | yjhB | NUDIX hydrolase |
| 485 | PKHB01000001.1 | GCA002861145_00494 | CDS | open | 575784-576230 | _na 148_aa | Adhesin domain-containing protein | |
| 486 | PKHB01000001.1 | GCA002861145_00495 | CDS | open | 576321-576698 | _na 125_aa | Death-on-curing family protein | |
| 487 | PKHB01000001.1 | GCA002861145_00496 | CDS | open | 576695-576943 | _na 82_aa | Toxin-antitoxin system%2C antitoxin component%2C PHD family | |
| 488 | PKHB01000001.1 | GCA002861145_00497 | CDS | open | 577320-578513 | _na 397_aa | hypothetical protein | |
| 489 | PKHB01000001.1 | GCA002861145_00498 | CDS | open | 578671-578976 | _na 101_aa | Addiction module antitoxin%2C RelB/DinJ family protein | |
| 490 | PKHB01000001.1 | GCA002861145_00499 | CDS | open | 578973-579293 | _na 106_aa | Addiction module toxin%2C RelE/StbE family protein | |
| 491 | PKHB01000001.1 | GCA002861145_00500 | CDS | open | 579631-580137 | _na 168_aa | GNAT family acetyltransferase | |
| 492 | PKHB01000001.1 | GCA002861145_00501 | CDS | open | 580254-580571 | _na 105_aa | Addiction module toxin%2C RelE/StbE family | |
| 493 | PKHB01000001.1 | GCA002861145_00502 | CDS | open | 580552-580824 | _na 90_aa | Antitoxin | |
| 494 | PKHB01000001.1 | GCA002861145_00503 | CDS | open | 581305-581946 | _na 213_aa | DUF5067 domain-containing protein | |
| 495 | PKHB01000001.1 | GCA002861145_00504 | CDS | open | 582047-584938 | _na 963_aa | mdlB | ABC transmembrane type-1 domain-containing protein |
| 496 | PKHB01000001.1 | GCA002861145_00505 | CDS | open | 585089-585385 | _na 98_aa | relB | Type II toxin-antitoxin system antitoxin%2C RelB/DinJ family |
| 497 | PKHB01000001.1 | GCA002861145_00506 | CDS | open | 585782-586426 | _na 214_aa | HTH cro/C1-type domain-containing protein | |
| 498 | PKHB01000001.1 | GCA002861145_00507 | CDS | open | 586513-586632 | _na 39_aa | hypothetical protein | |
| 499 | PKHB01000001.1 | GCA002861145_00508 | CDS | open | 586629-587135 | _na 168_aa | N-acetyltransferase domain-containing protein | |
| 500 | PKHB01000001.1 | GCA002861145_00509 | CDS | open | 587251-587745 | _na 164_aa | Sugar translocase |

