BAKTAGenome Explorer: Neisseria mucosa (GCA_007667125.1)
Select a Genome:
|
BAKTA Annotations for GCA_007667125.1
|
Search & Sort all 4483 Records
| ||||||||||||||||||
Notes: 1- Column headers only sort the current page. 2- Select [NA] or [AA] links to show sequences.
| Region | Protein-ID | Type | Genome Viewer |
Range (bp) |
Show Sequences (length) NA / AA |
BAKTA Gene |
BAKTA GeneProduct |
|
|---|---|---|---|---|---|---|---|---|
| 1 | VDQM01000001.1 | GCA007667125_00550 | gene | open | 79055-79113 | porB | ||
| 2 | VDQM01000001.1 | GCA007667125_00550 | ncRNA | open | 79055-79113 | porB | porB RNA | |
| 3 | VDQM01000001.1 | regulatory_region | open | 4846-4955 | TPP riboswitch aptamer (THI element) | |||
| 4 | VDQM01000001.1 | GCA007667125_00466 | CDS | open | 572-1591 | _na 339_aa | qor | Zinc-type alcohol dehydrogenase-like protein |
| 5 | VDQM01000001.1 | GCA007667125_00467 | CDS | open | 1708-2325 | _na 205_aa | thiE | Thiamine-phosphate synthase |
| 6 | VDQM01000001.1 | GCA007667125_00468 | CDS | open | 2342-2989 | _na 215_aa | NERD domain-containing protein | |
| 7 | VDQM01000001.1 | GCA007667125_00469 | CDS | open | 3134-3592 | _na 152_aa | sTE14 | Isoprenylcysteine carboxylmethyltransferase family protein |
| 8 | VDQM01000001.1 | GCA007667125_00470 | CDS | open | 3644-4738 | _na 364_aa | dadA | D-amino-acid oxidase |
| 9 | VDQM01000001.1 | GCA007667125_00471 | CDS | open | 5257-5634 | _na 125_aa | rplQ | 50S ribosomal protein L17 |
| 10 | VDQM01000001.1 | GCA007667125_00472 | CDS | open | 5659-6645 | _na 328_aa | rpoA | DNA-directed RNA polymerase subunit alpha |
| 11 | VDQM01000001.1 | GCA007667125_00473 | CDS | open | 6671-7291 | _na 206_aa | rpsD | 30S ribosomal protein S4 |
| 12 | VDQM01000001.1 | GCA007667125_00474 | CDS | open | 7307-7702 | _na 131_aa | rpsK | 30S ribosomal protein S11 |
| 13 | VDQM01000001.1 | GCA007667125_00475 | CDS | open | 7722-8084 | _na 120_aa | rpsM | 30S ribosomal protein S13 |
| 14 | VDQM01000001.1 | GCA007667125_00476 | CDS | open | 8506-9624 | _na 372_aa | secY | preprotein translocase subunit SecY |
| 15 | VDQM01000001.1 | GCA007667125_00477 | CDS | open | 9824-10258 | _na 144_aa | rplO | 50S ribosomal protein L15 |
| 16 | VDQM01000001.1 | GCA007667125_00478 | CDS | open | 10260-10445 | _na 61_aa | rpmD | 50S ribosomal protein L30 |
| 17 | VDQM01000001.1 | GCA007667125_00479 | CDS | open | 10438-10956 | _na 172_aa | rpsE | 30S ribosomal protein S5 |
| 18 | VDQM01000001.1 | GCA007667125_00480 | CDS | open | 10974-11327 | _na 117_aa | rplR | 50S ribosomal protein L18 |
| 19 | VDQM01000001.1 | GCA007667125_00481 | CDS | open | 11341-11874 | _na 177_aa | rplF | 50S ribosomal protein L6 |
| 20 | VDQM01000001.1 | GCA007667125_00482 | CDS | open | 11888-12280 | _na 130_aa | rpsH | 30S ribosomal protein S8 |
| 21 | VDQM01000001.1 | GCA007667125_00483 | CDS | open | 12295-12600 | _na 101_aa | rpsN | 30S ribosomal protein S14 |
| 22 | VDQM01000001.1 | GCA007667125_00484 | CDS | open | 12603-13142 | _na 179_aa | rplE | 50S ribosomal protein L5 |
| 23 | VDQM01000001.1 | GCA007667125_00485 | CDS | open | 13152-13475 | _na 107_aa | rplX | 50S ribosomal protein L24 |
| 24 | VDQM01000001.1 | GCA007667125_00486 | CDS | open | 13487-13855 | _na 122_aa | rplN | 50S ribosomal protein L14 |
| 25 | VDQM01000001.1 | GCA007667125_00487 | CDS | open | 14081-14344 | _na 87_aa | rpsQ | 30S ribosomal protein S17 |
| 26 | VDQM01000001.1 | GCA007667125_00488 | CDS | open | 14344-14535 | _na 63_aa | rpmC | 50S ribosomal protein L29 |
| 27 | VDQM01000001.1 | GCA007667125_00489 | CDS | open | 14538-14996 | _na 152_aa | hypothetical protein | |
| 28 | VDQM01000001.1 | GCA007667125_00490 | CDS | open | 14935-15630 | _na 231_aa | rpsC | 30S ribosomal protein S3 |
| 29 | VDQM01000001.1 | GCA007667125_00491 | CDS | open | 15640-15969 | _na 109_aa | rplV | 50S ribosomal protein L22 |
| 30 | VDQM01000001.1 | GCA007667125_00492 | CDS | open | 15978-16256 | _na 92_aa | rpsS | 30S ribosomal protein S19 |
| 31 | VDQM01000001.1 | GCA007667125_00493 | CDS | open | 16262-17095 | _na 277_aa | rplB | 50S ribosomal protein L2 |
| 32 | VDQM01000001.1 | GCA007667125_00494 | CDS | open | 17101-17415 | _na 104_aa | rplW | 50S ribosomal protein L23 |
| 33 | VDQM01000001.1 | GCA007667125_00495 | CDS | open | 17412-18032 | _na 206_aa | rplD | 50S ribosomal protein L4 |
| 34 | VDQM01000001.1 | GCA007667125_00496 | CDS | open | 18032-18676 | _na 214_aa | rplC | 50S ribosomal protein L3 |
| 35 | VDQM01000001.1 | GCA007667125_00497 | CDS | open | 18978-20261 | _na 427_aa | AmpG-related permease | |
| 36 | VDQM01000001.1 | GCA007667125_00498 | CDS | open | 20409-21623 | _na 404_aa | araJ | Transporter%2C major facilitator family protein |
| 37 | VDQM01000001.1 | GCA007667125_00499 | CDS | open | 21940-22155 | _na 71_aa | Phage associated membrane protein | |
| 38 | VDQM01000001.1 | GCA007667125_00500 | CDS | open | 22351-25374 | _na 1007_aa | cafA | Ribonuclease E |
| 39 | VDQM01000001.1 | GCA007667125_00501 | CDS | open | 25940-26938 | _na 332_aa | Pseudouridine synthase | |
| 40 | VDQM01000001.1 | GCA007667125_00502 | CDS | open | 27240-27863 | _na 207_aa | rsmG | 16S rRNA (guanine(527)-N(7))-methyltransferase RsmG |
| 41 | VDQM01000001.1 | GCA007667125_00503 | CDS | open | 28002-29426 | _na 474_aa | alsT | Amino acid carrier protein |
| 42 | VDQM01000001.1 | GCA007667125_00504 | CDS | open | 29758-29961 | _na 67_aa | Phage associated protein | |
| 43 | VDQM01000001.1 | GCA007667125_00505 | CDS | open | 29995-30654 | _na 219_aa | nlpC | NlpC/P60 family protein |
| 44 | VDQM01000001.1 | GCA007667125_00506 | CDS | open | 30825-32468 | _na 547_aa | aarF | ABC1 family protein |
| 45 | VDQM01000001.1 | GCA007667125_00507 | CDS | open | 32628-33533 | _na 301_aa | hslO | Hsp33 family molecular chaperone HslO |
| 46 | VDQM01000001.1 | GCA007667125_00508 | CDS | open | 33749-34579 | _na 276_aa | DUF6602 domain-containing protein | |
| 47 | VDQM01000001.1 | GCA007667125_00509 | CDS | open | 34782-35231 | _na 149_aa | mscL | large conductance mechanosensitive channel protein MscL |
| 48 | VDQM01000001.1 | GCA007667125_00510 | CDS | open | 35514-36302 | _na 262_aa | fabI | enoyl-ACP reductase FabI |
| 49 | VDQM01000001.1 | GCA007667125_00511 | CDS | open | 36509-37057 | _na 182_aa | orn | oligoribonuclease |
| 50 | VDQM01000001.1 | GCA007667125_00512 | CDS | open | 37332-38714 | _na 460_aa | tPR | Sel1 repeat family protein |
| 51 | VDQM01000001.1 | GCA007667125_00513 | CDS | open | 38805-39764 | _na 319_aa | yfeH | Sodium transporter |
| 52 | VDQM01000001.1 | GCA007667125_00514 | CDS | open | 39965-40555 | _na 196_aa | rnhB | ribonuclease HII |
| 53 | VDQM01000001.1 | GCA007667125_00515 | CDS | open | 41206-42354 | _na 382_aa | lpxB | lipid-A-disaccharide synthase |
| 54 | VDQM01000001.1 | GCA007667125_00516 | CDS | open | 42415-43215 | _na 266_aa | ABC transporter | |
| 55 | VDQM01000001.1 | GCA007667125_00517 | CDS | open | 43212-43490 | _na 92_aa | mlaB | STAS domain-containing protein |
| 56 | VDQM01000001.1 | GCA007667125_00518 | CDS | open | 43589-44179 | _na 196_aa | mlaC | Periplasmic transport protein |
| 57 | VDQM01000001.1 | GCA007667125_00519 | CDS | open | 44216-44713 | _na 165_aa | mlaD | outer membrane lipid asymmetry maintenance protein MlaD |
| 58 | VDQM01000001.1 | GCA007667125_00520 | CDS | open | 44764-45540 | _na 258_aa | mlaE | lipid asymmetry maintenance ABC transporter permease subunit MlaE |
| 59 | VDQM01000001.1 | GCA007667125_00521 | CDS | open | 45677-46477 | _na 266_aa | mlaF | Phospholipid import ATP-binding protein MlaF |
| 60 | VDQM01000001.1 | GCA007667125_00522 | CDS | open | 46890-47345 | _na 151_aa | Tat pathway signal protein | |
| 61 | VDQM01000001.1 | GCA007667125_00523 | CDS | open | 47635-48828 | _na 397_aa | ftsZ | cell division protein FtsZ |
| 62 | VDQM01000001.1 | GCA007667125_00524 | CDS | open | 49057-50301 | _na 414_aa | ftsA | cell division protein FtsA |
| 63 | VDQM01000001.1 | GCA007667125_00525 | CDS | open | 50382-51107 | _na 241_aa | ftsQ | Cell division protein FtsQ |
| 64 | VDQM01000001.1 | GCA007667125_00526 | CDS | open | 51097-52011 | _na 304_aa | ddl | D-alanine--D-alanine ligase |
| 65 | VDQM01000001.1 | GCA007667125_00527 | CDS | open | 52162-53571 | _na 469_aa | murC | UDP-N-acetylmuramate--L-alanine ligase |
| 66 | VDQM01000001.1 | GCA007667125_00528 | CDS | open | 53837-54664 | _na 275_aa | yktD | Tetracenomycin polyketide synthesis O-methyltransferase TcmP |
| 67 | VDQM01000001.1 | GCA007667125_00529 | CDS | open | 54799-55866 | _na 355_aa | murG | undecaprenyldiphospho-muramoylpentapeptide beta-N-acetylglucosaminyltransferase |
| 68 | VDQM01000001.1 | GCA007667125_00530 | CDS | open | 55870-57027 | _na 385_aa | ftsW | putative lipid II flippase FtsW |
| 69 | VDQM01000001.1 | GCA007667125_00531 | CDS | open | 57305-58801 | _na 498_aa | gatA | Aspartyl/glutamyl-tRNA amidotransferase subunit A |
| 70 | VDQM01000001.1 | GCA007667125_00532 | CDS | open | 59045-60382 | _na 445_aa | murD | UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase |
| 71 | VDQM01000001.1 | GCA007667125_00533 | CDS | open | 60422-61234 | _na 270_aa | SEL1-like repeat protein | |
| 72 | VDQM01000001.1 | GCA007667125_00534 | CDS | open | 61507-61995 | _na 162_aa | yjbI | Cysteine desulfurase / selenocysteine lyase |
| 73 | VDQM01000001.1 | GCA007667125_00535 | CDS | open | 62208-62552 | _na 114_aa | lrgA | Murein hydrolase regulator LrgA |
| 74 | VDQM01000001.1 | GCA007667125_00536 | CDS | open | 62552-63253 | _na 233_aa | lrgB | Murein hydrolase transporter LrgB |
| 75 | VDQM01000001.1 | GCA007667125_00537 | CDS | open | 63335-64555 | _na 406_aa | argJ | bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ |
| 76 | VDQM01000001.1 | GCA007667125_00538 | CDS | open | 65257-66096 | _na 279_aa | udg4 | Uracil-DNA glycosylase%2C family 4 |
| 77 | VDQM01000001.1 | GCA007667125_00539 | CDS | open | 66090-66533 | _na 147_aa | rimI | ribosomal protein S18-alanine N-acetyltransferase |
| 78 | VDQM01000001.1 | GCA007667125_00540 | CDS | open | 66530-67207 | _na 225_aa | tsaB | tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB |
| 79 | VDQM01000001.1 | GCA007667125_00541 | CDS | open | 67399-68304 | _na 301_aa | gluQRS | tRNA glutamyl-Q(34) synthetase GluQRS |
| 80 | VDQM01000001.1 | GCA007667125_00542 | CDS | open | 68490-69218 | _na 242_aa | lytT | Response regulator receiver domain protein |
| 81 | VDQM01000001.1 | GCA007667125_00543 | CDS | open | 69757-70821 | _na 354_aa | fba | class II fructose-bisphosphate aldolase |
| 82 | VDQM01000001.1 | GCA007667125_00544 | CDS | open | 71033-71461 | _na 142_aa | fadM | Esterase |
| 83 | VDQM01000001.1 | GCA007667125_00545 | CDS | open | 71464-72363 | _na 299_aa | xerC | tyrosine recombinase XerC |
| 84 | VDQM01000001.1 | GCA007667125_00546 | CDS | open | 72389-73789 | _na 466_aa | sdaA | L-serine ammonia-lyase |
| 85 | VDQM01000001.1 | GCA007667125_00547 | CDS | open | 74008-76398 | _na 796_aa | gyrB | DNA topoisomerase (ATP-hydrolyzing) subunit B |
| 86 | VDQM01000001.1 | GCA007667125_00548 | CDS | open | 76807-77250 | _na 147_aa | rpiB | Sugar-phosphate isomerase%2C RpiB/LacA/LacB family |
| 87 | VDQM01000001.1 | GCA007667125_00549 | CDS | open | 77915-79000 | _na 361_aa | porB | trimeric porin PorB |
| 88 | VDQM01000001.1 | GCA007667125_00551 | CDS | open | 79699-80511 | _na 270_aa | truA | tRNA pseudouridine(38-40) synthase TruA |
| 89 | VDQM01000001.1 | GCA007667125_00552 | CDS | open | 80643-83108 | _na 821_aa | fimV | LysM domain-containing protein |
| 90 | VDQM01000001.1 | GCA007667125_00553 | CDS | open | 83453-83983 | _na 176_aa | yciB | septation protein A |
| 91 | VDQM01000001.1 | GCA007667125_00554 | CDS | open | 83987-84277 | _na 96_aa | yciI | YciI family protein |
| 92 | VDQM01000001.1 | GCA007667125_00555 | CDS | open | 84277-84546 | _na 89_aa | bolA | BolA-like protein |
| 93 | VDQM01000001.1 | GCA007667125_00556 | CDS | open | 84581-85453 | _na 290_aa | peptidylprolyl isomerase | |
| 94 | VDQM01000001.1 | GCA007667125_00557 | CDS | open | 85647-86108 | _na 153_aa | dtd | D-aminoacyl-tRNA deacylase |
| 95 | VDQM01000001.1 | GCA007667125_00558 | CDS | open | 86435-87160 | _na 241_aa | aat | leucyl/phenylalanyl-tRNA--protein transferase |
| 96 | VDQM01000001.1 | GCA007667125_00559 | CDS | open | 87387-87821 | _na 144_aa | fur | ferric iron uptake transcriptional regulator |
| 97 | VDQM01000001.1 | GCA007667125_00560 | CDS | open | 88032-88415 | _na 127_aa | bamE | Outer membrane protein assembly factor BamE |
| 98 | VDQM01000001.1 | GCA007667125_00561 | CDS | open | 88431-89240 | _na 269_aa | dapB | 4-hydroxy-tetrahydrodipicolinate reductase |
| 99 | VDQM01000001.1 | GCA007667125_00562 | CDS | open | 89344-90264 | _na 306_aa | lysR | Hydrogen peroxide-inducible genes activator |
| 100 | VDQM01000001.1 | GCA007667125_00563 | CDS | open | 90268-90543 | _na 91_aa | minE | cell division topological specificity factor MinE |
| 101 | VDQM01000001.1 | GCA007667125_00564 | CDS | open | 90547-91362 | _na 271_aa | minD | septum site-determining protein MinD |
| 102 | VDQM01000001.1 | GCA007667125_00565 | CDS | open | 91390-92094 | _na 234_aa | minC | septum site-determining protein MinC |
| 103 | VDQM01000001.1 | GCA007667125_00566 | CDS | open | 92317-93828 | _na 503_aa | lysS | lysine--tRNA ligase |
| 104 | VDQM01000001.1 | GCA007667125_00567 | CDS | open | 94007-95449 | _na 480_aa | aldA | aldehyde dehydrogenase |
| 105 | VDQM01000001.1 | GCA007667125_00569 | CDS | open | 95853-96284 | _na 143_aa | Ag473 family lipoprotein | |
| 106 | VDQM01000001.1 | GCA007667125_00570 | CDS | open | 96410-97192 | _na 260_aa | trpC | indole-3-glycerol phosphate synthase TrpC |
| 107 | VDQM01000001.1 | GCA007667125_00571 | CDS | open | 97468-100383 | _na 971_aa | valine--tRNA ligase | |
| 108 | VDQM01000001.1 | GCA007667125_00572 | CDS | open | 100519-100812 | _na 97_aa | yiaG | RsaL-like HTH domain-containing protein |
| 109 | VDQM01000001.1 | GCA007667125_00573 | CDS | open | 101216-101710 | _na 164_aa | Integral membrane protein | |
| 110 | VDQM01000001.1 | GCA007667125_00574 | CDS | open | 101779-102588 | _na 269_aa | zupT | zinc transporter ZupT |
| 111 | VDQM01000001.1 | GCA007667125_00575 | CDS | open | 102849-103379 | _na 176_aa | ydeN | Serine hydrolase |
| 112 | VDQM01000001.1 | GCA007667125_00576 | CDS | open | 103390-103734 | _na 114_aa | Integral membrane protein | |
| 113 | VDQM01000001.1 | GCA007667125_00577 | CDS | open | 103721-104500 | _na 259_aa | xthA | exodeoxyribonuclease III |
| 114 | VDQM01000001.1 | GCA007667125_00578 | CDS | open | 104596-104967 | _na 123_aa | yeaO | MarR family transcriptional regulator |
| 115 | VDQM01000001.1 | GCA007667125_00579 | CDS | open | 105030-105917 | _na 295_aa | rsmI | 16S rRNA (cytidine(1402)-2'-O)-methyltransferase |
| 116 | VDQM01000001.1 | GCA007667125_00580 | CDS | open | 105973-106320 | _na 115_aa | yraN | YraN family protein |
| 117 | VDQM01000001.1 | GCA007667125_00581 | CDS | open | 106325-106918 | _na 197_aa | gmhA | phosphoheptose isomerase |
| 118 | VDQM01000001.1 | GCA007667125_00582 | CDS | open | 106991-107602 | _na 203_aa | osmY | Phospholipid-binding domain protein |
| 119 | VDQM01000001.1 | GCA007667125_00583 | CDS | open | 107672-108283 | _na 203_aa | ftsN | Cell division protein FtsN |
| 120 | VDQM01000001.1 | GCA007667125_00584 | CDS | open | 108393-109172 | _na 259_aa | map | type I methionyl aminopeptidase |
| 121 | VDQM01000001.1 | GCA007667125_00466 | gene | open | 572-1591 | qor | ||
| 122 | VDQM01000001.1 | GCA007667125_00467 | gene | open | 1708-2325 | thiE | ||
| 123 | VDQM01000001.1 | GCA007667125_00468 | gene | open | 2342-2989 | |||
| 124 | VDQM01000001.1 | GCA007667125_00469 | gene | open | 3134-3592 | sTE14 | ||
| 125 | VDQM01000001.1 | GCA007667125_00470 | gene | open | 3644-4738 | dadA | ||
| 126 | VDQM01000001.1 | GCA007667125_00471 | gene | open | 5257-5634 | rplQ | ||
| 127 | VDQM01000001.1 | GCA007667125_00472 | gene | open | 5659-6645 | rpoA | ||
| 128 | VDQM01000001.1 | GCA007667125_00473 | gene | open | 6671-7291 | rpsD | ||
| 129 | VDQM01000001.1 | GCA007667125_00474 | gene | open | 7307-7702 | rpsK | ||
| 130 | VDQM01000001.1 | GCA007667125_00475 | gene | open | 7722-8084 | rpsM | ||
| 131 | VDQM01000001.1 | GCA007667125_00476 | gene | open | 8506-9624 | secY | ||
| 132 | VDQM01000001.1 | GCA007667125_00477 | gene | open | 9824-10258 | rplO | ||
| 133 | VDQM01000001.1 | GCA007667125_00478 | gene | open | 10260-10445 | rpmD | ||
| 134 | VDQM01000001.1 | GCA007667125_00479 | gene | open | 10438-10956 | rpsE | ||
| 135 | VDQM01000001.1 | GCA007667125_00480 | gene | open | 10974-11327 | rplR | ||
| 136 | VDQM01000001.1 | GCA007667125_00481 | gene | open | 11341-11874 | rplF | ||
| 137 | VDQM01000001.1 | GCA007667125_00482 | gene | open | 11888-12280 | rpsH | ||
| 138 | VDQM01000001.1 | GCA007667125_00483 | gene | open | 12295-12600 | rpsN | ||
| 139 | VDQM01000001.1 | GCA007667125_00484 | gene | open | 12603-13142 | rplE | ||
| 140 | VDQM01000001.1 | GCA007667125_00485 | gene | open | 13152-13475 | rplX | ||
| 141 | VDQM01000001.1 | GCA007667125_00486 | gene | open | 13487-13855 | rplN | ||
| 142 | VDQM01000001.1 | GCA007667125_00487 | gene | open | 14081-14344 | rpsQ | ||
| 143 | VDQM01000001.1 | GCA007667125_00488 | gene | open | 14344-14535 | rpmC | ||
| 144 | VDQM01000001.1 | GCA007667125_00489 | gene | open | 14538-14996 | |||
| 145 | VDQM01000001.1 | GCA007667125_00490 | gene | open | 14935-15630 | rpsC | ||
| 146 | VDQM01000001.1 | GCA007667125_00491 | gene | open | 15640-15969 | rplV | ||
| 147 | VDQM01000001.1 | GCA007667125_00492 | gene | open | 15978-16256 | rpsS | ||
| 148 | VDQM01000001.1 | GCA007667125_00493 | gene | open | 16262-17095 | rplB | ||
| 149 | VDQM01000001.1 | GCA007667125_00494 | gene | open | 17101-17415 | rplW | ||
| 150 | VDQM01000001.1 | GCA007667125_00495 | gene | open | 17412-18032 | rplD | ||
| 151 | VDQM01000001.1 | GCA007667125_00496 | gene | open | 18032-18676 | rplC | ||
| 152 | VDQM01000001.1 | GCA007667125_00497 | gene | open | 18978-20261 | |||
| 153 | VDQM01000001.1 | GCA007667125_00498 | gene | open | 20409-21623 | araJ | ||
| 154 | VDQM01000001.1 | GCA007667125_00499 | gene | open | 21940-22155 | |||
| 155 | VDQM01000001.1 | GCA007667125_00500 | gene | open | 22351-25374 | cafA | ||
| 156 | VDQM01000001.1 | GCA007667125_00501 | gene | open | 25940-26938 | |||
| 157 | VDQM01000001.1 | GCA007667125_00502 | gene | open | 27240-27863 | rsmG | ||
| 158 | VDQM01000001.1 | GCA007667125_00503 | gene | open | 28002-29426 | alsT | ||
| 159 | VDQM01000001.1 | GCA007667125_00504 | gene | open | 29758-29961 | |||
| 160 | VDQM01000001.1 | GCA007667125_00505 | gene | open | 29995-30654 | nlpC | ||
| 161 | VDQM01000001.1 | GCA007667125_00506 | gene | open | 30825-32468 | aarF | ||
| 162 | VDQM01000001.1 | GCA007667125_00507 | gene | open | 32628-33533 | hslO | ||
| 163 | VDQM01000001.1 | GCA007667125_00508 | gene | open | 33749-34579 | |||
| 164 | VDQM01000001.1 | GCA007667125_00509 | gene | open | 34782-35231 | mscL | ||
| 165 | VDQM01000001.1 | GCA007667125_00510 | gene | open | 35514-36302 | fabI | ||
| 166 | VDQM01000001.1 | GCA007667125_00511 | gene | open | 36509-37057 | orn | ||
| 167 | VDQM01000001.1 | GCA007667125_00512 | gene | open | 37332-38714 | tPR | ||
| 168 | VDQM01000001.1 | GCA007667125_00513 | gene | open | 38805-39764 | yfeH | ||
| 169 | VDQM01000001.1 | GCA007667125_00514 | gene | open | 39965-40555 | rnhB | ||
| 170 | VDQM01000001.1 | GCA007667125_00515 | gene | open | 41206-42354 | lpxB | ||
| 171 | VDQM01000001.1 | GCA007667125_00516 | gene | open | 42415-43215 | |||
| 172 | VDQM01000001.1 | GCA007667125_00517 | gene | open | 43212-43490 | mlaB | ||
| 173 | VDQM01000001.1 | GCA007667125_00518 | gene | open | 43589-44179 | mlaC | ||
| 174 | VDQM01000001.1 | GCA007667125_00519 | gene | open | 44216-44713 | mlaD | ||
| 175 | VDQM01000001.1 | GCA007667125_00520 | gene | open | 44764-45540 | mlaE | ||
| 176 | VDQM01000001.1 | GCA007667125_00521 | gene | open | 45677-46477 | mlaF | ||
| 177 | VDQM01000001.1 | GCA007667125_00522 | gene | open | 46890-47345 | |||
| 178 | VDQM01000001.1 | GCA007667125_00523 | gene | open | 47635-48828 | ftsZ | ||
| 179 | VDQM01000001.1 | GCA007667125_00524 | gene | open | 49057-50301 | ftsA | ||
| 180 | VDQM01000001.1 | GCA007667125_00525 | gene | open | 50382-51107 | ftsQ | ||
| 181 | VDQM01000001.1 | GCA007667125_00526 | gene | open | 51097-52011 | ddl | ||
| 182 | VDQM01000001.1 | GCA007667125_00527 | gene | open | 52162-53571 | murC | ||
| 183 | VDQM01000001.1 | GCA007667125_00528 | gene | open | 53837-54664 | yktD | ||
| 184 | VDQM01000001.1 | GCA007667125_00529 | gene | open | 54799-55866 | murG | ||
| 185 | VDQM01000001.1 | GCA007667125_00530 | gene | open | 55870-57027 | ftsW | ||
| 186 | VDQM01000001.1 | GCA007667125_00531 | gene | open | 57305-58801 | gatA | ||
| 187 | VDQM01000001.1 | GCA007667125_00532 | gene | open | 59045-60382 | murD | ||
| 188 | VDQM01000001.1 | GCA007667125_00533 | gene | open | 60422-61234 | |||
| 189 | VDQM01000001.1 | GCA007667125_00534 | gene | open | 61507-61995 | yjbI | ||
| 190 | VDQM01000001.1 | GCA007667125_00535 | gene | open | 62208-62552 | lrgA | ||
| 191 | VDQM01000001.1 | GCA007667125_00536 | gene | open | 62552-63253 | lrgB | ||
| 192 | VDQM01000001.1 | GCA007667125_00537 | gene | open | 63335-64555 | argJ | ||
| 193 | VDQM01000001.1 | GCA007667125_00538 | gene | open | 65257-66096 | udg4 | ||
| 194 | VDQM01000001.1 | GCA007667125_00539 | gene | open | 66090-66533 | rimI | ||
| 195 | VDQM01000001.1 | GCA007667125_00540 | gene | open | 66530-67207 | tsaB | ||
| 196 | VDQM01000001.1 | GCA007667125_00541 | gene | open | 67399-68304 | gluQRS | ||
| 197 | VDQM01000001.1 | GCA007667125_00542 | gene | open | 68490-69218 | lytT | ||
| 198 | VDQM01000001.1 | GCA007667125_00543 | gene | open | 69757-70821 | fba | ||
| 199 | VDQM01000001.1 | GCA007667125_00544 | gene | open | 71033-71461 | fadM | ||
| 200 | VDQM01000001.1 | GCA007667125_00545 | gene | open | 71464-72363 | xerC | ||
| 201 | VDQM01000001.1 | GCA007667125_00546 | gene | open | 72389-73789 | sdaA | ||
| 202 | VDQM01000001.1 | GCA007667125_00547 | gene | open | 74008-76398 | gyrB | ||
| 203 | VDQM01000001.1 | GCA007667125_00548 | gene | open | 76807-77250 | rpiB | ||
| 204 | VDQM01000001.1 | GCA007667125_00549 | gene | open | 77915-79000 | porB | ||
| 205 | VDQM01000001.1 | GCA007667125_00551 | gene | open | 79699-80511 | truA | ||
| 206 | VDQM01000001.1 | GCA007667125_00552 | gene | open | 80643-83108 | fimV | ||
| 207 | VDQM01000001.1 | GCA007667125_00553 | gene | open | 83453-83983 | yciB | ||
| 208 | VDQM01000001.1 | GCA007667125_00554 | gene | open | 83987-84277 | yciI | ||
| 209 | VDQM01000001.1 | GCA007667125_00555 | gene | open | 84277-84546 | bolA | ||
| 210 | VDQM01000001.1 | GCA007667125_00556 | gene | open | 84581-85453 | |||
| 211 | VDQM01000001.1 | GCA007667125_00557 | gene | open | 85647-86108 | dtd | ||
| 212 | VDQM01000001.1 | GCA007667125_00558 | gene | open | 86435-87160 | aat | ||
| 213 | VDQM01000001.1 | GCA007667125_00559 | gene | open | 87387-87821 | fur | ||
| 214 | VDQM01000001.1 | GCA007667125_00560 | gene | open | 88032-88415 | bamE | ||
| 215 | VDQM01000001.1 | GCA007667125_00561 | gene | open | 88431-89240 | dapB | ||
| 216 | VDQM01000001.1 | GCA007667125_00562 | gene | open | 89344-90264 | lysR | ||
| 217 | VDQM01000001.1 | GCA007667125_00563 | gene | open | 90268-90543 | minE | ||
| 218 | VDQM01000001.1 | GCA007667125_00564 | gene | open | 90547-91362 | minD | ||
| 219 | VDQM01000001.1 | GCA007667125_00565 | gene | open | 91390-92094 | minC | ||
| 220 | VDQM01000001.1 | GCA007667125_00566 | gene | open | 92317-93828 | lysS | ||
| 221 | VDQM01000001.1 | GCA007667125_00567 | gene | open | 94007-95449 | aldA | ||
| 222 | VDQM01000001.1 | GCA007667125_00569 | gene | open | 95853-96284 | |||
| 223 | VDQM01000001.1 | GCA007667125_00570 | gene | open | 96410-97192 | trpC | ||
| 224 | VDQM01000001.1 | GCA007667125_00571 | gene | open | 97468-100383 | |||
| 225 | VDQM01000001.1 | GCA007667125_00572 | gene | open | 100519-100812 | yiaG | ||
| 226 | VDQM01000001.1 | GCA007667125_00573 | gene | open | 101216-101710 | |||
| 227 | VDQM01000001.1 | GCA007667125_00574 | gene | open | 101779-102588 | zupT | ||
| 228 | VDQM01000001.1 | GCA007667125_00575 | gene | open | 102849-103379 | ydeN | ||
| 229 | VDQM01000001.1 | GCA007667125_00576 | gene | open | 103390-103734 | |||
| 230 | VDQM01000001.1 | GCA007667125_00577 | gene | open | 103721-104500 | xthA | ||
| 231 | VDQM01000001.1 | GCA007667125_00578 | gene | open | 104596-104967 | yeaO | ||
| 232 | VDQM01000001.1 | GCA007667125_00579 | gene | open | 105030-105917 | rsmI | ||
| 233 | VDQM01000001.1 | GCA007667125_00580 | gene | open | 105973-106320 | yraN | ||
| 234 | VDQM01000001.1 | GCA007667125_00581 | gene | open | 106325-106918 | gmhA | ||
| 235 | VDQM01000001.1 | GCA007667125_00582 | gene | open | 106991-107602 | osmY | ||
| 236 | VDQM01000001.1 | GCA007667125_00583 | gene | open | 107672-108283 | ftsN | ||
| 237 | VDQM01000001.1 | GCA007667125_00584 | gene | open | 108393-109172 | map | ||
| 238 | VDQM01000001.1 | GCA007667125_00568 | gene | open | 95592-95667 | trnK | ||
| 239 | VDQM01000001.1 | GCA007667125_00568 | tRNA | open | 95592-95667 | trnK | tRNA-Lys(ttt) | |
| 240 | VDQM01000002.1 | GCA007667125_00895 | CDS | open | 243-1373 | _na 376_aa | Spore coat protein U/FanG domain-containing protein | |
| 241 | VDQM01000002.1 | GCA007667125_00896 | CDS | open | 1364-3832 | _na 822_aa | csuD | Protein CsuD |
| 242 | VDQM01000002.1 | GCA007667125_00897 | CDS | open | 3819-4544 | _na 241_aa | fimC | Pili assembly chaperone N-terminal domain-containing protein |
| 243 | VDQM01000002.1 | GCA007667125_00898 | CDS | open | 4586-5215 | _na 209_aa | spoU | Spore coat protein SpoU |
| 244 | VDQM01000002.1 | GCA007667125_00899 | CDS | open | 5648-6274 | _na 208_aa | tmk | dTMP kinase |
| 245 | VDQM01000002.1 | GCA007667125_00900 | CDS | open | 6495-7775 | _na 426_aa | sfcA | Malic enzyme |
| 246 | VDQM01000002.1 | GCA007667125_00901 | CDS | open | 7843-8490 | _na 215_aa | HAD family hydrolase | |
| 247 | VDQM01000002.1 | GCA007667125_00902 | CDS | open | 8551-9510 | _na 319_aa | czcD | Cation efflux protein cytoplasmic domain-containing protein |
| 248 | VDQM01000002.1 | GCA007667125_00903 | CDS | open | 9556-10383 | _na 275_aa | Ferritin-like domain-containing protein | |
| 249 | VDQM01000002.1 | GCA007667125_00904 | CDS | open | 10688-11311 | _na 207_aa | lolA | outer membrane lipoprotein chaperone LolA |
| 250 | VDQM01000002.1 | GCA007667125_00905 | CDS | open | 11681-12541 | _na 286_aa | tehB | SAM-dependent methyltransferase TehB |
| 251 | VDQM01000002.1 | GCA007667125_00906 | CDS | open | 12674-13123 | _na 149_aa | rnhA | ribonuclease HI |
| 252 | VDQM01000002.1 | GCA007667125_00907 | CDS | open | 13181-14533 | _na 450_aa | dgt | deoxyguanosinetriphosphate triphosphohydrolase |
| 253 | VDQM01000002.1 | GCA007667125_00910 | CDS | open | 15221-15424 | _na 67_aa | DUF2788 domain-containing protein | |
| 254 | VDQM01000002.1 | GCA007667125_00911 | CDS | open | 15543-16712 | _na 389_aa | metZ | O-succinylhomoserine sulfhydrylase |
| 255 | VDQM01000002.1 | GCA007667125_00912 | CDS | open | 17051-17989 | _na 312_aa | hemC | hydroxymethylbilane synthase |
| 256 | VDQM01000002.1 | GCA007667125_00913 | CDS | open | 18036-18413 | _na 125_aa | Lipoprotein | |
| 257 | VDQM01000002.1 | GCA007667125_00914 | CDS | open | 18592-19107 | _na 171_aa | ybeY | rRNA maturation RNase YbeY |
| 258 | VDQM01000002.1 | GCA007667125_00915 | CDS | open | 19109-19933 | _na 274_aa | corC | Magnesium and cobalt efflux protein CorC |
| 259 | VDQM01000002.1 | GCA007667125_00916 | CDS | open | 20034-20831 | _na 265_aa | dsbG | Thiol:disulfide interchange protein |
| 260 | VDQM01000002.1 | GCA007667125_00917 | CDS | open | 20970-23138 | _na 722_aa | priA | primosomal protein N' |
| 261 | VDQM01000002.1 | GCA007667125_00918 | CDS | open | 23247-23879 | _na 210_aa | nth | endonuclease III |
| 262 | VDQM01000002.1 | GCA007667125_00919 | CDS | open | 24089-25603 | _na 504_aa | degQ | putative periplasmic serine endoprotease DegP-like |
| 263 | VDQM01000002.1 | GCA007667125_00920 | CDS | open | 25799-27319 | _na 506_aa | nhaC | Na+/H+ antiporter NhaC-like C-terminal domain-containing protein |
| 264 | VDQM01000002.1 | GCA007667125_00921 | CDS | open | 27388-28476 | _na 362_aa | nagZ | beta-N-acetylhexosaminidase |
| 265 | VDQM01000002.1 | GCA007667125_00922 | CDS | open | 28715-30274 | _na 519_aa | mpfA | CBS domain-containing protein |
| 266 | VDQM01000002.1 | GCA007667125_00923 | CDS | open | 30527-33742 | _na 1071_aa | carB | carbamoyl-phosphate synthase large subunit |
| 267 | VDQM01000002.1 | GCA007667125_00924 | CDS | open | 33767-34582 | _na 271_aa | DUF4013 domain-containing protein | |
| 268 | VDQM01000002.1 | GCA007667125_00925 | CDS | open | 34675-35235 | _na 186_aa | hypothetical protein | |
| 269 | VDQM01000002.1 | GCA007667125_00926 | CDS | open | 36328-36717 | _na 129_aa | ycjD | DNA (Cytosine-5-)-methyltransferase |
| 270 | VDQM01000002.1 | GCA007667125_00927 | CDS | open | 36889-37146 | _na 85_aa | ABC transporter permease | |
| 271 | VDQM01000002.1 | GCA007667125_00928 | CDS | open | 37509-38639 | _na 376_aa | carA | carbamoyl phosphate synthase small subunit |
| 272 | VDQM01000002.1 | GCA007667125_00929 | CDS | open | 39044-42358 | _na 1104_aa | pilC | PilC family type IV pilus tip adhesin |
| 273 | VDQM01000002.1 | GCA007667125_00930 | CDS | open | 42687-43844 | _na 385_aa | nnrS | NnrS protein |
| 274 | VDQM01000002.1 | GCA007667125_00931 | CDS | open | 43957-44337 | _na 126_aa | Hemerythrin-like domain-containing protein | |
| 275 | VDQM01000002.1 | GCA007667125_00932 | CDS | open | 44507-44971 | _na 154_aa | iscR | Rrf2 family transcriptional regulator |
| 276 | VDQM01000002.1 | GCA007667125_00933 | CDS | open | 45480-46421 | _na 313_aa | TonB-dependent receptor | |
| 277 | VDQM01000002.1 | GCA007667125_00934 | CDS | open | 46489-47148 | _na 219_aa | exbB | Biopolymer transport protein ExbB |
| 278 | VDQM01000002.1 | GCA007667125_00935 | CDS | open | 47152-47589 | _na 145_aa | exbD | Biopolymer transporter ExbD |
| 279 | VDQM01000002.1 | GCA007667125_00936 | CDS | open | 47840-48493 | _na 217_aa | yihA | ribosome biogenesis GTP-binding protein YihA/YsxC |
| 280 | VDQM01000002.1 | GCA007667125_00937 | CDS | open | 48694-49320 | _na 208_aa | cytC553 | Cytochrome C |
| 281 | VDQM01000002.1 | GCA007667125_00938 | CDS | open | 49580-51598 | _na 672_aa | resB | Cytochrome C biogenesis protein |
| 282 | VDQM01000002.1 | GCA007667125_00939 | CDS | open | 51588-52775 | _na 395_aa | ccsB | c-type cytochrome biogenesis protein CcsB |
| 283 | VDQM01000002.1 | GCA007667125_00940 | CDS | open | 53085-54092 | _na 335_aa | iS5 | IS5 family transposase |
| 284 | VDQM01000002.1 | GCA007667125_00941 | CDS | open | 54334-55248 | _na 304_aa | rssA | Phospholipase%2C patatin family |
| 285 | VDQM01000002.1 | GCA007667125_00942 | CDS | open | 55385-56746 | _na 453_aa | pqqL | Peptidase M16 inactive domain protein |
| 286 | VDQM01000002.1 | GCA007667125_00943 | CDS | open | 56886-58223 | _na 445_aa | gdhA | NADP-specific glutamate dehydrogenase |
| 287 | VDQM01000002.1 | GCA007667125_00944 | CDS | open | 58769-59563 | _na 264_aa | thyA | thymidylate synthase |
| 288 | VDQM01000002.1 | GCA007667125_00945 | CDS | open | 59625-62024 | _na 799_aa | Rhamnogalacturonase A/B/Epimerase-like pectate lyase domain-containing protein | |
| 289 | VDQM01000002.1 | GCA007667125_00946 | CDS | open | 62290-62433 | _na 47_aa | hypothetical protein | |
| 290 | VDQM01000002.1 | GCA007667125_00947 | CDS | open | 63306-63434 | _na 42_aa | hypothetical protein | |
| 291 | VDQM01000002.1 | GCA007667125_00948 | CDS | open | 63595-64764 | _na 389_aa | lapB | lipopolysaccharide assembly protein LapB |
| 292 | VDQM01000002.1 | GCA007667125_00949 | CDS | open | 64777-65121 | _na 114_aa | yrvD | Lipopolysaccharide assembly protein A domain-containing protein |
| 293 | VDQM01000002.1 | GCA007667125_00950 | CDS | open | 65510-66508 | _na 332_aa | ilvE | branched-chain-amino-acid transaminase |
| 294 | VDQM01000002.1 | GCA007667125_00951 | CDS | open | 66770-67648 | _na 292_aa | DUF1275 domain-containing protein | |
| 295 | VDQM01000002.1 | GCA007667125_00952 | CDS | open | 67908-68588 | _na 226_aa | ompA | OmpA-like domain-containing protein |
| 296 | VDQM01000002.1 | GCA007667125_00953 | CDS | open | 68906-69145 | _na 79_aa | hypothetical protein | |
| 297 | VDQM01000002.1 | GCA007667125_00954 | CDS | open | 69547-70416 | _na 289_aa | lpxP | lipid A biosynthesis lauroyl acyltransferase |
| 298 | VDQM01000002.1 | GCA007667125_00955 | CDS | open | 70546-71094 | _na 182_aa | ruvC | crossover junction endodeoxyribonuclease RuvC |
| 299 | VDQM01000002.1 | GCA007667125_00956 | CDS | open | 71287-71622 | _na 111_aa | Porin domain-containing protein | |
| 300 | VDQM01000002.1 | GCA007667125_00957 | CDS | open | 71702-72787 | _na 361_aa | rfaQ | putative lipopolysaccharide heptosyltransferase III |
| 301 | VDQM01000002.1 | GCA007667125_00958 | CDS | open | 72997-73869 | _na 290_aa | tyrA | Prephenate dehydrogenase |
| 302 | VDQM01000002.1 | GCA007667125_00959 | CDS | open | 74032-75945 | _na 637_aa | dxs | 1-deoxy-D-xylulose-5-phosphate synthase |
| 303 | VDQM01000002.1 | GCA007667125_00960 | CDS | open | 76362-77192 | _na 276_aa | nit1 | Apolipoprotein acyltransferase |
| 304 | VDQM01000002.1 | GCA007667125_00961 | CDS | open | 77335-77775 | _na 146_aa | Pyridine nucleotide-disulfide oxidoreductase | |
| 305 | VDQM01000002.1 | GCA007667125_00962 | CDS | open | 77840-79603 | _na 587_aa | Peptidase%2C M61 family | |
| 306 | VDQM01000002.1 | GCA007667125_00963 | CDS | open | 79933-81366 | _na 477_aa | ccoN | cytochrome-c oxidase%2C cbb3-type subunit I |
| 307 | VDQM01000002.1 | GCA007667125_00964 | CDS | open | 81390-82001 | _na 203_aa | ccoO | cytochrome-c oxidase%2C cbb3-type subunit II |
| 308 | VDQM01000002.1 | GCA007667125_00965 | CDS | open | 82006-82173 | _na 55_aa | ccoQ | Cytochrome c oxidase%2C cbb3-type%2C CcoQ subunit |
| 309 | VDQM01000002.1 | GCA007667125_00966 | CDS | open | 82204-83568 | _na 454_aa | ccoP | cytochrome-c oxidase%2C cbb3-type subunit III |
| 310 | VDQM01000002.1 | GCA007667125_00967 | CDS | open | 83750-84850 | _na 366_aa | anmK | anhydro-N-acetylmuramic acid kinase |
| 311 | VDQM01000002.1 | GCA007667125_00968 | CDS | open | 85023-86597 | _na 524_aa | pitA | Phosphate transporter |
| 312 | VDQM01000002.1 | GCA007667125_00895 | gene | open | 243-1373 | |||
| 313 | VDQM01000002.1 | GCA007667125_00896 | gene | open | 1364-3832 | csuD | ||
| 314 | VDQM01000002.1 | GCA007667125_00897 | gene | open | 3819-4544 | fimC | ||
| 315 | VDQM01000002.1 | GCA007667125_00898 | gene | open | 4586-5215 | spoU | ||
| 316 | VDQM01000002.1 | GCA007667125_00899 | gene | open | 5648-6274 | tmk | ||
| 317 | VDQM01000002.1 | GCA007667125_00900 | gene | open | 6495-7775 | sfcA | ||
| 318 | VDQM01000002.1 | GCA007667125_00901 | gene | open | 7843-8490 | |||
| 319 | VDQM01000002.1 | GCA007667125_00902 | gene | open | 8551-9510 | czcD | ||
| 320 | VDQM01000002.1 | GCA007667125_00903 | gene | open | 9556-10383 | |||
| 321 | VDQM01000002.1 | GCA007667125_00904 | gene | open | 10688-11311 | lolA | ||
| 322 | VDQM01000002.1 | GCA007667125_00905 | gene | open | 11681-12541 | tehB | ||
| 323 | VDQM01000002.1 | GCA007667125_00906 | gene | open | 12674-13123 | rnhA | ||
| 324 | VDQM01000002.1 | GCA007667125_00907 | gene | open | 13181-14533 | dgt | ||
| 325 | VDQM01000002.1 | GCA007667125_00910 | gene | open | 15221-15424 | |||
| 326 | VDQM01000002.1 | GCA007667125_00911 | gene | open | 15543-16712 | metZ | ||
| 327 | VDQM01000002.1 | GCA007667125_00912 | gene | open | 17051-17989 | hemC | ||
| 328 | VDQM01000002.1 | GCA007667125_00913 | gene | open | 18036-18413 | |||
| 329 | VDQM01000002.1 | GCA007667125_00914 | gene | open | 18592-19107 | ybeY | ||
| 330 | VDQM01000002.1 | GCA007667125_00915 | gene | open | 19109-19933 | corC | ||
| 331 | VDQM01000002.1 | GCA007667125_00916 | gene | open | 20034-20831 | dsbG | ||
| 332 | VDQM01000002.1 | GCA007667125_00917 | gene | open | 20970-23138 | priA | ||
| 333 | VDQM01000002.1 | GCA007667125_00918 | gene | open | 23247-23879 | nth | ||
| 334 | VDQM01000002.1 | GCA007667125_00919 | gene | open | 24089-25603 | degQ | ||
| 335 | VDQM01000002.1 | GCA007667125_00920 | gene | open | 25799-27319 | nhaC | ||
| 336 | VDQM01000002.1 | GCA007667125_00921 | gene | open | 27388-28476 | nagZ | ||
| 337 | VDQM01000002.1 | GCA007667125_00922 | gene | open | 28715-30274 | mpfA | ||
| 338 | VDQM01000002.1 | GCA007667125_00923 | gene | open | 30527-33742 | carB | ||
| 339 | VDQM01000002.1 | GCA007667125_00924 | gene | open | 33767-34582 | |||
| 340 | VDQM01000002.1 | GCA007667125_00925 | gene | open | 34675-35235 | |||
| 341 | VDQM01000002.1 | GCA007667125_00926 | gene | open | 36328-36717 | ycjD | ||
| 342 | VDQM01000002.1 | GCA007667125_00927 | gene | open | 36889-37146 | |||
| 343 | VDQM01000002.1 | GCA007667125_00928 | gene | open | 37509-38639 | carA | ||
| 344 | VDQM01000002.1 | GCA007667125_00929 | gene | open | 39044-42358 | pilC | ||
| 345 | VDQM01000002.1 | GCA007667125_00930 | gene | open | 42687-43844 | nnrS | ||
| 346 | VDQM01000002.1 | GCA007667125_00931 | gene | open | 43957-44337 | |||
| 347 | VDQM01000002.1 | GCA007667125_00932 | gene | open | 44507-44971 | iscR | ||
| 348 | VDQM01000002.1 | GCA007667125_00933 | gene | open | 45480-46421 | |||
| 349 | VDQM01000002.1 | GCA007667125_00934 | gene | open | 46489-47148 | exbB | ||
| 350 | VDQM01000002.1 | GCA007667125_00935 | gene | open | 47152-47589 | exbD | ||
| 351 | VDQM01000002.1 | GCA007667125_00936 | gene | open | 47840-48493 | yihA | ||
| 352 | VDQM01000002.1 | GCA007667125_00937 | gene | open | 48694-49320 | cytC553 | ||
| 353 | VDQM01000002.1 | GCA007667125_00938 | gene | open | 49580-51598 | resB | ||
| 354 | VDQM01000002.1 | GCA007667125_00939 | gene | open | 51588-52775 | ccsB | ||
| 355 | VDQM01000002.1 | GCA007667125_00940 | gene | open | 53085-54092 | iS5 | ||
| 356 | VDQM01000002.1 | GCA007667125_00941 | gene | open | 54334-55248 | rssA | ||
| 357 | VDQM01000002.1 | GCA007667125_00942 | gene | open | 55385-56746 | pqqL | ||
| 358 | VDQM01000002.1 | GCA007667125_00943 | gene | open | 56886-58223 | gdhA | ||
| 359 | VDQM01000002.1 | GCA007667125_00944 | gene | open | 58769-59563 | thyA | ||
| 360 | VDQM01000002.1 | GCA007667125_00945 | gene | open | 59625-62024 | |||
| 361 | VDQM01000002.1 | GCA007667125_00946 | gene | open | 62290-62433 | |||
| 362 | VDQM01000002.1 | GCA007667125_00947 | gene | open | 63306-63434 | |||
| 363 | VDQM01000002.1 | GCA007667125_00948 | gene | open | 63595-64764 | lapB | ||
| 364 | VDQM01000002.1 | GCA007667125_00949 | gene | open | 64777-65121 | yrvD | ||
| 365 | VDQM01000002.1 | GCA007667125_00950 | gene | open | 65510-66508 | ilvE | ||
| 366 | VDQM01000002.1 | GCA007667125_00951 | gene | open | 66770-67648 | |||
| 367 | VDQM01000002.1 | GCA007667125_00952 | gene | open | 67908-68588 | ompA | ||
| 368 | VDQM01000002.1 | GCA007667125_00953 | gene | open | 68906-69145 | |||
| 369 | VDQM01000002.1 | GCA007667125_00954 | gene | open | 69547-70416 | lpxP | ||
| 370 | VDQM01000002.1 | GCA007667125_00955 | gene | open | 70546-71094 | ruvC | ||
| 371 | VDQM01000002.1 | GCA007667125_00956 | gene | open | 71287-71622 | |||
| 372 | VDQM01000002.1 | GCA007667125_00957 | gene | open | 71702-72787 | rfaQ | ||
| 373 | VDQM01000002.1 | GCA007667125_00958 | gene | open | 72997-73869 | tyrA | ||
| 374 | VDQM01000002.1 | GCA007667125_00959 | gene | open | 74032-75945 | dxs | ||
| 375 | VDQM01000002.1 | GCA007667125_00960 | gene | open | 76362-77192 | nit1 | ||
| 376 | VDQM01000002.1 | GCA007667125_00961 | gene | open | 77335-77775 | |||
| 377 | VDQM01000002.1 | GCA007667125_00962 | gene | open | 77840-79603 | |||
| 378 | VDQM01000002.1 | GCA007667125_00963 | gene | open | 79933-81366 | ccoN | ||
| 379 | VDQM01000002.1 | GCA007667125_00964 | gene | open | 81390-82001 | ccoO | ||
| 380 | VDQM01000002.1 | GCA007667125_00965 | gene | open | 82006-82173 | ccoQ | ||
| 381 | VDQM01000002.1 | GCA007667125_00966 | gene | open | 82204-83568 | ccoP | ||
| 382 | VDQM01000002.1 | GCA007667125_00967 | gene | open | 83750-84850 | anmK | ||
| 383 | VDQM01000002.1 | GCA007667125_00968 | gene | open | 85023-86597 | pitA | ||
| 384 | VDQM01000002.1 | GCA007667125_00908 | gene | open | 14666-14742 | trnR | ||
| 385 | VDQM01000002.1 | GCA007667125_00909 | gene | open | 14759-14833 | trnE | ||
| 386 | VDQM01000002.1 | GCA007667125_00908 | tRNA | open | 14666-14742 | trnR | tRNA-Arg(acg) | |
| 387 | VDQM01000002.1 | GCA007667125_00909 | tRNA | open | 14759-14833 | trnE | tRNA-Glu(ttc) | |
| 388 | VDQM01000003.1 | repeat_region | open | 65652-66024 | CRISPR array with 6 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCCGAAGGCGGCTGG and spacer length 34 | |||
| 389 | VDQM01000003.1 | repeat_region | open | 66103-66880 | CRISPR array with 12 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCCGAAGGCGGCTGG and spacer length 34 | |||
| 390 | VDQM01000003.1 | repeat_region | open | 73263-78088 | CRISPR array with 73 repeats of length 32%2C consensus sequence GTTTCAACACACAGCCGCCCGAAGGCGGCTGG and spacer length 34 | |||
| 391 | VDQM01000003.1 | GCA007667125_01201 | CDS | open | 169-1980 | _na 603_aa | typA | translational GTPase TypA |
| 392 | VDQM01000003.1 | GCA007667125_01202 | CDS | open | 2459-2923 | _na 154_aa | bfr | bacterioferritin |
| 393 | VDQM01000003.1 | GCA007667125_01203 | CDS | open | 2948-3421 | _na 157_aa | bfr | bacterioferritin |
| 394 | VDQM01000003.1 | GCA007667125_01204 | CDS | open | 3840-6125 | _na 761_aa | pflB | formate C-acetyltransferase |
| 395 | VDQM01000003.1 | GCA007667125_01205 | CDS | open | 6417-7229 | _na 270_aa | pflA | pyruvate formate lyase 1-activating protein |
| 396 | VDQM01000003.1 | GCA007667125_01206 | CDS | open | 7463-8509 | _na 348_aa | recA | recombinase RecA |
| 397 | VDQM01000003.1 | GCA007667125_01207 | CDS | open | 8843-9883 | _na 346_aa | mviM | Oxidoreductase%2C NAD-binding domain protein |
| 398 | VDQM01000003.1 | GCA007667125_01208 | CDS | open | 9989-10360 | _na 123_aa | rbfA | 30S ribosome-binding factor RbfA |
| 399 | VDQM01000003.1 | GCA007667125_01209 | CDS | open | 10470-11384 | _na 304_aa | truB | tRNA pseudouridine(55) synthase TruB |
| 400 | VDQM01000003.1 | GCA007667125_01210 | CDS | open | 11563-12906 | _na 447_aa | pcnB | Poly(A) polymerase I |
| 401 | VDQM01000003.1 | GCA007667125_01211 | CDS | open | 13085-13450 | _na 121_aa | Lipoprotein | |
| 402 | VDQM01000003.1 | GCA007667125_01212 | CDS | open | 13528-14502 | _na 324_aa | fbp | class 1 fructose-bisphosphatase |
| 403 | VDQM01000003.1 | GCA007667125_01213 | CDS | open | 14924-15985 | _na 353_aa | bioB | biotin synthase BioB |
| 404 | VDQM01000003.1 | GCA007667125_01214 | CDS | open | 16354-17262 | _na 302_aa | yddG | aromatic amino acid DMT transporter YddG |
| 405 | VDQM01000003.1 | GCA007667125_01215 | CDS | open | 17431-18474 | _na 347_aa | sbp | Sulfate ABC transporter%2C sulfate-binding protein |
| 406 | VDQM01000003.1 | GCA007667125_01216 | CDS | open | 18634-19281 | _na 215_aa | nnr1 | NAD(P)H-hydrate epimerase |
| 407 | VDQM01000003.1 | GCA007667125_01217 | CDS | open | 19596-19862 | _na 88_aa | feoA | FeoA domain protein |
| 408 | VDQM01000003.1 | GCA007667125_01218 | CDS | open | 20034-21896 | _na 620_aa | ferrous iron transporter B | |
| 409 | VDQM01000003.1 | GCA007667125_01219 | CDS | open | 21896-22024 | _na 42_aa | FeoB-associated Cys-rich membrane protein | |
| 410 | VDQM01000003.1 | GCA007667125_01220 | CDS | open | 22290-23666 | _na 458_aa | mpl | UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl-meso-diaminopimelate ligase |
| 411 | VDQM01000003.1 | GCA007667125_01221 | CDS | open | 23801-24514 | _na 237_aa | trmR | Class I SAM-dependent methyltransferase |
| 412 | VDQM01000003.1 | GCA007667125_01222 | CDS | open | 24567-26093 | _na 508_aa | fbpB | ABC transporter%2C permease protein |
| 413 | VDQM01000003.1 | GCA007667125_01223 | CDS | open | 26174-26374 | _na 66_aa | hypothetical protein | |
| 414 | VDQM01000003.1 | GCA007667125_01224 | CDS | open | 26769-27716 | _na 315_aa | PD-(D/E)XK nuclease superfamily protein | |
| 415 | VDQM01000003.1 | GCA007667125_01225 | CDS | open | 27810-28709 | _na 299_aa | nnr2 | ADP-dependent (S)-NAD(P)H-hydrate dehydratase |
| 416 | VDQM01000003.1 | GCA007667125_01226 | CDS | open | 28843-29502 | _na 219_aa | cytB | Nickel-dependent hydrogenases B-type cytochrome subunit |
| 417 | VDQM01000003.1 | GCA007667125_01227 | CDS | open | 29562-30161 | _na 199_aa | mlaC | Toluene tolerance family protein |
| 418 | VDQM01000003.1 | GCA007667125_01228 | CDS | open | 30289-30792 | _na 167_aa | DUF1841 domain-containing protein | |
| 419 | VDQM01000003.1 | GCA007667125_01229 | CDS | open | 31100-31780 | _na 226_aa | radC | DNA repair protein RadC |
| 420 | VDQM01000003.1 | GCA007667125_01230 | CDS | open | 32326-33450 | _na 374_aa | potA | Spermidine/putrescine import ATP-binding protein PotA |
| 421 | VDQM01000003.1 | GCA007667125_01231 | CDS | open | 33466-34431 | _na 321_aa | potB | ABC transporter permease%2C polyamine |
| 422 | VDQM01000003.1 | GCA007667125_01232 | CDS | open | 34431-35318 | _na 295_aa | potC | Spermidine/putrescine ABC transporter%2C permease protein |
| 423 | VDQM01000003.1 | GCA007667125_01233 | CDS | open | 35449-36744 | _na 431_aa | dadA | FAD-binding oxidoreductase |
| 424 | VDQM01000003.1 | GCA007667125_01234 | CDS | open | 36938-37765 | _na 275_aa | NMB0938 family lipoprotein | |
| 425 | VDQM01000003.1 | GCA007667125_01235 | CDS | open | 37877-38179 | _na 100_aa | yfaE | class I ribonucleotide reductase maintenance protein YfaE |
| 426 | VDQM01000003.1 | GCA007667125_01236 | CDS | open | 38299-39453 | _na 384_aa | nrdB | class Ia ribonucleoside-diphosphate reductase subunit beta |
| 427 | VDQM01000003.1 | GCA007667125_01237 | CDS | open | 39706-40629 | _na 307_aa | Abi-like protein | |
| 428 | VDQM01000003.1 | GCA007667125_01238 | CDS | open | 40668-42947 | _na 759_aa | nrdA | class 1a ribonucleoside-diphosphate reductase subunit alpha |
| 429 | VDQM01000003.1 | GCA007667125_01239 | CDS | open | 43305-43811 | _na 168_aa | hscB | Fe-S protein assembly co-chaperone HscB |
| 430 | VDQM01000003.1 | GCA007667125_01240 | CDS | open | 43894-44115 | _na 73_aa | arfA | Alternative ribosome-rescue factor A |
| 431 | VDQM01000003.1 | GCA007667125_01241 | CDS | open | 44075-44395 | _na 106_aa | iscA | iron-sulfur cluster assembly protein IscA |
| 432 | VDQM01000003.1 | GCA007667125_01242 | CDS | open | 44464-44709 | _na 81_aa | recA | Recombinase RecA |
| 433 | VDQM01000003.1 | GCA007667125_01243 | CDS | open | 44977-45363 | _na 128_aa | iscU | Iron-sulfur cluster assembly scaffold protein IscU |
| 434 | VDQM01000003.1 | GCA007667125_01244 | CDS | open | 45433-45561 | _na 42_aa | FxLD family lantipeptide | |
| 435 | VDQM01000003.1 | GCA007667125_01245 | CDS | open | 45742-45948 | _na 68_aa | hypothetical protein | |
| 436 | VDQM01000003.1 | GCA007667125_01246 | CDS | open | 46131-47345 | _na 404_aa | iscS | IscS subfamily cysteine desulfurase |
| 437 | VDQM01000003.1 | GCA007667125_01247 | CDS | open | 47375-47821 | _na 148_aa | iscR | Fe-S cluster assembly transcriptional regulator IscR |
| 438 | VDQM01000003.1 | GCA007667125_01248 | CDS | open | 48178-49350 | _na 390_aa | lldD | L-lactate dehydrogenase |
| 439 | VDQM01000003.1 | GCA007667125_01249 | CDS | open | 49473-50264 | _na 263_aa | spoU | RNA methyltransferase%2C TrmH family |
| 440 | VDQM01000003.1 | GCA007667125_01250 | CDS | open | 50443-51030 | _na 195_aa | rseA | Anti sigma-E protein RseA domain protein |
| 441 | VDQM01000003.1 | GCA007667125_01251 | CDS | open | 51035-51634 | _na 199_aa | rpoE | RNA polymerase sigma factor RpoE |
| 442 | VDQM01000003.1 | GCA007667125_01252 | CDS | open | 51718-52968 | _na 416_aa | ttcA | tRNA(Ile)-lysidine synthase |
| 443 | VDQM01000003.1 | GCA007667125_01253 | CDS | open | 53153-54112 | _na 319_aa | accA | acetyl-CoA carboxylase carboxyltransferase subunit alpha |
| 444 | VDQM01000003.1 | GCA007667125_01254 | CDS | open | 54331-54732 | _na 133_aa | hslR | Ribosome-associated heat shock protein Hsp15 |
| 445 | VDQM01000003.1 | GCA007667125_01255 | CDS | open | 54883-56001 | _na 372_aa | Porin | |
| 446 | VDQM01000003.1 | GCA007667125_01256 | CDS | open | 56249-58006 | _na 585_aa | recD | exodeoxyribonuclease V subunit alpha |
| 447 | VDQM01000003.1 | GCA007667125_01257 | CDS | open | 58221-59066 | _na 281_aa | rlmJ | Ribosomal RNA large subunit methyltransferase J |
| 448 | VDQM01000003.1 | GCA007667125_01258 | CDS | open | 59161-60219 | _na 352_aa | dinB | DNA polymerase IV |
| 449 | VDQM01000003.1 | GCA007667125_01259 | CDS | open | 60344-61075 | _na 243_aa | cysH | phosphoadenylyl-sulfate reductase |
| 450 | VDQM01000003.1 | GCA007667125_01260 | CDS | open | 61397-62155 | _na 252_aa | cah | Carbonic anhydrase |
| 451 | VDQM01000003.1 | GCA007667125_01261 | CDS | open | 62300-63214 | _na 304_aa | cysD | sulfate adenylyltransferase subunit CysD |
| 452 | VDQM01000003.1 | GCA007667125_01262 | CDS | open | 63484-64899 | _na 471_aa | cysG | siroheme synthase CysG |
| 453 | VDQM01000003.1 | GCA007667125_01263 | CDS | open | 64983-65201 | _na 72_aa | ydcH | DUF465 domain-containing protein |
| 454 | VDQM01000003.1 | GCA007667125_01264 | CDS | open | 67326-67970 | _na 214_aa | hypothetical protein | |
| 455 | VDQM01000003.1 | GCA007667125_01265 | CDS | open | 69118-69234 | _na 38_aa | hypothetical protein | |
| 456 | VDQM01000003.1 | GCA007667125_01266 | CDS | open | 69298-69837 | _na 179_aa | hypothetical protein | |
| 457 | VDQM01000003.1 | GCA007667125_01267 | CDS | open | 69837-69995 | _na 52_aa | hypothetical protein | |
| 458 | VDQM01000003.1 | GCA007667125_01268 | CDS | open | 70373-70846 | _na 157_aa | hypothetical protein | |
| 459 | VDQM01000003.1 | GCA007667125_01269 | CDS | open | 72063-72308 | _na 81_aa | hypothetical protein | |
| 460 | VDQM01000003.1 | GCA007667125_01270 | CDS | open | 78268-78561 | _na 97_aa | cas2 | CRISPR-associated endonuclease Cas2 |
| 461 | VDQM01000003.1 | GCA007667125_01271 | CDS | open | 78636-79649 | _na 337_aa | cas1c | type I-C CRISPR-associated endonuclease Cas1c |
| 462 | VDQM01000003.1 | GCA007667125_01201 | gene | open | 169-1980 | typA | ||
| 463 | VDQM01000003.1 | GCA007667125_01202 | gene | open | 2459-2923 | bfr | ||
| 464 | VDQM01000003.1 | GCA007667125_01203 | gene | open | 2948-3421 | bfr | ||
| 465 | VDQM01000003.1 | GCA007667125_01204 | gene | open | 3840-6125 | pflB | ||
| 466 | VDQM01000003.1 | GCA007667125_01205 | gene | open | 6417-7229 | pflA | ||
| 467 | VDQM01000003.1 | GCA007667125_01206 | gene | open | 7463-8509 | recA | ||
| 468 | VDQM01000003.1 | GCA007667125_01207 | gene | open | 8843-9883 | mviM | ||
| 469 | VDQM01000003.1 | GCA007667125_01208 | gene | open | 9989-10360 | rbfA | ||
| 470 | VDQM01000003.1 | GCA007667125_01209 | gene | open | 10470-11384 | truB | ||
| 471 | VDQM01000003.1 | GCA007667125_01210 | gene | open | 11563-12906 | pcnB | ||
| 472 | VDQM01000003.1 | GCA007667125_01211 | gene | open | 13085-13450 | |||
| 473 | VDQM01000003.1 | GCA007667125_01212 | gene | open | 13528-14502 | fbp | ||
| 474 | VDQM01000003.1 | GCA007667125_01213 | gene | open | 14924-15985 | bioB | ||
| 475 | VDQM01000003.1 | GCA007667125_01214 | gene | open | 16354-17262 | yddG | ||
| 476 | VDQM01000003.1 | GCA007667125_01215 | gene | open | 17431-18474 | sbp | ||
| 477 | VDQM01000003.1 | GCA007667125_01216 | gene | open | 18634-19281 | nnr1 | ||
| 478 | VDQM01000003.1 | GCA007667125_01217 | gene | open | 19596-19862 | feoA | ||
| 479 | VDQM01000003.1 | GCA007667125_01218 | gene | open | 20034-21896 | |||
| 480 | VDQM01000003.1 | GCA007667125_01219 | gene | open | 21896-22024 | |||
| 481 | VDQM01000003.1 | GCA007667125_01220 | gene | open | 22290-23666 | mpl | ||
| 482 | VDQM01000003.1 | GCA007667125_01221 | gene | open | 23801-24514 | trmR | ||
| 483 | VDQM01000003.1 | GCA007667125_01222 | gene | open | 24567-26093 | fbpB | ||
| 484 | VDQM01000003.1 | GCA007667125_01223 | gene | open | 26174-26374 | |||
| 485 | VDQM01000003.1 | GCA007667125_01224 | gene | open | 26769-27716 | |||
| 486 | VDQM01000003.1 | GCA007667125_01225 | gene | open | 27810-28709 | nnr2 | ||
| 487 | VDQM01000003.1 | GCA007667125_01226 | gene | open | 28843-29502 | cytB | ||
| 488 | VDQM01000003.1 | GCA007667125_01227 | gene | open | 29562-30161 | mlaC | ||
| 489 | VDQM01000003.1 | GCA007667125_01228 | gene | open | 30289-30792 | |||
| 490 | VDQM01000003.1 | GCA007667125_01229 | gene | open | 31100-31780 | radC | ||
| 491 | VDQM01000003.1 | GCA007667125_01230 | gene | open | 32326-33450 | potA | ||
| 492 | VDQM01000003.1 | GCA007667125_01231 | gene | open | 33466-34431 | potB | ||
| 493 | VDQM01000003.1 | GCA007667125_01232 | gene | open | 34431-35318 | potC | ||
| 494 | VDQM01000003.1 | GCA007667125_01233 | gene | open | 35449-36744 | dadA | ||
| 495 | VDQM01000003.1 | GCA007667125_01234 | gene | open | 36938-37765 | |||
| 496 | VDQM01000003.1 | GCA007667125_01235 | gene | open | 37877-38179 | yfaE | ||
| 497 | VDQM01000003.1 | GCA007667125_01236 | gene | open | 38299-39453 | nrdB | ||
| 498 | VDQM01000003.1 | GCA007667125_01237 | gene | open | 39706-40629 | |||
| 499 | VDQM01000003.1 | GCA007667125_01238 | gene | open | 40668-42947 | nrdA | ||
| 500 | VDQM01000003.1 | GCA007667125_01239 | gene | open | 43305-43811 | hscB |

